The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	0	38743	4884967	terminase,capsid,tail,head,protease	Stx2-converting_phage(45.83%)	36	NA	NA
WP_032207478.1|0_1662_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.1	0.0e+00
WP_155430240.1|1725_3663_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.7	0.0e+00
WP_001063025.1|3707_3929_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125990.1|6455_6782_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|6791_7142_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|7138_7585_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133377.1|7581_7926_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275432.1|7991_8708_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	6.2e-127
WP_000710952.1|8722_9097_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_128566924.1|9192_9402_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	97.1	4.4e-33
WP_155430241.1|9449_12692_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.1	0.0e+00
WP_112920967.1|12684_13026_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	95.6	5.3e-60
WP_155430242.1|13025_13724_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	8.9e-131
WP_089655382.1|13734_14478_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	7.3e-147
WP_122985634.1|14423_15056_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	93.3	5.7e-100
WP_155430243.1|15296_18683_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.8	0.0e+00
WP_155430244.1|18750_19350_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	87.4	2.5e-97
WP_155430245.1|19415_20663_+|tail	phage tail protein	tail	Q9LA62	Enterobacterial_phage	69.9	6.9e-33
WP_155430246.1|20670_21279_+	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	44.7	5.9e-38
WP_001079518.1|21851_22358_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|22403_22904_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|22989_23169_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|23549_24356_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|24355_25549_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001299680.1|25560_26919_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.1e-36
WP_000763511.1|26922_28518_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194615.1|28517_30080_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|30171_30216_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285664.1|30353_31235_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|31231_31852_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|31952_32825_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|32864_33455_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559283.1|33451_34210_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_000422045.1|34429_35479_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|35514_35766_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|36145_38743_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 2
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	43666	44257	4884967		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|43666_44257_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 3
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	52072	57730	4884967		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484982.1|52072_54007_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_001358441.1|54074_55202_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|55346_56135_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000968850.1|56502_56856_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|56923_57730_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 4
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	70645	71911	4884967		Klosneuvirus(100.0%)	1	NA	NA
WP_000069228.1|70645_71911_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	4.6e-24
>prophage 5
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	85903	86986	4884967		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057978.1|85903_86986_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 6
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	105166	105682	4884967		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945013.1|105166_105682_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.8e-24
>prophage 7
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	112008	119278	4884967	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_001389212.1|112008_113241_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387395.1|113495_114479_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123738.1|114956_116330_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081418.1|116458_117394_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001082294.1|117569_118004_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837924.1|118144_119278_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 8
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	124238	125228	4884967		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|124238_125228_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 9
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	156514	160417	4884967		Klosneuvirus(100.0%)	1	NA	NA
WP_000139612.1|156514_160417_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 10
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	164356	165305	4884967		Escherichia_phage(50.0%)	2	NA	NA
WP_001307188.1|164356_164887_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|165131_165305_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 11
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	177107	187259	4884967	transposase	Escherichia_phage(25.0%)	9	NA	NA
WP_000826403.1|177107_178316_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	1.5e-205
WP_071608019.1|178355_179570_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429155.1|179622_180159_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001307191.1|180231_182193_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_000494244.1|182284_182515_-	YncJ family protein	NA	NA	NA	NA	NA
WP_001270286.1|182936_183353_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760591.1|183431_184841_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047424.1|185082_186228_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220396.1|186245_187259_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 12
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	190640	191432	4884967		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_155430252.1|190640_191432_+	antibiotic acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	39.3	1.8e-18
>prophage 13
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	195697	197800	4884967		Salmonella_phage(100.0%)	1	NA	NA
WP_000689303.1|195697_197800_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.2	9.6e-136
>prophage 14
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	202707	206926	4884967	transposase	Ralstonia_phage(50.0%)	3	NA	NA
WP_000103411.1|202707_204816_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.3e-26
WP_072174558.1|204882_205662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112029397.1|205713_206926_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	6.0e-167
>prophage 15
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	216811	218356	4884967		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|216811_218356_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 16
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	225241	225532	4884967		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001295648.1|225241_225532_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.7e-25
>prophage 17
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	231544	232986	4884967		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|231544_231829_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642407.1|231975_232986_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 18
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	236260	238166	4884967		Planktothrix_phage(100.0%)	2	NA	NA
WP_000072429.1|236260_237187_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.6	1.2e-13
WP_000193562.1|237179_238166_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
>prophage 19
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	242482	246289	4884967		Klosneuvirus(50.0%)	2	NA	NA
WP_125090457.1|242482_244882_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426266.1|244906_246289_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 20
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	251563	258499	4884967		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_001307214.1|251563_254359_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.4e-19
WP_000832441.1|254403_256776_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001296749.1|256813_258499_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.5	1.7e-10
>prophage 21
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	275085	280506	4884967		Escherichia_phage(100.0%)	1	NA	NA
WP_033800750.1|275085_280506_-	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	38.2	3.0e-141
>prophage 22
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	283909	285445	4884967		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194907.1|283909_285445_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
>prophage 23
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	293326	294745	4884967		Bacillus_virus(100.0%)	1	NA	NA
WP_125090455.1|293326_294745_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	1.1e-18
>prophage 24
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	302489	304619	4884967		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|302489_302873_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|302904_303123_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012618.1|303179_304619_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
>prophage 25
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	312123	313014	4884967		Bacillus_phage(100.0%)	1	NA	NA
WP_000592814.1|312123_313014_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 26
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	318380	333818	4884967		Escherichia_phage(44.44%)	15	NA	NA
WP_000214712.1|318380_318584_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527756.1|318619_320080_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	8.6e-43
WP_000151243.1|320168_321536_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000836054.1|321593_322613_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001295394.1|322624_323839_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|324044_324371_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|324505_324847_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|324881_325442_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|325444_326155_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|326262_326568_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041556.1|326766_329193_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
WP_001433342.1|329253_331677_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.8e-208
WP_000213028.1|331687_332305_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|332306_333161_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|333203_333818_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 27
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	351578	352880	4884967		Bacillus_phage(100.0%)	1	NA	NA
WP_000732497.1|351578_352880_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
>prophage 28
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	362775	364587	4884967		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|362775_364587_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 29
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	384468	385743	4884967	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_125090445.1|384468_385743_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.1	2.0e-83
>prophage 30
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	392654	394153	4884967		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|392654_393176_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|393256_394153_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 31
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	402956	411748	4884967		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|402956_403772_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|403899_404481_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|404626_405796_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|405961_406051_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|406349_407375_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|407371_408304_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182362.1|408416_409628_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098911.1|409918_411067_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_000493947.1|411106_411748_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 32
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	417252	419519	4884967		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587560.1|417252_418065_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069997.1|418068_418854_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001349911.1|418850_419519_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 33
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	427809	432893	4884967		environmental_halophage(33.33%)	5	NA	NA
WP_000144575.1|427809_429030_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000908012.1|429026_430298_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948878.1|430272_431019_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.9e-10
WP_001297388.1|431028_432516_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|432524_432893_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 34
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	451483	471076	4884967	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_155430256.1|451483_453184_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	8.0e-32
WP_000069375.1|453240_455619_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|455951_456785_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082204.1|456941_457988_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|458119_458311_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175615.1|458314_459751_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001299570.1|459813_460527_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209785.1|460773_461238_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029466.1|461315_462065_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154183.1|462064_462616_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956529.1|462678_463659_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|463759_464059_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672342.1|464063_466451_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|466465_467449_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|467731_467776_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|467898_468255_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|468307_468505_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|468601_469144_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144190.1|469147_471076_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
>prophage 35
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	482376	484638	4884967		Tupanvirus(100.0%)	1	NA	NA
WP_000077852.1|482376_484638_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 36
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	490765	491593	4884967		Bacillus_virus(100.0%)	1	NA	NA
WP_001504335.1|490765_491593_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	1.3e-72
>prophage 37
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	499069	500290	4884967		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|499069_500290_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 38
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	507054	507708	4884967		Planktothrix_phage(100.0%)	1	NA	NA
WP_001299207.1|507054_507708_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.2	8.4e-14
>prophage 39
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	513306	515268	4884967		Streptococcus_phage(100.0%)	1	NA	NA
WP_125090437.1|513306_515268_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	1.8e-40
>prophage 40
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	520194	520836	4884967		Tupanvirus(100.0%)	1	NA	NA
WP_001135062.1|520194_520836_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 41
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	524079	524934	4884967		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|524079_524934_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 42
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	528252	532829	4884967		Bacillus_phage(100.0%)	3	NA	NA
WP_125090435.1|528252_529536_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616424.1|529682_531158_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001295489.1|531338_532829_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	1.1e-08
>prophage 43
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	538779	540427	4884967	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_155430258.1|538779_539988_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.3	3.3e-205
WP_000604932.1|539995_540427_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
>prophage 44
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	549329	557436	4884967	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|549329_551015_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|551219_551801_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001504357.1|551840_552536_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|552593_554504_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|554635_554980_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|555342_555702_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|555821_556001_-	YoaH family protein	NA	NA	NA	NA	NA
WP_155430259.1|556074_557436_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.6e-41
>prophage 45
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	561298	562855	4884967		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|561298_562855_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 46
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	568496	568706	4884967		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|568496_568706_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 47
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	574037	576086	4884967		Moraxella_phage(100.0%)	1	NA	NA
WP_001326055.1|574037_576086_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	1.2e-85
>prophage 48
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	583582	588052	4884967		Escherichia_phage(33.33%)	7	NA	NA
WP_000812724.1|583582_584239_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976492.1|584634_584976_-	YebY family protein	NA	NA	NA	NA	NA
WP_032261927.1|584988_585861_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|585864_586239_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|586377_586608_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011652.1|586709_587366_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|587389_588052_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 49
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	596107	597583	4884967		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|596107_597583_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 50
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	611158	612256	4884967		Planktothrix_phage(100.0%)	1	NA	NA
WP_029794801.1|611158_612256_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.5	3.5e-20
>prophage 51
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	619749	626813	4884967		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|619749_621072_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|621087_622020_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|622098_622854_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|622850_623636_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|623782_624793_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580328.1|624801_625413_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|625551_625617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024917.1|625687_626290_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|626291_626813_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 52
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	630831	632882	4884967		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639274.1|630831_631650_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|631702_632098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|632138_632882_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 53
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	639498	641232	4884967	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025342.1|639498_641232_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 54
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	646484	652128	4884967		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|646484_646874_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|646888_647938_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|647940_648801_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483214.1|648819_650421_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	2.0e-16
WP_001358497.1|650466_652128_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 55
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	662215	663730	4884967		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187810.1|662215_663730_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 56
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	675722	676475	4884967		Bacillus_virus(100.0%)	1	NA	NA
WP_001273007.1|675722_676475_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-26
>prophage 57
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	688740	689409	4884967		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334622.1|688740_689409_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	6.2e-81
>prophage 58
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	703425	715897	4884967		Bacillus_phage(28.57%)	12	NA	NA
WP_001349973.1|703425_705120_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|705290_705473_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922689.1|705551_706469_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212248.1|706641_707562_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|707550_708021_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157241.1|708001_709420_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
WP_000365561.1|709486_710182_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_155430336.1|710221_710587_-	permease	NA	NA	NA	NA	NA
WP_024234232.1|711153_712317_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.0	1.2e-108
WP_000218204.1|712908_713760_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826741.1|713867_715226_-	heavy metal sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001362894.1|715225_715897_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	3.1e-32
>prophage 59
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	719441	784783	4884967	transposase,integrase,terminase,holin,portal,capsid,tail,head,protease	Enterobacteria_phage(36.73%)	66	744474:744490	778206:778222
WP_001079074.1|719441_719972_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_000938107.1|721316_721886_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_120490855.1|721940_722822_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.1	1.1e-144
WP_072127173.1|722990_723152_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_125090879.1|723647_724667_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950793.1|724700_725681_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	3.8e-87
WP_001023455.1|725857_726127_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_155430262.1|726128_727442_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	1.8e-76
WP_120490853.1|727506_728106_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	3.2e-105
WP_089589147.1|728173_731647_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.4	0.0e+00
WP_000649825.1|731780_732308_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	61.0	2.1e-60
WP_001357741.1|733075_733819_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	5.6e-147
WP_001299882.1|733824_734523_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_000847304.1|734522_734852_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_075362629.1|734848_737428_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.9	0.0e+00
WP_075362630.1|737408_737822_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	81.8	1.9e-40
WP_000479105.1|737848_738280_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_001357739.1|738293_739046_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
WP_000683066.1|739053_739449_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000975046.1|739445_739979_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
WP_001204547.1|739994_740348_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201525.1|740340_740715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522615.1|740766_741795_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000256809.1|741852_742200_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253961.1|742236_743742_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	1.0e-99
WP_000831765.1|743731_745324_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
744474:744490	attL	TCAAGGTCACTTTCAAT	NA	NA	NA	NA
WP_000259002.1|745320_745527_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_120490839.1|745510_747439_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	6.1e-262
WP_000235436.1|747410_747920_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|748322_748547_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|748628_748943_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|749470_749656_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_032229863.1|749877_749958_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	96.2	3.2e-05
WP_155430263.1|749948_750050_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.0e-07
WP_112029397.1|750015_751229_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	6.0e-167
WP_001003118.1|751524_752058_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|752217_752490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411804.1|752745_752952_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_001171554.1|753077_753458_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|753454_753802_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_053888474.1|753851_755390_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	6.0e-297
WP_000023256.1|755849_757700_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_001064889.1|759240_759930_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	9.6e-61
WP_001217464.1|759926_760286_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.3	2.0e-38
WP_001265301.1|760298_761348_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	1.6e-107
WP_001360223.1|761349_761628_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	6.3e-11
WP_000975572.1|761694_761958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967409.1|762175_762388_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	1.2e-25
WP_000892866.1|763073_763769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077897774.1|763781_764435_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000566848.1|764749_765649_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_001151251.1|765901_766324_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	1.4e-62
WP_000054502.1|766364_767354_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.6	1.9e-57
WP_000705353.1|767334_767856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|767839_768070_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448563.1|768153_768561_+	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379593.1|768727_768883_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171943.1|769042_769261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001340038.1|769264_769429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|769829_770018_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|770014_770206_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048295.1|770298_772770_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.7	2.9e-59
WP_000096345.1|772828_773032_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533621.1|773031_774057_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
WP_001300307.1|774292_775090_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_085947598.1|783620_784783_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
778206:778222	attR	TCAAGGTCACTTTCAAT	NA	NA	NA	NA
>prophage 60
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	801250	802417	4884967		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830156.1|801250_802417_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	2.9e-227
>prophage 61
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	809620	810520	4884967		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|809620_810520_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 62
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	819206	822028	4884967		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000704805.1|819206_820373_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	1.1e-114
WP_000043476.1|820621_822028_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
>prophage 63
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	829710	833394	4884967		Bacillus_phage(33.33%)	3	NA	NA
WP_000183060.1|829710_830604_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000999466.1|830846_831842_-	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_024234392.1|831999_833394_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
>prophage 64
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	839106	845900	4884967		Bacillus_phage(25.0%)	6	NA	NA
WP_001356294.1|839106_840477_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	1.7e-32
WP_000079285.1|840669_842106_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_000699714.1|842108_843332_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_001298845.1|843328_843808_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043623.1|843810_844776_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	9.9e-88
WP_000048188.1|844778_845900_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.2	9.0e-133
>prophage 65
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	850143	860619	4884967		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|850143_850983_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137102.1|851160_853323_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|853325_853769_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|853774_854914_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_001300971.1|855572_857156_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001556113.1|857429_859283_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|859304_859886_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|859977_860619_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 66
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	865283	866636	4884967		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469759.1|865283_866636_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
>prophage 67
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	871231	921028	4884967	transposase,integrase,terminase,holin,portal,capsid,tail,head,protease	Enterobacteria_phage(38.81%)	71	882232:882247	927133:927148
WP_155430265.1|871231_872473_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	86.2	1.8e-219
WP_024167648.1|872810_873371_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	62.8	5.4e-62
WP_106409363.1|873361_873556_-	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_000767050.1|873500_874043_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_001023457.1|874263_874533_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	4.2e-44
WP_072174799.1|874534_875848_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	98.9	2.4e-76
WP_024234435.1|875912_876512_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	97.0	1.3e-109
WP_053878287.1|876579_879975_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	90.5	0.0e+00
WP_000090891.1|880035_880668_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000194780.1|880604_881348_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152639.1|881353_882052_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847345.1|882051_882381_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
882232:882247	attL	GACAGAAAGCGTCACG	NA	NA	NA	NA
WP_001505275.1|882377_884939_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	92.2	0.0e+00
WP_000459457.1|884931_885366_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479169.1|885347_885770_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_001342267.1|885785_886526_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_032244082.1|886533_886929_-	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	97.7	1.4e-69
WP_032241129.1|886925_887504_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	2.8e-77
WP_032241128.1|887515_887869_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	95.7	4.2e-60
WP_000158868.1|887880_888276_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063244.1|888317_889343_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_001345004.1|889398_889731_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000123322.1|889740_891060_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	9.6e-235
WP_001504035.1|891040_892642_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.7e-310
WP_000198149.1|892638_892845_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_053890897.1|892841_894767_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453576.1|894741_895287_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001307652.1|895675_895870_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_001504034.1|896164_896689_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	93.6	1.0e-86
WP_122996710.1|896929_897136_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	92.6	1.9e-28
WP_001504032.1|897352_897850_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	99.4	2.6e-92
WP_000284515.1|897849_898065_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_033816266.1|898207_898606_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|898686_898845_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|898930_899674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235460.1|899926_900550_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001505172.1|900546_901212_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	1.3e-131
WP_001223933.1|901208_901811_-	hypothetical protein	NA	A0A1U9AJF8	Stx1_converting_phage	95.1	1.2e-91
WP_001108084.1|901785_902352_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001505174.1|902938_904711_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.5	0.0e+00
WP_001254221.1|905214_905397_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_000153270.1|905393_905921_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000810176.1|905917_906364_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000229809.1|906371_906578_-	hypothetical protein	NA	G9L683	Escherichia_phage	94.1	1.1e-25
WP_000145894.1|906650_906941_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
WP_032313406.1|906937_907639_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	2.2e-129
WP_052905266.1|907635_908535_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	98.0	5.7e-170
WP_001504516.1|908567_908864_-	bacteriophage CII family protein	NA	A0A0N7KZD0	Stx2-converting_phage	96.9	8.3e-46
WP_001180318.1|908970_909198_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250469.1|909276_909984_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.3	3.7e-132
WP_155430266.1|909970_910075_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.0e-07
WP_085947970.1|910040_911254_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_024167659.1|911394_911937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528775.1|911924_912701_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001504518.1|913144_913486_+	hypothetical protein	NA	E7C9Q7	Salmonella_phage	64.6	5.7e-30
WP_000213975.1|913756_913957_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_052908307.1|914139_914508_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	1.3e-64
WP_001198858.1|914580_914721_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000358700.1|914713_914857_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	95.7	1.8e-17
WP_000995439.1|914931_915228_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100844.1|915233_916019_+	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000186789.1|916015_916696_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	7.9e-132
WP_032240674.1|916692_916875_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	93.3	5.3e-27
WP_032240676.1|916847_917039_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	6.2e-26
WP_001308571.1|917049_917331_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
WP_024238365.1|917429_917651_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	94.5	2.1e-33
WP_001504519.1|917650_917935_+	ASCH domain-containing protein	NA	A0A1I9LJL9	Stx_converting_phage	89.4	2.8e-43
WP_001504521.1|918167_918728_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	100.0	5.2e-97
WP_001504522.1|919050_919674_+	phage antirepressor Ant	NA	A0A0P0ZDY7	Stx2-converting_phage	93.3	1.3e-104
WP_039264506.1|919758_919977_+	excisionase	NA	Q77WA4	Escherichia_phage	98.6	2.4e-34
WP_024234252.1|919954_921028_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	94.7	1.2e-190
927133:927148	attR	CGTGACGCTTTCTGTC	NA	NA	NA	NA
>prophage 68
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	930231	937105	4884967	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000675150.1|930231_931635_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137869.1|931631_932354_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000929408.1|932544_932877_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|933085_933382_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|933383_933680_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|933782_935144_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_000716757.1|935473_935791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|936205_937105_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 69
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	946315	949872	4884967		Serratia_phage(50.0%)	4	NA	NA
WP_000846231.1|946315_947320_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	6.4e-13
WP_000011960.1|947316_948282_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|948255_949002_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001437757.1|949053_949872_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.5e-23
>prophage 70
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	960562	962596	4884967	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|960562_962596_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 71
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	975161	984603	4884967		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|975161_976298_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001317947.1|976294_978295_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|978419_978881_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|978921_979392_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|979438_980158_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|980154_981840_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|982061_982793_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|982852_982960_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|982940_983672_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569329.1|983676_984603_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 72
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1004916	1006437	4884967		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|1004916_1006437_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 73
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1010131	1013917	4884967		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|1010131_1010800_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425438.1|1011057_1011894_+	S-formylglutathione hydrolase YeiG	NA	NA	NA	NA	NA
WP_000489247.1|1011925_1013917_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 74
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1017986	1018844	4884967		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|1017986_1018844_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 75
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1033342	1037643	4884967		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_155430268.1|1033342_1034809_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.1	1.9e-42
WP_000198823.1|1034926_1035913_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000594599.1|1035951_1036665_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241012.1|1037076_1037643_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 76
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1043397	1051045	4884967		Vibrio_phage(50.0%)	7	NA	NA
WP_000194940.1|1043397_1044987_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
WP_000202798.1|1044990_1045335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213382.1|1045667_1046858_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
WP_001234850.1|1046885_1047581_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|1047729_1049490_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|1049614_1049899_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|1050037_1051045_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 77
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1062744	1063362	4884967		Bacillus_virus(100.0%)	1	NA	NA
WP_001296826.1|1062744_1063362_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.5e-12
>prophage 78
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1072129	1077907	4884967		Bacillus_phage(25.0%)	5	NA	NA
WP_000422188.1|1072129_1073773_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884942.1|1073848_1074499_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000710363.1|1074498_1075563_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406087.1|1075636_1076692_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865564.1|1076803_1077907_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.2	1.5e-119
>prophage 79
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1082184	1087027	4884967		Hokovirus(50.0%)	2	NA	NA
WP_000876014.1|1082184_1085034_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_000559125.1|1085200_1087027_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
>prophage 80
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1101950	1116006	4884967		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281242.1|1101950_1104578_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000990754.1|1104724_1105447_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_125090508.1|1105574_1109309_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	24.2	3.8e-18
WP_001075177.1|1110004_1112290_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_000332036.1|1112378_1113509_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|1113508_1113763_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301045.1|1113816_1114467_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000768973.1|1114929_1116006_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 81
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1121899	1122802	4884967	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140553.1|1121899_1122802_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	9.6e-69
>prophage 82
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1125954	1130958	4884967		Tupanvirus(50.0%)	4	NA	NA
WP_001297077.1|1125954_1126557_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
WP_001342601.1|1126864_1128004_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.9e-29
WP_000461661.1|1128007_1128976_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_000860259.1|1128975_1130958_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 83
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1165373	1168601	4884967		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|1165373_1165973_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|1166031_1167864_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203389.1|1167950_1168601_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
>prophage 84
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1179160	1181033	4884967	transposase	Sodalis_phage(50.0%)	2	NA	NA
WP_000156113.1|1179160_1180063_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.5	8.2e-68
WP_001293612.1|1180259_1181033_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 85
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1185244	1186762	4884967		Mollivirus(100.0%)	1	NA	NA
WP_000334218.1|1185244_1186762_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.0e-86
>prophage 86
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1193238	1194375	4884967		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|1193238_1194375_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 87
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1202939	1204025	4884967		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|1202939_1204025_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 88
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1223186	1224119	4884967		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|1223186_1224119_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 89
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1227159	1228593	4884967		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|1227159_1228593_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 90
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1235234	1242811	4884967		Hokovirus(50.0%)	4	NA	NA
WP_001348569.1|1235234_1238828_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
WP_001296867.1|1238883_1240029_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|1240102_1241047_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283499.1|1241116_1242811_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 91
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1246501	1247422	4884967		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|1246501_1247422_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 92
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1251240	1251975	4884967		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|1251240_1251975_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 93
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1274869	1290239	4884967		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443665.1|1274869_1276885_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
WP_001300494.1|1276955_1277942_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|1278171_1278933_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1279117_1280089_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1280472_1280730_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|1280774_1282502_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|1282542_1283052_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096644.1|1283093_1283945_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719963.1|1284049_1284418_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001297645.1|1284420_1285332_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000021040.1|1285465_1286563_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|1286552_1287428_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|1287427_1288261_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290231.1|1288260_1289277_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_125090474.1|1289447_1290239_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 94
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1293717	1298655	4884967		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001315775.1|1293717_1295022_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|1295079_1295979_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|1296074_1296650_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001307326.1|1296710_1297160_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|1297146_1297572_-	acetyltransferase YpeA	NA	NA	NA	NA	NA
WP_000102891.1|1297785_1298655_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 95
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1317209	1318160	4884967		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|1317209_1318160_+	transaldolase A	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 96
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1336207	1336921	4884967		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1336207_1336921_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 97
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1358211	1362213	4884967		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|1358211_1359501_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|1359586_1360213_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_155430275.1|1360537_1361575_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|1361574_1362213_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 98
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1368647	1370205	4884967		Escherichia_phage(100.0%)	3	NA	NA
WP_001344399.1|1368647_1368821_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669403.1|1369134_1369650_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_000755173.1|1369665_1370205_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
>prophage 99
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1375369	1377148	4884967		Klosneuvirus(100.0%)	1	NA	NA
WP_024234405.1|1375369_1377148_+	N-6 DNA methylase	NA	A0A1V0SLK8	Klosneuvirus	26.0	3.6e-27
>prophage 100
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1382139	1382574	4884967		Escherichia_phage(100.0%)	1	NA	NA
WP_024167665.1|1382139_1382574_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	41.6	5.4e-09
>prophage 101
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1386899	1396514	4884967	integrase	Rhodoferax_phage(25.0%)	8	1375154:1375169	1399421:1399436
1375154:1375169	attL	CGCCGACCACGGCGTG	NA	NA	NA	NA
WP_032240795.1|1386899_1387757_-	AAA family ATPase	NA	A0A0E3GMB2	Rhodoferax_phage	26.7	1.8e-16
WP_023308174.1|1387762_1387993_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001504594.1|1387977_1389042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023308176.1|1389618_1390248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001504596.1|1390371_1391562_-|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	53.4	3.9e-118
WP_000138282.1|1391869_1393447_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|1393515_1394982_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937890.1|1395143_1396514_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	5.2e-42
1399421:1399436	attR	CACGCCGTGGTCGGCG	NA	NA	NA	NA
>prophage 102
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1405343	1405775	4884967		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|1405343_1405775_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 103
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1415660	1422117	4884967		Mycoplasma_phage(20.0%)	8	NA	NA
WP_125090466.1|1415660_1416944_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.9e-34
WP_000523616.1|1417121_1417322_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|1417333_1417669_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|1417670_1419521_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384411.1|1419537_1420053_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|1420148_1420472_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|1420488_1420875_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|1420902_1422117_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 104
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1437281	1438793	4884967		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493471.1|1437281_1438793_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 105
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1444551	1455841	4884967		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|1444551_1445805_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_155430277.1|1446132_1447323_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|1447367_1447706_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|1447766_1449101_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001345753.1|1449090_1449804_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001297612.1|1449968_1451396_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_000970116.1|1451953_1455841_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	1.2e-131
>prophage 106
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1459960	1460221	4884967		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|1459960_1460221_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 107
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1463679	1467422	4884967		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|1463679_1464360_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|1464632_1465607_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|1465622_1467422_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 108
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1473193	1479452	4884967	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|1473193_1474528_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001437780.1|1474736_1475618_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189221.1|1475720_1476308_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|1476363_1476747_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262723.1|1477051_1477741_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_125090462.1|1477788_1478826_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1479032_1479452_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 109
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1484745	1486044	4884967		Burkholderia_virus(100.0%)	1	NA	NA
WP_000230376.1|1484745_1486044_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 110
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1491902	1494476	4884967		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|1491902_1494476_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 111
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1500382	1501453	4884967		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168044.1|1500382_1501453_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 112
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1515087	1530949	4884967	transposase,integrase	Escherichia_phage(28.57%)	13	1513673:1513686	1521288:1521301
1513673:1513686	attL	AGTAAACAGCAAAA	NA	NA	NA	NA
WP_000162574.1|1515087_1515570_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000113815.1|1516352_1517594_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	4.5e-101
WP_125090767.1|1517732_1518827_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_085947598.1|1520288_1521451_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
1521288:1521301	attR	TTTTGCTGTTTACT	NA	NA	NA	NA
WP_085947970.1|1523991_1525205_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001594396.1|1525868_1526615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000925811.1|1526601_1526781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000655916.1|1527048_1527930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001367084.1|1528043_1528283_+	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	49.2	2.5e-08
WP_001283984.1|1528448_1528748_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_085947772.1|1528768_1529981_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000927517.1|1530486_1530606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000340075.1|1530691_1530949_-	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	69.2	1.2e-05
>prophage 113
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1540429	1544554	4884967		Klosneuvirus(50.0%)	4	NA	NA
WP_000097641.1|1540429_1541710_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
WP_001325764.1|1542020_1543421_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|1543441_1544104_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_155430278.1|1544104_1544554_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 114
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1548489	1553785	4884967		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|1548489_1548735_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080944.1|1548731_1549142_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_000246509.1|1549114_1551259_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	1.6e-194
WP_113453414.1|1551268_1552228_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	4.5e-133
WP_000985494.1|1552582_1553785_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 115
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1566969	1572529	4884967	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|1566969_1567155_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047176.1|1567389_1570020_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|1570147_1570648_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|1570890_1571952_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|1572031_1572529_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 116
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1577995	1578961	4884967		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|1577995_1578961_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 117
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1586728	1587742	4884967		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001355855.1|1586728_1587742_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.0	2.3e-26
>prophage 118
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1606810	1613950	4884967		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|1606810_1609372_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141314.1|1609477_1610134_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.9	1.1e-50
WP_001297141.1|1610184_1610952_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|1611147_1612056_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|1612052_1613315_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|1613311_1613950_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 119
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1619163	1622879	4884967		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|1619163_1620156_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|1620218_1621358_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|1621497_1622124_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1622117_1622879_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 120
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1625991	1628024	4884967		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|1625991_1626597_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090345.1|1626596_1628024_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	2.8e-30
>prophage 121
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1648527	1655683	4884967	transposase	Vibrio_phage(20.0%)	7	NA	NA
WP_001199982.1|1648527_1649199_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001379137.1|1649371_1649974_+	LemA family protein	NA	NA	NA	NA	NA
WP_155430279.1|1650292_1650394_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.0e-07
WP_112029397.1|1650359_1651573_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	6.0e-167
WP_000034929.1|1652241_1652604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000036723.1|1652659_1653958_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|1654045_1655683_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 122
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1659715	1663830	4884967		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046790.1|1659715_1661017_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
WP_000186450.1|1661073_1663830_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 123
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1671364	1672213	4884967		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|1671364_1672213_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 124
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1677071	1677827	4884967		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|1677071_1677827_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 125
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1689341	1704890	4884967	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_001299106.1|1689341_1690547_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	1.7e-73
WP_000184249.1|1690546_1690990_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|1691040_1691847_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|1692085_1693183_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|1693762_1695016_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237948.1|1695247_1696579_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775946.1|1696640_1698467_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	7.8e-25
WP_001285985.1|1698466_1702009_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.5e-08
WP_001138163.1|1702001_1704890_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	1.2e-67
>prophage 126
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1710367	1717140	4884967		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|1710367_1711162_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|1711168_1712044_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957914.1|1712194_1714441_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|1714453_1714984_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|1715668_1716358_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|1716426_1717140_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 127
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1726771	1729266	4884967		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|1726771_1728190_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|1728504_1729266_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 128
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1752083	1752839	4884967		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|1752083_1752839_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 129
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1777118	1792510	4884967	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280215.1|1777118_1778519_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001295158.1|1778536_1779853_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|1779888_1781256_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838428.1|1781291_1781780_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001345944.1|1781779_1783699_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|1784134_1785583_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|1785584_1785710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|1785706_1785778_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192814.1|1785832_1786381_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003068.1|1786423_1787941_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|1787950_1789049_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813215.1|1789139_1790873_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_000715214.1|1790878_1791589_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|1791613_1792510_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 130
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1796434	1801807	4884967		Pandoravirus(50.0%)	3	NA	NA
WP_001307385.1|1796434_1797868_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	5.7e-31
WP_000951964.1|1797924_1798668_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195023.1|1798933_1801807_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	3.7e-263
>prophage 131
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1810335	1811568	4884967		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|1810335_1811568_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 132
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1829574	1830252	4884967		Bacillus_virus(100.0%)	1	NA	NA
WP_000956871.1|1829574_1830252_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.1e-08
>prophage 133
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1843828	1844983	4884967		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|1843828_1844983_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 134
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1901607	1902780	4884967		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|1901607_1902780_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 135
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1924999	1925884	4884967		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|1924999_1925884_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 136
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1931959	1942783	4884967		Staphylococcus_phage(25.0%)	9	NA	NA
WP_155430285.1|1931959_1932787_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.9	3.6e-62
WP_000691598.1|1932986_1933913_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|1933963_1934221_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|1934263_1936483_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|1936593_1938006_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|1938080_1938818_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|1939051_1941310_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000183494.1|1941855_1942338_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|1942390_1942783_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 137
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1946610	1957572	4884967		Bacillus_virus(20.0%)	12	NA	NA
WP_060615308.1|1946610_1948503_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|1948531_1949113_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|1949112_1949940_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|1949964_1950387_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|1950387_1951017_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|1951221_1952703_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|1952850_1953522_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|1953527_1954688_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188373.1|1954725_1955541_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|1955656_1956430_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|1956487_1956658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|1956918_1957572_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 138
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1967087	1968521	4884967		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|1967087_1968521_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 139
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1973658	1974897	4884967	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708500.1|1973658_1974897_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 140
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	1981280	1997465	4884967	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264365.1|1981280_1982294_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|1982531_1982747_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|1982857_1984603_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|1984797_1986639_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|1986717_1987224_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065895.1|1987477_1988242_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018003.1|1988518_1989142_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094682.1|1989295_1990816_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000627213.1|1991122_1992613_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000450589.1|1992654_1992987_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212475.1|1993205_1994189_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082867.1|1994372_1997465_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.3e-157
>prophage 141
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2009886	2010852	4884967		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|2009886_2010852_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 142
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2037645	2039940	4884967		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|2037645_2039940_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 143
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2048146	2049292	4884967		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|2048146_2049292_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 144
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2072301	2080094	4884967		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809264.1|2072301_2073162_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.0	2.5e-50
WP_000249149.1|2073225_2075262_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246855.1|2075219_2075615_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|2075634_2076225_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646043.1|2076234_2076810_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147574.1|2076923_2077964_-	permease	NA	NA	NA	NA	NA
WP_001351326.1|2078036_2078672_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|2078799_2079318_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449451.1|2079297_2079741_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189315.1|2079791_2080094_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 145
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2085921	2087811	4884967		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2085921_2087811_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 146
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2093292	2099931	4884967		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|2093292_2095965_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|2095989_2097477_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2097504_2097957_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207685.1|2098587_2099931_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 147
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2104013	2106886	4884967	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|2104013_2104862_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|2104951_2106886_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 148
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2113514	2114992	4884967		Indivirus(50.0%)	2	NA	NA
WP_001047348.1|2113514_2114486_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	3.5e-08
WP_000445413.1|2114713_2114992_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 149
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2119060	2133855	4884967		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|2119060_2119870_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922901.1|2120079_2121057_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2121070_2122057_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030016.1|2122077_2122644_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|2122640_2123216_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2123184_2123742_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2123748_2124474_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|2124521_2125955_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2125977_2126265_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|2126382_2126874_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2126919_2127774_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2127770_2128043_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620387.1|2128256_2128889_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|2128885_2129614_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001307414.1|2129610_2130264_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|2130493_2132830_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001176896.1|2132925_2133855_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 150
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2143551	2145042	4884967		Burkholderia_virus(100.0%)	1	NA	NA
WP_000108459.1|2143551_2145042_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 151
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2148746	2149244	4884967	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|2148746_2149244_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 152
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2153210	2155735	4884967	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|2153210_2154578_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|2154667_2155735_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 153
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2172237	2173281	4884967		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2172237_2173281_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 154
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2183846	2184731	4884967		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_125090392.1|2183846_2184731_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	31.2	3.2e-24
>prophage 155
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2191235	2195389	4884967		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738579.1|2191235_2192261_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_000019674.1|2192328_2193510_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001307418.1|2193519_2194623_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078332.1|2194630_2195389_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	6.9e-20
>prophage 156
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2205727	2207199	4884967	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|2205727_2206237_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004432.1|2206251_2207199_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 157
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2227076	2232650	4884967		Tupanvirus(33.33%)	7	NA	NA
WP_000031783.1|2227076_2228261_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|2228331_2230446_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|2230542_2231013_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2231109_2231484_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|2231609_2231897_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820720.1|2231904_2232264_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001209711.1|2232263_2232650_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	9.6e-18
>prophage 158
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2238220	2247761	4884967		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|2238220_2240134_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_125090618.1|2240133_2241156_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|2241149_2241368_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|2241421_2242291_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|2242345_2242750_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|2243051_2243684_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|2243734_2245825_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963785.1|2245891_2247112_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|2247197_2247761_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 159
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2271989	2272826	4884967		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|2271989_2272826_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 160
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2289801	2293569	4884967		Bacillus_phage(66.67%)	3	NA	NA
WP_001298201.1|2289801_2291424_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253696.1|2291500_2292853_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|2292849_2293569_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 161
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2306980	2309374	4884967		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|2306980_2309374_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 162
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2313753	2314980	4884967		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105436.1|2313753_2314980_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.5	1.3e-132
>prophage 163
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2324209	2326657	4884967		Dickeya_phage(100.0%)	1	NA	NA
WP_001504788.1|2324209_2326657_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 164
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2344179	2349740	4884967	transposase	Acinetobacter_phage(33.33%)	6	NA	NA
WP_085947598.1|2344179_2345341_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_032163276.1|2345354_2345603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000595084.1|2345640_2347383_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_000825996.1|2347502_2347943_+	DUF2756 family protein	NA	NA	NA	NA	NA
WP_000073609.1|2347929_2348673_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	8.3e-10
WP_000907790.1|2348669_2349740_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 165
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2353962	2356853	4884967	transposase	Acinetobacter_phage(33.33%)	3	NA	NA
WP_085947598.1|2353962_2355124_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000416895.1|2355370_2356084_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082110.1|2356085_2356853_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 166
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2362586	2365405	4884967		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|2362586_2363441_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|2363685_2364744_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|2364736_2365405_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 167
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2368408	2372540	4884967		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|2368408_2369035_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106527.1|2369108_2371307_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	5.0e-119
WP_000130621.1|2371408_2371654_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|2371874_2372540_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 168
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2380433	2386316	4884967		Bacillus_virus(50.0%)	5	NA	NA
WP_000173666.1|2380433_2381240_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
WP_001190062.1|2381245_2381647_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000593555.1|2381766_2382126_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001314210.1|2382456_2383581_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_000149132.1|2383580_2386316_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 169
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2399746	2401789	4884967		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|2399746_2401789_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 170
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2405134	2407269	4884967		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|2405134_2405488_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_000922639.1|2405541_2406831_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065769.1|2406843_2407269_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
>prophage 171
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2412150	2412798	4884967		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|2412150_2412798_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 172
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2459777	2461762	4884967		Bacillus_virus(50.0%)	2	NA	NA
WP_000107031.1|2459777_2460782_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	6.6e-18
WP_001196496.1|2460778_2461762_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.7e-15
>prophage 173
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2477669	2480003	4884967		Escherichia_phage(100.0%)	1	NA	NA
WP_000024005.1|2477669_2480003_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	7.0e-71
>prophage 174
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2483657	2483870	4884967		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|2483657_2483870_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 175
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2488094	2489090	4884967		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|2488094_2489090_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 176
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2494408	2495950	4884967		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146482.1|2494408_2495950_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 177
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2524374	2535066	4884967	tRNA	uncultured_Caudovirales_phage(66.67%)	7	NA	NA
WP_000582482.1|2524374_2526219_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
WP_000206275.1|2526215_2527607_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|2527704_2528313_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_155430292.1|2528541_2532777_+	DUF4329 domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	7.3e-26
WP_001665086.1|2532812_2533133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000072850.1|2533237_2534080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001346013.1|2534232_2535066_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
>prophage 178
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2557163	2567892	4884967		Rhizobium_phage(16.67%)	10	NA	NA
WP_000024392.1|2557163_2557415_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|2557556_2557988_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116565.1|2558232_2559777_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|2559786_2561070_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483860.1|2561073_2562033_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982078.1|2562019_2563054_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	7.5e-09
WP_000646014.1|2563292_2564318_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213855.1|2564327_2565524_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.1	7.1e-35
WP_001307464.1|2565798_2566671_-	protein YibB	NA	NA	NA	NA	NA
WP_000587764.1|2566959_2567892_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
>prophage 179
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2579823	2584386	4884967		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|2579823_2580303_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114533.1|2580341_2581151_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|2581248_2581416_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|2581436_2581673_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|2581889_2582558_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_001402644.1|2582729_2583950_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	8.5e-44
WP_001298007.1|2583930_2584386_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 180
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2587759	2594510	4884967		Morganella_phage(25.0%)	6	NA	NA
WP_001297374.1|2587759_2588584_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
WP_000924289.1|2588875_2589493_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000870052.1|2589489_2591172_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	2.5e-22
WP_001295237.1|2591429_2592053_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|2592107_2592383_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|2592401_2594510_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 181
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2599631	2601023	4884967		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2599631_2601023_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 182
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2607302	2608487	4884967	integrase	Enterobacteria_phage(100.0%)	1	2600219:2600232	2610985:2610998
2600219:2600232	attL	GAAAAATCTGCTGC	NA	NA	NA	NA
WP_001218910.1|2607302_2608487_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
WP_001218910.1|2607302_2608487_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
2610985:2610998	attR	GAAAAATCTGCTGC	NA	NA	NA	NA
>prophage 183
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2616015	2623714	4884967	transposase	Enterobacteria_phage(40.0%)	7	NA	NA
WP_000157061.1|2616015_2616501_+	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	63.8	4.4e-52
WP_125090731.1|2616554_2618876_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_085950468.1|2619230_2620444_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	1.7e-100
WP_155430294.1|2621145_2621619_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.2	6.1e-14
WP_001186725.1|2621634_2622111_+	RadC family protein	NA	NA	NA	NA	NA
WP_112029397.1|2622263_2623476_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	6.0e-167
WP_155430295.1|2623519_2623714_+	DUF987 family protein	NA	A0A142F0X9	Klebsiella_phage	46.0	1.7e-07
>prophage 184
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2632540	2633875	4884967		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|2632540_2633875_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 185
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2641179	2650341	4884967		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_000168480.1|2641179_2642868_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
WP_001315912.1|2642973_2643072_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|2643636_2643726_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001349998.1|2644144_2645329_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.2	4.4e-13
WP_000148063.1|2645336_2645834_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|2645830_2646193_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|2646182_2646530_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511287.1|2646639_2647089_+	membrane protein	NA	NA	NA	NA	NA
WP_000828483.1|2647135_2648629_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_001087147.1|2648625_2650341_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 186
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2656694	2657648	4884967		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|2656694_2657123_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|2657234_2657648_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 187
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2662075	2663224	4884967		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|2662075_2663224_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 188
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2667930	2675299	4884967		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|2667930_2670345_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|2670373_2671447_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|2671446_2672547_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|2672551_2673955_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|2674251_2674332_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|2674561_2674702_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|2674718_2675078_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|2675041_2675299_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 189
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2685498	2686836	4884967		Moraxella_phage(100.0%)	1	NA	NA
WP_001299598.1|2685498_2686836_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 190
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2697826	2701667	4884967		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|2697826_2698600_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|2698690_2699581_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|2699580_2700540_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|2700626_2701667_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 191
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2707198	2710560	4884967		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334099.1|2707198_2709028_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000933736.1|2709189_2710560_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 192
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2722512	2723505	4884967		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845134.1|2722512_2723505_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	6.5e-50
>prophage 193
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2726673	2732526	4884967		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|2726673_2728542_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001297694.1|2728708_2729128_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387753.1|2729135_2730641_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.6e-15
WP_000211858.1|2730645_2731611_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|2731635_2732526_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 194
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2745918	2747565	4884967		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012597.1|2745918_2747565_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	7.4e-67
>prophage 195
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2756038	2761450	4884967		Bacillus_phage(33.33%)	4	NA	NA
WP_001238869.1|2756038_2758060_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
WP_001299253.1|2758106_2759591_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|2759724_2760990_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|2761120_2761450_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 196
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2765492	2771636	4884967		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866670.1|2765492_2766623_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_000006625.1|2766619_2767882_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226604.1|2767881_2768949_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.5e-102
WP_000676056.1|2768967_2769849_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145196.1|2769826_2770501_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|2770505_2771636_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 197
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2790118	2793977	4884967		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|2790118_2791015_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|2791014_2791731_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383406.1|2791814_2793977_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 198
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2801463	2803293	4884967		Catovirus(100.0%)	1	NA	NA
WP_001346040.1|2801463_2803293_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	9.7e-84
>prophage 199
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2815705	2818992	4884967		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|2815705_2817346_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|2817424_2817694_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|2817697_2818213_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|2818215_2818992_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 200
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2827782	2828397	4884967		Streptococcus_phage(100.0%)	1	NA	NA
WP_001308167.1|2827782_2828397_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 201
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2842087	2844874	4884967		uncultured_virus(100.0%)	1	NA	NA
WP_000250055.1|2842087_2844874_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 202
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2848952	2851423	4884967		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188776.1|2848952_2850362_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|2850373_2851423_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 203
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2858594	2863325	4884967		Escherichia_phage(33.33%)	5	NA	NA
WP_000022286.1|2858594_2859383_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
WP_001504889.1|2859422_2860319_-	sugar kinase	NA	NA	NA	NA	NA
WP_001299483.1|2860491_2861370_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.7e-47
WP_000094544.1|2861394_2862282_+	aldolase	NA	NA	NA	NA	NA
WP_000357967.1|2862314_2863325_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
>prophage 204
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2877346	2880397	4884967		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|2877346_2880397_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 205
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2895160	2895781	4884967		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_001297064.1|2895160_2895781_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 206
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2899231	2901300	4884967		Bacillus_phage(50.0%)	2	NA	NA
WP_000580417.1|2899231_2900605_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|2900601_2901300_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 207
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2912875	2917378	4884967		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|2912875_2913721_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|2914145_2914391_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|2914475_2914961_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|2915053_2915980_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|2916046_2917378_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 208
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2923015	2927200	4884967		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_155430297.1|2923015_2927200_+	DUF4329 domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.0e-24
>prophage 209
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2940068	2947315	4884967		Synechococcus_phage(33.33%)	5	NA	NA
WP_125090740.1|2940068_2940731_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	5.5e-29
WP_125090738.1|2940742_2943244_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004454.1|2943552_2944632_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|2944646_2944967_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184821.1|2945017_2947315_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 210
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2964350	2966195	4884967		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591355.1|2964350_2966195_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 211
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2974703	2977756	4884967		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|2974703_2975654_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|2976571_2977756_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 212
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2981872	2990201	4884967		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|2981872_2985901_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|2985977_2990201_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 213
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	2999417	3001181	4884967		Klosneuvirus(50.0%)	3	NA	NA
WP_000362392.1|2999417_3000089_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|3000131_3000722_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3000908_3001181_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 214
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3006405	3007995	4884967		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|3006405_3007995_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 215
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3023459	3027143	4884967		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|3023459_3027143_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 216
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3032793	3033585	4884967		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130529.1|3032793_3033585_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	44.2	1.0e-45
>prophage 217
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3049392	3050508	4884967		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3049392_3050508_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 218
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3060409	3061018	4884967		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3060409_3061018_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 219
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3067615	3070163	4884967		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|3067615_3069031_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|3069083_3070163_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 220
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3074370	3077983	4884967		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|3074370_3077193_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|3077446_3077983_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 221
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3081800	3083150	4884967		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|3081800_3083150_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 222
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3088733	3090692	4884967		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|3088733_3090692_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 223
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3099974	3102122	4884967		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|3099974_3102122_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 224
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3107367	3109353	4884967		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001307516.1|3107367_3109353_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
>prophage 225
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3113338	3114888	4884967		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611428.1|3113338_3114019_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
WP_001075526.1|3114129_3114888_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
>prophage 226
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3120492	3121281	4884967		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|3120492_3121281_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 227
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3126120	3127623	4884967		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|3126120_3127623_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 228
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3148819	3152031	4884967	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|3148819_3150337_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856832.1|3150573_3152031_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	4.0e-48
>prophage 229
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3166307	3168291	4884967		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3166307_3166601_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3166644_3168291_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 230
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3174088	3174622	4884967		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|3174088_3174622_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 231
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3179542	3180520	4884967		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|3179542_3180520_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 232
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3187948	3188494	4884967		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001358360.1|3187948_3188494_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	1.7e-28
>prophage 233
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3192409	3205440	4884967	tRNA,protease	Vibrio_phage(20.0%)	11	NA	NA
WP_000990320.1|3192409_3193747_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122507.1|3193756_3195604_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|3195596_3196547_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3196632_3196941_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|3197016_3198297_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|3198382_3199642_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3199644_3200649_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3200730_3200928_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3201031_3202330_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|3202534_3202960_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|3202998_3205440_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 234
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3209372	3210536	4884967		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943987.1|3209372_3210536_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
>prophage 235
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3224982	3226630	4884967	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_000604912.1|3224982_3225414_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_000826425.1|3225421_3226630_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
>prophage 236
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3246571	3253059	4884967		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055075.1|3246571_3247102_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265933.1|3247411_3248368_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205813.1|3248507_3250010_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001296689.1|3250023_3251046_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|3251032_3252028_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3252060_3253059_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 237
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3257387	3260149	4884967		Vibrio_phage(100.0%)	2	NA	NA
WP_001106217.1|3257387_3257852_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	60.4	6.5e-53
WP_000187791.1|3258010_3260149_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
>prophage 238
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3263787	3269884	4884967		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181332.1|3263787_3264735_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
WP_001387276.1|3264919_3264973_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|3265113_3267810_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|3268015_3268402_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3268474_3268936_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3268948_3269884_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 239
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3278162	3294737	4884967	tRNA,transposase	Klebsiella_phage(22.22%)	15	NA	NA
WP_000416392.1|3278162_3281018_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_000786399.1|3281017_3281461_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3281715_3283227_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|3283493_3284594_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|3284593_3285676_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001346092.1|3285794_3287297_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
WP_001382682.1|3287426_3288446_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	4.2e-44
WP_001219006.1|3288912_3290175_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.7	1.5e-83
WP_112029415.1|3290570_3291784_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	96.3	1.6e-164
WP_072097794.1|3291849_3292191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001119729.1|3292269_3292503_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001234620.1|3292602_3293421_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000849571.1|3293475_3293961_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.4	1.5e-12
WP_001186726.1|3293976_3294453_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692311.1|3294515_3294737_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
>prophage 240
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3298294	3300589	4884967		Phage_Gifsy-1(50.0%)	2	NA	NA
WP_000953522.1|3298294_3299659_-	EspK/GogB family type III secretion system effector	NA	Q9MBM1	Phage_Gifsy-1	29.3	2.1e-51
WP_001145628.1|3299950_3300589_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	42.7	9.0e-45
>prophage 241
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3324025	3325564	4884967		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000723928.1|3324025_3325564_+	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	28.9	2.0e-10
>prophage 242
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3336340	3345606	4884967	transposase	Enterobacteria_phage(40.0%)	11	NA	NA
WP_024233278.1|3336340_3337216_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	80.4	1.2e-129
WP_112029397.1|3338686_3339900_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	6.0e-167
WP_001164975.1|3340951_3341197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001368734.1|3341290_3341764_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.2	2.5e-12
WP_069723416.1|3341779_3342256_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692311.1|3342318_3342540_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
WP_001280952.1|3342702_3343077_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001506713.1|3343123_3343501_+	toxin CbtA	NA	NA	NA	NA	NA
WP_001470575.1|3343497_3343986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839249.1|3343997_3344195_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001219054.1|3344895_3345606_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	42.7	1.8e-41
>prophage 243
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3366395	3367376	4884967		Escherichia_phage(100.0%)	1	NA	NA
WP_000338792.1|3366395_3367376_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	55.4	9.4e-102
>prophage 244
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3370738	3372415	4884967		Escherichia_phage(100.0%)	2	NA	NA
WP_000790571.1|3370738_3371341_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	51.8	7.6e-54
WP_000044711.1|3371818_3372415_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 245
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3382611	3384072	4884967		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|3382611_3384072_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 246
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3390639	3391194	4884967		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151861.1|3390639_3391194_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.0	6.0e-37
>prophage 247
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3398695	3399640	4884967	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181113.1|3398695_3399640_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.3e-60
>prophage 248
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3419706	3425071	4884967		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919567.1|3419706_3421371_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410127.1|3421419_3422781_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|3422995_3423910_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106030.1|3424048_3425071_+	L-galactonate-5-dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 249
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3428298	3429578	4884967		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3428298_3429036_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|3429038_3429578_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 250
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3437507	3440383	4884967		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|3437507_3439097_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|3439489_3440095_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3440221_3440383_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 251
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3446018	3447341	4884967		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477808.1|3446018_3447341_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
>prophage 252
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3454084	3459439	4884967		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093841.1|3454084_3455317_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|3455623_3457291_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|3457501_3459439_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 253
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3462671	3464785	4884967		Bacillus_phage(50.0%)	2	NA	NA
WP_001188666.1|3462671_3463361_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_001219614.1|3463360_3464785_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
>prophage 254
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3477832	3488250	4884967	transposase	Cyanophage(20.0%)	10	NA	NA
WP_000130189.1|3477832_3478786_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
WP_001094682.1|3478900_3479488_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|3479522_3480089_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102379.1|3480237_3480951_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843559.1|3480976_3481381_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|3481757_3483674_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118470.1|3483762_3484893_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001300563.1|3485155_3486268_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000935262.1|3486345_3486555_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681368.1|3487083_3488250_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
>prophage 255
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3495284	3498101	4884967	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286856.1|3495284_3498101_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 256
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3502507	3503656	4884967		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|3502507_3503656_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 257
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3509158	3514819	4884967		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001352635.1|3509158_3510712_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.3	5.4e-35
WP_000349932.1|3510785_3512003_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|3512131_3513274_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787107.1|3513304_3514819_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 258
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3522714	3525468	4884967		Bacillus_phage(50.0%)	5	NA	NA
WP_000624375.1|3522714_3523194_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000998542.1|3523214_3523394_+	antitoxin	NA	NA	NA	NA	NA
WP_001248979.1|3523492_3523960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000796358.1|3523995_3524595_-	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_000257193.1|3524619_3525468_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 259
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3533212	3538635	4884967		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117010.1|3533212_3536119_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035654.1|3536283_3538635_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
>prophage 260
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3544967	3545666	4884967		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916291.1|3544967_3545666_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 261
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3558368	3560093	4884967		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425657.1|3558368_3560093_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 262
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3586066	3587110	4884967		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|3586066_3587110_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 263
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3591355	3591907	4884967		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|3591355_3591907_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 264
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3600534	3601959	4884967		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|3600534_3601959_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 265
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3609608	3611159	4884967		Mamastrovirus(100.0%)	1	NA	NA
WP_001189633.1|3609608_3611159_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 266
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3615235	3617510	4884967		uncultured_virus(50.0%)	3	NA	NA
WP_000683335.1|3615235_3615772_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|3615812_3616475_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|3616583_3617510_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 267
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3620772	3621675	4884967	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339944.1|3620772_3621675_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 268
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3631581	3638387	4884967	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174639.1|3631581_3633000_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937424.1|3633038_3633965_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|3634001_3634457_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
WP_000396036.1|3634634_3635339_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|3635353_3635884_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_125090693.1|3635957_3638387_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.8	1.8e-40
>prophage 269
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3643630	3644428	4884967		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|3643630_3644428_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 270
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3650339	3650684	4884967		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3650339_3650684_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 271
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3654613	3656038	4884967	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753955.1|3654613_3656038_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 272
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3667922	3732654	4884967	tRNA,transposase,plate,protease	Flavobacterium_phage(10.0%)	53	NA	NA
WP_001295562.1|3667922_3668681_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922446.1|3668693_3669551_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295561.1|3669562_3670915_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|3670944_3673377_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|3673498_3673984_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|3673987_3675013_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3675117_3675573_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|3675576_3676365_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|3676364_3677513_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|3677509_3678106_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|3678142_3681625_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|3681637_3682597_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001021030.1|3682695_3684837_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|3684893_3685283_+	VOC family protein	NA	NA	NA	NA	NA
WP_125090720.1|3685347_3686646_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|3686694_3686955_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|3686941_3687142_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185293.1|3687307_3687853_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|3687849_3688272_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|3688285_3688996_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|3689245_3690226_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001297208.1|3690428_3691253_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|3691306_3693025_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|3693135_3693843_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|3693839_3694244_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|3694361_3695177_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|3695216_3695870_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_155430303.1|3695862_3696894_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	9.4e-36
WP_001140175.1|3697081_3697657_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997043.1|3703418_3704222_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_000648572.1|3704218_3705133_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3705373_3706174_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211726.1|3706251_3707022_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|3707069_3708428_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_125090604.1|3708499_3709255_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001298887.1|3709288_3710011_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917888.1|3710007_3710475_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|3710539_3711271_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|3711806_3712592_+	aminopeptidase	NA	NA	NA	NA	NA
WP_155430304.1|3712728_3713208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908058.1|3713217_3714132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|3714175_3714658_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087750.1|3714681_3716034_-	membrane protein	NA	NA	NA	NA	NA
WP_122986077.1|3716044_3719479_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_125090602.1|3719587_3721000_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|3721004_3721748_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614399.1|3721744_3724510_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_112029397.1|3724914_3726127_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	6.0e-167
WP_125090600.1|3726597_3727929_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|3727931_3728456_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|3728452_3729733_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|3729757_3730840_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|3730803_3732654_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 273
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3736788	3743259	4884967		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103319.1|3736788_3738930_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_024234281.1|3739005_3743259_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	3.2e-21
>prophage 274
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3749461	3753380	4884967		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|3749461_3750040_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|3750245_3751013_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|3750983_3751724_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615976.1|3751879_3752158_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|3752160_3752421_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543897.1|3752606_3753380_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.6e-19
>prophage 275
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3758431	3759598	4884967		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001325639.1|3758431_3759598_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	32.0	5.5e-32
>prophage 276
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3764275	3771857	4884967		Streptococcus_phage(50.0%)	6	NA	NA
WP_000749866.1|3764275_3765331_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
WP_001285288.1|3765618_3766722_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893257.1|3766733_3767987_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.3e-95
WP_001111349.1|3768303_3768714_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000121330.1|3768692_3769649_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|3769658_3771857_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
>prophage 277
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3792037	3795342	4884967		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001299025.1|3792037_3792907_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_001299021.1|3793066_3793660_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474077.1|3793671_3793908_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046293.1|3794016_3795342_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
>prophage 278
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3800918	3806838	4884967	holin	Catovirus(50.0%)	4	NA	NA
WP_001159109.1|3800918_3802589_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	2.3e-60
WP_125090533.1|3802602_3804075_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001295527.1|3804088_3804676_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|3804804_3806838_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 279
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3819564	3824102	4884967		Bacillus_virus(50.0%)	4	NA	NA
WP_000447335.1|3819564_3821049_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
WP_000818900.1|3821041_3822013_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750339.1|3822009_3822966_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000692753.1|3823052_3824102_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	2.8e-72
>prophage 280
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3832481	3838076	4884967		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000010284.1|3832481_3834368_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
WP_000076236.1|3834604_3835864_+	cytosine permease	NA	NA	NA	NA	NA
WP_001299008.1|3835853_3837137_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_000952476.1|3837176_3838076_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	5.5e-16
>prophage 281
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3842617	3846897	4884967		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177971.1|3842617_3845692_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.8	0.0e+00
WP_000805910.1|3845814_3846897_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.4	1.1e-191
>prophage 282
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3852307	3854268	4884967		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_000044315.1|3852307_3853258_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	1.1e-35
WP_001013499.1|3853254_3854268_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 283
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3857445	3858555	4884967		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|3857445_3858555_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 284
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3863797	3864565	4884967		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939375.1|3863797_3864565_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 285
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3871458	3872616	4884967		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|3871458_3872616_-	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 286
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3880031	3881147	4884967		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|3880031_3881147_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 287
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3885437	3895409	4884967		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|3885437_3886349_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219320.1|3886473_3887382_+	fructokinase	NA	NA	NA	NA	NA
WP_125090552.1|3887524_3888709_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698907.1|3888834_3891978_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|3891974_3893177_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|3893366_3894056_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893577.1|3894113_3895409_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
>prophage 288
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3902361	3911342	4884967	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|3902361_3903489_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|3903511_3903844_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|3903871_3905719_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|3905729_3906701_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|3906829_3907177_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|3907353_3908238_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001295327.1|3908536_3909076_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|3909226_3909676_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150474.1|3909679_3910783_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	2.6e-52
WP_001021161.1|3910871_3911342_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 289
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3935173	3940220	4884967	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|3935173_3935797_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|3935922_3937197_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_125090545.1|3937384_3939739_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	9.4e-225
WP_001043542.1|3939947_3940220_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 290
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3943360	3944056	4884967		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_155430310.1|3943360_3944056_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	2.5e-88
>prophage 291
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3947379	3950926	4884967		Bacillus_phage(100.0%)	2	NA	NA
WP_125090546.1|3947379_3949152_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.9	1.3e-48
WP_001256175.1|3949144_3950926_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.4e-42
>prophage 292
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3959761	3962911	4884967		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|3959761_3962911_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 293
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3969919	3978377	4884967		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|3969919_3970471_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122008.1|3970599_3972531_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|3972583_3972913_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|3972912_3973518_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|3973627_3975502_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_000261609.1|3975622_3976327_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250120.1|3976458_3977421_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801838.1|3977417_3978377_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	2.9e-15
>prophage 294
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3986621	3989682	4884967		Escherichia_phage(50.0%)	2	NA	NA
WP_001437645.1|3986621_3986963_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	73.6	3.9e-39
WP_000083962.1|3987177_3989682_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
>prophage 295
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3994221	3994899	4884967		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|3994221_3994899_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 296
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	3998035	4005765	4884967		Planktothrix_phage(50.0%)	3	NA	NA
WP_001110573.1|3998035_3998722_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561879.1|3998718_4001133_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053886982.1|4001562_4005765_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.0	1.1e-21
>prophage 297
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4011022	4012804	4884967		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096878.1|4011022_4012804_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	2.1e-38
>prophage 298
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4018995	4020141	4884967		Streptococcus_phage(100.0%)	1	NA	NA
WP_155430311.1|4018995_4020141_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
>prophage 299
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4031561	4126396	4884967	transposase,integrase,terminase,portal,tRNA,capsid,lysis,tail,head,protease	Enterobacteria_phage(57.35%)	102	4041723:4041769	4091410:4091456
WP_000912345.1|4031561_4032947_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|4032982_4033504_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4033611_4033824_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|4033825_4034692_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_125090756.1|4035172_4035715_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|4035934_4036627_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001437891.1|4036657_4039267_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691052.1|4039279_4040287_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_024167618.1|4040297_4040813_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|4040815_4041448_-	fimbriae biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
4041723:4041769	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|4041782_4042946_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000446905.1|4042801_4043173_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|4043144_4043423_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|4043470_4043689_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001443983.1|4043787_4044069_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|4044079_4044271_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|4044243_4044426_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000186835.1|4044422_4045103_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	99.1	4.6e-132
WP_000100847.1|4045099_4045885_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|4045890_4046187_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|4046261_4046405_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198861.1|4046373_4046538_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|4046610_4046979_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213971.1|4047182_4047362_-	Restriction inhibitor protein ral	NA	M1FQU1	Enterobacteria_phage	100.0	6.6e-30
WP_000281856.1|4047628_4048111_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_029365275.1|4048111_4048435_-	antitermination protein	NA	A4KWR8	Enterobacteria_phage	99.1	1.7e-52
WP_029365273.1|4050668_4051382_-	LexA family transcriptional regulator	NA	A4KWS0	Enterobacteria_phage	99.6	4.1e-131
WP_000437875.1|4051482_4051683_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_029365272.1|4051801_4052095_+	hypothetical protein	NA	A2SY75	Escherichia_phage	99.0	1.4e-45
WP_155430312.1|4052127_4053027_+	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	99.3	1.2e-172
WP_000788877.1|4053023_4053725_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_024233453.1|4053721_4054012_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	99.0	6.3e-46
WP_085947970.1|4054096_4055309_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_155430313.1|4055275_4055365_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.3e-07
WP_000736904.1|4055399_4055840_+	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	100.0	7.0e-81
WP_001254223.1|4056358_4056535_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000386643.1|4056537_4056879_+	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_000950954.1|4056871_4057066_+	protein ninF	NA	NA	NA	NA	NA
WP_001099712.1|4057085_4057448_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|4057444_4057585_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|4057670_4058054_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737266.1|4058243_4059341_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|4059929_4060145_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|4060144_4060642_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|4060858_4061041_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|4061131_4061425_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001415975.1|4061784_4061979_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_001027283.1|4062887_4064813_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|4064809_4065016_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001369921.1|4065012_4066614_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.9e-309
WP_000123273.1|4066594_4067914_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.6e-232
WP_001369910.1|4067923_4068256_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.1e-54
WP_000063218.1|4068311_4069337_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_000158868.1|4069378_4069774_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_029365230.1|4069785_4070139_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	7.6e-62
WP_000975051.1|4070150_4070729_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	3.5e-80
WP_000683105.1|4070725_4071121_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001345558.1|4071128_4071869_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
WP_000479154.1|4071884_4072307_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	9.7e-72
WP_000459458.1|4072288_4072723_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_155430314.1|4072715_4075277_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.8	0.0e+00
WP_000847379.1|4075273_4075603_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|4075602_4076301_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|4076306_4077050_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|4076986_4077619_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_065311093.1|4077679_4081093_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.3	0.0e+00
WP_001233071.1|4081163_4081763_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_000279163.1|4081827_4084788_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_000885616.1|4084787_4085363_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|4085460_4086051_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|4086367_4086601_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|4086669_4086783_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|4087148_4087817_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|4087873_4088179_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226378.1|4088362_4089847_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|4090033_4090987_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177464.1|4091498_4092260_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
4091410:4091456	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|4092442_4093333_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_155430315.1|4093333_4096306_-	phage receptor	NA	NA	NA	NA	NA
WP_000383951.1|4096292_4098530_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420923.1|4098798_4099935_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_001299580.1|4100038_4100350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299578.1|4100464_4100674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001289047.1|4100712_4105575_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	6.9e-20
WP_001160804.1|4105594_4106056_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_000103231.1|4106083_4107985_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	3.0e-27
WP_000253830.1|4108721_4110170_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000770941.1|4110159_4110843_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
WP_000074252.1|4110999_4112382_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709865.1|4112405_4112738_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717156.1|4112753_4113977_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000573951.1|4113988_4117132_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.0	2.2e-59
WP_000786320.1|4117233_4118610_+	aromatic amino acid transporter AroP	NA	NA	NA	NA	NA
WP_001153146.1|4118677_4119925_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000351464.1|4120032_4120686_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360951.1|4120779_4121148_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682518.1|4121212_4121461_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001130618.1|4121526_4122645_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000956456.1|4123086_4123239_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001300563.1|4123431_4124544_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956465.1|4124938_4125091_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001300563.1|4125283_4126396_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 300
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4131259	4137302	4884967		Tupanvirus(50.0%)	3	NA	NA
WP_000077799.1|4131259_4135141_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	4.9e-61
WP_000096744.1|4135356_4136490_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|4136486_4137302_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 301
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4151848	4153671	4884967		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502941.1|4151848_4152478_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029802.1|4152450_4153671_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.0	1.2e-58
>prophage 302
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4156780	4158895	4884967		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|4156780_4158346_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|4158466_4158895_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 303
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4174319	4174967	4884967		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4174319_4174529_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|4174583_4174967_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 304
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4179782	4182222	4884967		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4179782_4180994_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231428.1|4181133_4182222_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 305
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4189232	4191815	4884967	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|4189232_4191815_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 306
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4198753	4202286	4884967		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367895.1|4198753_4200424_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	3.0e-76
WP_125090645.1|4200507_4201443_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|4201560_4202286_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 307
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4210182	4211262	4884967		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|4210182_4211262_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 308
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4215467	4217132	4884967		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337066.1|4215467_4217132_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 309
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4221758	4225572	4884967	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023104.1|4221758_4223705_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|4223907_4225572_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 310
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4229722	4230487	4884967		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|4229722_4230487_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 311
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4237142	4249863	4884967		Bacillus_phage(25.0%)	8	NA	NA
WP_000186103.1|4237142_4237820_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
WP_001324644.1|4237816_4240501_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_001324645.1|4240493_4241066_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087969.1|4241074_4243123_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	28.6	3.4e-37
WP_000741137.1|4243145_4244819_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|4244818_4244908_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|4245220_4245427_+	YbfA family protein	NA	NA	NA	NA	NA
WP_155430318.1|4245669_4249863_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	9.5e-26
>prophage 312
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4254326	4257268	4884967		Hokovirus(50.0%)	2	NA	NA
WP_000628039.1|4254326_4255745_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	6.8e-61
WP_001032700.1|4255786_4257268_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.0	5.5e-45
>prophage 313
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4260646	4261438	4884967		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114025.1|4260646_4261438_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 314
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4297477	4300997	4884967		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|4297477_4298197_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|4298193_4299135_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|4299248_4299629_-	periplasmic protein	NA	NA	NA	NA	NA
WP_097399287.1|4299944_4300997_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	2.6e-81
>prophage 315
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4305351	4311927	4884967		Tupanvirus(33.33%)	7	NA	NA
WP_001265443.1|4305351_4306368_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_000096903.1|4306630_4308103_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	29.5	3.6e-12
WP_001147439.1|4308170_4308959_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4309087_4309237_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_000113005.1|4309403_4310177_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_125090594.1|4310176_4310866_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891683.1|4310868_4311927_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
>prophage 316
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4322282	4323572	4884967		Klosneuvirus(100.0%)	1	NA	NA
WP_001389241.1|4322282_4323572_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.8e-18
>prophage 317
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4330053	4330962	4884967		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|4330053_4330962_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 318
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4341559	4356371	4884967		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_000996099.1|4341559_4343296_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_001296990.1|4343288_4344284_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|4344286_4344958_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007102.1|4345186_4346551_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145128.1|4346782_4347265_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_001340191.1|4347384_4349535_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_125090592.1|4349562_4350525_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_125090590.1|4350665_4351751_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|4351979_4352240_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|4352504_4352771_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990177.1|4352844_4353522_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000430075.1|4353563_4355846_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|4356110_4356371_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 319
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4359911	4365137	4884967		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|4359911_4360634_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|4360630_4361290_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|4361428_4362175_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|4362578_4363082_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_125090588.1|4363380_4364268_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|4364503_4364569_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|4364621_4365137_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 320
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4370134	4451909	4884967	transposase,integrase,plate,terminase,portal,capsid,tail,lysis,head	Salmonella_phage(68.63%)	90	4403539:4403560	4440162:4440183
WP_000961458.1|4370134_4371727_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000399648.1|4372005_4372986_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000168797.1|4373241_4374507_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114244.1|4374658_4375474_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209359.1|4375619_4378052_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001307076.1|4378057_4378957_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001351540.1|4379087_4379750_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.2	1.6e-25
WP_000829231.1|4379837_4380587_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397382.1|4380586_4381822_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513775.1|4382025_4382991_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_001396359.1|4382977_4384849_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
WP_000090164.1|4384868_4386407_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|4386424_4387345_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236044.1|4387347_4388259_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_004015183.1|4388436_4390785_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000086910.1|4390792_4392121_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|4392167_4393493_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|4393705_4394089_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555022.1|4394199_4395315_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_001295292.1|4395311_4395938_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_000195961.1|4396183_4397386_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450133.1|4397432_4398191_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_000892317.1|4398248_4398845_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180076.1|4399129_4400362_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000480893.1|4400402_4400687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297001.1|4400772_4401588_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217848.1|4401587_4402796_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297003.1|4402879_4403416_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
4403539:4403560	attL	CGCTGCCGCCATTTTGTCGCCA	NA	NA	NA	NA
WP_024205920.1|4403778_4404093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290920.1|4404202_4405222_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	55.6	3.4e-102
WP_023568567.1|4405301_4405898_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_001027997.1|4405901_4407035_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000347902.1|4407036_4407603_-	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	39.2	1.6e-32
WP_000191881.1|4407729_4407951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460901.1|4407983_4408493_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.7e-86
WP_000956182.1|4408500_4408701_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963472.1|4408664_4409006_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_001244230.1|4409073_4409307_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000752619.1|4409306_4409534_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_125090776.1|4409530_4410385_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	89.8	2.4e-146
WP_001420002.1|4410390_4411212_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	75.7	1.1e-122
WP_023568566.1|4411211_4413584_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.1	0.0e+00
WP_001154434.1|4413736_4413925_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_155430321.1|4413935_4414169_+	DinI-like family protein	NA	E5G6M1	Salmonella_phage	97.4	6.8e-35
WP_000834899.1|4414328_4414754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155430322.1|4415207_4416767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121835573.1|4416839_4417865_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.9	2.6e-171
WP_121835575.1|4417864_4419631_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000216237.1|4419773_4420607_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_000742504.1|4420623_4421682_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.8	4.2e-180
WP_000059191.1|4421685_4422336_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673526.1|4422431_4422896_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_097407790.1|4422895_4423099_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	91.0	4.0e-31
WP_000171568.1|4423102_4423318_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001346410.1|4423337_4423811_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	90.4	1.4e-79
WP_063112263.1|4423812_4424190_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	1.4e-16
WP_001080923.1|4424186_4424615_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	3.8e-47
WP_001039936.1|4424710_4425142_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
WP_000829128.1|4425134_4425581_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.8	5.3e-60
WP_155430323.1|4425558_4426719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993763.1|4426795_4427374_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177580.1|4427370_4427730_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_000268309.1|4427716_4428625_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.0e-143
WP_111724705.1|4428617_4429223_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	3.4e-110
WP_111724704.1|4429219_4430764_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.6	4.5e-199
WP_001030518.1|4430763_4431366_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	88.0	5.6e-97
WP_001089534.1|4431337_4431781_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	49.7	3.6e-37
WP_024173770.1|4431783_4432275_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_000905023.1|4432305_4432872_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
WP_000046151.1|4433014_4434187_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.7	1.7e-203
WP_001207667.1|4434196_4434712_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_001281009.1|4434766_4435069_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|4435083_4435203_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_125090722.1|4435195_4438273_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.6	0.0e+00
WP_000980387.1|4438269_4438755_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	3.7e-67
WP_155430324.1|4438751_4439852_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.1	3.4e-177
WP_000972391.1|4439942_4440161_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024867.1|4440396_4442082_-	transporter	NA	NA	NA	NA	NA
4440162:4440183	attR	CGCTGCCGCCATTTTGTCGCCA	NA	NA	NA	NA
WP_000681108.1|4442351_4442729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195240.1|4442758_4443016_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|4443175_4443463_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189152.1|4443446_4444169_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|4444229_4445132_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4445219_4445696_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126072.1|4446047_4447160_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000995994.1|4447254_4448388_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_001093858.1|4448397_4449351_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061651.1|4449347_4450193_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4450252_4450741_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149734.1|4450781_4451909_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	4.6e-28
>prophage 321
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4455246	4457984	4884967		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|4455246_4455975_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270735.1|4456192_4456708_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|4456833_4457157_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|4457153_4457984_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 322
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4461571	4463290	4884967		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815362.1|4461571_4463290_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
>prophage 323
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4472587	4496345	4884967	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188194.1|4472587_4474534_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000410785.1|4474606_4474831_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4475153_4475474_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934053.1|4475504_4477781_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|4478465_4478684_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|4478968_4479673_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202188.1|4479714_4481436_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001043587.1|4481436_4483203_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_155430325.1|4483325_4484291_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|4484834_4485329_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077016.1|4485463_4489531_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4489685_4490297_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|4490307_4491651_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4491741_4493034_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850306.1|4493272_4495717_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213101.1|4495727_4496345_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 324
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4502655	4505870	4884967		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|4502655_4503396_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292815.1|4503587_4505870_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
>prophage 325
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4509968	4511057	4884967		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|4509968_4511057_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 326
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4516143	4520684	4884967		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|4516143_4516428_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705706.1|4516634_4518899_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|4518935_4520684_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 327
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4535389	4546522	4884967	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|4535389_4535938_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|4535964_4536612_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|4536833_4538024_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977920.1|4538208_4539297_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|4539898_4541299_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|4541467_4542670_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193844.1|4542935_4545548_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090508.1|4545754_4546522_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 328
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4562443	4564351	4884967		Tupanvirus(100.0%)	1	NA	NA
WP_000053089.1|4562443_4564351_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.4e-53
>prophage 329
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4576950	4579005	4884967		Bacillus_phage(100.0%)	1	NA	NA
WP_000420533.1|4576950_4579005_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 330
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4583238	4583898	4884967	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|4583238_4583898_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 331
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4603163	4615418	4884967		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|4603163_4603376_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071597721.1|4603386_4603575_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|4603549_4603780_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|4603769_4603943_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829658.1|4603990_4605064_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001437910.1|4605135_4607880_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	29.7	2.7e-37
WP_001264930.1|4607962_4608991_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|4608963_4609656_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|4609785_4610958_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_125090620.1|4610957_4613504_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_000209854.1|4613500_4614100_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024561.1|4614192_4614498_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420629.1|4614497_4615418_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
>prophage 332
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4619721	4621821	4884967		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|4619721_4619895_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001504154.1|4619977_4621306_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.2	1.4e-230
WP_001028105.1|4621326_4621821_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	4.2e-50
>prophage 333
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4636597	4637521	4884967		Cronobacter_phage(100.0%)	1	NA	NA
WP_001295604.1|4636597_4637521_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.2	4.1e-91
>prophage 334
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4644340	4646902	4884967	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_000409883.1|4644340_4645699_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
WP_085947598.1|4645739_4646902_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 335
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4652315	4653149	4884967		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|4652315_4653149_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 336
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4657283	4657817	4884967		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857399.1|4657283_4657817_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 337
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4667125	4668046	4884967		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|4667125_4668046_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 338
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4672708	4672954	4884967		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|4672708_4672954_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 339
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4688838	4689780	4884967		Brevibacillus_phage(100.0%)	1	NA	NA
WP_125090557.1|4688838_4689780_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 340
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4702138	4703320	4884967		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|4702138_4702873_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|4703083_4703320_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 341
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4706592	4708235	4884967		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|4706592_4707234_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267931.1|4707230_4708235_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 342
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4720541	4720799	4884967		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|4720541_4720799_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 343
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4728088	4731811	4884967		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|4728088_4728790_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251348.1|4728789_4730034_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|4730062_4730974_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|4730989_4731811_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 344
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4735087	4737065	4884967		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|4735087_4735945_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|4735928_4737065_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 345
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4742185	4743556	4884967		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423729.1|4742185_4743556_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
>prophage 346
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4746692	4750421	4884967		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000444487.1|4746692_4747943_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001325741.1|4748045_4748369_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	1.0e-41
WP_032141808.1|4748901_4749012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|4749064_4749469_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|4749689_4750421_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 347
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4756288	4758610	4884967		Escherichia_phage(100.0%)	1	NA	NA
WP_001307136.1|4756288_4758610_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.8	1.5e-89
>prophage 348
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4767132	4768820	4884967		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|4767132_4767552_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|4767551_4768820_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 349
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4795489	4798241	4884967		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|4795489_4797169_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|4797293_4798241_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 350
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4801377	4805385	4884967		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|4801377_4802460_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|4802459_4803293_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200374.1|4803289_4803682_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|4803685_4804495_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|4804530_4805385_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 351
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4808487	4808718	4884967		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146444.1|4808487_4808718_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 352
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4819849	4830038	4884967		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|4819849_4821388_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|4821384_4822095_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|4822094_4822772_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|4823675_4824518_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|4824567_4825026_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|4825138_4826044_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193437.1|4826135_4827149_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|4827350_4828259_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|4828402_4828816_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|4829420_4830038_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 353
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4838448	4840463	4884967		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|4838448_4839462_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|4839458_4840463_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 354
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4845333	4852709	4884967	transposase	Mycobacterium_phage(20.0%)	6	NA	NA
WP_000996136.1|4845333_4845885_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	40.9	1.1e-27
WP_155430328.1|4846229_4846892_+	DNA methylase	NA	A0A2C9CWW2	Yersinia_phage	33.3	8.5e-06
WP_085947598.1|4847107_4848270_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_155430329.1|4848516_4849512_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085947970.1|4849514_4850728_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_130570385.1|4851935_4852709_+	hypothetical protein	NA	A0A291AY96	Shigella_phage	59.9	1.3e-74
>prophage 355
NZ_CP046259	Escherichia coli strain ECO2947 chromosome, complete genome	4884967	4857982	4884115	4884967	integrase,holin	Escherichia_phage(43.24%)	43	4855113:4855126	4865159:4865172
4855113:4855126	attL	TACTCAACAGGTAA	NA	NA	NA	NA
WP_155430330.1|4857982_4859113_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.1	2.6e-103
WP_000113189.1|4859090_4859339_-	excisionase	NA	NA	NA	NA	NA
WP_155430331.1|4859403_4861875_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001083297.1|4861967_4862159_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854559.1|4862155_4862344_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001329848.1|4862743_4862908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|4862911_4863130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379557.1|4863289_4863445_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_032331581.1|4863721_4864024_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_001022415.1|4864026_4864386_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000578360.1|4864432_4864825_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001172789.1|4864951_4865212_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
4865159:4865172	attR	TTACCTGTTGAGTA	NA	NA	NA	NA
WP_000693932.1|4865208_4865646_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_155430332.1|4865732_4866746_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	90.0	1.9e-174
WP_001379651.1|4866777_4867200_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_155430333.1|4867233_4867959_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	2.0e-77
WP_016237929.1|4867974_4868367_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	2.9e-38
WP_001266130.1|4868363_4868660_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209471.1|4868656_4869118_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	91.7	3.8e-37
WP_000403778.1|4869095_4869452_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_001224662.1|4869545_4869728_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_155430334.1|4869893_4870589_+	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	95.7	4.4e-122
WP_115736886.1|4870590_4871142_+	DUF551 domain-containing protein	NA	G9L6G3	Escherichia_phage	82.1	2.3e-81
WP_000813254.1|4871710_4871866_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_115736926.1|4872033_4872312_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	3.3e-12
WP_155430335.1|4872313_4873360_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.3e-109
WP_000904113.1|4873372_4873747_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|4873743_4874565_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917767.1|4874791_4874989_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_032253524.1|4875139_4876198_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	88.2	6.9e-183
WP_032253526.1|4876993_4878946_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	69.8	2.5e-263
WP_032253528.1|4879080_4879263_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	84.7	1.7e-20
WP_032253529.1|4879300_4879570_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	70.8	8.5e-05
WP_000284506.1|4879645_4879861_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_096973148.1|4879864_4880209_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	94.7	2.3e-55
WP_000992078.1|4880259_4880793_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	94.9	9.0e-99
WP_000661714.1|4881066_4881762_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	98.7	1.4e-123
WP_001280922.1|4881856_4881988_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	90.7	8.5e-11
WP_153060551.1|4882210_4882396_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	95.1	3.9e-17
WP_101981593.1|4882481_4882706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828068.1|4883049_4883376_+	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_000095741.1|4883507_4883708_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829194.1|4883749_4884115_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	94.2	8.7e-61
>prophage 1
NZ_CP046260	Escherichia coli strain ECO2947 plasmid p2974-D, complete sequence	108424	7037	49433	108424	integrase,transposase	Macacine_betaherpesvirus(25.0%)	35	6801:6816	44612:44627
6801:6816	attL	AGGCCGGCGACAGCGA	NA	NA	NA	NA
WP_000844627.1|7037_7280_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012477564.1|7397_7988_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|8124_8697_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_001493761.1|8733_10125_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001516695.1|10904_11561_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001067855.1|12638_13343_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_025732387.1|14312_15512_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000470729.1|15590_16244_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000844627.1|16275_16518_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000480968.1|16904_17741_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|17740_18544_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|18604_19420_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|19749_19926_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001067855.1|20902_21607_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_077625588.1|21577_21922_+	hypothetical protein	NA	A0A1B0VAH3	Salmonella_phage	100.0	2.4e-36
WP_096320939.1|22693_23967_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	4.4e-168
WP_033804283.1|24475_25612_+	porin	NA	Q1MVN1	Enterobacteria_phage	56.6	8.3e-118
WP_000401034.1|25707_27405_+	sulfatase-like hydrolase/transferase	NA	A0A1V0SA98	Catovirus	23.2	2.0e-06
WP_001032733.1|27473_27731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947756.1|28877_29992_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.3	5.6e-50
WP_063073396.1|31691_35768_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	43.1	4.3e-265
WP_000990619.1|37426_37717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813639.1|38533_38752_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|38753_39059_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_032332905.1|39059_39866_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	98.3	2.2e-56
WP_000852146.1|40652_41408_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000772446.1|41995_43162_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_032248840.1|43161_44133_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	98.8	2.0e-173
WP_122990549.1|44784_45687_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
44612:44627	attR	TCGCTGTCGCCGGCCT	NA	NA	NA	NA
WP_033804376.1|45690_45996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032332811.1|46072_46756_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	6.7e-30
WP_032332810.1|46756_46978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033804380.1|46990_47425_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_113449533.1|47470_48247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300563.1|48320_49433_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
