The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	0	8564	8027492		uncultured_virus(100.0%)	9	NA	NA
WP_155362356.1|321_495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155362357.1|3200_3377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155362358.1|3373_4048_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_155362359.1|5435_5918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155362360.1|6056_6884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155362361.1|6887_7721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155362362.1|7717_7915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155362363.1|7911_8139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155362364.1|8135_8564_+	HAD-IC family P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.4	9.7e-11
>prophage 2
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	18392	20417	8027492		Mycobacterium_phage(100.0%)	1	NA	NA
WP_155362380.1|18392_20417_+	AAA family ATPase	NA	Q854C1	Mycobacterium_phage	45.6	3.9e-17
>prophage 3
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	26697	27999	8027492		Pandoravirus(100.0%)	1	NA	NA
WP_155362387.1|26697_27999_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	23.3	3.0e-15
>prophage 4
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	56272	56869	8027492		Cyanophage(100.0%)	1	NA	NA
WP_145041035.1|56272_56869_-	HNH endonuclease	NA	M1U3A7	Cyanophage	53.6	9.7e-09
>prophage 5
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	82269	85377	8027492		Pneumococcus_phage(50.0%)	3	NA	NA
WP_145040981.1|82269_82644_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	52.5	2.3e-24
WP_155362431.1|82759_84223_-	DUF5009 domain-containing protein	NA	NA	NA	NA	NA
WP_155362432.1|84378_85377_+	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	33.9	1.4e-47
>prophage 6
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	98143	102007	8027492		Scale_drop_disease_virus(50.0%)	3	NA	NA
WP_155362437.1|98143_98683_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	42.4	3.9e-25
WP_155362438.1|98820_99939_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_155362439.1|99994_102007_+	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	29.3	4.4e-29
>prophage 7
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	197849	201692	8027492		Bacillus_phage(100.0%)	1	NA	NA
WP_155362507.1|197849_201692_+	response regulator	NA	W8CYF6	Bacillus_phage	24.2	5.3e-23
>prophage 8
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	204765	206529	8027492		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
WP_155367276.1|204765_206529_+	HDOD domain-containing protein	NA	Q6XM27	Feldmannia_irregularis_virus	27.1	2.3e-05
>prophage 9
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	211707	214686	8027492		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_155362515.1|211707_214686_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	27.5	5.2e-18
>prophage 10
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	225297	226905	8027492		Oenococcus_phage(100.0%)	1	NA	NA
WP_155362527.1|225297_226905_+	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	20.7	6.9e-09
>prophage 11
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	259651	269114	8027492	protease	Tupanvirus(50.0%)	7	NA	NA
WP_155367279.1|259651_262342_-	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	24.7	1.5e-21
WP_155362547.1|262515_263436_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_155362548.1|263518_263842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155362549.1|263811_264537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155362550.1|264568_266869_-	tetratricopeptide repeat protein	NA	W5SAB9	Pithovirus	30.5	6.0e-06
WP_155362551.1|267073_268516_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	22.3	1.0e-11
WP_145040571.1|268880_269114_+	carbon storage regulator CsrA	NA	A0A0U1UNS3	Pseudomonas_phage	50.0	5.6e-05
>prophage 12
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	278734	280105	8027492		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_155367280.1|278734_280105_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.7	1.2e-14
>prophage 13
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	283898	285686	8027492		Streptococcus_virus(100.0%)	1	NA	NA
WP_155362562.1|283898_285686_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	34.5	1.1e-47
>prophage 14
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	288752	290536	8027492		Bacillus_phage(100.0%)	2	NA	NA
WP_155362565.1|288752_289487_-	response regulator	NA	W8CYM9	Bacillus_phage	30.6	3.1e-25
WP_155367281.1|289483_290536_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.0	9.0e-18
>prophage 15
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	297023	301548	8027492		Oenococcus_phage(50.0%)	3	NA	NA
WP_155362568.1|297023_298430_-	dgoA protein	NA	Q6A202	Oenococcus_phage	23.7	1.1e-05
WP_155362569.1|299078_300329_+	insulinase family protein	NA	NA	NA	NA	NA
WP_145184444.1|300315_301548_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	23.9	2.9e-31
>prophage 16
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	316631	321609	8027492		Molluscum_contagiosum_virus(33.33%)	5	NA	NA
WP_155362579.1|316631_317216_+	redoxin domain-containing protein	NA	A0A1S7DM81	Molluscum_contagiosum_virus	32.1	2.3e-10
WP_155362580.1|317349_318519_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_155362581.1|318655_319948_+	SGNH/GDSL hydrolase family protein	NA	A0A0A0RS52	Bacillus_phage	23.8	1.3e-05
WP_155362582.1|319984_320908_+	hexose kinase	NA	NA	NA	NA	NA
WP_155362583.1|320904_321609_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	25.8	5.3e-14
>prophage 17
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	325799	326702	8027492		uncultured_virus(100.0%)	1	NA	NA
WP_155362587.1|325799_326702_-	UDP-2,3-diacylglucosamine diphosphatase	NA	A0A218MKA7	uncultured_virus	39.6	1.4e-48
>prophage 18
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	330864	331476	8027492		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_155362591.1|330864_331476_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	63.7	2.6e-73
>prophage 19
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	334538	338960	8027492		Orpheovirus(100.0%)	1	NA	NA
WP_155362595.1|334538_338960_-	protein kinase	NA	A0A2I2L395	Orpheovirus	33.5	5.3e-19
>prophage 20
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	348007	349357	8027492		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_155362603.1|348007_349357_+	SidA/IucD/PvdA family monooxygenase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	25.9	1.2e-09
>prophage 21
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	371050	372886	8027492		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
WP_155362622.1|371050_372886_+	DNA helicase RecQ	NA	J2YAJ8	Acanthamoeba_polyphaga_lentillevirus	35.8	4.5e-81
>prophage 22
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	423050	427180	8027492		Bacillus_virus(50.0%)	4	NA	NA
WP_155362649.1|423050_423767_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.4	7.2e-27
WP_155362650.1|423850_424804_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155362651.1|424800_426453_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155362652.1|426490_427180_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.6	3.9e-30
>prophage 23
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	437231	439769	8027492		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_155362661.1|437231_439769_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	65.7	3.6e-12
>prophage 24
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	447232	450453	8027492		Heterosigma_akashiwo_virus(50.0%)	2	NA	NA
WP_155362665.1|447232_448396_+	protein kinase	NA	A0A1C9C556	Heterosigma_akashiwo_virus	27.2	5.5e-16
WP_155362666.1|448470_450453_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	36.0	6.3e-105
>prophage 25
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	455409	460175	8027492	tRNA	uncultured_Mediterranean_phage(100.0%)	3	NA	NA
WP_155362670.1|455409_458400_-	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	30.9	9.1e-15
WP_155362671.1|458511_458865_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_145184081.1|459056_460175_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	8.5e-91
>prophage 26
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	464392	466069	8027492		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_155362676.1|464392_466069_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	30.4	1.1e-22
>prophage 27
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	486128	494192	8027492		Bacillus_phage(50.0%)	4	NA	NA
WP_155362691.1|486128_488360_-	protein kinase	NA	G5CT46	Megavirus	26.8	3.4e-14
WP_155362692.1|488869_491656_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	29.3	1.4e-86
WP_155362693.1|491711_492734_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	47.9	2.6e-78
WP_155362694.1|492869_494192_+	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	36.9	1.1e-76
>prophage 28
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	497763	501247	8027492		Perigonia_lusca_single_nucleopolyhedrovirus(50.0%)	2	NA	NA
WP_155362697.1|497763_500112_+	protein kinase	NA	A0A0M3WNS7	Perigonia_lusca_single_nucleopolyhedrovirus	27.6	1.0e-05
WP_145440378.1|500266_501247_+	aspartate carbamoyltransferase catalytic subunit	NA	Q84489	Paramecium_bursaria_Chlorella_virus	34.3	9.3e-33
>prophage 29
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	512351	515678	8027492		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_155362706.1|512351_515678_-	helicase SNF2	NA	A0A0P0YMN2	Yellowstone_lake_phycodnavirus	32.8	5.7e-50
>prophage 30
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	519281	520130	8027492		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_155362710.1|519281_520130_+	carbon-nitrogen hydrolase family protein	NA	M1HUK8	Acanthocystis_turfacea_Chlorella_virus	29.3	6.8e-16
>prophage 31
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	525522	526608	8027492		Salmonella_phage(100.0%)	1	NA	NA
WP_155362714.1|525522_526608_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	36.8	1.2e-46
>prophage 32
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	538032	539316	8027492	protease	Bacillus_virus(100.0%)	1	NA	NA
WP_145183950.1|538032_539316_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	52.0	1.1e-115
>prophage 33
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	555138	560959	8027492		uncultured_Mediterranean_phage(100.0%)	3	NA	NA
WP_155362733.1|555138_557721_+	hypothetical protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.0	7.3e-146
WP_155362734.1|557734_559783_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_155362735.1|559954_560959_-	chromosome segregation protein ScpA	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	6.8e-07
>prophage 34
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	590589	591429	8027492		Vibrio_phage(100.0%)	1	NA	NA
WP_145040100.1|590589_591429_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2I7SAT0	Vibrio_phage	33.0	3.1e-29
>prophage 35
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	595615	606727	8027492	protease	Sulfolobus_monocaudavirus(33.33%)	9	NA	NA
WP_155367295.1|595615_596458_+	glycosyltransferase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	24.8	1.8e-08
WP_155362751.1|596747_598742_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	44.2	4.4e-106
WP_145183849.1|598808_600062_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	36.5	6.0e-61
WP_155362752.1|600068_600947_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155362753.1|601017_602208_-	8-amino-7-oxononanoate synthase	NA	D2TEZ5	Emiliania_huxleyi_virus	28.1	2.7e-34
WP_155362754.1|602247_603387_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_155362755.1|603441_604518_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.4	8.5e-72
WP_155362756.1|605134_605950_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_155362757.1|605965_606727_-	glycosyltransferase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	31.2	3.3e-22
>prophage 36
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	624421	626470	8027492		Hokovirus(100.0%)	1	NA	NA
WP_155362765.1|624421_626470_-	hypothetical protein	NA	A0A1V0SGR7	Hokovirus	28.4	8.4e-28
>prophage 37
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	629741	633190	8027492		Bacillus_phage(50.0%)	3	NA	NA
WP_155362768.1|629741_630833_-	acyltransferase family protein	NA	A0A0S2SXM2	Bacillus_phage	31.0	8.2e-14
WP_155362769.1|630974_631211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155362770.1|631633_633190_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	24.9	9.6e-16
>prophage 38
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	646032	647829	8027492		Catovirus(100.0%)	1	NA	NA
WP_155362779.1|646032_647829_+	sulfatase-like hydrolase/transferase	NA	A0A1V0SA98	Catovirus	32.4	2.1e-06
>prophage 39
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	657602	662730	8027492		Citrobacter_phage(50.0%)	3	NA	NA
WP_155362786.1|657602_658982_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1B1IXQ7	Citrobacter_phage	37.8	8.0e-06
WP_155362787.1|659240_661241_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_155362788.1|661770_662730_+	AAA family ATPase	NA	A0A0S0MVD6	Pseudomonas_phage	45.3	1.9e-43
>prophage 40
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	670027	670942	8027492		Mycobacterium_phage(100.0%)	1	NA	NA
WP_145443672.1|670027_670942_+	tyrosine recombinase XerC	NA	A0A142K7N4	Mycobacterium_phage	28.5	4.2e-19
>prophage 41
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	683431	684016	8027492		Acinetobacter_phage(100.0%)	1	NA	NA
WP_155362798.1|683431_684016_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	47.9	2.5e-49
>prophage 42
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	718981	721003	8027492		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_155362821.1|718981_721003_-	Hsp70 family protein	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	29.8	3.9e-62
>prophage 43
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	725192	726629	8027492		Cyanophage(100.0%)	1	NA	NA
WP_155362824.1|725192_726629_+	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	H6WFR9	Cyanophage	30.5	2.4e-29
>prophage 44
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	732156	735705	8027492	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_155362829.1|732156_735705_+|tRNA	class I tRNA ligase family protein	tRNA	A0A1V0SJ93	Klosneuvirus	26.0	5.2e-102
>prophage 45
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	740767	741235	8027492		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_155362833.1|740767_741235_+	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	33.8	6.2e-19
>prophage 46
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	744608	745781	8027492	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_155362836.1|744608_745781_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.4	4.7e-23
>prophage 47
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	776480	778136	8027492	tRNA	Catovirus(100.0%)	1	NA	NA
WP_145039846.1|776480_778136_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SAN4	Catovirus	25.3	2.4e-41
>prophage 48
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	794616	802327	8027492		Oenococcus_phage(25.0%)	6	NA	NA
WP_155362862.1|794616_795795_-	D-galactonate dehydratase	NA	Q6A202	Oenococcus_phage	30.3	1.1e-43
WP_155362863.1|795964_797233_-	tetratricopeptide repeat protein	NA	M1PFD8	Streptococcus_phage	30.8	4.7e-05
WP_155362864.1|797471_798713_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A219Y950	Aeromonas_phage	50.5	2.7e-93
WP_155362865.1|798731_800108_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_155362866.1|800697_800907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155362867.1|801499_802327_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.0	3.5e-65
>prophage 49
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	811755	812652	8027492		Tupanvirus(50.0%)	2	NA	NA
WP_155362874.1|811755_812229_+	VOC family protein	NA	A0A2K9L4N3	Tupanvirus	35.8	9.0e-18
WP_145440536.1|812343_812652_-	hypothetical protein	NA	A0A1B0UY37	Roseobacter_phage	46.4	9.4e-16
>prophage 50
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	816048	816615	8027492	protease	Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_155362878.1|816048_816615_-|protease	DJ-1/PfpI/YhbO family deglycase/protease	protease	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	30.8	6.1e-13
>prophage 51
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	823363	823993	8027492	tail	Salmonella_phage(100.0%)	1	NA	NA
WP_155362886.1|823363_823993_-|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	47.2	6.3e-43
>prophage 52
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	844254	844992	8027492		Bacillus_virus(100.0%)	1	NA	NA
WP_155362915.1|844254_844992_-	TIGR02452 family protein	NA	G3MBH6	Bacillus_virus	44.0	5.9e-40
>prophage 53
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	848382	849930	8027492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_155362919.1|848382_849930_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	3.4e-13
>prophage 54
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	860871	869120	8027492		Diadromus_pulchellus_ascovirus(25.0%)	6	NA	NA
WP_145039560.1|860871_861618_-	glucose 1-dehydrogenase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	30.9	1.3e-18
WP_155362926.1|861671_862790_-	muconate cycloisomerase	NA	Q6A202	Oenococcus_phage	26.4	3.6e-25
WP_155362927.1|863232_864327_+	serine hydrolase	NA	NA	NA	NA	NA
WP_155362928.1|864561_867429_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.8	1.1e-17
WP_155362929.1|867812_868475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155362930.1|868646_869120_+	response regulator	NA	W8CYM9	Bacillus_phage	40.7	1.6e-19
>prophage 55
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	874154	875693	8027492		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_155362935.1|874154_875693_+	protein kinase	NA	A7IVH4	Paramecium_bursaria_Chlorella_virus	24.5	5.0e-17
>prophage 56
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	907713	909834	8027492		Shigella_phage(50.0%)	2	NA	NA
WP_145039453.1|907713_908316_+	transcriptional repressor LexA	NA	Q8SBE8	Shigella_phage	44.6	2.0e-06
WP_145183171.1|908439_909834_-	response regulator	NA	W8CYM9	Bacillus_phage	30.8	3.0e-08
>prophage 57
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	961435	968200	8027492	tRNA	unidentified_phage(50.0%)	4	NA	NA
WP_155362983.1|961435_962707_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	30.7	2.4e-41
WP_145183064.1|962736_963840_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_155362984.1|963842_964940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149345500.1|965584_968200_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.0	3.5e-119
>prophage 58
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	975065	985050	8027492	tRNA	Enterococcus_phage(25.0%)	7	NA	NA
WP_145039304.1|975065_975680_+	guanylate kinase	NA	A0A1D3SNH1	Enterococcus_phage	40.3	3.9e-13
WP_145039302.1|975663_975942_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_155362989.1|975979_976519_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	A0A1V0S7W6	Shearwaterpox_virus	34.4	7.6e-21
WP_155362990.1|976568_977195_+	phosphopantothenoylcysteine decarboxylase	NA	NA	NA	NA	NA
WP_155362991.1|977645_979952_+	DNA translocase FtsK	NA	G1DAY1	Mycobacterium_virus	45.2	3.4e-78
WP_145440658.1|980397_981972_+	citramalate synthase	NA	NA	NA	NA	NA
WP_155362992.1|982125_985050_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	35.9	1.7e-146
>prophage 59
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	988414	991579	8027492		Leptospira_phage(100.0%)	1	NA	NA
WP_155362995.1|988414_991579_+	MMPL family transporter	NA	S5VTK5	Leptospira_phage	29.0	5.7e-124
>prophage 60
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	995676	996855	8027492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_155362999.1|995676_996855_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	54.4	1.8e-115
>prophage 61
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1006861	1009628	8027492		Klosneuvirus(50.0%)	2	NA	NA
WP_155363007.1|1006861_1008460_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A1V0SKZ0	Klosneuvirus	51.0	1.0e-137
WP_155363008.1|1008626_1009628_-	NAD-dependent epimerase/dehydratase family protein	NA	Q76TT0	Molluscum_contagiosum_virus	31.8	4.0e-23
>prophage 62
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1023775	1027297	8027492		Bacillus_virus(100.0%)	1	NA	NA
WP_155363017.1|1023775_1027297_-	AAA family ATPase	NA	G3MA40	Bacillus_virus	24.3	3.3e-24
>prophage 63
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1030967	1033545	8027492	tRNA	Moraxella_phage(100.0%)	2	NA	NA
WP_155363019.1|1030967_1032407_+	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	27.1	2.6e-23
WP_155363020.1|1032513_1033545_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.2	2.1e-67
>prophage 64
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1065333	1068912	8027492		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_155367307.1|1065333_1068912_-	helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	24.1	5.4e-30
>prophage 65
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1074649	1076248	8027492		Acinetobacter_phage(100.0%)	1	NA	NA
WP_155363040.1|1074649_1076248_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	30.5	7.3e-27
>prophage 66
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1086402	1088700	8027492		Cedratvirus(100.0%)	1	NA	NA
WP_155363049.1|1086402_1088700_+	protein kinase	NA	A0A1M7XTW9	Cedratvirus	27.9	9.2e-15
>prophage 67
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1105666	1168219	8027492	protease,transposase	Phormidium_phage(16.67%)	48	NA	NA
WP_155363066.1|1105666_1108531_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_155363067.1|1108788_1110132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363068.1|1110201_1110420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363069.1|1110512_1110761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363070.1|1110772_1111717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363071.1|1111812_1113309_-	AAA family ATPase	NA	U5XGM6	Phormidium_phage	31.0	1.2e-50
WP_155363072.1|1113403_1113631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363073.1|1113630_1113831_-	DUF2997 domain-containing protein	NA	NA	NA	NA	NA
WP_155363074.1|1113827_1114196_-	DUF1257 domain-containing protein	NA	NA	NA	NA	NA
WP_155363075.1|1114266_1114824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363076.1|1114786_1114996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363077.1|1115290_1116445_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	40.6	5.0e-70
WP_155363078.1|1116888_1117155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155363079.1|1117389_1118052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155363080.1|1118156_1118873_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_155363081.1|1119293_1120823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363082.1|1121593_1122409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155363083.1|1122807_1123734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155363084.1|1123754_1125077_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155363085.1|1125067_1125814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363086.1|1125847_1126258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363087.1|1126335_1127070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363088.1|1127139_1128189_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_155363089.1|1128296_1128971_-	serine/threonine protein phosphatase	NA	A0A1V0EF12	Caulobacter_phage	33.7	2.3e-19
WP_155363090.1|1129176_1130304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155363091.1|1130944_1131700_+	flavodoxin reductase	NA	NA	NA	NA	NA
WP_155363092.1|1131955_1132144_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155363093.1|1132279_1132783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155363094.1|1133541_1133844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155363095.1|1134475_1135513_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_155363096.1|1135962_1142511_-	alpha/beta fold hydrolase	NA	A0A0R6PIZ1	Moraxella_phage	27.8	7.5e-54
WP_155363097.1|1143355_1145614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155363098.1|1145754_1149783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155363099.1|1149849_1150983_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_155363100.1|1151343_1151583_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155363101.1|1151705_1151984_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155363102.1|1152216_1153593_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_155363103.1|1153771_1154446_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155363104.1|1154734_1155661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363105.1|1155941_1156142_-	carbon storage regulator	NA	NA	NA	NA	NA
WP_155363106.1|1156186_1156606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363107.1|1156938_1159029_+	PAS domain S-box protein	NA	A0A1V0S925	Catovirus	37.8	2.5e-11
WP_155363108.1|1158929_1159691_+	response regulator	NA	NA	NA	NA	NA
WP_155363109.1|1159768_1162489_+	HAD-IC family P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.3	1.9e-67
WP_155363110.1|1162728_1163226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155363111.1|1163499_1165869_+	phosphoketolase	NA	NA	NA	NA	NA
WP_155363112.1|1165841_1167068_+	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_155367308.1|1167235_1168219_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 68
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1188063	1216538	8027492		Bacillus_phage(25.0%)	5	NA	NA
WP_155363131.1|1188063_1188933_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	40.8	1.9e-05
WP_155363132.1|1188932_1190567_-	cytochrome P450	NA	I6WI04	Cotesia_sesamiae_Mombasa_bracovirus	24.9	6.7e-12
WP_155363133.1|1190999_1191533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363134.1|1191770_1194380_-	protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	30.3	3.9e-22
WP_155363135.1|1194689_1216538_-	hypothetical protein	NA	E5ERA2	Bathycoccus_sp._RCC1105_virus	31.3	8.1e-20
>prophage 69
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1222218	1227414	8027492		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_155363139.1|1222218_1227414_-	protein kinase	NA	M1HTI1	Paramecium_bursaria_Chlorella_virus	30.7	2.1e-14
>prophage 70
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1237717	1238776	8027492		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_155363147.1|1237717_1238776_-	serine hydrolase	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	25.2	3.8e-08
>prophage 71
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1265307	1273806	8027492		Hokovirus(100.0%)	3	NA	NA
WP_155363163.1|1265307_1268037_+	response regulator	NA	A0A1V0SGX0	Hokovirus	32.6	7.2e-43
WP_155363164.1|1268178_1268793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155363165.1|1269504_1273806_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	31.3	9.0e-48
>prophage 72
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1293260	1294700	8027492		Tupanvirus(100.0%)	1	NA	NA
WP_155363180.1|1293260_1294700_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	22.2	8.9e-16
>prophage 73
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1299235	1305570	8027492		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_155363181.1|1299235_1300642_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.1	6.1e-46
WP_155363182.1|1301381_1301978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363183.1|1302144_1305570_-	protein kinase	NA	M1HV07	Acanthocystis_turfacea_Chlorella_virus	29.3	5.6e-16
>prophage 74
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1341008	1343297	8027492		Escherichia_phage(100.0%)	1	NA	NA
WP_155363202.1|1341008_1343297_+	hypothetical protein	NA	A0A2H4PGQ5	Escherichia_phage	34.4	1.8e-15
>prophage 75
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1367771	1371896	8027492		Microcystis_virus(100.0%)	1	NA	NA
WP_155363222.1|1367771_1371896_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	32.2	1.3e-24
>prophage 76
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1407823	1410028	8027492		Bathycoccus_sp._RCC1105_virus(100.0%)	1	NA	NA
WP_155363236.1|1407823_1410028_-	hypothetical protein	NA	E5ERA2	Bathycoccus_sp._RCC1105_virus	30.0	4.7e-24
>prophage 77
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1415123	1417664	8027492		Acanthamoeba_castellanii_mimivirus(100.0%)	1	NA	NA
WP_155363241.1|1415123_1417664_+	protein kinase	NA	A0A1E1EXF7	Acanthamoeba_castellanii_mimivirus	31.9	9.8e-18
>prophage 78
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1423062	1423596	8027492		Choristoneura_biennis_entomopoxvirus(100.0%)	1	NA	NA
WP_155363246.1|1423062_1423596_-	superoxide dismutase family protein	NA	R4ZFG3	Choristoneura_biennis_entomopoxvirus	41.1	2.3e-17
>prophage 79
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1427214	1428753	8027492		Leptospira_phage(100.0%)	1	NA	NA
WP_155363251.1|1427214_1428753_+	efflux RND transporter periplasmic adaptor subunit	NA	S5VL44	Leptospira_phage	23.4	2.1e-07
>prophage 80
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1479106	1479808	8027492		Vibrio_phage(100.0%)	1	NA	NA
WP_155363279.1|1479106_1479808_-	NAD-dependent deacylase	NA	Q6WIA8	Vibrio_phage	34.7	2.3e-25
>prophage 81
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1508517	1517083	8027492		Powai_lake_megavirus(50.0%)	5	NA	NA
WP_155363297.1|1508517_1513728_-	protein kinase	NA	A0A160EPW9	Powai_lake_megavirus	34.1	7.4e-12
WP_155363298.1|1513848_1514310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363299.1|1514364_1514997_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_155363300.1|1515265_1515538_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_155363301.1|1515709_1517083_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0G2YB36	Acanthamoeba_polyphaga_mimivirus	25.2	2.3e-13
>prophage 82
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1561983	1566314	8027492		Burkholderia_virus(25.0%)	4	NA	NA
WP_149336473.1|1561983_1562880_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	37.4	4.1e-11
WP_155363323.1|1563062_1564502_+	catalase	NA	A0A2K9L0T1	Tupanvirus	43.4	3.5e-89
WP_155363324.1|1564569_1565460_-	slipin family protein	NA	A0A0G2YDT0	Acanthamoeba_polyphaga_mimivirus	26.0	5.1e-14
WP_155363325.1|1565750_1566314_-	hypothetical protein	NA	A0A0E3I641	Synechococcus_phage	30.3	6.5e-07
>prophage 83
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1580222	1580450	8027492		Bacillus_virus(100.0%)	1	NA	NA
WP_145439747.1|1580222_1580450_+	hypothetical protein	NA	G3MBF7	Bacillus_virus	41.4	6.2e-09
>prophage 84
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1586547	1593881	8027492		Hokovirus(50.0%)	4	NA	NA
WP_155363341.1|1586547_1590663_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	31.6	8.3e-67
WP_155367322.1|1590673_1591771_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155363342.1|1591779_1592574_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_155363343.1|1592570_1593881_-	methyltransferase domain-containing protein	NA	A0A2I2L5L3	Orpheovirus	32.5	2.9e-50
>prophage 85
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1600473	1600929	8027492		Tupanvirus(100.0%)	1	NA	NA
WP_155363350.1|1600473_1600929_+	VOC family protein	NA	A0A2K9L1J4	Tupanvirus	36.7	6.6e-18
>prophage 86
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1609153	1610104	8027492		Catovirus(100.0%)	1	NA	NA
WP_155363354.1|1609153_1610104_+	hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	35.9	3.6e-34
>prophage 87
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1619193	1633910	8027492		Tupanvirus(42.86%)	13	NA	NA
WP_155363364.1|1619193_1620138_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9KZK0	Tupanvirus	49.1	1.0e-81
WP_155363365.1|1620277_1621111_-	aldolase	NA	NA	NA	NA	NA
WP_155363366.1|1621110_1622706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363367.1|1622654_1623656_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2K9L4U8	Tupanvirus	31.2	3.1e-28
WP_155363368.1|1623696_1624830_-	NTP transferase domain-containing protein	NA	A0A291LA53	Escherichia_phage	26.1	6.3e-09
WP_155363369.1|1624897_1626058_-	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_155363370.1|1626054_1627062_-	N-acetylneuraminate synthase	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	34.4	4.3e-33
WP_155363371.1|1627058_1627724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363372.1|1627693_1628845_-	LegC family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.8	9.2e-32
WP_155363373.1|1628889_1629618_-	acylneuraminate cytidylyltransferase family protein	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.6e-10
WP_155363374.1|1629811_1631134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155367323.1|1631339_1631948_-	sugar transferase	NA	NA	NA	NA	NA
WP_155363375.1|1632071_1633910_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A0G2Y369	Acanthamoeba_polyphaga_mimivirus	25.6	2.9e-27
>prophage 88
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1663582	1664827	8027492		Cyanophage(100.0%)	1	NA	NA
WP_145439687.1|1663582_1664827_-	RimK family alpha-L-glutamate ligase	NA	A0A1D7SYT2	Cyanophage	34.6	1.1e-38
>prophage 89
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1679909	1682986	8027492		Enterococcus_phage(50.0%)	2	NA	NA
WP_155363404.1|1679909_1680758_-	hypothetical protein	NA	A0A0S2MYI4	Enterococcus_phage	40.8	4.7e-09
WP_155363405.1|1680898_1682986_+	serine hydrolase	NA	A0A2P1JR59	Mycobacterium_phage	26.5	5.6e-11
>prophage 90
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1694391	1695132	8027492	integrase	Leptospira_phage(100.0%)	1	1691913:1691928	1699967:1699982
1691913:1691928	attL	AAATGACACCCGCAAT	NA	NA	NA	NA
WP_155363413.1|1694391_1695132_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	31.8	4.0e-12
WP_155363413.1|1694391_1695132_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	31.8	4.0e-12
1699967:1699982	attR	ATTGCGGGTGTCATTT	NA	NA	NA	NA
>prophage 91
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1702770	1703457	8027492		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_155367329.1|1702770_1703457_-	hypothetical protein	NA	A0A0P0CLM1	Ostreococcus_lucimarinus_virus	29.0	5.3e-11
>prophage 92
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1720810	1730916	8027492		environmental_Halophage(33.33%)	6	NA	NA
WP_155363435.1|1720810_1722079_-	hypothetical protein	NA	H9YSJ8	environmental_Halophage	32.4	6.2e-13
WP_155363436.1|1722108_1723020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363437.1|1723302_1724838_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.8	1.1e-91
WP_155363438.1|1724830_1726198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155363439.1|1726190_1727699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155363440.1|1727700_1730916_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.5	2.5e-66
>prophage 93
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1752564	1757409	8027492		Erwinia_phage(100.0%)	1	NA	NA
WP_155363461.1|1752564_1757409_-	hypothetical protein	NA	H2DE49	Erwinia_phage	48.6	7.9e-08
>prophage 94
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1764408	1766625	8027492		Canarypox_virus(50.0%)	2	NA	NA
WP_155363465.1|1764408_1765785_+	sulfatase-like hydrolase/transferase	NA	Q6VZU9	Canarypox_virus	24.1	8.2e-11
WP_155363466.1|1765851_1766625_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.2	4.8e-16
>prophage 95
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1786870	1790989	8027492		Hokovirus(100.0%)	1	NA	NA
WP_155363476.1|1786870_1790989_-	response regulator	NA	A0A1V0SGX0	Hokovirus	33.1	4.9e-67
>prophage 96
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1796840	1798082	8027492		Myoviridae_environmental_samples(100.0%)	1	NA	NA
WP_155363481.1|1796840_1798082_-	exo-alpha-sialidase	NA	A0A2R3UAY9	Myoviridae_environmental_samples	29.2	1.4e-25
>prophage 97
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1812730	1813606	8027492		Pandoravirus(100.0%)	1	NA	NA
WP_155363487.1|1812730_1813606_+	methyltransferase domain-containing protein	NA	A0A0B5J146	Pandoravirus	25.9	3.2e-08
>prophage 98
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1829525	1833747	8027492		Hokovirus(50.0%)	3	NA	NA
WP_155363498.1|1829525_1832945_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	30.4	2.1e-71
WP_155363499.1|1833165_1833444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145181643.1|1833579_1833747_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	54.7	8.1e-06
>prophage 99
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1846952	1853783	8027492		Indivirus(66.67%)	3	NA	NA
WP_155363515.1|1846952_1849889_+	protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	27.2	8.4e-13
WP_155363516.1|1849896_1851120_-	protein kinase	NA	A0A1V0SDC3	Indivirus	32.5	3.2e-06
WP_155363517.1|1851404_1853783_-	ABC transporter substrate-binding protein	NA	A0A1V0SDC3	Indivirus	29.7	2.3e-21
>prophage 100
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1885727	1886711	8027492	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_155363532.1|1885727_1886711_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.6	5.1e-39
>prophage 101
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1925286	1926699	8027492		Feldmannia_species_virus(100.0%)	1	NA	NA
WP_155363556.1|1925286_1926699_+	response regulator	NA	B5LWN0	Feldmannia_species_virus	27.0	7.1e-26
>prophage 102
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1946970	1953379	8027492		Bacillus_phage(50.0%)	3	NA	NA
WP_155363571.1|1946970_1948863_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.1	1.7e-51
WP_155363572.1|1950609_1951326_+	divalent cation transporter	NA	NA	NA	NA	NA
WP_155367332.1|1951564_1953379_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.4	1.3e-59
>prophage 103
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	1964048	1965257	8027492		Morganella_phage(100.0%)	1	NA	NA
WP_155367333.1|1964048_1965257_+	nucleotidyltransferase	NA	A0A1W6JNT0	Morganella_phage	30.6	1.8e-30
>prophage 104
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2008325	2010440	8027492		Golden_Marseillevirus(100.0%)	1	NA	NA
WP_155363609.1|2008325_2010440_+	protein kinase	NA	A0A1D6Y713	Golden_Marseillevirus	29.8	1.0e-20
>prophage 105
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2018242	2019361	8027492		Oenococcus_phage(100.0%)	1	NA	NA
WP_155363614.1|2018242_2019361_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	25.8	1.5e-26
>prophage 106
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2026062	2027049	8027492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_155363620.1|2026062_2027049_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	23.4	4.4e-06
>prophage 107
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2040355	2040838	8027492		Tupanvirus(100.0%)	1	NA	NA
WP_155363633.1|2040355_2040838_-	VOC family protein	NA	A0A2K9L1J4	Tupanvirus	42.4	9.2e-26
>prophage 108
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2046523	2047339	8027492		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_155363637.1|2046523_2047339_-	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	29.8	4.7e-14
>prophage 109
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2060445	2064940	8027492		Staphylococcus_phage(50.0%)	2	NA	NA
WP_155363645.1|2060445_2063973_+	MFS transporter	NA	A0A2H4PQM9	Staphylococcus_phage	26.4	1.6e-18
WP_155363646.1|2064334_2064940_+	transcriptional repressor LexA	NA	A0A1B2APZ3	Phage_Wrath	31.8	7.8e-06
>prophage 110
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2087255	2088737	8027492		Tetraselmis_virus(100.0%)	1	NA	NA
WP_155363657.1|2087255_2088737_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.5	9.4e-29
>prophage 111
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2100429	2101776	8027492		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_155363667.1|2100429_2101776_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.7	2.0e-49
>prophage 112
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2106521	2112564	8027492		Bacteriophage(50.0%)	5	NA	NA
WP_155363671.1|2106521_2106725_-	YqaE/Pmp3 family membrane protein	NA	A0A0C5AJ71	Bacteriophage	52.5	2.8e-08
WP_155363672.1|2106726_2107008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363673.1|2107042_2107243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363674.1|2107239_2107530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363675.1|2107722_2112564_+	N-6 DNA methylase	NA	A0A2H4UTW8	Bodo_saltans_virus	28.7	1.6e-53
>prophage 113
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2142188	2143580	8027492		Bordetella_phage(100.0%)	1	NA	NA
WP_155363691.1|2142188_2143580_-	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	35.0	1.9e-47
>prophage 114
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2155720	2157572	8027492		Halovirus(50.0%)	2	NA	NA
WP_155363695.1|2155720_2156899_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.3	2.0e-50
WP_145037663.1|2157104_2157572_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	44.7	1.4e-23
>prophage 115
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2161432	2162719	8027492		Megavirus(100.0%)	1	NA	NA
WP_145181356.1|2161432_2162719_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.1e-65
>prophage 116
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2168186	2168693	8027492		Acinetobacter_phage(100.0%)	1	NA	NA
WP_145181349.1|2168186_2168693_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A0P0IVM8	Acinetobacter_phage	36.7	3.7e-17
>prophage 117
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2175139	2177843	8027492		Streptococcus_phage(50.0%)	3	NA	NA
WP_155363704.1|2175139_2176570_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	40.6	4.4e-84
WP_145037632.1|2176751_2177258_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_155363705.1|2177345_2177843_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	50.4	1.7e-22
>prophage 118
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2204629	2205904	8027492		Streptococcus_phage(100.0%)	1	NA	NA
WP_155363723.1|2204629_2205904_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.5	5.1e-100
>prophage 119
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2223311	2227599	8027492	protease,tail	Moraxella_phage(50.0%)	3	NA	NA
WP_155367342.1|2223311_2225312_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	29.9	2.1e-71
WP_155363734.1|2225404_2226472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155363735.1|2226570_2227599_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	1.5e-17
>prophage 120
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2234226	2239586	8027492		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_155363740.1|2234226_2236158_-	succinate dehydrogenase (quinone) flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	25.3	7.5e-10
WP_155363741.1|2236235_2236979_-	succinate dehydrogenase	NA	NA	NA	NA	NA
WP_155363742.1|2237288_2239586_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	1.3e-61
>prophage 121
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2259112	2264636	8027492	tRNA	Bacillus_phage(50.0%)	3	NA	NA
WP_155363753.1|2259112_2260213_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	57.0	2.4e-106
WP_155363754.1|2260403_2262002_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_155363755.1|2262008_2264636_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	32.8	1.4e-59
>prophage 122
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2269410	2273501	8027492	tRNA	Bacillus_phage(50.0%)	3	NA	NA
WP_145037498.1|2269410_2269992_-	response regulator	NA	W8CYM9	Bacillus_phage	32.2	2.3e-07
WP_155363758.1|2270558_2272391_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_155363759.1|2272430_2273501_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A0E3HYS2	Synechococcus_phage	29.5	2.1e-06
>prophage 123
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2280711	2283486	8027492		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_155363764.1|2280711_2283486_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.5	4.3e-27
>prophage 124
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2316139	2316874	8027492		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_155363784.1|2316139_2316874_-	permease	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	32.2	3.5e-08
>prophage 125
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2321225	2321762	8027492		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_155363786.1|2321225_2321762_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	44.9	5.6e-24
>prophage 126
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2330958	2333849	8027492		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_155363795.1|2330958_2332314_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	35.4	9.1e-55
WP_155363796.1|2332379_2333849_+	aminotransferase class V-fold PLP-dependent enzyme	NA	E3ST28	Prochlorococcus_phage	38.4	1.7e-70
>prophage 127
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2356756	2357968	8027492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_155367345.1|2356756_2357968_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	38.2	5.8e-77
>prophage 128
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2368090	2368897	8027492		Cedratvirus(100.0%)	1	NA	NA
WP_155363815.1|2368090_2368897_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.5	2.9e-08
>prophage 129
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2385803	2394553	8027492		Stenotrophomonas_phage(33.33%)	6	NA	NA
WP_155363825.1|2385803_2388536_+	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	41.7	5.5e-83
WP_145181209.1|2388963_2391108_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.0	1.9e-54
WP_155363826.1|2391136_2392069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363827.1|2392232_2393138_+	triphosphoribosyl-dephospho-CoA synthetase	NA	NA	NA	NA	NA
WP_145181206.1|2393127_2393634_+	6-pyruvoyl tetrahydropterin synthase family protein	NA	NA	NA	NA	NA
WP_155363828.1|2393689_2394553_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.3	6.5e-14
>prophage 130
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2413721	2416637	8027492		Microbacterium_phage(100.0%)	1	NA	NA
WP_155363839.1|2413721_2416637_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	32.5	1.3e-82
>prophage 131
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2430801	2432559	8027492	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_155363847.1|2430801_2432559_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.2	7.5e-17
>prophage 132
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2491297	2494009	8027492		Indivirus(100.0%)	1	NA	NA
WP_155367351.1|2491297_2494009_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	33.4	2.1e-106
>prophage 133
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2497427	2498195	8027492		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_145037201.1|2497427_2498195_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.3	1.9e-25
>prophage 134
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2506252	2506876	8027492		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_145037191.1|2506252_2506876_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	26.6	5.2e-05
>prophage 135
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2534955	2537376	8027492		Hokovirus(100.0%)	1	NA	NA
WP_155363905.1|2534955_2537376_+	response regulator	NA	A0A1V0SGX0	Hokovirus	34.4	4.9e-51
>prophage 136
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2541333	2543292	8027492		Wolbachia_phage(100.0%)	1	NA	NA
WP_155363908.1|2541333_2543292_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.4	3.7e-65
>prophage 137
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2554434	2556564	8027492	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	2	NA	NA
WP_155363913.1|2554434_2555991_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	27.0	1.9e-32
WP_155367354.1|2556051_2556564_+	crossover junction endodeoxyribonuclease RuvC	NA	S6CQM9	Streptococcus_phage	26.5	1.1e-08
>prophage 138
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2585582	2587274	8027492	tRNA	Escherichia_phage(100.0%)	1	NA	NA
WP_155363929.1|2585582_2587274_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	59.4	4.2e-190
>prophage 139
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2598077	2599121	8027492		Providencia_phage(100.0%)	1	NA	NA
WP_155363938.1|2598077_2599121_-	signal peptide peptidase SppA	NA	K4I1N3	Providencia_phage	29.5	7.6e-17
>prophage 140
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2617935	2620161	8027492		Enterobacteria_phage(100.0%)	1	NA	NA
WP_155363951.1|2617935_2620161_-	type II and III secretion system protein	NA	D0U174	Enterobacteria_phage	28.3	2.7e-11
>prophage 141
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2648597	2649242	8027492		Rhizobium_phage(100.0%)	1	NA	NA
WP_155363977.1|2648597_2649242_-	Appr-1-p processing protein	NA	W6E8J3	Rhizobium_phage	35.5	2.0e-23
>prophage 142
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2671940	2672909	8027492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_155363990.1|2671940_2672909_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.5	6.6e-23
>prophage 143
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2677215	2677992	8027492		Planktothrix_phage(100.0%)	1	NA	NA
WP_155363994.1|2677215_2677992_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.1	9.0e-15
>prophage 144
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2691577	2695585	8027492		Bacillus_phage(50.0%)	2	NA	NA
WP_155367363.1|2691577_2692618_-	ribonucleotide-diphosphate reductase subunit beta	NA	U5Q1G6	Bacillus_phage	27.1	1.0e-29
WP_155364003.1|2692732_2695585_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.5	2.6e-176
>prophage 145
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2701114	2702953	8027492		Phaeocystis_pouchetii_virus(100.0%)	1	NA	NA
WP_155364008.1|2701114_2702953_+	DNA mismatch repair protein MutS	NA	F2QAF8	Phaeocystis_pouchetii_virus	26.2	9.6e-07
>prophage 146
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2716476	2716677	8027492		Vibrio_phage(100.0%)	1	NA	NA
WP_155364018.1|2716476_2716677_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	45.6	3.9e-07
>prophage 147
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2728303	2730013	8027492		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_155364027.1|2728303_2730013_+	protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	29.4	2.0e-19
>prophage 148
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2736412	2744581	8027492		Salmonella_phage(33.33%)	7	NA	NA
WP_155367365.1|2736412_2737591_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	1.1e-19
WP_155364035.1|2737837_2738104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155364036.1|2738132_2739032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364037.1|2739046_2740261_-	myo-inositol-1-phosphate synthase	NA	NA	NA	NA	NA
WP_155364038.1|2740538_2741807_-	hypothetical protein	NA	A0A1X9I671	Streptococcus_phage	34.0	1.0e-55
WP_155364039.1|2741704_2742385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364040.1|2742997_2744581_+	Hsp70 family protein	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	36.9	2.7e-82
>prophage 149
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2791740	2792766	8027492		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_155364066.1|2791740_2792766_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	33.1	1.8e-10
>prophage 150
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2808125	2811265	8027492		Hokovirus(50.0%)	3	NA	NA
WP_155364078.1|2808125_2809184_+	EF-P lysine aminoacylase GenX	NA	A0A1V0SFI4	Hokovirus	26.6	1.4e-21
WP_155364079.1|2809187_2810198_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_155364080.1|2810668_2811265_-	exonuclease	NA	A0A2K9L1J3	Tupanvirus	31.4	2.4e-15
>prophage 151
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2816660	2820209	8027492		Hokovirus(100.0%)	1	NA	NA
WP_155364087.1|2816660_2820209_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	34.1	1.2e-53
>prophage 152
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2823987	2824449	8027492		Synechococcus_phage(100.0%)	1	NA	NA
WP_155364089.1|2823987_2824449_+	ribose 5-phosphate isomerase B	NA	A0A222YX14	Synechococcus_phage	31.7	1.8e-15
>prophage 153
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2847112	2848201	8027492		Moumouvirus(100.0%)	1	NA	NA
WP_155364108.1|2847112_2848201_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2P1EL10	Moumouvirus	37.0	3.2e-18
>prophage 154
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2855994	2857149	8027492		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_155364113.1|2855994_2857149_-	2-hydroxyacid dehydrogenase	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	41.8	1.7e-65
>prophage 155
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2863325	2864294	8027492		Tetraselmis_virus(100.0%)	1	NA	NA
WP_155367371.1|2863325_2864294_-	DUF1214 domain-containing protein	NA	A0A2P0VP21	Tetraselmis_virus	37.7	4.7e-53
>prophage 156
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2872236	2874565	8027492		Tetraselmis_virus(50.0%)	3	NA	NA
WP_155364122.1|2872236_2872731_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.2	1.4e-24
WP_155364123.1|2872727_2873867_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_145180852.1|2873884_2874565_-	radical SAM protein	NA	J9PV61	Bacillus_phage	28.5	5.3e-19
>prophage 157
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2895751	2896720	8027492		Synechococcus_phage(100.0%)	1	NA	NA
WP_155364144.1|2895751_2896720_+	YHYH protein	NA	I3UL96	Synechococcus_phage	36.6	9.5e-30
>prophage 158
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2919250	2939290	8027492		Synechococcus_phage(50.0%)	2	NA	NA
WP_155364159.1|2919250_2920795_-	adenylyltransferase/cytidyltransferase family protein	NA	M4QSA2	Synechococcus_phage	40.8	1.0e-17
WP_155364160.1|2923000_2939290_+	hypothetical protein	NA	E3T5D0	Cafeteria_roenbergensis_virus	25.8	1.8e-11
>prophage 159
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2947466	2956904	8027492		Croceibacter_phage(20.0%)	8	NA	NA
WP_155364166.1|2947466_2947973_-	ASCH domain-containing protein	NA	I6RTQ6	Croceibacter_phage	29.1	1.9e-05
WP_155364167.1|2947917_2949312_-	MBL fold metallo-hydrolase	NA	Q331V3	Clostridium_botulinum_C_phage	34.5	6.1e-22
WP_155364168.1|2949397_2950375_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	28.5	2.5e-22
WP_155364169.1|2950405_2951473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364170.1|2951505_2951925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364171.1|2952004_2953024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364172.1|2953243_2955334_+	M3 family peptidase	NA	A0A1V0SID3	Klosneuvirus	25.3	8.8e-49
WP_149343082.1|2955584_2956904_+	nucleotide sugar dehydrogenase	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	31.1	1.8e-39
>prophage 160
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2966511	2967402	8027492		Mollivirus(100.0%)	1	NA	NA
WP_155364179.1|2966511_2967402_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	36.6	4.3e-45
>prophage 161
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	2985834	2989394	8027492		Moumouvirus(33.33%)	4	NA	NA
WP_155364190.1|2985834_2987070_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A2P1ELT3	Moumouvirus	28.8	9.6e-19
WP_145180704.1|2987337_2987550_-	carbon storage regulator CsrA	NA	H2BD56	Pseudomonas_phage	50.9	3.2e-07
WP_145103980.1|2988078_2988405_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_155364191.1|2988830_2989394_+	response regulator	NA	W8CYM9	Bacillus_phage	33.3	6.1e-13
>prophage 162
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3026554	3027661	8027492		Oenococcus_phage(100.0%)	1	NA	NA
WP_155364216.1|3026554_3027661_-	hypothetical protein	NA	Q6A202	Oenococcus_phage	27.9	5.2e-32
>prophage 163
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3035881	3037663	8027492		Streptomyces_phage(100.0%)	1	NA	NA
WP_155364223.1|3035881_3037663_-	thioredoxin fold domain-containing protein	NA	A0A1J0GW78	Streptomyces_phage	37.8	8.4e-08
>prophage 164
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3046704	3053074	8027492		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_155364227.1|3046704_3048060_-	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	30.5	1.0e-13
WP_145036358.1|3048243_3049656_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_155364228.1|3049843_3053074_-	AcrB/AcrD/AcrF family protein	NA	S5VTK5	Leptospira_phage	23.0	4.1e-61
>prophage 165
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3073638	3075426	8027492		uncultured_phage(100.0%)	1	NA	NA
WP_155364242.1|3073638_3075426_-	tetratricopeptide repeat protein	NA	D6PFH9	uncultured_phage	28.9	1.4e-10
>prophage 166
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3086618	3089925	8027492		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_155364250.1|3086618_3087863_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	60.7	2.0e-08
WP_155364251.1|3087901_3088420_-	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	46.7	6.2e-28
WP_145180564.1|3088848_3089925_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F205	Synechococcus_phage	43.8	3.2e-63
>prophage 167
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3094600	3103347	8027492		Bacillus_phage(40.0%)	8	NA	NA
WP_145036290.1|3094600_3095314_-	response regulator	NA	W8CYM9	Bacillus_phage	39.6	4.2e-35
WP_145036288.1|3095347_3096019_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_149340869.1|3096023_3096806_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	7.4e-17
WP_155364255.1|3097008_3097887_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_155367375.1|3097883_3098810_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_155364256.1|3098875_3099880_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	29.0	1.3e-21
WP_155364257.1|3100129_3101908_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	39.4	1.9e-36
WP_149340871.1|3102165_3103347_-	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	27.4	1.1e-24
>prophage 168
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3127170	3129427	8027492		Tokyovirus(50.0%)	2	NA	NA
WP_155364273.1|3127170_3128901_+	protein kinase	NA	A0A146JFA3	Tokyovirus	26.6	7.1e-20
WP_155364274.1|3128893_3129427_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.9	4.1e-27
>prophage 169
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3137485	3141454	8027492		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_145180500.1|3137485_3138256_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.3	7.8e-19
WP_155364280.1|3138410_3139541_-	dehypoxanthine futalosine cyclase	NA	NA	NA	NA	NA
WP_155367376.1|3139509_3140391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364281.1|3140635_3141454_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	38.4	5.2e-37
>prophage 170
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3145615	3146374	8027492		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_145443517.1|3145615_3146374_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.1	4.8e-13
>prophage 171
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3159876	3162021	8027492		Bacillus_phage(100.0%)	1	NA	NA
WP_155364292.1|3159876_3162021_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.3	7.0e-17
>prophage 172
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3168154	3169918	8027492		Hokovirus(100.0%)	1	NA	NA
WP_155364298.1|3168154_3169918_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	32.0	2.9e-16
>prophage 173
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3182758	3183649	8027492		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_155364305.1|3182758_3183649_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.5	3.3e-13
>prophage 174
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3187384	3188626	8027492		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_155364309.1|3187384_3188626_+	exodeoxyribonuclease VII large subunit	NA	E3T4G9	Cafeteria_roenbergensis_virus	31.1	4.5e-24
>prophage 175
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3199292	3200492	8027492		Moumouvirus(100.0%)	1	NA	NA
WP_145180421.1|3199292_3200492_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	32.9	4.9e-36
>prophage 176
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3206276	3210633	8027492		uncultured_virus(66.67%)	4	NA	NA
WP_155364322.1|3206276_3206972_-	serine/threonine protein phosphatase	NA	Q4Z929	Staphylococcus_phage	31.7	8.9e-14
WP_155364323.1|3207089_3208346_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_155364324.1|3208615_3210217_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	52.9	4.4e-149
WP_145036124.1|3210315_3210633_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	49.4	1.3e-15
>prophage 177
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3215377	3222326	8027492		Ectromelia_virus(33.33%)	5	NA	NA
WP_155364327.1|3215377_3216067_+	hypothetical protein	NA	Q8JLD2	Ectromelia_virus	42.6	9.8e-05
WP_145036114.1|3216087_3216909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364328.1|3217312_3218230_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_155364329.1|3218255_3220601_-	DUF1343 domain-containing protein	NA	A0A2P1CHE9	Mycobacterium_phage	27.2	6.3e-11
WP_155364330.1|3220652_3222326_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	33.2	2.6e-75
>prophage 178
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3229631	3232221	8027492		Streptococcus_phage(50.0%)	2	NA	NA
WP_155364336.1|3229631_3231257_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	36.5	1.8e-33
WP_145036094.1|3231570_3232221_+	HNH endonuclease	NA	A0A248SKR4	Salicola_phage	33.6	4.1e-13
>prophage 179
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3243772	3246697	8027492	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_155364346.1|3243772_3246697_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	47.6	2.5e-243
>prophage 180
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3250900	3251587	8027492		Bacillus_phage(100.0%)	1	NA	NA
WP_155364351.1|3250900_3251587_-	hypothetical protein	NA	A0A1P8CX02	Bacillus_phage	48.6	3.2e-32
>prophage 181
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3278520	3281250	8027492		Hokovirus(100.0%)	1	NA	NA
WP_155364370.1|3278520_3281250_+	response regulator	NA	A0A1V0SGX0	Hokovirus	33.1	1.8e-49
>prophage 182
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3289497	3290532	8027492		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_155364376.1|3289497_3290532_-	ATP-dependent 6-phosphofructokinase	NA	H8ZJH0	Ostreococcus_tauri_virus	26.5	1.6e-14
>prophage 183
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3294344	3296543	8027492		Streptococcus_phage(100.0%)	1	NA	NA
WP_155364380.1|3294344_3296543_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.0	4.8e-138
>prophage 184
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3305640	3306426	8027492		Moumouvirus(100.0%)	1	NA	NA
WP_155364385.1|3305640_3306426_+	hypothetical protein	NA	M1PGF9	Moumouvirus	28.3	1.2e-19
>prophage 185
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3324022	3327034	8027492		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_155364397.1|3324022_3324583_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	36.6	8.4e-23
WP_155364398.1|3324771_3326040_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_155364399.1|3326359_3327034_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.6	6.0e-23
>prophage 186
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3333354	3334344	8027492		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_155364403.1|3333354_3334344_+	3-phosphoglycerate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	36.4	1.3e-34
>prophage 187
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3388421	3390745	8027492		Acidianus_two-tailed_virus(50.0%)	2	NA	NA
WP_145035820.1|3388421_3389495_+	AAA domain-containing protein	NA	A0A1C9EGB9	Acidianus_two-tailed_virus	26.4	6.6e-08
WP_155364430.1|3389596_3390745_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7C038	Faustovirus	27.6	6.6e-30
>prophage 188
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3406978	3410954	8027492	tRNA	Planktothrix_phage(50.0%)	3	NA	NA
WP_145045943.1|3406978_3407707_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.7	2.4e-30
WP_155364441.1|3407803_3409408_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_155364442.1|3409472_3410954_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.9	8.1e-81
>prophage 189
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3513491	3514073	8027492		Tupanvirus(100.0%)	1	NA	NA
WP_155364504.1|3513491_3514073_+	HD domain-containing protein	NA	A0A2K9L141	Tupanvirus	35.0	6.1e-24
>prophage 190
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3520717	3521755	8027492		Yersinia_phage(100.0%)	1	NA	NA
WP_155364511.1|3520717_3521755_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A1V0DXF5	Yersinia_phage	38.6	1.1e-20
>prophage 191
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3543136	3546016	8027492		Staphylococcus_phage(50.0%)	2	NA	NA
WP_155364525.1|3543136_3545092_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.9	2.1e-92
WP_145179876.1|3545227_3546016_+	nickel pincer cofactor biosynthesis protein LarB	NA	A0A0C5K6I2	Enterococcus_phage	38.8	1.5e-17
>prophage 192
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3552360	3553386	8027492		Lactobacillus_phage(100.0%)	1	NA	NA
WP_155364530.1|3552360_3553386_-	glycerophosphodiester phosphodiesterase	NA	A0A075KJS1	Lactobacillus_phage	27.1	2.4e-15
>prophage 193
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3557740	3559504	8027492	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_155364534.1|3557740_3559504_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	22.1	3.4e-09
>prophage 194
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3566305	3569269	8027492		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_155364541.1|3566305_3569269_+	protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	27.8	5.7e-17
>prophage 195
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3572743	3573433	8027492		Rhizobium_phage(100.0%)	1	NA	NA
WP_155364544.1|3572743_3573433_-	serine/threonine protein phosphatase	NA	V9QL63	Rhizobium_phage	35.0	2.7e-23
>prophage 196
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3598957	3603387	8027492		Bacillus_virus(100.0%)	2	NA	NA
WP_149342859.1|3598957_3601372_+	DNA topoisomerase 4 subunit A	NA	G3M9Z5	Bacillus_virus	31.1	1.1e-87
WP_155364565.1|3601455_3603387_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	36.7	7.3e-106
>prophage 197
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3606478	3609837	8027492		Bacillus_phage(50.0%)	2	NA	NA
WP_155364567.1|3606478_3608746_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	37.2	1.2e-112
WP_155364568.1|3608886_3609837_+	site-specific tyrosine recombinase XerD	NA	A0A1P8DJJ6	Virus_Rctr41k	28.5	4.2e-14
>prophage 198
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3619251	3624192	8027492		Edwardsiella_phage(50.0%)	3	NA	NA
WP_155364577.1|3619251_3620295_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	49.8	4.8e-88
WP_155364578.1|3620471_3620906_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_155364579.1|3620997_3624192_-	protein kinase	NA	A0A1E1EXF7	Acanthamoeba_castellanii_mimivirus	32.1	2.7e-17
>prophage 199
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3631806	3633555	8027492		Moumouvirus(100.0%)	1	NA	NA
WP_155364586.1|3631806_3633555_+	Hsp70 family protein	NA	A0A2P1ELQ7	Moumouvirus	34.9	1.5e-86
>prophage 200
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3644903	3645983	8027492		Microcystis_virus(100.0%)	1	NA	NA
WP_155364599.1|3644903_3645983_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	28.2	1.6e-17
>prophage 201
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3663613	3666121	8027492		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_155364613.1|3663613_3664363_+	hypothetical protein	NA	A0A2H4JE88	uncultured_Caudovirales_phage	28.9	6.2e-13
WP_155364614.1|3664519_3666121_+	sodium/solute symporter	NA	A0A240F3J2	Aeromonas_phage	29.7	2.0e-32
>prophage 202
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3685309	3689934	8027492		Tupanvirus(33.33%)	4	NA	NA
WP_155364630.1|3685309_3685831_+	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L2A2	Tupanvirus	24.5	4.2e-08
WP_155364631.1|3685855_3688345_-	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.2	1.3e-115
WP_145035297.1|3688440_3688800_-	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_155364632.1|3688803_3689934_-	DNA polymerase III subunit beta	NA	A0A0K1LLX6	Caulobacter_phage	24.0	1.7e-14
>prophage 203
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3698213	3699722	8027492		Bacillus_phage(100.0%)	1	NA	NA
WP_155364641.1|3698213_3699722_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.1	1.9e-21
>prophage 204
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3702955	3705370	8027492		Enterobacteria_phage(100.0%)	1	NA	NA
WP_155364645.1|3702955_3705370_-	hypothetical protein	NA	D0U174	Enterobacteria_phage	24.7	7.9e-17
>prophage 205
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3714362	3715586	8027492		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_155364655.1|3714362_3715586_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.9	3.8e-36
>prophage 206
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3729525	3730857	8027492		Pandoravirus(100.0%)	1	NA	NA
WP_155364664.1|3729525_3730857_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	33.0	2.9e-53
>prophage 207
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3743885	3747765	8027492		Vibrio_phage(50.0%)	4	NA	NA
WP_145193518.1|3743885_3744386_-	6-carboxytetrahydropterin synthase	NA	A0A088FAL2	Vibrio_phage	38.4	4.4e-23
WP_155364678.1|3744438_3745842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145045806.1|3745869_3746355_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_155364679.1|3746790_3747765_-	WYL domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	28.1	3.8e-10
>prophage 208
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3762006	3763422	8027492		Tupanvirus(100.0%)	1	NA	NA
WP_155364692.1|3762006_3763422_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	21.2	3.0e-16
>prophage 209
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3800258	3801026	8027492		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_155364722.1|3800258_3801026_-	NAD-dependent epimerase/dehydratase family protein	NA	Q58M85	Prochlorococcus_phage	26.8	2.0e-11
>prophage 210
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3811879	3812896	8027492		Pandoravirus(100.0%)	1	NA	NA
WP_155364728.1|3811879_3812896_-	alpha/beta fold hydrolase	NA	S4VVM9	Pandoravirus	28.2	3.2e-12
>prophage 211
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3821223	3823305	8027492		Bacillus_phage(100.0%)	1	NA	NA
WP_155364731.1|3821223_3823305_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	30.1	2.5e-72
>prophage 212
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3829554	3830421	8027492		Microcystis_phage(100.0%)	1	NA	NA
WP_155364736.1|3829554_3830421_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BUR2	Microcystis_phage	32.1	2.6e-10
>prophage 213
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3840668	3843029	8027492		Hokovirus(100.0%)	1	NA	NA
WP_155364743.1|3840668_3843029_+	response regulator	NA	A0A1V0SGX0	Hokovirus	30.5	9.0e-42
>prophage 214
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3859218	3860166	8027492		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_155364753.1|3859218_3860166_+	site-specific DNA-methyltransferase	NA	R4THJ7	Phaeocystis_globosa_virus	30.5	2.3e-28
>prophage 215
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3865936	3871466	8027492		Staphylococcus_phage(33.33%)	4	NA	NA
WP_155364756.1|3865936_3867442_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	5.8e-18
WP_155364757.1|3867445_3868435_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155364758.1|3868580_3870497_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2P1ELS8	Moumouvirus	29.1	6.9e-24
WP_155364759.1|3870860_3871466_+	anthranilate/aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	55.1	2.6e-62
>prophage 216
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3880996	3887848	8027492		Streptococcus_phage(33.33%)	6	NA	NA
WP_145193263.1|3880996_3882271_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.8	2.4e-137
WP_155367396.1|3882826_3883804_+	phosphatidylserine decarboxylase family protein	NA	NA	NA	NA	NA
WP_155364765.1|3883790_3884672_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_145443278.1|3884726_3885344_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.7	7.9e-30
WP_155364766.1|3885330_3886251_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
WP_155364767.1|3886363_3887848_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	2.4e-93
>prophage 217
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3894820	3896866	8027492	tRNA	Hokovirus(100.0%)	1	NA	NA
WP_155364773.1|3894820_3896866_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	6.6e-41
>prophage 218
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3910514	3911975	8027492		Vibrio_phage(100.0%)	1	NA	NA
WP_155364782.1|3910514_3911975_-	hypothetical protein	NA	X2KUH8	Vibrio_phage	45.5	7.1e-05
>prophage 219
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3950913	3951834	8027492		Serratia_phage(100.0%)	1	NA	NA
WP_155367399.1|3950913_3951834_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	41.6	1.7e-49
>prophage 220
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3959521	3963190	8027492		Vibrio_phage(50.0%)	3	NA	NA
WP_145045449.1|3959521_3959752_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	49.0	2.7e-07
WP_155364813.1|3959864_3960551_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155364814.1|3960652_3963190_-	AAA domain-containing protein	NA	H6X3M6	Enterobacteria_phage	34.2	3.0e-123
>prophage 221
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3966760	3972584	8027492		Hokovirus(50.0%)	2	NA	NA
WP_155364817.1|3966760_3969727_+	ammonium transporter	NA	A0A1V0SGX0	Hokovirus	31.7	7.1e-60
WP_155364818.1|3970682_3972584_+	hypothetical protein	NA	A6M972	Geobacillus_virus	24.2	9.9e-07
>prophage 222
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3980510	3981935	8027492		Salmonella_phage(100.0%)	1	NA	NA
WP_155364826.1|3980510_3981935_-	hypothetical protein	NA	A0A1S6KZY3	Salmonella_phage	33.9	2.0e-20
>prophage 223
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	3988292	3999639	8027492		Liberibacter_phage(50.0%)	7	NA	NA
WP_155364834.1|3988292_3991544_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.5	7.8e-60
WP_155364835.1|3991536_3992781_-	DUF429 domain-containing protein	NA	NA	NA	NA	NA
WP_155364836.1|3992891_3993770_-	DUF4357 domain-containing protein	NA	NA	NA	NA	NA
WP_155364837.1|3993762_3995085_-	hypothetical protein	NA	A0A2H4PQP5	Staphylococcus_phage	31.8	7.6e-14
WP_155364838.1|3995077_3997645_-	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	36.5	1.4e-75
WP_155364839.1|3997810_3998719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155364840.1|3998934_3999639_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.5	1.6e-39
>prophage 224
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4005475	4005793	8027492		Antheraea_pernyi_nuclear_polyhedrosis_virus(100.0%)	1	NA	NA
WP_155367401.1|4005475_4005793_-	GIY-YIG nuclease family protein	NA	Q1HH24	Antheraea_pernyi_nuclear_polyhedrosis_virus	44.2	4.5e-05
>prophage 225
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4015709	4072454	8027492	capsid,integrase,transposase,protease	Acinetobacter_phage(14.29%)	53	4019753:4019767	4078603:4078617
WP_155364858.1|4015709_4016756_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.0	2.3e-45
WP_155364859.1|4016590_4016908_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155364860.1|4016940_4017324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364861.1|4017400_4018312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155367402.1|4019529_4019817_+	hypothetical protein	NA	NA	NA	NA	NA
4019753:4019767	attL	AGATCTGGATCATCA	NA	NA	NA	NA
WP_155364862.1|4020032_4020986_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155364863.1|4020990_4021464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155364864.1|4021564_4022476_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	30.3	9.5e-32
WP_155364865.1|4022488_4022863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155364866.1|4022970_4023516_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155364867.1|4023544_4023850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364868.1|4024173_4024731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364869.1|4024895_4025696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155364870.1|4025704_4026055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363077.1|4026094_4027249_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	40.6	5.0e-70
WP_155364871.1|4028676_4029075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155364872.1|4029871_4030516_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_155364873.1|4030573_4031371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364874.1|4031367_4033368_-	protein kinase	NA	A0A146JFA3	Tokyovirus	33.5	7.5e-21
WP_149338776.1|4033464_4033689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364875.1|4033745_4034414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145045424.1|4034631_4035438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364876.1|4035640_4036723_-	peptidase M19	NA	NA	NA	NA	NA
WP_155364877.1|4036800_4037286_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_145192907.1|4037337_4037919_-|protease	DJ-1/PfpI/YhbO family deglycase/protease	protease	NA	NA	NA	NA
WP_155364878.1|4038021_4038900_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_155364879.1|4039252_4040383_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	33.9	2.5e-26
WP_155364880.1|4040418_4041090_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155364881.1|4041101_4041926_+	DUF455 family protein	NA	NA	NA	NA	NA
WP_155364882.1|4041950_4042697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155364883.1|4042735_4044250_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_155364884.1|4044299_4047425_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_155364885.1|4047835_4048219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155364886.1|4048389_4048989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155364887.1|4049055_4050159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145192890.1|4050290_4051664_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_155364888.1|4051672_4052200_+	oxidoreductase, 2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_155364889.1|4052512_4052887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155364890.1|4053115_4053775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155364891.1|4053807_4054491_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155364892.1|4054487_4056440_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155364893.1|4056468_4058262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364894.1|4058264_4060400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364895.1|4060408_4063330_-	hypothetical protein	NA	A0A2P1A0R6	Gordonia_phage	39.4	1.1e-07
WP_155364896.1|4063345_4064074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364897.1|4064070_4066023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364898.1|4066735_4067188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364899.1|4067245_4068139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364900.1|4068156_4068609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364901.1|4068811_4069264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364902.1|4069601_4070264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364903.1|4070607_4071120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155364904.1|4071179_4072454_-|capsid	phage major capsid protein	capsid	A0A1B1IQC5	uncultured_Mediterranean_phage	31.0	3.5e-40
4078603:4078617	attR	AGATCTGGATCATCA	NA	NA	NA	NA
>prophage 226
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4082735	4084127	8027492	tRNA	Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_155364911.1|4082735_4084127_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2L2DJX5	Acanthamoeba_polyphaga_mimivirus	39.3	9.0e-90
>prophage 227
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4095410	4104026	8027492		Acanthamoeba_polyphaga_mimivirus(20.0%)	5	NA	NA
WP_155364922.1|4095410_4096355_-	alpha/beta hydrolase fold domain-containing protein	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	30.6	9.9e-32
WP_155364923.1|4096628_4097729_+	chemotaxis-specific protein-glutamate methyltransferase CheB	NA	W8CYM9	Bacillus_phage	39.8	4.1e-05
WP_155364924.1|4098480_4100838_+	response regulator	NA	A0A1V0SGX0	Hokovirus	36.0	3.5e-54
WP_155364925.1|4100839_4101814_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.8	5.7e-43
WP_155364926.1|4102013_4104026_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	30.4	5.0e-25
>prophage 228
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4113916	4114483	8027492		Streptomyces_phage(100.0%)	1	NA	NA
WP_145045324.1|4113916_4114483_+	redoxin domain-containing protein	NA	A0A1J0GW78	Streptomyces_phage	44.7	2.8e-05
>prophage 229
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4124189	4128324	8027492		Cyanophage(33.33%)	5	NA	NA
WP_155364941.1|4124189_4124852_-	transaldolase	NA	M4SK70	Cyanophage	35.5	3.3e-26
WP_155364942.1|4125061_4125910_+	glucosamine-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_155364943.1|4125944_4126655_+	LmbE family protein	NA	NA	NA	NA	NA
WP_155364944.1|4126669_4127788_-	GNAT family N-acetyltransferase	NA	I6S6M4	Nonlabens_phage	39.2	1.3e-54
WP_155364945.1|4127766_4128324_-	hypothetical protein	NA	A0A1B1IN57	uncultured_Mediterranean_phage	44.2	1.3e-26
>prophage 230
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4139176	4140106	8027492		Streptococcus_phage(100.0%)	1	NA	NA
WP_155364955.1|4139176_4140106_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	50.0	1.7e-76
>prophage 231
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4144020	4145184	8027492		Orpheovirus(100.0%)	1	NA	NA
WP_155364957.1|4144020_4145184_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2I2L4R9	Orpheovirus	35.5	6.2e-44
>prophage 232
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4158614	4159289	8027492		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_155364966.1|4158614_4159289_+	thymidylate kinase	NA	G4YAU9	Emiliania_huxleyi_virus	32.4	1.1e-16
>prophage 233
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4168940	4170399	8027492		Staphylococcus_phage(50.0%)	2	NA	NA
WP_145045223.1|4168940_4169552_-	phosphoesterase	NA	A0A060AB76	Staphylococcus_phage	35.4	1.9e-12
WP_155364974.1|4169607_4170399_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	44.1	3.2e-52
>prophage 234
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4188889	4190671	8027492		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_145443124.1|4188889_4190671_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.5	4.1e-63
>prophage 235
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4194789	4197744	8027492		Tetraselmis_virus(50.0%)	3	NA	NA
WP_155364989.1|4194789_4196259_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	24.5	2.3e-11
WP_145192695.1|4196440_4196842_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145443120.1|4196838_4197744_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.4	6.8e-22
>prophage 236
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4206829	4216410	8027492		Moraxella_phage(50.0%)	2	NA	NA
WP_155364996.1|4206829_4207591_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	49.3	2.8e-45
WP_155364997.1|4207944_4216410_+	hypothetical protein	NA	A0A2K9L1M9	Tupanvirus	41.1	3.6e-08
>prophage 237
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4235705	4236212	8027492		Agrobacterium_phage(100.0%)	1	NA	NA
WP_155367408.1|4235705_4236212_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.8	4.2e-13
>prophage 238
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4256665	4257448	8027492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_145192600.1|4256665_4257448_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	1.4e-20
>prophage 239
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4266597	4268406	8027492		Streptococcus_phage(100.0%)	1	NA	NA
WP_145192571.1|4266597_4268406_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.2	4.4e-28
>prophage 240
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4285730	4286480	8027492		Planktothrix_phage(100.0%)	1	NA	NA
WP_155365042.1|4285730_4286480_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.5	5.4e-33
>prophage 241
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4296471	4314026	8027492		Tupanvirus(40.0%)	13	NA	NA
WP_155365048.1|4296471_4297668_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.0	4.0e-14
WP_144980952.1|4297783_4297939_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_155365049.1|4298229_4298661_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_145045005.1|4298836_4299421_+	transcription termination/antitermination factor NusG	NA	A0A291AUL3	Sinorhizobium_phage	23.9	8.3e-05
WP_145192507.1|4299495_4299921_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_145192504.1|4300001_4300706_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_155365050.1|4300787_4301306_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_145443066.1|4301438_4301855_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_155365051.1|4302392_4306106_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	38.1	1.2e-35
WP_145443064.1|4306201_4310569_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	24.9	1.8e-67
WP_002649821.1|4310800_4311172_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_145192489.1|4311268_4311748_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_155365052.1|4311926_4314026_+	elongation factor G	NA	A0A2K9L2P9	Tupanvirus	25.4	6.6e-44
>prophage 242
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4337355	4340120	8027492		Powai_lake_megavirus(50.0%)	2	NA	NA
WP_149338375.1|4337355_4338105_-	ribonuclease III	NA	A0A167RGU4	Powai_lake_megavirus	30.3	1.6e-21
WP_155365065.1|4338614_4340120_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	1.8e-19
>prophage 243
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4357987	4358896	8027492		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_155365081.1|4357987_4358896_-	FAD-dependent thymidylate synthase	NA	A0A0N7KVT4	Yellowstone_lake_phycodnavirus	45.3	1.0e-57
>prophage 244
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4365974	4372042	8027492		Hokovirus(33.33%)	4	NA	NA
WP_155365090.1|4365974_4367657_-	response regulator	NA	A0A1V0SGX0	Hokovirus	34.6	4.0e-44
WP_155365091.1|4367841_4368789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155365092.1|4368766_4369540_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.7	8.4e-21
WP_155365093.1|4371244_4372042_-	SDR family oxidoreductase	NA	A0A0G2Y924	Acanthamoeba_polyphaga_mimivirus	33.3	1.9e-07
>prophage 245
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4393662	4394355	8027492		Planktothrix_phage(100.0%)	1	NA	NA
WP_155365105.1|4393662_4394355_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.6	3.0e-30
>prophage 246
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4409696	4410116	8027492		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
WP_145044797.1|4409696_4410116_-	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	26.7	9.2e-06
>prophage 247
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4414357	4415110	8027492		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_145044787.1|4414357_4415110_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.6	6.9e-20
>prophage 248
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4464674	4469675	8027492		Ostreococcus_tauri_virus(50.0%)	5	NA	NA
WP_155365144.1|4464674_4466051_-	MBL fold metallo-hydrolase	NA	C7U0N7	Ostreococcus_tauri_virus	33.3	6.7e-05
WP_155365145.1|4466068_4466635_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_145192139.1|4466688_4466997_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_155365146.1|4467174_4468089_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_155365147.1|4468157_4469675_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	25.1	9.3e-24
>prophage 249
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4474036	4479760	8027492		Tupanvirus(50.0%)	4	NA	NA
WP_155365150.1|4474036_4475515_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	3.8e-14
WP_155365151.1|4475585_4476893_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_155365152.1|4477202_4477775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365153.1|4477837_4479760_+	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	27.9	9.6e-42
>prophage 250
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4497367	4504460	8027492		Bodo_saltans_virus(50.0%)	4	NA	NA
WP_155365164.1|4497367_4501357_-	ATP-dependent RNA helicase HrpA	NA	A0A2H4UU36	Bodo_saltans_virus	31.1	1.9e-52
WP_155365165.1|4501878_4502796_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_155365166.1|4502915_4503344_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_155365167.1|4503503_4504460_-	alpha/beta hydrolase fold domain-containing protein	NA	A0A068F2G2	Mycobacterium_phage	30.5	4.3e-19
>prophage 251
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4523193	4526218	8027492		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_155365182.1|4523193_4524789_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	29.5	2.9e-28
WP_145044624.1|4525072_4526218_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.3	2.3e-59
>prophage 252
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4537931	4539950	8027492		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_155365192.1|4537931_4539950_+	prolyl oligopeptidase family serine peptidase	NA	A0A2H4JE88	uncultured_Caudovirales_phage	28.4	1.3e-09
>prophage 253
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4555331	4563118	8027492		Tetraselmis_virus(50.0%)	2	NA	NA
WP_155365207.1|4555331_4556756_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.3	1.2e-25
WP_155365208.1|4556965_4563118_+	hypothetical protein	NA	S5W9C6	Leptospira_phage	37.5	6.5e-07
>prophage 254
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4568237	4568810	8027492		Halovirus(100.0%)	1	NA	NA
WP_155365211.1|4568237_4568810_-	dCTP deaminase	NA	R4T945	Halovirus	33.9	2.5e-14
>prophage 255
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4584823	4585996	8027492		Faustovirus(100.0%)	1	NA	NA
WP_155365224.1|4584823_4585996_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7C038	Faustovirus	27.3	5.0e-17
>prophage 256
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4607519	4608824	8027492	protease	Mycobacterium_phage(50.0%)	2	NA	NA
WP_145191798.1|4607519_4608146_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A2P0ZZZ0	Mycobacterium_phage	30.3	2.8e-06
WP_145191795.1|4608218_4608824_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	53.2	5.1e-50
>prophage 257
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4612398	4613406	8027492		Bifidobacterium_phage(100.0%)	1	NA	NA
WP_155365237.1|4612398_4613406_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.3	1.6e-11
>prophage 258
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4624738	4629212	8027492		uncultured_virus(33.33%)	4	NA	NA
WP_155365245.1|4624738_4625863_-	FkbM family methyltransferase	NA	A0A0A0V284	uncultured_virus	26.9	3.1e-08
WP_155365246.1|4625832_4626978_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_155365247.1|4626970_4627936_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	31.8	7.2e-38
WP_155365248.1|4628000_4629212_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	42.3	6.7e-25
>prophage 259
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4647479	4649732	8027492		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_155365261.1|4647479_4649732_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.6	1.9e-20
>prophage 260
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4652757	4653426	8027492		Lactococcus_phage(100.0%)	1	NA	NA
WP_155365264.1|4652757_4653426_-	SGNH/GDSL hydrolase family protein	NA	Q37959	Lactococcus_phage	29.1	4.5e-07
>prophage 261
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4667704	4669294	8027492		Tetraselmis_virus(100.0%)	1	NA	NA
WP_155365276.1|4667704_4669294_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	23.2	7.0e-14
>prophage 262
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4673519	4674818	8027492		Burkholderia_virus(100.0%)	1	NA	NA
WP_155365280.1|4673519_4674818_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.1	5.1e-55
>prophage 263
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4691775	4692366	8027492		Synechococcus_phage(100.0%)	1	NA	NA
WP_145044313.1|4691775_4692366_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.3	5.2e-15
>prophage 264
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4700479	4702933	8027492		Staphylococcus_phage(50.0%)	3	NA	NA
WP_145044304.1|4700479_4700806_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.7	6.4e-15
WP_155365295.1|4701300_4702251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365296.1|4702294_4702933_+	phosphoribosylglycinamide formyltransferase	NA	Q58MV3	Prochlorococcus_phage	30.4	3.5e-17
>prophage 265
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4726580	4727357	8027492		Vibrio_phage(100.0%)	1	NA	NA
WP_145044282.1|4726580_4727357_-	FliA/WhiG family RNA polymerase sigma factor	NA	A0A2I7SAT0	Vibrio_phage	22.7	2.9e-05
>prophage 266
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4747171	4753949	8027492	protease	Ostreococcus_tauri_virus(33.33%)	5	NA	NA
WP_155365320.1|4747171_4749238_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E4WLN5	Ostreococcus_tauri_virus	40.4	5.6e-104
WP_155365321.1|4749234_4749825_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	23.7	3.9e-10
WP_145044266.1|4749845_4750238_-	holo-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
WP_155365322.1|4750499_4752485_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_155365323.1|4752494_4753949_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	24.9	1.3e-09
>prophage 267
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4765143	4771489	8027492		Tetraselmis_virus(50.0%)	2	NA	NA
WP_155367422.1|4765143_4766688_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	56.9	1.4e-163
WP_155365335.1|4767187_4771489_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	30.1	1.6e-44
>prophage 268
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4804897	4806843	8027492		Acanthocystis_turfacea_Chlorella_virus(100.0%)	2	NA	NA
WP_155365352.1|4804897_4805950_-	agmatine deiminase family protein	NA	M1HI51	Acanthocystis_turfacea_Chlorella_virus	31.6	4.6e-46
WP_155365353.1|4805946_4806843_-	acyltransferase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	41.1	2.4e-56
>prophage 269
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4814991	4816599	8027492		Tupanvirus(100.0%)	1	NA	NA
WP_155365360.1|4814991_4816599_+	AMP-binding protein	NA	A0A2K9L3I8	Tupanvirus	21.3	7.6e-16
>prophage 270
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4820631	4821585	8027492		Streptomyces_phage(100.0%)	1	NA	NA
WP_149343900.1|4820631_4821585_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	40.2	1.1e-09
>prophage 271
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4848441	4854728	8027492	tRNA	Vibrio_phage(50.0%)	4	NA	NA
WP_155365381.1|4848441_4851609_+	hypothetical protein	NA	R9TEZ5	Vibrio_phage	31.5	4.5e-12
WP_155365382.1|4851633_4852527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365383.1|4852637_4853345_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_155365384.1|4853351_4854728_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	60.4	1.1e-121
>prophage 272
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4861985	4862480	8027492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_145043994.1|4861985_4862480_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.2	5.3e-29
>prophage 273
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4878854	4880414	8027492		Synechococcus_phage(100.0%)	1	NA	NA
WP_145043963.1|4878854_4880414_-	glucose-6-phosphate dehydrogenase	NA	E3SKF6	Synechococcus_phage	37.8	7.0e-83
>prophage 274
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4894891	4922740	8027492	integrase,transposase	Leptospira_phage(50.0%)	29	4888103:4888117	4906306:4906320
4888103:4888117	attL	GTTCGTCTGCCTGGA	NA	NA	NA	NA
WP_155365406.1|4894891_4896250_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155365407.1|4896318_4898283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365408.1|4898340_4898523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365409.1|4898662_4898974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365410.1|4899280_4900024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365411.1|4900085_4900631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365412.1|4900951_4901143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365413.1|4901081_4901654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365414.1|4901655_4901967_+	DUF1257 domain-containing protein	NA	NA	NA	NA	NA
WP_155365415.1|4902090_4902453_+	DUF1257 domain-containing protein	NA	NA	NA	NA	NA
WP_155365416.1|4904996_4905191_+	DUF2997 domain-containing protein	NA	NA	NA	NA	NA
WP_155367429.1|4905295_4905856_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_155365417.1|4905901_4906813_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	26.6	6.4e-20
4906306:4906320	attR	GTTCGTCTGCCTGGA	NA	NA	NA	NA
WP_155365418.1|4907265_4909101_+	maturase	NA	A0A0U4J920	Pseudomonas_phage	30.4	6.4e-27
WP_155365419.1|4909081_4909804_+	AAA family ATPase	NA	A0A2H4PEN4	Mycobacterium_phage	33.5	1.0e-20
WP_155365420.1|4909826_4910771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365421.1|4910780_4911026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365422.1|4911122_4911338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365423.1|4911542_4911767_+	molybdopterin converting factor	NA	NA	NA	NA	NA
WP_155365424.1|4911887_4912874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155367430.1|4912854_4913454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365425.1|4913450_4914110_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_155365426.1|4914269_4914692_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	50.0	1.0e-20
WP_155365427.1|4914755_4915466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155365428.1|4915657_4916757_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.1	2.5e-47
WP_155365429.1|4916863_4918037_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.0	7.0e-35
WP_155365430.1|4918381_4921063_+	phospholipid carrier-dependent glycosyltransferase	NA	NA	NA	NA	NA
WP_155365429.1|4921204_4922378_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.0	7.0e-35
WP_155365431.1|4922482_4922740_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.3	2.1e-16
>prophage 275
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	4927206	5065167	8027492	integrase,transposase,protease	Liberibacter_phage(14.29%)	106	4959082:4959098	5041799:5041815
WP_155367431.1|4927206_4928691_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	26.2	1.3e-14
WP_155365434.1|4928693_4929488_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	42.1	2.0e-41
WP_155365435.1|4929571_4929949_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155365436.1|4929945_4930212_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155365437.1|4930299_4931402_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.7	2.3e-48
WP_155365438.1|4932270_4932726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155365439.1|4932815_4933990_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	34.2	4.5e-34
WP_155365440.1|4934217_4935336_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_155365441.1|4935319_4936441_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_155365442.1|4936486_4938088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365443.1|4938221_4940147_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	35.7	1.9e-34
WP_155365444.1|4940304_4945665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365445.1|4945917_4946745_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_145043880.1|4947858_4948149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365446.1|4948348_4948525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145043878.1|4948707_4948968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365447.1|4949164_4950658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365448.1|4950809_4952294_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.9	1.7e-14
WP_155365449.1|4952296_4953091_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	42.4	2.6e-41
WP_145043840.1|4953661_4954015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145043838.1|4954240_4954735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145043836.1|4955355_4955580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145043834.1|4955591_4955861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155365450.1|4955939_4956731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145043830.1|4957130_4958363_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
4959082:4959098	attL	CTGTTGATTATCTATTT	NA	NA	NA	NA
WP_145043828.1|4959452_4959629_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155367432.1|4960354_4961338_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145043824.1|4961492_4961897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145043822.1|4962872_4964408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145043820.1|4964411_4965866_+	response regulator	NA	NA	NA	NA	NA
WP_145043818.1|4967751_4968009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145043816.1|4968033_4968288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145043814.1|4969056_4969494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155365451.1|4970004_4970349_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	49.0	2.2e-21
WP_145043810.1|4970563_4970815_-|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.4	7.9e-13
WP_145043808.1|4971805_4972480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145043806.1|4972638_4973787_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_155367433.1|4973993_4974422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145043802.1|4974564_4975377_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0F7L647	uncultured_marine_virus	35.5	2.6e-28
WP_145046504.1|4976096_4976153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155365452.1|4976290_4978342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155365453.1|4978563_4980018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145046502.1|4982042_4985285_+	DUF87 domain-containing protein	NA	A0A0A0RUH6	Bacillus_phage	30.1	8.1e-33
WP_145043786.1|4986305_4986947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145043784.1|4987437_4988793_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_145043782.1|4988866_4990204_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_145043780.1|4990526_4991642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145043779.1|4991821_4993390_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155365454.1|4993718_4995110_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155365455.1|4995330_4998768_-	DEAD/DEAH box helicase	NA	A0A2H4UVG1	Bodo_saltans_virus	21.7	7.5e-13
WP_155365456.1|4998777_4999659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155365457.1|4999709_5002601_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	41.6	7.3e-219
WP_155365458.1|5002590_5003823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155365459.1|5003819_5005328_-	N-6 DNA methylase	NA	A0A220A2U5	Liberibacter_phage	55.7	2.8e-145
WP_155365460.1|5005324_5006296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155365461.1|5006606_5008118_-	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	55.7	6.2e-153
WP_155365462.1|5008529_5009435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145043935.1|5010927_5012151_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_145043933.1|5012147_5013017_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	32.9	1.4e-32
WP_155365463.1|5013500_5014073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365464.1|5014074_5014452_+	DUF1257 domain-containing protein	NA	NA	NA	NA	NA
WP_155365465.1|5014438_5014633_+	DUF2997 domain-containing protein	NA	NA	NA	NA	NA
WP_155367434.1|5014737_5015298_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_155365466.1|5015343_5016840_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	29.4	2.8e-49
WP_155365467.1|5016862_5017810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365468.1|5017819_5018065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365469.1|5018161_5018377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365470.1|5018591_5018816_+	molybdopterin converting factor	NA	NA	NA	NA	NA
WP_155365471.1|5018906_5019923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365472.1|5019942_5020503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365473.1|5020499_5021165_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_155365474.1|5021192_5022629_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155365475.1|5022755_5024099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365476.1|5024788_5025046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365477.1|5025258_5026479_+	hypothetical protein	NA	A0A0K2CNN5	Brevibacillus_phage	25.2	2.5e-19
WP_155365478.1|5026561_5027626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365479.1|5028456_5029824_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_155365480.1|5029902_5030830_+|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	26.3	7.5e-08
WP_155365481.1|5031202_5032264_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155365482.1|5032309_5032687_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155365483.1|5032687_5033731_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_155365484.1|5033808_5034120_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155365485.1|5034941_5035208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155365486.1|5036004_5036541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365487.1|5036794_5037049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155365488.1|5037102_5038530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155365489.1|5038681_5040091_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_155365490.1|5040089_5040488_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	42.5	1.5e-18
WP_145187196.1|5040747_5041218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155365491.1|5044857_5046735_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
5041799:5041815	attR	AAATAGATAATCAACAG	NA	NA	NA	NA
WP_145187188.1|5048575_5049133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145187185.1|5049575_5050403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145187182.1|5050777_5051068_+	glycoside hydrolase family 13	NA	NA	NA	NA	NA
WP_145187179.1|5051181_5051631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365492.1|5051968_5053231_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_155365493.1|5053545_5054907_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_155365494.1|5055107_5056019_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_155365495.1|5056054_5057635_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_155365496.1|5057701_5058760_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155365497.1|5059772_5060873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155365498.1|5060869_5061124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155365499.1|5061137_5061326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155367435.1|5061531_5061921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155365500.1|5062711_5063224_-	response regulator	NA	NA	NA	NA	NA
WP_155365501.1|5063652_5064000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365502.1|5064432_5065167_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	39.9	6.1e-29
>prophage 276
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5077411	5079520	8027492		uncultured_virus(100.0%)	1	NA	NA
WP_155365514.1|5077411_5079520_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.4	1.7e-60
>prophage 277
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5085920	5091534	8027492	transposase	Acinetobacter_phage(50.0%)	3	NA	NA
WP_155364858.1|5085920_5086967_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.0	2.3e-45
WP_155364859.1|5086801_5087119_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155365522.1|5087586_5091534_+	protein kinase	NA	A0A146JFA3	Tokyovirus	26.9	1.1e-18
>prophage 278
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5112279	5119442	8027492		Tupanvirus(33.33%)	4	NA	NA
WP_155365536.1|5112279_5113677_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	25.6	7.0e-18
WP_155365537.1|5113838_5114003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155365538.1|5114283_5115366_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	32.5	3.5e-09
WP_155365539.1|5115362_5119442_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	26.6	2.6e-65
>prophage 279
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5127198	5130639	8027492		Leptospira_phage(100.0%)	1	NA	NA
WP_155365544.1|5127198_5130639_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	23.7	9.1e-51
>prophage 280
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5149509	5150202	8027492		Planktothrix_phage(100.0%)	1	NA	NA
WP_155365558.1|5149509_5150202_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.6	8.0e-31
>prophage 281
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5161289	5165156	8027492		Leptospira_phage(100.0%)	1	NA	NA
WP_155365568.1|5161289_5165156_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	26.6	4.5e-06
>prophage 282
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5186093	5187065	8027492		Indivirus(100.0%)	1	NA	NA
WP_155365581.1|5186093_5187065_-	cation diffusion facilitator family transporter	NA	A0A1V0SED0	Indivirus	31.0	2.1e-08
>prophage 283
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5191767	5194893	8027492		Synechococcus_phage(100.0%)	1	NA	NA
WP_155365585.1|5191767_5194893_-	DUF3427 domain-containing protein	NA	G8EY40	Synechococcus_phage	30.1	5.8e-28
>prophage 284
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5201968	5202778	8027492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_155365590.1|5201968_5202778_-	hypothetical protein	NA	A0A173GBD0	Staphylococcus_phage	28.2	3.0e-13
>prophage 285
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5222065	5223588	8027492		Lactococcus_phage(50.0%)	2	NA	NA
WP_145043521.1|5222065_5222263_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	44.4	2.5e-06
WP_155365601.1|5222352_5223588_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	48.6	4.9e-116
>prophage 286
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5256872	5258015	8027492		Pandoravirus(100.0%)	1	NA	NA
WP_155365626.1|5256872_5258015_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.8	1.1e-82
>prophage 287
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5265389	5272721	8027492		uncultured_virus(60.0%)	5	NA	NA
WP_145190558.1|5265389_5266526_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	2.2e-25
WP_155365632.1|5266701_5268321_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	55.3	3.9e-161
WP_145312224.1|5268482_5268773_-	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	46.7	1.0e-16
WP_145442577.1|5268913_5270620_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	54.6	1.2e-149
WP_155367441.1|5271362_5272721_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	42.0	5.1e-74
>prophage 288
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5277145	5281116	8027492		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_155365636.1|5277145_5278552_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	29.8	8.1e-22
WP_155365637.1|5278752_5279121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365638.1|5279387_5279735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365639.1|5280330_5281116_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	30.4	1.1e-25
>prophage 289
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5309828	5310851	8027492		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_155365667.1|5309828_5310851_-	carbon-nitrogen hydrolase family protein	NA	M1H2P4	Paramecium_bursaria_Chlorella_virus	27.6	3.1e-07
>prophage 290
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5328115	5330377	8027492		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_155365684.1|5328115_5329300_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	27.8	2.8e-36
WP_145190381.1|5329345_5330377_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	66.7	4.5e-14
>prophage 291
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5334112	5338038	8027492		Cafeteria_roenbergensis_virus(50.0%)	3	NA	NA
WP_149344159.1|5334112_5334955_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	4.8e-46
WP_155365688.1|5334994_5335891_-	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_155365689.1|5336307_5338038_+	response regulator	NA	W8CYM9	Bacillus_phage	30.7	2.4e-07
>prophage 292
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5343182	5347493	8027492		Oenococcus_phage(50.0%)	4	NA	NA
WP_155365694.1|5343182_5344400_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	28.7	1.1e-35
WP_155365695.1|5344429_5345902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155367443.1|5346001_5346817_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155365696.1|5346824_5347493_+	RraA family protein	NA	E3T536	Cafeteria_roenbergensis_virus	24.0	4.2e-13
>prophage 293
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5354747	5355557	8027492		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_155365703.1|5354747_5355557_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1J0F996	Only_Syngen_Nebraska_virus	30.8	8.8e-05
>prophage 294
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5361238	5362147	8027492		Microcystis_virus(100.0%)	1	NA	NA
WP_155367445.1|5361238_5362147_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	36.4	1.4e-27
>prophage 295
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5366413	5367841	8027492		Tetraselmis_virus(100.0%)	1	NA	NA
WP_155365713.1|5366413_5367841_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	29.0	3.7e-38
>prophage 296
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5378314	5386354	8027492		uncultured_virus(25.0%)	6	NA	NA
WP_155365718.1|5378314_5380714_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.9	2.9e-96
WP_155365719.1|5380715_5381582_-	alpha/beta hydrolase fold domain-containing protein	NA	G1FGF0	Mycobacterium_phage	31.5	8.2e-17
WP_155365720.1|5381832_5383605_+	hypothetical protein	NA	A0A1B1IVF2	uncultured_Mediterranean_phage	33.1	3.8e-69
WP_155365721.1|5384075_5384300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365722.1|5384573_5385119_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_155365723.1|5385115_5386354_+	sulfatase-like hydrolase/transferase	NA	A0A1V0SA98	Catovirus	23.7	3.5e-05
>prophage 297
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5428097	5428640	8027492		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_145043160.1|5428097_5428640_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	42.6	1.2e-29
>prophage 298
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5442779	5445458	8027492		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_155365755.1|5442779_5445458_-	HAD-IC family P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	30.0	2.9e-84
>prophage 299
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5453007	5457996	8027492	tRNA	Synechococcus_phage(50.0%)	4	NA	NA
WP_155365760.1|5453007_5453985_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	35.1	4.3e-30
WP_145043124.1|5454258_5454468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365761.1|5454742_5456488_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_145190109.1|5456715_5457996_+|tRNA	serine--tRNA ligase	tRNA	A0A2K9L088	Tupanvirus	36.6	7.8e-64
>prophage 300
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5470737	5472078	8027492		Bacillus_virus(100.0%)	1	NA	NA
WP_155365769.1|5470737_5472078_-	AAA family ATPase	NA	G3MBE0	Bacillus_virus	46.4	7.8e-99
>prophage 301
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5492172	5501476	8027492		Tetraselmis_virus(25.0%)	8	NA	NA
WP_155367452.1|5492172_5493585_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.7	1.2e-36
WP_145043063.1|5493705_5494329_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_145043061.1|5494537_5495143_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_155365786.1|5495441_5496509_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_145043057.1|5496534_5497530_-	NAD(+) synthase	NA	A0A222YW38	Synechococcus_phage	27.6	3.1e-12
WP_155365787.1|5497620_5499177_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	29.3	2.5e-40
WP_155365788.1|5499195_5499453_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_155365789.1|5499502_5501476_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A0N9QYX6	Chrysochromulina_ericina_virus	28.2	1.6e-28
>prophage 302
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5508523	5510287	8027492		Vibrio_phage(100.0%)	1	NA	NA
WP_155365792.1|5508523_5510287_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2I7SAT0	Vibrio_phage	30.8	1.1e-31
>prophage 303
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5553059	5554661	8027492		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_155367455.1|5553059_5554661_+	AarF/ABC1/UbiB kinase family protein	NA	A9YVW0	Ostreococcus_tauri_virus	28.6	1.8e-38
>prophage 304
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5571569	5573003	8027492		Catovirus(100.0%)	1	NA	NA
WP_155365825.1|5571569_5573003_+	sulfatase-like hydrolase/transferase	NA	A0A1V0SA98	Catovirus	24.7	1.3e-14
>prophage 305
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5595193	5599352	8027492		Flavobacterium_phage(50.0%)	5	NA	NA
WP_145042922.1|5595193_5595946_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	45.3	1.3e-26
WP_155365839.1|5595952_5596861_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_155365840.1|5596797_5597448_-	uridylate kinase	NA	NA	NA	NA	NA
WP_149339647.1|5597490_5598369_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_145189810.1|5598737_5599352_+	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	44.2	2.0e-25
>prophage 306
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5612262	5614071	8027492		unidentified_phage(100.0%)	1	NA	NA
WP_155365846.1|5612262_5614071_+	signal peptide peptidase SppA	NA	H7BUS5	unidentified_phage	23.4	7.2e-07
>prophage 307
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5618186	5625158	8027492		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_155365850.1|5618186_5625158_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	46.8	5.2e-255
>prophage 308
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5650772	5651642	8027492		Enterobacteria_phage(100.0%)	1	NA	NA
WP_155365867.1|5650772_5651642_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.1	9.2e-101
>prophage 309
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5659010	5668737	8027492		Caulobacter_phage(14.29%)	10	NA	NA
WP_155365873.1|5659010_5659604_-	SIS domain-containing protein	NA	A0A067XQR2	Caulobacter_phage	34.0	8.1e-16
WP_155365874.1|5659632_5660385_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.3	1.3e-07
WP_155365875.1|5660386_5661178_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_155365876.1|5661688_5663164_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.4	4.1e-109
WP_155365877.1|5663214_5665206_+	NAD(+) synthase	NA	A0A2L0UZF5	Agrobacterium_phage	23.2	2.7e-23
WP_155365878.1|5665299_5665989_+	NUDIX domain-containing protein	NA	A0A0E3JJF3	Streptomyces_phage	43.8	1.0e-17
WP_155365879.1|5665992_5667045_+	ADP-ribosylglycohydrolase	NA	NA	NA	NA	NA
WP_155367458.1|5667061_5667658_+	bifunctional nicotinamidase/pyrazinamidase	NA	NA	NA	NA	NA
WP_155365880.1|5667717_5668263_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	44.7	7.9e-42
WP_155365881.1|5668269_5668737_-	DUF1768 domain-containing protein	NA	A0A141ZK81	Faustovirus	49.0	9.8e-33
>prophage 310
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5678246	5679056	8027492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_155365892.1|5678246_5679056_-	hypothetical protein	NA	A0A220BY94	Staphylococcus_phage	32.3	1.5e-12
>prophage 311
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5700797	5706280	8027492		Shearwaterpox_virus(50.0%)	4	NA	NA
WP_155365906.1|5700797_5702291_-	deoxyribodipyrimidine photolyase	NA	A0A1V0QGF2	Shearwaterpox_virus	31.9	2.9e-62
WP_155367461.1|5702318_5703533_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_155365907.1|5704007_5704229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155365908.1|5704120_5706280_+	sulfate transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.8	1.3e-15
>prophage 312
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5720394	5721300	8027492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_145042727.1|5720394_5721300_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	1.2e-29
>prophage 313
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5725292	5728920	8027492		Caulobacter_phage(50.0%)	2	NA	NA
WP_155365921.1|5725292_5727212_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	34.3	1.1e-45
WP_155365922.1|5727237_5728920_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.4	1.7e-34
>prophage 314
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5751495	5753358	8027492		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_155365939.1|5751495_5753358_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A0A1J0F994	Only_Syngen_Nebraska_virus	38.7	7.0e-106
>prophage 315
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5800210	5801785	8027492		Hokovirus(100.0%)	1	NA	NA
WP_155367464.1|5800210_5801785_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.4e-22
>prophage 316
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5807321	5824777	8027492		Mycobacterium_phage(50.0%)	2	NA	NA
WP_155365970.1|5807321_5817188_+	hypothetical protein	NA	A0A1L6BXR0	Mycobacterium_phage	29.0	2.2e-12
WP_155365971.1|5817259_5824777_+	hypothetical protein	NA	F5B3R2	Synechococcus_phage	40.2	3.3e-61
>prophage 317
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5838625	5844692	8027492		Bacillus_phage(50.0%)	4	NA	NA
WP_155365980.1|5838625_5840755_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	26.7	5.3e-41
WP_155365981.1|5841103_5842558_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_155365982.1|5842570_5843416_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_155365983.1|5843309_5844692_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.3	2.4e-50
>prophage 318
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5857457	5858945	8027492		Phormidium_phage(100.0%)	1	NA	NA
WP_155365991.1|5857457_5858945_-	AAA family ATPase	NA	U5XJW0	Phormidium_phage	34.5	2.0e-79
>prophage 319
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5891911	5894110	8027492		Orpheovirus(100.0%)	1	NA	NA
WP_155366010.1|5891911_5894110_+	protein kinase	NA	A0A2I2L4T9	Orpheovirus	28.8	1.2e-08
>prophage 320
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5898803	5899757	8027492		Acidianus_two-tailed_virus(100.0%)	1	NA	NA
WP_145193871.1|5898803_5899757_-	AAA domain-containing protein	NA	A0A1C9EGB9	Acidianus_two-tailed_virus	26.9	5.3e-09
>prophage 321
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5911119	5912040	8027492		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_155366019.1|5911119_5912040_+	ornithine carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	29.1	1.3e-20
>prophage 322
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5921463	5922363	8027492		Salmonella_phage(100.0%)	1	NA	NA
WP_155366024.1|5921463_5922363_+	DNA methyltransferase	NA	H2EQJ0	Salmonella_phage	38.6	3.8e-09
>prophage 323
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5938679	5942367	8027492		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_155366038.1|5938679_5939018_-	hypothetical protein	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	41.8	2.5e-09
WP_155366039.1|5939122_5939605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366040.1|5939698_5941579_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_155366041.1|5941572_5942367_-	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	35.5	1.2e-06
>prophage 324
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5948774	5950835	8027492		Thermus_phage(100.0%)	1	NA	NA
WP_155366048.1|5948774_5950835_+	serine protein kinase	NA	F9VHR5	Thermus_phage	31.5	1.1e-75
>prophage 325
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5961339	5962704	8027492	protease	Erwinia_phage(100.0%)	1	NA	NA
WP_145042484.1|5961339_5962704_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	28.8	2.8e-43
>prophage 326
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	5999378	6005783	8027492		Bacillus_phage(33.33%)	4	NA	NA
WP_155366071.1|5999378_6001103_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	29.8	9.6e-25
WP_145442060.1|6001193_6001955_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_155366072.1|6002349_6003324_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2K9L0I7	Tupanvirus	45.2	1.9e-70
WP_155366073.1|6003410_6005783_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	31.6	7.2e-23
>prophage 327
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6028510	6035241	8027492		Only_Syngen_Nebraska_virus(50.0%)	4	NA	NA
WP_155366089.1|6028510_6029479_-	C-terminal binding protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.0	1.0e-23
WP_155366090.1|6029824_6030316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155366091.1|6030463_6031939_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_155366092.1|6032007_6035241_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	25.1	2.1e-81
>prophage 328
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6047339	6049249	8027492		Tupanvirus(50.0%)	2	NA	NA
WP_155366101.1|6047339_6048083_+	NTP transferase domain-containing protein	NA	A0A2K9L4K9	Tupanvirus	32.8	9.8e-27
WP_145042428.1|6048301_6049249_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.2	1.5e-48
>prophage 329
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6055409	6057374	8027492	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_155366106.1|6055409_6057374_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	32.1	3.2e-77
>prophage 330
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6062504	6063566	8027492		Streptococcus_phage(100.0%)	1	NA	NA
WP_155366108.1|6062504_6063566_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	27.9	5.2e-13
>prophage 331
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6068320	6069844	8027492		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_155366112.1|6068320_6069844_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	34.9	2.2e-12
>prophage 332
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6074259	6074754	8027492		Salmonella_phage(100.0%)	1	NA	NA
WP_155366115.1|6074259_6074754_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	46.5	1.0e-27
>prophage 333
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6089058	6091239	8027492	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_155366126.1|6089058_6091239_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.1	1.1e-123
>prophage 334
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6103887	6111123	8027492		Bacillus_virus(25.0%)	9	NA	NA
WP_155366135.1|6103887_6105606_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.4	2.2e-21
WP_155366136.1|6105799_6106087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155366137.1|6106155_6107418_+	limonene hydroxylase	NA	NA	NA	NA	NA
WP_155366138.1|6107423_6108668_+	serpin family protein	NA	Q8V3F1	Swinepox_virus	26.9	6.2e-26
WP_155366139.1|6108664_6109096_-	protein phosphatase	NA	NA	NA	NA	NA
WP_145441943.1|6109118_6109343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145042380.1|6109667_6109850_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_149339041.1|6109853_6110069_-	DUF1653 domain-containing protein	NA	A0A0K2FMI5	Brevibacillus_phage	35.8	9.4e-07
WP_155366140.1|6110094_6111123_-	fructose-bisphosphate aldolase class I	NA	A0A0K0KVJ8	Prochlorococcus_phage	47.0	1.1e-71
>prophage 335
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6116159	6117089	8027492		Bacillus_phage(100.0%)	1	NA	NA
WP_155366145.1|6116159_6117089_-	UV DNA damage repair endonuclease UvsE	NA	A0A127AW32	Bacillus_phage	37.2	2.4e-38
>prophage 336
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6120308	6135465	8027492		Staphylococcus_phage(25.0%)	15	NA	NA
WP_145188815.1|6120308_6120728_+	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	43.2	5.0e-20
WP_155367476.1|6120756_6121248_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_155366150.1|6121250_6121988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366151.1|6122277_6123042_-	nucleotidyltransferase	NA	K4K696	Caulobacter_phage	39.2	3.1e-07
WP_155366152.1|6123038_6123989_-	nucleotidyltransferase domain-containing protein	NA	A0A1J0GW18	Streptomyces_phage	34.6	1.5e-19
WP_155366153.1|6124023_6126624_-	polynucleotide kinase-phosphatase	NA	A0A2L0UZN4	Agrobacterium_phage	26.6	1.8e-27
WP_155366154.1|6126723_6128139_-	3' terminal RNA ribose 2'-O-methyltransferase Hen1	NA	NA	NA	NA	NA
WP_155366155.1|6128166_6129279_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_155366156.1|6129275_6130016_-	DNA ligase	NA	W0TW99	Staphylococcus_phage	29.2	1.6e-08
WP_145042354.1|6130204_6130372_-	nucleic acid-binding protein	NA	V5LQX0	Emiliania_huxleyi_virus	64.3	4.0e-05
WP_155367477.1|6130493_6131027_-	phosphoprotein phosphatase	NA	NA	NA	NA	NA
WP_155366157.1|6131347_6132568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155366158.1|6132614_6133376_-	guanylyltransferase	NA	A0A0K2D0E0	Bacillus_phage	33.0	4.5e-19
WP_155366159.1|6133365_6133812_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_155366160.1|6134046_6135465_+	hypothetical protein	NA	M4HP54	Bacillus_phage	35.6	4.8e-06
>prophage 337
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6183748	6184852	8027492		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_155366200.1|6183748_6184852_-	NAD-dependent epimerase/dehydratase family protein	NA	Q58M85	Prochlorococcus_phage	25.0	3.7e-06
>prophage 338
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6221687	6223634	8027492		Moumouvirus(100.0%)	1	NA	NA
WP_155366228.1|6221687_6223634_-	protein kinase	NA	A0A2P1EMR8	Moumouvirus	27.5	2.3e-19
>prophage 339
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6232595	6234623	8027492		Pandoravirus(100.0%)	1	NA	NA
WP_155366232.1|6232595_6234623_+	protein kinase	NA	S4VV57	Pandoravirus	32.8	2.9e-20
>prophage 340
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6239030	6240773	8027492		Bacillus_virus(100.0%)	1	NA	NA
WP_155366238.1|6239030_6240773_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.6	1.3e-21
>prophage 341
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6247952	6251132	8027492		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_155366242.1|6247952_6251132_+	DUF1553 domain-containing protein	NA	A0A1B1INW8	uncultured_Mediterranean_phage	30.5	1.2e-07
>prophage 342
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6255227	6256763	8027492		Tetraselmis_virus(100.0%)	1	NA	NA
WP_155367482.1|6255227_6256763_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	41.6	2.2e-105
>prophage 343
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6261050	6262160	8027492		Tupanvirus(100.0%)	1	NA	NA
WP_155366248.1|6261050_6262160_-	histone deacetylase	NA	A0A2K9L2T7	Tupanvirus	36.0	1.5e-47
>prophage 344
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6265344	6325807	8027492	integrase,protease,transposase	Burkholderia_phage(25.0%)	38	6257796:6257813	6338415:6338432
6257796:6257813	attL	AGCTGTTCTGCTCGCCTG	NA	NA	NA	NA
WP_155366253.1|6265344_6266913_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155366254.1|6267092_6268202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155366255.1|6268662_6269661_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_145188233.1|6269611_6270064_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145188230.1|6270229_6270463_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_145188227.1|6270507_6271641_+	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_155366256.1|6271656_6273222_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_155366257.1|6273419_6274757_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_155366258.1|6274830_6276186_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_155366259.1|6276857_6277376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366260.1|6277671_6278547_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_155366261.1|6278632_6278956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366262.1|6279224_6283508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366263.1|6284000_6284876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366264.1|6285484_6285715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366265.1|6285734_6286595_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_155366266.1|6286893_6287214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366267.1|6287711_6288617_-	hypothetical protein	NA	K4NXB8	Burkholderia_phage	27.5	9.8e-05
WP_155366268.1|6288629_6289547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366269.1|6290657_6292406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366270.1|6292458_6294039_-	DUF2723 domain-containing protein	NA	NA	NA	NA	NA
WP_155366271.1|6294192_6295788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366272.1|6295855_6297832_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	35.4	5.4e-32
WP_155366273.1|6297908_6302738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366274.1|6302890_6303745_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_155366275.1|6304137_6305229_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_155366276.1|6305218_6306337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155367483.1|6306580_6306682_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155366277.1|6307827_6308487_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_155367484.1|6308461_6311026_+	protein kinase	NA	A0A146JFA3	Tokyovirus	27.2	3.5e-15
WP_155366278.1|6313145_6314444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155366279.1|6314436_6315069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155366280.1|6315072_6316146_+	DUF1573 domain-containing protein	NA	NA	NA	NA	NA
WP_155366281.1|6316209_6316644_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.3	2.7e-24
WP_155366282.1|6316738_6317071_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155366283.1|6318208_6322243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366284.1|6322305_6324264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366285.1|6325441_6325807_-|transposase	transposase	transposase	NA	NA	NA	NA
6338415:6338432	attR	AGCTGTTCTGCTCGCCTG	NA	NA	NA	NA
>prophage 345
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6336360	6403918	8027492	integrase,transposase	Paenibacillus_phage(33.33%)	53	6344609:6344668	6377332:6378705
WP_145042236.1|6336360_6337245_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	18.9	1.3e-06
WP_155366292.1|6337681_6338254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155366293.1|6338919_6339096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366294.1|6339670_6339847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366295.1|6339918_6340203_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155366296.1|6341276_6344666_-	hypothetical protein	NA	NA	NA	NA	NA
6344609:6344668	attL	TGATAAAGCAACAAACATTCTGTAAATTTCCGGGGCCTTCGGTCTCTGTGATCAGCATTA	NA	NA	NA	NA
WP_155363077.1|6344665_6345820_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	40.6	5.0e-70
WP_155366297.1|6345970_6348958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366298.1|6349382_6350825_-	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	M4QSA2	Synechococcus_phage	39.5	7.3e-18
WP_155366299.1|6350863_6353056_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155366300.1|6352997_6353795_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155366301.1|6353656_6355276_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155367485.1|6355269_6356271_-	ADP-heptose--LPS heptosyltransferase	NA	NA	NA	NA	NA
WP_145043900.1|6356814_6357354_-	iron-sulfur cluster assembly scaffold protein	NA	NA	NA	NA	NA
WP_145043902.1|6357468_6358368_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_155366302.1|6358364_6359255_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_155366303.1|6360919_6361282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366304.1|6361872_6362532_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_155367486.1|6362528_6363119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366305.1|6363108_6364125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366306.1|6364214_6364439_-	molybdopterin converting factor	NA	NA	NA	NA	NA
WP_145043917.1|6364644_6364860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145043919.1|6364956_6365202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145043921.1|6365211_6366147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145043923.1|6366178_6367675_-	AAA family ATPase	NA	U5XJW0	Phormidium_phage	29.0	3.1e-48
WP_155366307.1|6367719_6368367_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_145043927.1|6368384_6368579_-	DUF2997 domain-containing protein	NA	NA	NA	NA	NA
WP_155366308.1|6368575_6368944_-	DUF1257 domain-containing protein	NA	NA	NA	NA	NA
WP_145043931.1|6368945_6369518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145043933.1|6370001_6370871_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	32.9	1.4e-32
WP_145043935.1|6370867_6372091_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_145188126.1|6372460_6372643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145043937.1|6372700_6374665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366309.1|6374733_6375981_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155363077.1|6376179_6377334_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	40.6	5.0e-70
WP_145190855.1|6378541_6378931_+	hypothetical protein	NA	NA	NA	NA	NA
6377332:6378705	attR	TAATGCTGATCACAGAGACCGAAGGCCCCGGAAATTTACAGAATGTTTGTTGCTTTATCAAGATACCAGGCACCGTGATGCAGATAGTACGAAACGCGCCCAACGCGTTTGCGTTGGGCAGACTTCTTGCGTCGTCTCATCAAAACCTCCTGTGCACACTGTGTGCACCAACTGTGCACCAGGGGGTTTATTACGACGCGCAAAAAACAACGCTAAGCTATTGAATTCAATAACTTAGCGCGTTTGGTCAGTTTGAAAAGCGGAGAGAGGGGGATTCTCTGACCGCTGAATTGTTGCCGGGTTTCCCATGTGTTTGAGACTATAATAATAGACTTATTCTATCAAACGTCAAGAACTTTTATCAGGAATTAATTCATTTAAGGCAAAAACGAATGCCACAAAACTGCCACAAATATTATGAGCAACTTGATAGTATAGTAGAACCACTCTCTCGCCAGCTATGACCGGTTGGCCGTGCGCAGTTCGTTATCTCCAACAGTGAATTCATCCCGAAATCAATTTCCCAATATGGAAGAGTCATTTCAGACGGTGATGATTCACTGTGTTTCGTTGCCGAACGGACTGCATTTTTCTCAGGCGTGAGAACTCGCGCAACAATATCAGGATTTCATAATAAACAGCACAGTCGGTTCATTATTAATTGCTATTTACTTTAGTTGTTTGTTGAATTATGCAGAGTCCCCAGTACTGCAACAATGCAAACATCAAAACAATATCTGCTAAGATTGATACTACCCAATTACCAGTCGAGTTAAGAGTTGCGATAGCCCAAGACTGGCGGACTCCCAAAGAGTGAATTATGCGGCCAGTTATTGAGTGTATATTCTCTCGAACTGGTCGGGACATTGATAGTTTAATGTTTGATGTAAACGTTTTGAATTGTAGAACGTTTCGATGTAGCGGAACAGGGCCGAATGTTTTCGCTTGCGATTATAAATCGTTTCGATGTAGACAAAGACGCTCAATCGCGCTGTCTGACGAGTTGTGTACCGTTTGGCCAACTCGCGCACCTCCCCCAAGGATAGTCGTTCAGGATCATAGTGGATGCAAATTTGGTCCTGACTCATGCCCTTGTTGTCCGTCGCATGGGTGGTCTCGATCCCTTCCTTTGTGTCCTTCCGGTAAGCGTGCATGATTGTTTTTTTAAATTCTGCTATCGTGAGCGGTTTCTCTTTTCAGGAGGTCGGCGATGGCGAATCAGAATCAGCGTGCACTGCCCCCGGATCTGGCCAGGGTTCGGGAGCGACTGGCGGCGTGGCGGCAGACAAAACAGCCCGGGGCGCGGATTCCCGCCCCCTTGTGGAAAATGGCGGTCAGGCTGGCTGGCAAATATGGTGTGACACGCACCGCTCG	NA	NA	NA	NA
WP_155366310.1|6378822_6379293_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_145190861.1|6379171_6381052_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_145190864.1|6381378_6383853_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_145190867.1|6384748_6386368_-	TolC family protein	NA	NA	NA	NA	NA
WP_145190870.1|6387248_6387458_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145190873.1|6388040_6389018_-	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	NA	NA	NA	NA
WP_145190876.1|6389477_6391619_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145190879.1|6391615_6393202_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_145190882.1|6393724_6394255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145190885.1|6394525_6394729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145190888.1|6394828_6398038_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	25.6	1.5e-79
WP_145190890.1|6398050_6399526_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155366311.1|6400800_6401955_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	40.6	2.2e-70
WP_145190896.1|6402185_6402914_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_145193907.1|6402832_6403093_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	59.0	6.0e-16
WP_145190900.1|6403343_6403844_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145190903.1|6403756_6403918_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 346
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6406941	6451051	8027492	integrase,transposase	Streptococcus_phage(50.0%)	37	6417503:6417517	6453263:6453277
WP_145190912.1|6406941_6409398_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	42.2	4.1e-130
WP_145190915.1|6410538_6411060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145193908.1|6411341_6411764_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_145193909.1|6411678_6412089_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
WP_145190918.1|6412187_6414299_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	39.8	3.1e-134
WP_145190921.1|6414653_6414998_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_145193910.1|6415415_6415745_-	RND transporter	NA	NA	NA	NA	NA
WP_145190924.1|6415824_6419031_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
6417503:6417517	attL	TTTTCTTGGATGTTT	NA	NA	NA	NA
WP_145190927.1|6419042_6420716_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002648756.1|6421508_6421844_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155366312.1|6421795_6422239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145190933.1|6422845_6423538_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.5	3.0e-30
WP_145190936.1|6423542_6424763_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_145190939.1|6424796_6425582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145193911.1|6426692_6427025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145190941.1|6427076_6427706_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145190944.1|6427975_6428377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145193912.1|6428431_6428884_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145190947.1|6429044_6429461_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_145190950.1|6430188_6430842_+	response regulator	NA	NA	NA	NA	NA
WP_145190953.1|6430819_6432337_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_145190956.1|6432430_6435538_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VL66	Leptospira_phage	20.2	1.8e-26
WP_145190959.1|6436329_6438819_+	spermidine synthase	NA	NA	NA	NA	NA
WP_145190962.1|6438815_6439088_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_145190965.1|6439126_6440701_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_145190968.1|6440891_6441251_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.3	2.1e-14
WP_145190971.1|6441138_6441504_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145190973.1|6441525_6441687_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155366313.1|6442814_6443564_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	30.7	2.6e-11
WP_155366314.1|6443579_6444125_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155366315.1|6444693_6445170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366316.1|6445271_6445928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366317.1|6446013_6447246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366318.1|6447238_6447502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366319.1|6447987_6448668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366320.1|6448769_6449315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366321.1|6449500_6451051_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
6453263:6453277	attR	TTTTCTTGGATGTTT	NA	NA	NA	NA
>prophage 347
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6455357	6456854	8027492		Phormidium_phage(100.0%)	1	NA	NA
WP_155366328.1|6455357_6456854_-	AAA family ATPase	NA	U5XJW0	Phormidium_phage	29.6	2.2e-49
>prophage 348
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6481704	6526425	8027492	integrase,transposase	Wolbachia_phage(20.0%)	40	6490831:6490844	6506747:6506760
WP_155366349.1|6481704_6482295_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	43.9	1.7e-34
WP_155366350.1|6482288_6482636_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_155366351.1|6483256_6484465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366352.1|6484886_6485102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155366353.1|6485102_6485354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155366354.1|6485714_6486371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366355.1|6487117_6488167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155366356.1|6488118_6489327_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155366357.1|6489380_6492152_+	methyltransferase domain-containing protein	NA	M4T0F5	Cyanophage	25.8	1.1e-06
6490831:6490844	attL	ATCTGGATCAAATC	NA	NA	NA	NA
WP_155366358.1|6492609_6493533_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	31.1	3.4e-21
WP_155366359.1|6493536_6494043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155366360.1|6494603_6495473_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	31.9	8.5e-30
WP_155366361.1|6495469_6496693_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155366362.1|6497031_6498471_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155366363.1|6498799_6500368_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155366364.1|6500546_6501662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155366365.1|6502066_6502486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366366.1|6502697_6503378_-	DUF1956 domain-containing protein	NA	NA	NA	NA	NA
WP_155366367.1|6503936_6504425_+	DUF2141 domain-containing protein	NA	NA	NA	NA	NA
WP_155366368.1|6504835_6506005_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155366369.1|6506001_6507213_+	ABC transporter permease	NA	NA	NA	NA	NA
6506747:6506760	attR	ATCTGGATCAAATC	NA	NA	NA	NA
WP_155366370.1|6507223_6507916_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	44.1	1.7e-41
WP_155367490.1|6508641_6509988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155366371.1|6511258_6512485_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155366372.1|6512744_6513383_-	type I-MYXAN CRISPR-associated protein Cas5/Cmx5/DevS	NA	NA	NA	NA	NA
WP_155366373.1|6513379_6514306_-	type I-B CRISPR-associated protein Cas7/Cst2/DevR	NA	NA	NA	NA	NA
WP_155366374.1|6514331_6515909_-	type I-MYXAN CRISPR-associated Cas8a1/Cmx1	NA	NA	NA	NA	NA
WP_155366375.1|6515892_6516564_-	type I-MYXAN CRISPR-associated protein Cas6/Cmx6	NA	NA	NA	NA	NA
WP_155366376.1|6516658_6517231_-	DUF3365 domain-containing protein	NA	NA	NA	NA	NA
WP_155366377.1|6517284_6517854_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_155366378.1|6517969_6518398_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_145442687.1|6518378_6518945_-	DUF3365 domain-containing protein	NA	NA	NA	NA	NA
WP_155366379.1|6519010_6519430_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_155366380.1|6519888_6520221_+	cupin	NA	NA	NA	NA	NA
WP_155366381.1|6521162_6521735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145442683.1|6521895_6522315_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_155366382.1|6522444_6523683_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_155366383.1|6524424_6524829_+	transcription elongation factor GreAB	NA	NA	NA	NA	NA
WP_155366384.1|6525101_6525581_-	transcription elongation factor GreAB	NA	NA	NA	NA	NA
WP_155366385.1|6526023_6526425_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 349
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6536068	6600053	8027492	integrase,protease,transposase	uncultured_Caudovirales_phage(14.29%)	50	6539164:6539178	6549699:6549713
WP_155366398.1|6536068_6537409_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_155366399.1|6537481_6538837_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
6539164:6539178	attL	TCTTCCTGTACTTTT	NA	NA	NA	NA
WP_155366400.1|6539195_6539450_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155367491.1|6539811_6539988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366401.1|6540071_6540347_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155366402.1|6540448_6541390_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_155366403.1|6541527_6542388_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_155367492.1|6542391_6542748_-	helix-turn-helix domain-containing protein	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	33.6	4.0e-10
WP_155366404.1|6543054_6543315_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_155366405.1|6543328_6543523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155366406.1|6544004_6544910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366407.1|6544906_6545707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366408.1|6545827_6546331_-	hypothetical protein	NA	A0A2I7R1T3	Vibrio_phage	38.9	3.5e-12
WP_155366409.1|6546402_6546972_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_155367493.1|6546968_6547643_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_155366410.1|6547890_6548685_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_155366411.1|6548713_6551674_-	hypothetical protein	NA	NA	NA	NA	NA
6549699:6549713	attR	TCTTCCTGTACTTTT	NA	NA	NA	NA
WP_155366412.1|6551742_6554307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366413.1|6554333_6555587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366414.1|6556026_6558645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366415.1|6559405_6559690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366416.1|6560037_6560709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366417.1|6561775_6561943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366418.1|6562243_6563050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366419.1|6563416_6564814_-	nuclease PIN	NA	NA	NA	NA	NA
WP_155366420.1|6564820_6566590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366421.1|6566945_6567545_-	hypothetical protein	NA	A0A1B1IPE4	uncultured_Mediterranean_phage	40.5	4.8e-08
WP_155366422.1|6567943_6568633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366423.1|6568883_6569306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366424.1|6569731_6570043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366425.1|6570085_6570424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155363077.1|6571663_6572818_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	40.6	5.0e-70
WP_155366426.1|6572850_6574380_-	hypothetical protein	NA	A0A2D2W2B8	Stenotrophomonas_phage	26.0	3.7e-12
WP_155366427.1|6574469_6576050_-	DUF2723 domain-containing protein	NA	NA	NA	NA	NA
WP_145441609.1|6576201_6577797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366428.1|6577864_6579895_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	34.7	1.9e-32
WP_145441607.1|6579917_6584717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366429.1|6584899_6585754_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_155366430.1|6586146_6587238_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_155366431.1|6587227_6588346_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_155366432.1|6589005_6589995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366433.1|6590954_6592748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155366434.1|6592763_6592940_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155366435.1|6594352_6595429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366436.1|6595645_6596074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366437.1|6596091_6597225_-	DUF1573 domain-containing protein	NA	NA	NA	NA	NA
WP_155367494.1|6597747_6597873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366438.1|6597818_6598001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366439.1|6598153_6599253_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.7	9.4e-50
WP_155366440.1|6599357_6600053_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 350
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6604565	6606062	8027492		Phormidium_phage(100.0%)	1	NA	NA
WP_155366445.1|6604565_6606062_-	AAA family ATPase	NA	U5XJW0	Phormidium_phage	29.9	7.5e-50
>prophage 351
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6610681	6611551	8027492	integrase	Virus_Rctr41k(100.0%)	1	6606406:6606419	6622870:6622883
6606406:6606419	attL	GACTCCGTTTCTGC	NA	NA	NA	NA
WP_155366451.1|6610681_6611551_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	32.6	1.8e-32
WP_155366451.1|6610681_6611551_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	32.6	1.8e-32
6622870:6622883	attR	GCAGAAACGGAGTC	NA	NA	NA	NA
>prophage 352
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6633614	6634769	8027492	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_155363077.1|6633614_6634769_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	40.6	5.0e-70
>prophage 353
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6642370	6643405	8027492		Microcystis_phage(100.0%)	1	NA	NA
WP_145441571.1|6642370_6643405_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BUR2	Microcystis_phage	45.9	2.0e-25
>prophage 354
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6647195	6648047	8027492		Lactobacillus_phage(100.0%)	1	NA	NA
WP_155366474.1|6647195_6648047_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	30.9	3.2e-05
>prophage 355
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6671205	6674145	8027492		Synechococcus_phage(100.0%)	1	NA	NA
WP_155366492.1|6671205_6674145_-	hypothetical protein	NA	F5B3Z3	Synechococcus_phage	36.7	5.6e-09
>prophage 356
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6689670	6690141	8027492		Geobacillus_virus(100.0%)	1	NA	NA
WP_145042118.1|6689670_6690141_-	integration host factor subunit beta	NA	A0A0H3UZA0	Geobacillus_virus	41.1	8.1e-11
>prophage 357
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6694598	6699989	8027492		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_155366506.1|6694598_6696122_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	34.1	2.7e-07
WP_145187974.1|6696503_6698225_-	NADPH-dependent assimilatory sulfite reductase hemoprotein subunit	NA	NA	NA	NA	NA
WP_155366507.1|6698550_6699042_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_155366508.1|6699110_6699989_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.5	1.9e-29
>prophage 358
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6704791	6705361	8027492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_155366512.1|6704791_6705361_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	40.1	6.2e-21
>prophage 359
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6711421	6712198	8027492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_155366518.1|6711421_6712198_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.1e-23
>prophage 360
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6719085	6726563	8027492		Catovirus(25.0%)	7	NA	NA
WP_155366523.1|6719085_6719925_-	metal-dependent hydrolase	NA	A0A1V0SBU2	Catovirus	29.8	7.0e-21
WP_145042093.1|6720155_6721217_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_145042092.1|6721842_6722046_+	carbon storage regulator	NA	A0A2H4J8C6	uncultured_Caudovirales_phage	43.9	2.2e-05
WP_155366524.1|6722168_6722480_+	acylphosphatase	NA	NA	NA	NA	NA
WP_145187919.1|6722869_6723796_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155366525.1|6723851_6725960_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.9	1.4e-22
WP_155366526.1|6725975_6726563_+	HD domain-containing protein	NA	A0A2I2L310	Orpheovirus	38.2	8.3e-13
>prophage 361
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6730656	6731514	8027492		Indivirus(100.0%)	1	NA	NA
WP_155366530.1|6730656_6731514_+	deoxyribonuclease IV	NA	A0A1V0SCI4	Indivirus	32.9	1.2e-31
>prophage 362
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6738766	6748526	8027492		Staphylococcus_phage(33.33%)	6	NA	NA
WP_145042078.1|6738766_6739255_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.7	9.3e-34
WP_145187891.1|6739343_6740777_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_155366535.1|6741010_6741655_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_155366536.1|6741970_6744667_-	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	29.3	6.5e-44
WP_155366537.1|6745186_6746686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155366538.1|6746762_6748526_-	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	5.9e-54
>prophage 363
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6753208	6754240	8027492		Acinetobacter_phage(100.0%)	1	NA	NA
WP_155366542.1|6753208_6754240_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	41.0	1.5e-46
>prophage 364
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6786292	6787087	8027492		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_155366557.1|6786292_6787087_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	28.6	3.2e-23
>prophage 365
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6800767	6808398	8027492		Escherichia_phage(33.33%)	5	NA	NA
WP_155366568.1|6800767_6802471_+	protein kinase	NA	B0FEC2	Escherichia_phage	27.3	8.3e-21
WP_155366569.1|6802666_6804388_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_155366570.1|6804448_6806446_+	DEAD/DEAH box helicase	NA	A0A127AW80	Bacillus_phage	34.2	4.4e-98
WP_155366571.1|6806462_6806873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366572.1|6807225_6808398_+	protein kinase	NA	W5S5J6	Pithovirus	36.5	7.2e-08
>prophage 366
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6826243	6826918	8027492		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_155366583.1|6826243_6826918_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	42.7	1.2e-26
>prophage 367
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6849587	6852035	8027492		Hokovirus(100.0%)	1	NA	NA
WP_155366607.1|6849587_6852035_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	38.5	1.2e-182
>prophage 368
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6859673	6867400	8027492		Bacillus_phage(33.33%)	6	NA	NA
WP_155366613.1|6859673_6861449_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.4	3.4e-17
WP_155367501.1|6861630_6862365_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_155366614.1|6862374_6863286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366615.1|6863335_6864373_-	hypothetical protein	NA	Q6A202	Oenococcus_phage	25.7	1.9e-23
WP_155366616.1|6864487_6865834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366617.1|6866467_6867400_+	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	33.2	5.9e-45
>prophage 369
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6872214	6875570	8027492		Agrobacterium_phage(50.0%)	3	NA	NA
WP_155366624.1|6872214_6873144_-	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	30.3	8.2e-23
WP_155366625.1|6873468_6874824_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_155366626.1|6874871_6875570_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.8	1.1e-30
>prophage 370
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6881233	6881905	8027492		Planktothrix_phage(100.0%)	1	NA	NA
WP_155366631.1|6881233_6881905_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.9	4.0e-19
>prophage 371
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6896907	6898443	8027492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_155366640.1|6896907_6898443_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.8e-20
>prophage 372
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	6976759	6985114	8027492		Tetraselmis_virus(50.0%)	4	NA	NA
WP_155366691.1|6976759_6978325_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.9	9.6e-16
WP_155366692.1|6978354_6978750_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_155366693.1|6978855_6979614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366694.1|6979798_6985114_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	41.0	1.5e-39
>prophage 373
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7024211	7024904	8027492		Planktothrix_phage(100.0%)	1	NA	NA
WP_155366725.1|7024211_7024904_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.6	6.8e-30
>prophage 374
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7041224	7044650	8027492		Leptospira_phage(100.0%)	1	NA	NA
WP_145187213.1|7041224_7044650_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	23.6	3.4e-50
>prophage 375
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7073649	7074003	8027492		Shigella_phage(100.0%)	1	NA	NA
WP_145187152.1|7073649_7074003_+	hypothetical protein	NA	A0A0C4UR34	Shigella_phage	46.8	1.6e-11
>prophage 376
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7105106	7107602	8027492		uncultured_virus(100.0%)	1	NA	NA
WP_145187099.1|7105106_7107602_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.9	6.1e-97
>prophage 377
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7113203	7114700	8027492		Phormidium_phage(100.0%)	1	NA	NA
WP_155366744.1|7113203_7114700_-	AAA family ATPase	NA	U5XJW0	Phormidium_phage	29.0	6.1e-52
>prophage 378
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7119537	7121985	8027492		Streptococcus_phage(100.0%)	1	NA	NA
WP_155366745.1|7119537_7121985_-	hypothetical protein	NA	A0A1X9I6J1	Streptococcus_phage	23.1	8.3e-06
>prophage 379
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7139404	7140595	8027492		Staphylococcus_phage(100.0%)	1	NA	NA
WP_155366758.1|7139404_7140595_+	aminoacetone oxidase family FAD-binding enzyme	NA	A0A2H4PQX1	Staphylococcus_phage	41.0	5.1e-09
>prophage 380
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7157294	7158515	8027492		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_155366768.1|7157294_7158515_+	pyruvate carboxyltransferase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.4	4.9e-07
>prophage 381
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7167280	7168927	8027492		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
WP_155366775.1|7167280_7168927_-	response regulator	NA	Q6XLV6	Feldmannia_irregularis_virus	25.4	2.5e-30
>prophage 382
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7175991	7177930	8027492		Escherichia_phage(50.0%)	2	NA	NA
WP_155366782.1|7175991_7176540_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	47.2	8.5e-44
WP_155366783.1|7176850_7177930_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	24.1	3.1e-05
>prophage 383
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7196516	7198190	8027492		Tupanvirus(100.0%)	1	NA	NA
WP_145186853.1|7196516_7198190_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	25.5	2.1e-40
>prophage 384
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7201598	7202936	8027492		Moumouvirus(100.0%)	1	NA	NA
WP_145186845.1|7201598_7202936_+	HD domain-containing protein	NA	A0A2P1ELN1	Moumouvirus	32.3	5.3e-23
>prophage 385
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7206333	7209891	8027492		Leptospira_phage(100.0%)	1	NA	NA
WP_155366795.1|7206333_7209891_+	AcrB/AcrD/AcrF family protein	NA	S5VTK5	Leptospira_phage	24.1	2.6e-61
>prophage 386
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7234813	7236505	8027492		Hokovirus(100.0%)	1	NA	NA
WP_155366811.1|7234813_7236505_+	response regulator	NA	A0A1V0SGX0	Hokovirus	27.8	1.0e-55
>prophage 387
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7248247	7251476	8027492		Mycoplasma_phage(50.0%)	3	NA	NA
WP_155366823.1|7248247_7249732_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	40.3	7.9e-52
WP_155366824.1|7249816_7250773_+	nitrilase	NA	NA	NA	NA	NA
WP_149345135.1|7250780_7251476_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	36.9	4.4e-29
>prophage 388
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7267684	7268737	8027492		Vibrio_phage(100.0%)	1	NA	NA
WP_155366834.1|7267684_7268737_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2I7SAT0	Vibrio_phage	40.0	2.2e-08
>prophage 389
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7272073	7273822	8027492		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_155366837.1|7272073_7273822_+	protein kinase	NA	M1I1I7	Paramecium_bursaria_Chlorella_virus	24.9	1.4e-10
>prophage 390
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7287603	7295251	8027492		Bodo_saltans_virus(50.0%)	4	NA	NA
WP_155366846.1|7287603_7291122_+	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	31.0	2.3e-17
WP_155366847.1|7291221_7291737_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155366848.1|7291779_7292667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155366849.1|7292893_7295251_+	protein kinase	NA	A0A146JFA3	Tokyovirus	28.3	2.5e-15
>prophage 391
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7363311	7367229	8027492		Microcystis_phage(50.0%)	2	NA	NA
WP_155366891.1|7363311_7365852_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BUR2	Microcystis_phage	61.7	5.4e-32
WP_155366892.1|7365861_7367229_-	carbon-nitrogen hydrolase family protein	NA	M1H510	Paramecium_bursaria_Chlorella_virus	36.3	1.2e-17
>prophage 392
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7370938	7371502	8027492		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_145041660.1|7370938_7371502_+	DJ-1/PfpI family protein	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	29.5	2.9e-15
>prophage 393
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7384177	7385080	8027492		Bacillus_phage(100.0%)	1	NA	NA
WP_155366905.1|7384177_7385080_+	uracil-DNA glycosylase	NA	A0A127AW33	Bacillus_phage	34.4	2.4e-19
>prophage 394
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7399569	7404579	8027492		Cafeteria_roenbergensis_virus(33.33%)	3	NA	NA
WP_155366913.1|7399569_7402170_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	22.4	3.3e-37
WP_145186441.1|7402212_7403229_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	32.7	1.5e-41
WP_155366914.1|7403493_7404579_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.5	7.7e-89
>prophage 395
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7421644	7422904	8027492		Moumouvirus(100.0%)	1	NA	NA
WP_149345250.1|7421644_7422904_+	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	27.1	1.6e-21
>prophage 396
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7439555	7441193	8027492		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_155367521.1|7439555_7441193_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.8	3.2e-147
>prophage 397
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7449008	7450397	8027492		Acinetobacter_phage(100.0%)	1	NA	NA
WP_155366949.1|7449008_7450397_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	23.7	3.2e-23
>prophage 398
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7461943	7463527	8027492		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_155366957.1|7461943_7463527_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.8	2.4e-67
>prophage 399
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7481879	7487409	8027492		Streptococcus_phage(33.33%)	4	NA	NA
WP_155366969.1|7481879_7483247_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	49.6	1.8e-114
WP_155366970.1|7483256_7485518_-	protein kinase	NA	A0A1D6Y713	Golden_Marseillevirus	31.6	5.8e-14
WP_155366971.1|7485714_7486341_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_155366972.1|7486341_7487409_-	cytochrome D ubiquinol oxidase subunit II	NA	F4YCQ1	Synechococcus_phage	36.1	1.8e-21
>prophage 400
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7491993	7492920	8027492		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_145440961.1|7491993_7492920_-	ATP-binding cassette domain-containing protein	NA	M1HRF1	Paramecium_bursaria_Chlorella_virus	29.6	4.7e-10
>prophage 401
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7502460	7503921	8027492		Leptospira_phage(100.0%)	1	NA	NA
WP_155366980.1|7502460_7503921_+	efflux RND transporter periplasmic adaptor subunit	NA	S5VL44	Leptospira_phage	24.6	6.2e-09
>prophage 402
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7549885	7551373	8027492		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_155367005.1|7549885_7551373_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	23.5	8.9e-11
>prophage 403
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7555055	7558367	8027492		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_155367008.1|7555055_7556966_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	31.0	1.9e-82
WP_155367009.1|7557240_7558131_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_145041500.1|7558169_7558367_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	49.0	6.6e-07
>prophage 404
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7603881	7604613	8027492		Planktothrix_phage(100.0%)	1	NA	NA
WP_155367030.1|7603881_7604613_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.5	6.2e-34
>prophage 405
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7671973	7673758	8027492		Tupanvirus(100.0%)	1	NA	NA
WP_155367077.1|7671973_7673758_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.3	4.1e-47
>prophage 406
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7683746	7685018	8027492		Leptospira_phage(100.0%)	1	NA	NA
WP_155367082.1|7683746_7685018_+	efflux RND transporter periplasmic adaptor subunit	NA	S5VL44	Leptospira_phage	22.2	3.6e-05
>prophage 407
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7695199	7696612	8027492		Tupanvirus(100.0%)	1	NA	NA
WP_155367088.1|7695199_7696612_+	hypothetical protein	NA	A0A2K9L775	Tupanvirus	24.2	2.1e-25
>prophage 408
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7726811	7729556	8027492		Tetraselmis_virus(100.0%)	1	NA	NA
WP_155367105.1|7726811_7729556_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	27.3	1.2e-21
>prophage 409
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7738788	7741062	8027492		Kaumoebavirus(100.0%)	1	NA	NA
WP_155367110.1|7738788_7741062_+	peroxidase	NA	A0A1V0CNP9	Kaumoebavirus	32.7	9.6e-49
>prophage 410
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7755595	7755793	8027492		Lactococcus_phage(100.0%)	1	NA	NA
WP_145185730.1|7755595_7755793_-	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	42.9	4.7e-05
>prophage 411
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7762013	7763300	8027492		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_155367126.1|7762013_7763300_-	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	22.6	8.5e-10
>prophage 412
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7780232	7783264	8027492		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_155367137.1|7780232_7781216_+	GDP-mannose 4,6-dehydratase	NA	M1HGM9	Acanthocystis_turfacea_Chlorella_virus	54.1	7.5e-99
WP_155367138.1|7781254_7783264_+	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	37.6	2.1e-100
>prophage 413
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7791241	7794958	8027492		Dickeya_phage(100.0%)	1	NA	NA
WP_155367142.1|7791241_7794958_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	72.1	6.4e-18
>prophage 414
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7798819	7799653	8027492		Enterobacteria_phage(100.0%)	1	NA	NA
WP_155367147.1|7798819_7799653_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	28.9	1.1e-15
>prophage 415
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7803334	7804267	8027492		Tupanvirus(100.0%)	1	NA	NA
WP_155367151.1|7803334_7804267_+	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	31.1	1.1e-40
>prophage 416
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7831659	7836813	8027492		Mollivirus(100.0%)	1	NA	NA
WP_155367168.1|7831659_7836813_-	protein kinase	NA	A0A0M4JBJ9	Mollivirus	29.5	3.2e-15
>prophage 417
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7885093	7886857	8027492		Bacillus_phage(100.0%)	1	NA	NA
WP_155367190.1|7885093_7886857_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.0	2.5e-68
>prophage 418
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7899276	7901118	8027492		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_155367198.1|7899276_7901118_+	ATP-binding cassette domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.1	6.7e-08
>prophage 419
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7910231	7911179	8027492		Bacillus_virus(100.0%)	1	NA	NA
WP_155367204.1|7910231_7911179_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	26.7	1.2e-13
>prophage 420
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7914959	7915922	8027492		Bacillus_virus(100.0%)	1	NA	NA
WP_155367207.1|7914959_7915922_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	26.6	6.3e-18
>prophage 421
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7921110	7923639	8027492		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_155367210.1|7921110_7923639_+	ATP-binding cassette domain-containing protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	37.0	1.8e-181
>prophage 422
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7929475	7931338	8027492		Planktothrix_phage(100.0%)	1	NA	NA
WP_155367215.1|7929475_7931338_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	9.7e-23
>prophage 423
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7954548	7955511	8027492	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_155367232.1|7954548_7955511_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	36.4	1.1e-17
>prophage 424
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7965795	7967526	8027492		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_155367240.1|7965795_7967526_-	alpha-keto acid decarboxylase family protein	NA	E4WLQ6	Ostreococcus_tauri_virus	25.3	2.8e-24
>prophage 425
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	7975711	7979970	8027492	protease	uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_155367540.1|7975711_7976704_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.8	1.2e-24
WP_145041157.1|7976780_7977032_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_155367244.1|7977189_7978035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155367245.1|7978458_7979970_-	protein kinase	NA	G9BWE0	Planktothrix_phage	26.2	1.1e-13
>prophage 426
NZ_CP043930	Gimesia sp. E7 chromosome, complete genome	8027492	8015262	8017623	8027492		uncultured_virus(100.0%)	1	NA	NA
WP_155367263.1|8015262_8017623_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	27.4	2.6e-57
