The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041946	Klebsiella pneumoniae strain KP2 chromosome, complete genome	5349282	1359547	1418605	5349282	portal,head,capsid,protease,tRNA,integrase,holin,tail	Klebsiella_phage(51.16%)	70	1382547:1382570	1423598:1423621
WP_004145598.1|1359547_1360966_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913435.1|1361017_1361410_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002913434.1|1361413_1361767_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_064173618.1|1362388_1364560_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002913423.1|1364608_1365811_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_002913421.1|1366157_1367399_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_004899719.1|1367456_1367810_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_023301632.1|1367940_1368933_-	oxidoreductase	NA	NA	NA	NA	NA
WP_023301633.1|1369113_1370775_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_004180794.1|1370771_1372007_-	ion channel protein	NA	NA	NA	NA	NA
WP_002913377.1|1372270_1373236_+	glucokinase	NA	NA	NA	NA	NA
WP_002913374.1|1373289_1374027_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_004149230.1|1374038_1375736_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_002913372.1|1376118_1377333_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099119320.1|1377403_1377475_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_004185022.1|1377813_1379010_-	MFS transporter	NA	NA	NA	NA	NA
WP_023301635.1|1379006_1379465_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	7.2e-12
WP_004149227.1|1379597_1380506_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	4.6e-10
WP_023301636.1|1380515_1381397_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004174945.1|1381763_1382246_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
1382547:1382570	attL	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_009309602.1|1382764_1383937_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	86.0	4.7e-201
WP_061891355.1|1383987_1385301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071986589.1|1385341_1385599_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	61.8	1.2e-13
WP_109027969.1|1385534_1386194_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	56.1	7.3e-50
WP_004864289.1|1386190_1386706_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	76.4	2.9e-70
WP_145981949.1|1386705_1387215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109027971.1|1387237_1387462_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.8	6.4e-14
WP_064188250.1|1387776_1388637_-	hypothetical protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	53.1	2.3e-72
WP_004104278.1|1389575_1389935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109027972.1|1390292_1390817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109027973.1|1390962_1391322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109027974.1|1391623_1392250_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	47.3	1.3e-43
WP_109027975.1|1392350_1392566_+	cell division protein	NA	NA	NA	NA	NA
WP_029497186.1|1392588_1393104_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	63.4	1.5e-58
WP_070991649.1|1393582_1393858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070991647.1|1393850_1395380_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	8.6e-203
WP_109027976.1|1395376_1396348_+	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	61.6	1.7e-108
WP_050484678.1|1396317_1396962_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	54.3	1.9e-39
WP_070991643.1|1396958_1397600_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.0	1.9e-82
WP_070991641.1|1397596_1398175_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	4.9e-50
WP_001018764.1|1398325_1398565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294159.1|1398730_1399117_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_000243811.1|1399103_1399385_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
WP_070991639.1|1399384_1400014_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	73.9	8.7e-85
WP_070991637.1|1400016_1400292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031592522.1|1400510_1400999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031592520.1|1401083_1401473_+	hypothetical protein	NA	Q1MVJ1	Enterobacteria_phage	48.4	8.7e-27
WP_065519868.1|1401539_1401785_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	93.8	8.7e-33
WP_023339166.1|1401903_1402389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077270817.1|1402460_1402751_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	3.8e-51
WP_017880219.1|1402763_1402973_+	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	100.0	7.0e-31
WP_004143905.1|1403094_1403529_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_155367665.1|1405034_1406141_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	99.5	3.3e-212
WP_155367666.1|1406146_1406827_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	99.1	1.3e-123
WP_058842800.1|1406838_1408002_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	100.0	3.1e-213
WP_155367667.1|1408038_1408227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017880223.1|1408229_1408556_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
WP_004143899.1|1408616_1408814_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_070991632.1|1408815_1409148_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	99.1	9.0e-57
WP_004216814.1|1409140_1409680_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	99.4	3.0e-94
WP_000561415.1|1409676_1410042_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_000115125.1|1410097_1410589_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_065806535.1|1410632_1410986_+|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	98.3	1.1e-60
WP_001333686.1|1411018_1411282_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.9	6.9e-44
WP_077270814.1|1411278_1411710_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	94.3	2.2e-63
WP_070991631.1|1411771_1414198_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	83.5	0.0e+00
WP_001018848.1|1414197_1414677_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	78.6	1.9e-76
WP_064159804.1|1414663_1415146_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	67.7	1.7e-56
WP_029497207.1|1415153_1415540_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	50.8	4.7e-33
WP_109027941.1|1415536_1418605_+	kinase	NA	A0A286S259	Klebsiella_phage	66.2	0.0e+00
1423598:1423621	attR	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
>prophage 2
NZ_CP041946	Klebsiella pneumoniae strain KP2 chromosome, complete genome	5349282	1645285	1652190	5349282	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1645285_1646149_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|1646159_1646933_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1647173_1648067_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1648312_1649674_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1649992_1650715_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1650711_1652190_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
NZ_CP041946	Klebsiella pneumoniae strain KP2 chromosome, complete genome	5349282	1765831	1807781	5349282	portal,terminase,head,capsid,protease,integrase,holin,tail	Klebsiella_phage(48.0%)	56	1765657:1765716	1803254:1803318
1765657:1765716	attL	CCGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCG	NA	NA	NA	NA
WP_101516282.1|1765831_1766824_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	8.4e-175
WP_032408630.1|1766825_1767053_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	2.4e-29
WP_142368272.1|1767360_1767564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101516285.1|1768105_1768582_-	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	50.0	3.8e-16
WP_101516286.1|1768578_1768785_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	98.5	2.1e-32
WP_101516287.1|1768781_1769243_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.5	4.0e-10
WP_101516288.1|1769370_1770156_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.8	3.8e-61
WP_065954001.1|1770155_1770455_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	5.5e-13
WP_101516289.1|1770544_1771462_-	hypothetical protein	NA	A0A1W6JP69	Morganella_phage	36.2	2.6e-45
WP_023317570.1|1772255_1772951_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	3.5e-87
WP_001191665.1|1773048_1773291_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_004213338.1|1773325_1773787_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_058842804.1|1774191_1775106_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	60.6	1.4e-30
WP_049026353.1|1775102_1775912_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	1.0e-109
WP_000779146.1|1775921_1776299_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_058842803.1|1776311_1777292_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	2.4e-134
WP_004899672.1|1777305_1777884_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_031281242.1|1778196_1778454_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	98.8	2.8e-42
WP_032416155.1|1778359_1778806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017145563.1|1779368_1779764_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|1779750_1780032_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_058842802.1|1780031_1780661_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	89.0	1.7e-104
WP_020317342.1|1780668_1780944_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	52.8	1.4e-15
WP_032420712.1|1780894_1781086_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	88.1	3.2e-22
WP_032426434.1|1781117_1781318_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	65.1	7.9e-16
WP_004216876.1|1781382_1781628_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
WP_023301206.1|1781699_1781906_+	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	97.1	5.1e-34
WP_017880218.1|1781977_1782268_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	99.0	1.4e-53
WP_017880219.1|1782280_1782490_+	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	100.0	7.0e-31
WP_004143905.1|1782611_1783046_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_004143904.1|1783055_1784588_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_017880221.1|1784590_1785868_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_077254200.1|1785873_1786554_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	99.6	6.0e-124
WP_058842800.1|1786565_1787729_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	100.0	3.1e-213
WP_044067369.1|1787765_1788008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017880223.1|1787955_1788282_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
WP_004143899.1|1788342_1788540_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_004184710.1|1788541_1788874_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
WP_000763233.1|1788866_1789406_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	100.0	1.0e-94
WP_000561415.1|1789402_1789768_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_004899623.1|1790141_1790525_+	hypothetical protein	NA	A0A286S1N4	Klebsiella_phage	86.3	1.4e-53
WP_004899621.1|1790527_1790791_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	90.8	7.9e-40
WP_058842799.1|1790854_1791232_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_058842798.1|1791293_1793840_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	74.6	0.0e+00
WP_004899614.1|1793839_1794319_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_032412796.1|1794305_1794788_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	96.9	1.6e-83
WP_017880229.1|1794797_1795178_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_058842797.1|1795174_1798234_+	kinase	NA	A0A286S259	Klebsiella_phage	91.0	0.0e+00
WP_040181868.1|1800279_1801080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074177881.1|1801091_1801274_+	helix-turn-helix domain-containing protein	NA	A0A286S1P7	Klebsiella_phage	88.9	1.5e-18
WP_001333465.1|1801351_1801774_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.8e-26
WP_074376103.1|1802611_1802983_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.9	9.2e-26
WP_002911596.1|1803588_1804734_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
1803254:1803318	attR	CCGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGCCACT	NA	NA	NA	NA
WP_004151461.1|1805272_1805554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009307518.1|1805596_1806304_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.3	3.7e-07
WP_009484430.1|1806347_1807781_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	4.0e-101
>prophage 4
NZ_CP041946	Klebsiella pneumoniae strain KP2 chromosome, complete genome	5349282	1938446	2044039	5349282	portal,terminase,transposase,head,capsid,protease,lysis,plate,tRNA,integrase,tail	Escherichia_phage(16.67%)	115	1945123:1945141	1981761:1981779
WP_002910830.1|1938446_1939193_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_023285302.1|1939604_1940618_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004189318.1|1940610_1941411_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004145488.1|1941448_1941571_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_002910764.1|1942188_1943130_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|1943223_1944213_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|1944238_1945570_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
1945123:1945141	attL	CTATCTGGCGAACCACTTT	NA	NA	NA	NA
WP_002910759.1|1945597_1946806_+	propionate kinase	NA	NA	NA	NA	NA
WP_009307576.1|1946834_1949129_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	2.8e-157
WP_009484368.1|1949559_1950675_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009307577.1|1950784_1951699_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004148804.1|1951708_1952995_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004148803.1|1952991_1953867_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_004175491.1|1953863_1954583_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|1954588_1955482_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004148802.1|1955765_1957409_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|1957458_1957935_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009307580.1|1958033_1958960_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175494.1|1959263_1960559_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_032413763.1|1960573_1961380_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021312745.1|1961620_1962883_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	95.0	1.7e-233
WP_040181674.1|1962925_1963171_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	92.1	1.9e-35
WP_009483816.1|1963174_1963393_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.6e-12
WP_032431536.1|1963389_1963599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040218332.1|1963595_1963787_-	DUF1382 family protein	NA	G9L698	Escherichia_phage	64.4	1.3e-12
WP_110225232.1|1963783_1964548_-	hypothetical protein	NA	Q71T76	Escherichia_phage	58.3	2.3e-71
WP_040181679.1|1964764_1965535_-	hypothetical protein	NA	D5LH17	Escherichia_phage	51.0	3.2e-65
WP_024264482.1|1965531_1966059_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	62.2	1.3e-57
WP_016529279.1|1966055_1966214_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	6.7e-10
WP_040181683.1|1966210_1966897_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	90.6	4.8e-113
WP_124072215.1|1966889_1967339_-	hypothetical protein	NA	A0A221SAP1	Ralstonia_phage	52.6	1.0e-18
WP_040181685.1|1967506_1968352_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	2.6e-68
WP_040181687.1|1968367_1968652_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	4.3e-39
WP_008807814.1|1968732_1968939_-	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_039110713.1|1969469_1970066_-	helix-turn-helix transcriptional regulator	NA	K7P850	Enterobacteria_phage	27.1	9.0e-07
WP_038435003.1|1970174_1970387_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065802491.1|1970407_1970692_+	hypothetical protein	NA	K7PHN8	Enterobacterial_phage	55.1	3.7e-19
WP_040218315.1|1970726_1971524_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	71.5	2.5e-89
WP_065802493.1|1971520_1972417_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.5	1.9e-64
WP_040182092.1|1972413_1973262_+	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	60.8	1.2e-89
WP_040182091.1|1973258_1973552_+	protein ren	NA	M1FPD5	Enterobacteria_phage	62.4	2.1e-25
WP_052450983.1|1973788_1974241_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	40.6	4.4e-14
WP_040181701.1|1974237_1974498_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.6e-29
WP_004141386.1|1975029_1975242_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_087750241.1|1975870_1976284_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	34.6	1.1e-11
WP_004191566.1|1976689_1977286_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	1.2e-56
WP_086551365.1|1977291_1977462_+	NinE family protein	NA	G8C7V4	Escherichia_phage	69.6	8.2e-14
WP_155367673.1|1977454_1978063_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	64.2	3.0e-50
WP_065807619.1|1978059_1978290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004136182.1|1978286_1978427_+	YlcG family protein	NA	NA	NA	NA	NA
WP_065807620.1|1978423_1979113_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	1.1e-56
WP_004146347.1|1979887_1980202_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_155367674.1|1980204_1980708_+	glycoside hydrolase family protein	NA	A0A1V0E5Q7	Salmonella_phage	78.4	1.1e-74
WP_155367675.1|1980704_1981166_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	57.2	9.0e-39
WP_001165319.1|1981198_1981603_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_155367676.1|1981679_1982321_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	32.1	3.7e-06
1981761:1981779	attR	AAAGTGGTTCGCCAGATAG	NA	NA	NA	NA
WP_064141836.1|1982562_1983144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143887651.1|1983085_1985212_+|terminase	terminase	terminase	A0A0C5ABH4	Bacteriophage	35.0	2.3e-97
WP_000483310.1|1985220_1985484_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_143887650.1|1985483_1987118_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.2	1.2e-88
WP_021543305.1|1987114_1987981_+	S49 family peptidase	NA	A0A248XD65	Klebsiella_phage	48.1	1.4e-48
WP_143887649.1|1987982_1988573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021543307.1|1988572_1988980_+|head	head decoration protein	head	NA	NA	NA	NA
WP_023281756.1|1989078_1990128_+|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	34.0	5.6e-52
WP_021543309.1|1990129_1990507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021543310.1|1990511_1990871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021543311.1|1990867_1991413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021543312.1|1991415_1991601_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_021543313.1|1991597_1993109_+	hypothetical protein	NA	B5TK67	Pseudomonas_phage	44.6	4.1e-104
WP_000896639.1|1993112_1993484_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000818812.1|1993485_1993764_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_088224442.1|1993905_1995759_+	hypothetical protein	NA	A0A172JGI1	Citrobacter_phage	45.3	3.1e-21
WP_053287019.1|1995805_1997206_+	hypothetical protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	39.1	4.0e-05
WP_000102291.1|1997202_1998288_+|tail	tail protein	tail	Q8SBG7	Shigella_phage	30.7	3.3e-39
WP_001075147.1|1998284_1998866_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_001280393.1|1998862_1999312_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	41.2	5.6e-17
WP_155367677.1|1999301_2000450_+|plate	phage baseplate protein	plate	B6SBU6	Clostridium_virus	27.4	3.8e-09
WP_000051916.1|2000446_2001121_+	YmfQ family protein	NA	NA	NA	NA	NA
WP_001310746.1|2001147_2001933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155367678.1|2001911_2003003_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_155367697.1|2003367_2005362_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	27.2	8.5e-25
WP_071854268.1|2005371_2006172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343760.1|2006319_2007540_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_040181289.1|2007601_2007841_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	4.2e-16
WP_074422971.1|2007950_2008157_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.2	1.9e-09
WP_048289904.1|2009131_2009614_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|2009805_2010504_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_004899028.1|2010529_2011114_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2011183_2011513_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_009307582.1|2012078_2013419_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004175498.1|2013415_2014069_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009307583.1|2014072_2015770_+	OmpA family protein	NA	NA	NA	NA	NA
WP_009307584.1|2016228_2018856_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.5	2.3e-17
WP_023342696.1|2018858_2020886_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	31.6	2.6e-74
WP_004148791.1|2020900_2021797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413757.1|2022289_2022697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029499423.1|2022722_2022980_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_040181245.1|2022984_2024196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029498250.1|2024660_2027627_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_040181246.1|2027760_2029524_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002910494.1|2029523_2030570_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_019704158.1|2030544_2031087_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004152261.1|2031089_2031533_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_048289900.1|2031552_2032968_+	membrane protein	NA	NA	NA	NA	NA
WP_002910453.1|2033099_2034014_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155367679.1|2034097_2034427_+	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910443.1|2034507_2035599_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_009307591.1|2035716_2036301_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910437.1|2036573_2036849_+	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_023301802.1|2037069_2038116_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189412.1|2038117_2039797_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_002910407.1|2039921_2040869_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004891134.1|2041052_2041904_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910405.1|2041900_2042512_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004891136.1|2042782_2044039_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP041946	Klebsiella pneumoniae strain KP2 chromosome, complete genome	5349282	2705499	2711929	5349282		Escherichia_phage(100.0%)	7	NA	NA
WP_040182017.1|2705499_2706588_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	8.8e-210
WP_004176262.1|2706674_2706935_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|2707232_2708093_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|2708113_2708875_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2709136_2710039_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_032423485.1|2710050_2711316_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002210516.1|2711308_2711929_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 6
NZ_CP041946	Klebsiella pneumoniae strain KP2 chromosome, complete genome	5349282	2982202	3003445	5349282	holin,terminase,tail	Pseudomonas_phage(30.0%)	26	NA	NA
WP_077264109.1|2982202_2985118_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	34.2	4.9e-90
WP_129693861.1|2985697_2986096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012967913.1|2986163_2986361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012967912.1|2986498_2986981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048289860.1|2987035_2988208_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_012967910.1|2988231_2988624_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_012967909.1|2988620_2989172_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	5.9e-29
WP_048289859.1|2989173_2989557_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	43.7	1.6e-20
WP_072072127.1|2989543_2989777_-	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	49.2	6.4e-09
WP_048289858.1|2989786_2990041_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	51.2	3.0e-20
WP_048289857.1|2990042_2990438_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	4.3e-13
WP_133060713.1|2990478_2990751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048289856.1|2990759_2991713_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	6.5e-132
WP_048289855.1|2991723_2992503_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	64.0	2.7e-67
WP_048289854.1|2993015_2994128_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	55.1	1.6e-110
WP_048267898.1|2994111_2995512_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	2.4e-127
WP_016946682.1|2995513_2996827_-|terminase	terminase	terminase	A0A0S2SYF1	Pseudomonas_phage	73.6	2.2e-183
WP_048289853.1|2996810_2997806_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004190672.1|2998894_2999170_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_048289852.1|2999166_2999511_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	79.8	2.6e-38
WP_004184488.1|2999507_3000047_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_024176410.1|3000043_3000343_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_048289851.1|3001100_3001922_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	60.6	5.1e-85
WP_086528373.1|3001918_3002059_-	YlcG family protein	NA	NA	NA	NA	NA
WP_048289850.1|3002055_3002637_-	protein ninG	NA	E7C9S3	Salmonella_phage	44.8	2.7e-40
WP_086528372.1|3002845_3003445_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.4	3.8e-90
>prophage 7
NZ_CP041946	Klebsiella pneumoniae strain KP2 chromosome, complete genome	5349282	3007877	3023509	5349282	integrase	Salmonella_phage(50.0%)	22	3006635:3006648	3023798:3023811
3006635:3006648	attL	GATATTCCGGCGCT	NA	NA	NA	NA
WP_032445505.1|3007877_3008078_-	hypothetical protein	NA	A0A1U8QWK2	Salmonella_phage	57.5	3.2e-09
WP_032445503.1|3008553_3008790_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	90.7	7.1e-32
WP_019705292.1|3008782_3008986_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	92.5	2.6e-30
WP_032423776.1|3008982_3009351_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	4.9e-11
WP_004215885.1|3009343_3010087_-	replication protein P	NA	A0A0M3ULE2	Salmonella_phage	55.2	3.1e-65
WP_004215886.1|3010083_3011004_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	61.3	1.7e-92
WP_032445502.1|3011354_3011891_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	68.9	6.3e-60
WP_023320775.1|3011893_3012121_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	50.0	3.4e-15
WP_050485525.1|3012225_3012660_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.0	2.3e-15
WP_101516259.1|3012843_3012942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179600.1|3013048_3013240_+	YebW family protein	NA	NA	NA	NA	NA
WP_012967861.1|3013248_3013404_+	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	75.0	1.2e-14
WP_048289849.1|3013541_3016580_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.2	1.0e-292
WP_048289848.1|3016592_3017702_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	85.9	9.4e-183
WP_004190719.1|3017736_3018075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016160779.1|3018067_3018679_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.3	4.9e-40
WP_048289847.1|3018675_3018984_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	4.6e-23
WP_004892750.1|3018991_3019231_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.1	8.0e-23
WP_086528371.1|3019451_3020639_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	4.2e-120
WP_004151901.1|3020815_3021706_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004140266.1|3021705_3022698_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3022699_3023509_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
3023798:3023811	attR	AGCGCCGGAATATC	NA	NA	NA	NA
>prophage 8
NZ_CP041946	Klebsiella pneumoniae strain KP2 chromosome, complete genome	5349282	3142881	3210521	5349282	portal,terminase,head,plate,capsid,tRNA,integrase,tail	Enterobacteria_phage(51.43%)	79	3148109:3148126	3185285:3185302
WP_004892876.1|3142881_3143382_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3143498_3143945_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3143928_3144720_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004148041.1|3144821_3146006_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3146037_3146730_-	CTP synthase	NA	NA	NA	NA	NA
WP_020802835.1|3146875_3147385_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3147371_3147728_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004176548.1|3147717_3147957_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
3148109:3148126	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|3148221_3148473_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_040181406.1|3148516_3149656_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	72.3	9.4e-146
WP_040181409.1|3149810_3150983_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	5.0e-158
WP_004216461.1|3150982_3151498_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_004131585.1|3151543_3151861_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_075604421.1|3151860_3152019_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_040181412.1|3152005_3154981_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.4	2.0e-219
WP_040181415.1|3154996_3155470_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.9	6.6e-53
WP_040181417.1|3155933_3156596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052450975.1|3156613_3157837_-	DUF262 domain-containing protein	NA	A0A1V0S9I8	Catovirus	27.5	7.8e-05
WP_040181419.1|3158436_3159534_-|tail	tail fiber protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_023339950.1|3159533_3159746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181424.1|3159742_3162769_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_023300878.1|3162758_3163682_-	hypothetical protein	NA	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
WP_040181426.1|3163683_3164034_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.2	1.8e-23
WP_009486481.1|3164030_3164618_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_020316957.1|3164614_3165250_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_040181428.1|3165246_3165714_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_124072220.1|3165714_3165990_-	peptidase	NA	NA	NA	NA	NA
WP_031593580.1|3165895_3166225_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_023339943.1|3166236_3166782_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
WP_004213110.1|3166778_3167063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|3167053_3167254_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_040181431.1|3167253_3167769_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	48.8	2.7e-39
WP_040181433.1|3167881_3168739_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	61.3	9.8e-71
WP_023328071.1|3168788_3169823_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
WP_040181436.1|3169832_3170672_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	4.3e-95
WP_040181438.1|3170828_3172556_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	67.1	1.0e-228
WP_048289843.1|3172549_3173611_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.1	9.1e-143
WP_040181440.1|3174455_3175247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181442.1|3175246_3177517_+	helicase UvrD	NA	NA	NA	NA	NA
WP_040181444.1|3180406_3181363_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	54.4	1.5e-83
WP_023329528.1|3181595_3182162_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	2.8e-13
WP_004213098.1|3182158_3182383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023329526.1|3182451_3182724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181449.1|3182739_3183117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216643.1|3183132_3183351_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|3183371_3183650_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004213095.1|3183770_3184070_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_040181453.1|3184185_3185169_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.8	1.4e-150
WP_004176549.1|3185433_3186447_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
3185285:3185302	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|3186504_3186606_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004892898.1|3186605_3186680_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3186797_3186923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3186982_3187246_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3187376_3188015_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_023302064.1|3188104_3189019_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|3189680_3190724_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004140494.1|3191026_3192235_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_023302065.1|3192308_3194093_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_021313530.1|3194099_3194990_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023302066.1|3195110_3196619_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3196929_3197616_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153236426.1|3198065_3198254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3198232_3198865_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3199431_3199629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004183659.1|3199744_3200755_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140511.1|3200751_3202158_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004179357.1|3202213_3203101_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3203117_3203624_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|3203650_3204145_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3204235_3204421_-	general stress protein	NA	NA	NA	NA	NA
WP_137013050.1|3204640_3204829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140529.1|3205044_3206238_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3206350_3206578_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_019704434.1|3206598_3206784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150797.1|3207026_3207350_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3207342_3207735_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004213085.1|3207731_3208445_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3208717_3208870_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_040200296.1|3209024_3210521_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	69.0	2.8e-137
>prophage 9
NZ_CP041946	Klebsiella pneumoniae strain KP2 chromosome, complete genome	5349282	3219586	3256354	5349282	portal,terminase,protease,tRNA,integrase,holin,tail	Enterobacteria_phage(31.25%)	46	3206874:3206888	3254165:3254179
3206874:3206888	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_016530340.1|3219586_3220177_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	77.0	2.5e-81
WP_023342884.1|3220208_3220919_-	hypothetical protein	NA	Q6UAW4	Klebsiella_phage	90.7	1.1e-136
WP_016530342.1|3220920_3221676_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	84.1	1.3e-130
WP_023342885.1|3221672_3222020_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	67.8	4.7e-40
WP_134917911.1|3222024_3225168_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	73.4	0.0e+00
WP_071609142.1|3225151_3225466_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	75.0	5.0e-41
WP_072216832.1|3225486_3225915_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	60.0	2.7e-37
WP_016530349.1|3225925_3226669_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	83.0	1.7e-111
WP_016530350.1|3226677_3227079_-|tail	minor tail family protein	tail	K7PHM6	Enterobacterial_phage	75.6	2.7e-55
WP_032416997.1|3227075_3227654_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	81.2	1.3e-79
WP_023342887.1|3227657_3227933_-	hypothetical protein	NA	K7PH43	Enterobacteria_phage	57.1	1.1e-23
WP_032416996.1|3227925_3228252_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	65.7	1.4e-33
WP_134917912.1|3228335_3230357_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	81.7	0.0e+00
WP_016530355.1|3230307_3231810_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.0	6.2e-246
WP_023342890.1|3231809_3232022_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	80.0	2.9e-24
WP_016530357.1|3232018_3234121_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	84.0	0.0e+00
WP_023342892.1|3234120_3234609_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	87.7	1.3e-72
WP_077273936.1|3234840_3235155_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.8	7.5e-29
WP_131082162.1|3235259_3235568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131066636.1|3235649_3236126_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_131066624.1|3236158_3236698_-	lysozyme	NA	K7PM52	Enterobacteria_phage	73.6	1.2e-74
WP_075208973.1|3236669_3236939_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	84.8	4.2e-36
WP_131066623.1|3237092_3237944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131082163.1|3238102_3238801_-	antitermination protein	NA	NA	NA	NA	NA
WP_131082164.1|3238821_3239880_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.0	2.3e-106
WP_131082165.1|3240079_3240472_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_104454100.1|3240512_3240803_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
WP_110540614.1|3240814_3241048_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
WP_100682201.1|3241758_3242730_-	macro domain-containing protein	NA	A0A173GFD0	Erwinia_phage	37.5	2.1e-16
WP_094945273.1|3242734_3243316_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_094945274.1|3243942_3244383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094945275.1|3244396_3244861_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	69.5	1.7e-61
WP_104457101.1|3244853_3245837_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	55.8	6.2e-45
WP_057171835.1|3245888_3246443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023342905.1|3246445_3246658_-	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	57.6	1.9e-15
WP_032428184.1|3246763_3247144_+	helix-turn-helix domain-containing protein	NA	A0A0M4REM4	Salmonella_phage	37.7	1.9e-10
WP_040234937.1|3247484_3247799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160636.1|3248189_3248384_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3248426_3248771_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_134917915.1|3248912_3251051_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.9	2.5e-99
WP_012542206.1|3251103_3251349_+	excisionase	NA	NA	NA	NA	NA
WP_110540615.1|3251329_3252457_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.7	2.6e-119
WP_004150800.1|3252574_3253825_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3254065_3254716_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3254165:3254179	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|3254732_3255191_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3255247_3256354_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP041946	Klebsiella pneumoniae strain KP2 chromosome, complete genome	5349282	3495379	3504853	5349282	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_114504563.1|3495379_3497101_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.8	3.1e-15
WP_023302126.1|3497145_3497847_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3498200_3498419_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3498549_3500829_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3500859_3501177_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3501502_3501724_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3501800_3503741_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3503737_3504853_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 11
NZ_CP041946	Klebsiella pneumoniae strain KP2 chromosome, complete genome	5349282	3990612	4038765	5349282	terminase,head,lysis,tRNA,integrase	Cronobacter_phage(27.66%)	73	3985540:3985586	4035836:4035882
3985540:3985586	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_040186451.1|3990612_3993090_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	1.4e-197
WP_040181295.1|3993076_3993472_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	4.7e-36
WP_004196571.1|3993468_3993939_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	1.2e-27
WP_016531189.1|3993938_3994358_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.8	1.8e-30
WP_071854269.1|3994528_3994942_+	hypothetical protein	NA	G0ZNE8	Cronobacter_phage	89.8	5.0e-65
WP_040181302.1|3994961_3995141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058842809.1|3995181_3998622_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	40.5	7.3e-133
WP_029884072.1|3998716_3999220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074160392.1|3999322_3999550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129693860.1|3999644_3999962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328739.1|4000013_4000334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048294323.1|4000816_4001290_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	40.6	2.1e-14
WP_072061015.1|4001326_4001758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129312537.1|4001768_4002134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049182521.1|4002130_4002436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178855.1|4002740_4003424_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	59.7	2.3e-75
WP_048294321.1|4003476_4004229_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	41.8	1.7e-42
WP_048294319.1|4004297_4004690_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	2.0e-34
WP_004151265.1|4004686_4005112_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_058842810.1|4005114_4005477_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	3.3e-20
WP_038434988.1|4005476_4005650_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	51.8	1.2e-12
WP_058842811.1|4005649_4006030_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.8e-29
WP_058842812.1|4006032_4006308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191540.1|4006318_4007413_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	2.2e-123
WP_058842813.1|4007424_4007853_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	8.1e-42
WP_040186437.1|4007856_4009242_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.7	1.5e-153
WP_049185996.1|4009314_4009665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064148479.1|4009764_4010778_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.5	1.5e-110
WP_058842815.1|4010710_4012174_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.1	4.0e-149
WP_048294304.1|4012186_4013485_-|terminase	PBSX family phage terminase large subunit	terminase	Q5G8Y7	Enterobacteria_phage	94.3	3.0e-241
WP_048294303.1|4013468_4013936_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	73.8	1.5e-57
WP_058842816.1|4013966_4014593_-	hypothetical protein	NA	I6S676	Salmonella_phage	84.9	8.4e-104
WP_058842820.1|4015442_4015901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087760209.1|4016334_4016472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058842818.1|4016474_4016942_-|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	71.6	1.0e-53
WP_004146527.1|4016938_4017469_-	lysozyme	NA	G9L6J6	Escherichia_phage	79.7	5.4e-80
WP_004151282.1|4017471_4017720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322094.1|4018147_4018672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048322093.1|4019016_4019706_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	1.9e-56
WP_048322092.1|4019702_4019843_-	YlcG family protein	NA	NA	NA	NA	NA
WP_058842819.1|4019839_4020475_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.0	2.2e-80
WP_032431555.1|4020467_4020638_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
WP_016530701.1|4020618_4021086_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	1.5e-33
WP_048322089.1|4021276_4021534_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	74.0	6.4e-26
WP_032432693.1|4021862_4022060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322087.1|4022052_4022319_-	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	69.8	4.6e-27
WP_048322086.1|4023330_4023849_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.7	1.8e-91
WP_048322084.1|4024351_4024549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322083.1|4024541_4024805_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.3e-29
WP_040181698.1|4024801_4025224_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.9	1.5e-11
WP_004218528.1|4025220_4025523_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040181695.1|4025519_4026257_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	55.2	6.9e-65
WP_040181719.1|4026253_4027219_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	78.9	5.1e-60
WP_040181694.1|4027278_4028076_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	67.9	2.8e-88
WP_004139615.1|4028161_4028383_-	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_004178811.1|4028422_4028656_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_024622727.1|4028760_4029450_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
WP_004178801.1|4029472_4029592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434121.1|4029790_4030507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434120.1|4030497_4031043_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_024622729.1|4031091_4031295_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	1.0e-18
WP_154706900.1|4031541_4031730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019704100.1|4031722_4031917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182107.1|4032006_4032291_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	81.9	1.7e-40
WP_040182110.1|4032307_4033054_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	7.0e-65
WP_040182112.1|4033050_4033674_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	59.2	5.8e-57
WP_040182113.1|4033702_4034230_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	1.1e-56
WP_040182114.1|4034226_4034445_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
WP_071531921.1|4034446_4034782_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021441323.1|4034658_4035822_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
WP_004143017.1|4036253_4037120_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4035836:4035882	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|4037121_4037334_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4037379_4038765_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 1
NZ_CP041947	Klebsiella pneumoniae strain KP2 plasmid pKP2_1, complete sequence	47983	6365	13354	47983	transposase	Salmonella_phage(33.33%)	7	NA	NA
WP_001549892.1|6365_6605_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001067834.1|6997_7702_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_001393253.1|8417_8750_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|8796_9672_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|9927_11190_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|11753_12311_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|12493_13354_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
>prophage 1
NZ_CP041949	Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence	174723	1727	67720	174723	integrase,protease,transposase	Escherichia_phage(20.0%)	53	NA	NA
WP_001515717.1|1727_2468_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|3611_4559_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|4585_4897_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|4961_5885_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|6557_6815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080895248.1|7434_8871_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|9853_11131_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|11193_13191_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|14230_15438_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|16866_17298_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|17548_19024_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|19016_19697_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|19886_21272_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|21300_21654_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|21767_23060_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|23070_26217_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|26303_26744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|26870_29318_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|29358_29556_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|29589_30327_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|30615_31065_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|31298_33116_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_077255522.1|33605_34952_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_032422684.1|35000_35399_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_020314316.1|35594_36941_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|38783_39746_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|39732_40482_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|40719_40917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|40916_43712_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|43826_44396_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|44430_44712_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|44935_45199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|45213_45477_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014386148.1|46678_47659_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	98.8	2.6e-184
WP_004152692.1|48867_49737_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|49730_50741_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|50749_51577_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|51585_52449_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014386147.1|52445_53273_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	9.0e-21
WP_001067855.1|54128_54833_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001083725.1|56506_57004_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|57115_57406_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|57411_58203_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|58366_58714_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|58707_59547_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|59674_59878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|60033_61239_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|61249_61555_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|62374_63079_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001553819.1|63348_66246_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_001398199.1|66382_66784_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|66716_66974_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|67066_67720_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP041953	Klebsiella pneumoniae strain KP2 plasmid pKP2_7, complete sequence	55133	0	37369	55133	terminase,portal,head,capsid,tail	Klebsiella_phage(81.82%)	47	NA	NA
WP_039814612.1|1727_2528_-	hypothetical protein	NA	O64341	Escherichia_phage	78.1	3.2e-116
WP_039814615.1|2524_2755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032413547.1|2751_2916_-	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	96.3	2.8e-19
WP_072040876.1|3494_3920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077256350.1|4058_5051_-	hypothetical protein	NA	A0A2H5BFZ4	Vibrio_phage	40.8	1.4e-23
WP_039814626.1|5385_5736_-	hypothetical protein	NA	O64343	Escherichia_phage	77.6	5.1e-50
WP_039814628.1|5732_6029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106418127.1|6021_10026_-	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	81.3	0.0e+00
WP_048292304.1|10276_10885_-	XRE family transcriptional regulator	NA	Q6UAU6	Klebsiella_phage	92.6	1.3e-104
WP_032408972.1|10965_11175_+	hypothetical protein	NA	Q6UAU5	Klebsiella_phage	92.8	7.7e-30
WP_032408971.1|11164_11902_+	phage antitermination Q family protein	NA	Q6UAU4	Klebsiella_phage	84.5	2.2e-119
WP_048292305.1|12313_12922_+	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	88.5	3.0e-98
WP_023339397.1|13522_13768_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	83.1	5.1e-25
WP_048292306.1|13760_14087_+	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	1.1e-51
WP_023339395.1|14107_14335_+	hypothetical protein	NA	O64355	Escherichia_phage	80.3	2.8e-25
WP_023339393.1|14686_14974_-	helix-turn-helix transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	96.8	1.7e-43
WP_023339392.1|14973_15282_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
WP_023339391.1|15452_15674_+	hypothetical protein	NA	O64358	Escherichia_phage	90.4	3.0e-32
WP_032408967.1|15685_15913_+	hypothetical protein	NA	Q6UAT1	Klebsiella_phage	84.0	1.6e-28
WP_048292307.1|16230_17292_+	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	92.9	1.0e-170
WP_023339388.1|17350_17662_+	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	89.1	6.3e-44
WP_048292308.1|17658_18150_+	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.2	4.1e-82
WP_040118545.1|18166_18643_+	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.7	1.7e-61
WP_117037470.1|18590_18785_+	hypothetical protein	NA	Q6UAS6	Klebsiella_phage	89.5	1.5e-19
WP_032408961.1|18896_19196_+	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	96.0	3.0e-51
WP_053090680.1|19365_20427_+	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	38.3	8.8e-37
WP_072072213.1|20410_20773_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	94.2	2.4e-63
WP_032408958.1|20769_21054_+	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	37.5	3.1e-05
WP_077256079.1|21050_21482_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	59.9	7.6e-40
WP_032408957.1|21898_22333_+|terminase	terminase	terminase	Q6UAY1	Klebsiella_phage	95.8	2.4e-73
WP_032408956.1|22367_24077_+|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	95.1	0.0e+00
WP_064168720.1|24249_25509_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	3.1e-222
WP_087749692.1|25545_26466_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.6	3.6e-148
WP_087749693.1|26543_27830_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	86.0	1.8e-206
WP_087749694.1|27889_28177_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	79.6	2.5e-18
WP_023339902.1|28157_28475_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	5.8e-45
WP_087749695.1|28471_28810_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_017880258.1|28790_29180_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_017898997.1|29176_29578_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_014228913.1|29609_30071_+|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_014228914.1|30128_30494_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_106418128.1|30726_34083_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.3	0.0e+00
WP_017898999.1|34082_34421_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	2.4e-57
WP_020803197.1|34417_35173_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	6.7e-124
WP_039814703.1|35174_35885_+	peptidase P60	NA	Q6UAW4	Klebsiella_phage	89.8	6.7e-134
WP_052285794.1|35931_36759_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	44.0	1.3e-08
WP_032447254.1|36775_37369_+|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	80.7	3.7e-85
>prophage 2
NZ_CP041953	Klebsiella pneumoniae strain KP2 plasmid pKP2_7, complete sequence	55133	50501	54173	55133	tail	Klebsiella_phage(100.0%)	3	NA	NA
WP_065519969.1|50501_51962_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	52.9	2.7e-97
WP_048993688.1|52041_53007_-	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	86.6	1.5e-155
WP_023339381.1|53009_54173_-	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	98.4	2.1e-225
