The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039988	Pseudomonas aeruginosa strain T2436 chromosome, complete genome	6782092	63098	118173	6782092	plate,transposase	Shigella_phage(16.67%)	51	NA	NA
WP_096249031.1|63098_63758_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101476525.1|63807_64969_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.6	5.6e-85
WP_096248869.1|65390_65984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003083536.1|66471_66867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077563739.1|67131_68541_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_003111705.1|68704_70078_+	T3SS effector bifunctional cytotoxin exoenzyme T	NA	NA	NA	NA	NA
WP_003083559.1|70573_71260_+	curli production assembly protein CsgG	NA	NA	NA	NA	NA
WP_003083569.1|71290_71644_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_003083573.1|71640_72306_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_003083575.1|72320_72704_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033984507.1|72985_74647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083582.1|75258_75399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019485247.1|76219_78052_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A2K9R7N5	Dishui_lake_phycodnavirus	28.3	2.7e-17
WP_096248870.1|78104_78533_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003111524.1|78972_79443_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_009314898.1|79459_80008_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	41.6	4.7e-34
WP_003083593.1|80046_80553_-	DUF1993 family protein	NA	NA	NA	NA	NA
WP_128623071.1|80618_81539_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003083599.1|81646_82534_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_009314899.1|82596_83301_+	DsbA family protein	NA	NA	NA	NA	NA
WP_003118563.1|83384_83840_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003083610.1|83950_84184_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_003083612.1|84195_84633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083614.1|84689_85106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003136953.1|85197_86325_+	aminopeptidase	NA	NA	NA	NA	NA
WP_003114660.1|86332_87316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003118497.1|87348_88014_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003083618.1|88006_88549_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016852309.1|88626_90672_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	21.3	7.8e-34
WP_003083624.1|90668_90944_+	YheV family putative metal-binding protein	NA	NA	NA	NA	NA
WP_096248871.1|91032_92091_+	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_003083630.1|92321_93236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128623072.1|93297_95010_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_128623073.1|95002_96202_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003111510.1|96201_96921_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	3.3e-19
WP_023518242.1|96917_100016_-	protein kinase	NA	M1PCM5	Moumouvirus	27.8	2.5e-23
WP_003083639.1|100023_100752_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_003083642.1|100761_101442_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_009314904.1|101438_104972_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_014603461.1|104968_106318_-	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_096248872.1|106324_107659_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_003083660.1|107674_108139_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_023094294.1|108183_109701_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_073665599.1|110068_111103_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_003083666.1|111191_111710_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003104973.1|111722_113219_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003083670.1|113294_113783_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003119488.1|113950_114796_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003111625.1|114797_115307_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003083676.1|115303_117163_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003083679.1|117126_118173_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP039988	Pseudomonas aeruginosa strain T2436 chromosome, complete genome	6782092	636080	706305	6782092	tRNA,plate,tail,transposase	uncultured_Caudovirales_phage(21.88%)	68	NA	NA
WP_101476525.1|636080_637242_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.6	5.6e-85
WP_034001189.1|637479_637797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034075339.1|638220_640173_-	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_033969993.1|640169_640667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034075340.1|640666_641872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034075338.1|642141_642912_-	nuclease	NA	A0A2R2ZH57	Clostridioides_phage	34.5	6.2e-24
WP_034075337.1|643083_644205_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	25.8	5.3e-08
WP_023874863.1|644466_644628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034075336.1|644849_648587_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	35.4	4.8e-13
WP_003085035.1|648693_650547_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.8	1.2e-36
WP_003085039.1|650626_652621_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.7	3.8e-73
WP_003085042.1|652703_653153_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.8	5.0e-18
WP_003085057.1|653222_653438_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003109020.1|653638_654664_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	3.7e-109
WP_003085061.1|654742_655312_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|655395_655749_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_023126993.1|655739_656282_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|656254_657487_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_023119538.1|657530_658037_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|658131_659685_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|659681_660953_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|661053_662976_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|663254_663587_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|663630_664482_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|664481_664862_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_096248927.1|664898_665705_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003085089.1|665820_666807_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|666803_668096_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003085092.1|668076_670878_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_023095148.1|671004_672021_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003117959.1|672017_672692_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003099547.1|672693_673452_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_003137371.1|673452_674514_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_003459408.1|674665_677059_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|677104_677737_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|677865_678900_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|679133_680243_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003109043.1|680298_681345_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014604087.1|681459_682707_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085119.1|682812_683643_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|683766_684441_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003085124.1|684440_685259_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|685331_686810_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003109046.1|686996_687311_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003109047.1|687410_688181_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.0	7.9e-72
WP_003085132.1|688638_688839_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_096248926.1|688886_689246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|689609_690059_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_023435435.1|690080_690596_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	8.3e-33
WP_003085141.1|690592_691150_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003113199.1|691302_691629_+	bacteriophage protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	2.4e-30
WP_003085151.1|691625_692513_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003137385.1|692505_693039_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	5.2e-62
WP_015502281.1|693040_695149_+|tail	tail fiber	tail	Q9ZXK6	Pseudomonas_virus	52.3	6.5e-225
WP_003085172.1|695157_695598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003109051.1|695640_696801_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	2.7e-188
WP_003085175.1|696813_697317_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|697331_697676_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_096248925.1|697845_700083_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_023112718.1|700092_700965_+	hypothetical protein	NA	A0A2H4J875	uncultured_Caudovirales_phage	52.1	1.3e-75
WP_003101635.1|700939_701146_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_023095155.1|701203_702193_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	2.2e-106
WP_003161924.1|702225_702855_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.5	5.5e-87
WP_003121852.1|702851_703214_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	4.2e-15
WP_003118919.1|703210_703468_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_024928380.1|703815_704421_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	4.6e-75
WP_003085203.1|704422_705472_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_096248924.1|705468_706305_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.5	6.2e-70
>prophage 3
NZ_CP039988	Pseudomonas aeruginosa strain T2436 chromosome, complete genome	6782092	1450070	1459099	6782092		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1450070_1450706_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_017148388.1|1450751_1451645_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1451749_1452754_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1453180_1453504_-	Ferredoxin 1	NA	NA	NA	NA	NA
WP_003122151.1|1453570_1456138_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	2.4e-24
WP_003092265.1|1456263_1457271_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|1457418_1457925_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_058176080.1|1458058_1459099_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	3.9e-114
>prophage 4
NZ_CP039988	Pseudomonas aeruginosa strain T2436 chromosome, complete genome	6782092	2336949	2365975	6782092	tRNA,holin,terminase,transposase,integrase,tail	Pseudomonas_phage(66.67%)	40	2337236:2337250	2340581:2340595
WP_016562059.1|2336949_2337930_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
2337236:2337250	attL	TCGCGACCGAGCATC	NA	NA	NA	NA
WP_031627948.1|2338112_2339228_+|integrase	site-specific integrase	integrase	A0A2K8I325	Pseudomonas_phage	60.3	2.1e-118
WP_003130859.1|2339201_2339477_-	hypothetical protein	NA	A0A2K8HN48	Pseudomonas_phage	65.5	3.4e-25
WP_003130860.1|2339580_2339793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101476525.1|2339932_2341094_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.6	5.6e-85
2340581:2340595	attR	TCGCGACCGAGCATC	NA	NA	NA	NA
WP_003130870.1|2341240_2341600_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_153562506.1|2341969_2342290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031637682.1|2342317_2342968_-	hypothetical protein	NA	A0A0U4J8W4	Pseudomonas_phage	97.2	1.6e-121
WP_023088260.1|2343101_2343674_-	S24 family peptidase	NA	H2BD63	Pseudomonas_phage	91.7	1.9e-86
WP_003451709.1|2344050_2344269_+	helix-turn-helix domain-containing protein	NA	A0A2D1GND2	Pseudomonas_phage	64.7	2.9e-19
WP_033987544.1|2344300_2344873_+	hypothetical protein	NA	H2BD67	Pseudomonas_phage	98.9	3.5e-101
WP_096248995.1|2344875_2345760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003103373.1|2345809_2346418_+	hypothetical protein	NA	A0A2H4J6S4	uncultured_Caudovirales_phage	43.9	3.4e-41
WP_023083722.1|2346410_2346854_+	RusA family crossover junction endodeoxyribonuclease	NA	H2BD71	Pseudomonas_phage	69.2	1.4e-52
WP_096248996.1|2346882_2347752_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	84.4	1.6e-140
WP_034008242.1|2347811_2348120_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_023101093.1|2348094_2348370_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A0A1IU40	Pseudomonas_phage	64.9	2.7e-06
WP_031685794.1|2348670_2348970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003103377.1|2349077_2349458_+	hypothetical protein	NA	H2BDJ3	Pseudomonas_virus	67.5	4.8e-38
WP_003103378.1|2349432_2349780_+|holin	phage holin family protein	holin	Q9MC42	Pseudomonas_phage	61.3	1.9e-25
WP_003103379.1|2349846_2350302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023101096.1|2350359_2350956_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	61.9	3.3e-49
WP_023115880.1|2350942_2352238_+	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	58.5	1.4e-145
WP_033990710.1|2352240_2353596_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	45.8	3.7e-96
WP_023115882.1|2353592_2354672_+	hypothetical protein	NA	A0A0S2SY77	Pseudomonas_phage	97.7	3.8e-197
WP_034075297.1|2354654_2355170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033990719.1|2355322_2356066_+	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	74.5	8.4e-87
WP_003103391.1|2356075_2357047_+	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	64.7	9.3e-110
WP_023088300.1|2357088_2357574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033990709.1|2357557_2358022_+	hypothetical protein	NA	H9EB35	Vibrio_phage	36.4	4.0e-10
WP_034075295.1|2358021_2358411_+	hypothetical protein	NA	A0A2H4JAS3	uncultured_Caudovirales_phage	55.0	2.1e-33
WP_023087397.1|2358414_2359089_+	hypothetical protein	NA	A0A0S2SY81	Pseudomonas_phage	96.4	1.0e-115
WP_003451667.1|2359085_2359496_+	hypothetical protein	NA	A0A1B0VMI0	Pseudomonas_phage	43.4	2.5e-24
WP_012075337.1|2359563_2360217_+|tail	phage tail protein	tail	A0A2H4IZV5	uncultured_Caudovirales_phage	52.8	7.7e-60
WP_023115887.1|2360226_2360607_+	hypothetical protein	NA	A0A1B0VMH4	Pseudomonas_phage	44.9	4.8e-22
WP_049246843.1|2360669_2360933_+	phage protein	NA	A0A2R3UAE2	Siphoviridae_environmental_samples	46.0	2.7e-16
WP_034075292.1|2360929_2364121_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	40.5	1.1e-156
WP_012075340.1|2364126_2364465_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	99.1	3.1e-60
WP_033946795.1|2364461_2365211_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	99.6	3.9e-148
WP_003160548.1|2365213_2365975_+	C40 family peptidase	NA	A0A0S2SY75	Pseudomonas_phage	93.9	1.4e-140
>prophage 5
NZ_CP039988	Pseudomonas aeruginosa strain T2436 chromosome, complete genome	6782092	2604829	2658748	6782092	tRNA,integrase,terminase	Pseudomonas_phage(71.7%)	58	2595838:2595854	2625457:2625473
2595838:2595854	attL	GCCGGTGCGGCATCCGG	NA	NA	NA	NA
WP_003097631.1|2604829_2606110_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003108773.1|2606111_2607509_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|2607513_2608488_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003108776.1|2608575_2609559_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	9.3e-142
WP_003090393.1|2609555_2609891_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|2609887_2610193_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2610192_2610552_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|2610548_2610944_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|2611054_2611723_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
WP_058151720.1|2612058_2613126_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	68.7	1.1e-135
WP_003116724.1|2613127_2613364_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	53.2	3.8e-17
WP_058158460.1|2613442_2615758_-	hypothetical protein	NA	A0A0U1UNM2	Pseudomonas_phage	47.1	1.2e-152
WP_023131627.1|2615855_2616362_-	hypothetical protein	NA	L7TI83	Pseudomonas_virus	95.8	3.4e-87
WP_023131628.1|2616358_2616847_-	DUF1643 domain-containing protein	NA	A0A0U1W068	Pseudomonas_phage	93.8	2.4e-90
WP_016852961.1|2616843_2617521_-	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	59.0	1.8e-64
WP_128623046.1|2617517_2617961_-	hypothetical protein	NA	A0A2K8HVL6	Pseudomonas_phage	80.3	2.0e-59
WP_128623045.1|2617957_2619736_-	DNA cytosine methyltransferase	NA	Q9ZXI4	Pseudomonas_virus	97.6	6.8e-300
WP_128623044.1|2619732_2622363_-	DNA methylase N-4	NA	H2BD45	Pseudomonas_phage	97.8	0.0e+00
WP_004355019.1|2622631_2622946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004354996.1|2623051_2624272_-	recombination-associated protein RdgC	NA	L7TP07	Pseudomonas_virus	98.0	1.5e-162
WP_034010289.1|2624298_2624796_-	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	100.0	9.9e-92
WP_034010291.1|2624799_2625405_-	3'-5' exonuclease	NA	A0A0U1W072	Pseudomonas_phage	99.5	4.7e-112
WP_128623093.1|2625534_2626551_-	DUF1351 domain-containing protein	NA	A0A0U1UNR0	Pseudomonas_phage	98.5	1.4e-119
2625457:2625473	attR	CCGGATGCCGCACCGGC	NA	NA	NA	NA
WP_034010293.1|2626555_2627311_-	hypothetical protein	NA	A0A0U1UNQ9	Pseudomonas_phage	99.6	9.0e-145
WP_034010295.1|2627572_2627944_-	hypothetical protein	NA	A0A2K8HNX4	Pseudomonas_phage	98.4	1.3e-59
WP_023082364.1|2627940_2628162_-	hypothetical protein	NA	A0A0U1SZL8	Pseudomonas_phage	94.5	9.3e-34
WP_019396719.1|2628288_2628792_-	hypothetical protein	NA	J7I0S8	Pseudomonas_phage	97.6	1.1e-98
WP_022579931.1|2629271_2629643_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	99.2	1.6e-62
WP_020750452.1|2629677_2629890_-	hypothetical protein	NA	L7TKR9	Pseudomonas_virus	97.1	5.8e-33
WP_031641801.1|2629943_2630123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015649351.1|2630408_2630615_-	hypothetical protein	NA	A0A0U4IJ22	Pseudomonas_phage	97.1	3.9e-34
WP_023082999.1|2630625_2630832_-	hypothetical protein	NA	A0A0U4B0I0	Pseudomonas_phage	94.1	2.2e-29
WP_128623094.1|2631608_2631929_+	DUF1654 domain-containing protein	NA	A0A127KNY9	Pseudomonas_phage	91.3	2.6e-45
WP_128623105.1|2632428_2633049_-	helix-turn-helix transcriptional regulator	NA	J7I0S2	Pseudomonas_phage	91.2	4.0e-106
WP_031692832.1|2633206_2633410_+	hypothetical protein	NA	J7I423	Pseudomonas_phage	98.5	9.1e-28
WP_102969951.1|2633509_2634526_+	phage replication protein	NA	A0A0U1UNR4	Pseudomonas_phage	99.7	7.3e-150
WP_128623096.1|2634512_2635370_+	hypothetical protein	NA	A0A0U1UNR3	Pseudomonas_phage	98.9	2.4e-146
WP_019486230.1|2635362_2635914_+	hypothetical protein	NA	A0A0U1W0G1	Pseudomonas_phage	99.5	2.2e-100
WP_004354944.1|2635913_2636528_+	hypothetical protein	NA	A0A0U1VZM0	Pseudomonas_phage	100.0	4.3e-113
WP_019486228.1|2636606_2637101_+	hypothetical protein	NA	A0A0U1VYN2	Pseudomonas_phage	99.4	4.2e-82
WP_004349191.1|2637480_2638047_+	hypothetical protein	NA	A0A2K8HN72	Pseudomonas_phage	94.7	4.2e-94
WP_127891063.1|2638043_2639327_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2K8HZU7	Pseudomonas_phage	99.5	3.2e-259
WP_127891062.1|2639336_2641655_+	hypothetical protein	NA	A0A2K8HKC3	Pseudomonas_phage	99.7	0.0e+00
WP_155375932.1|2641801_2642932_+	hypothetical protein	NA	Q5QF43	Pseudomonas_virus	97.6	5.4e-178
WP_004349199.1|2642944_2644237_+	DUF4043 family protein	NA	A0A2K8IBP1	Pseudomonas_phage	100.0	2.2e-252
WP_010793302.1|2644295_2644775_+	hypothetical protein	NA	A0A2K8HNV7	Pseudomonas_phage	100.0	6.4e-80
WP_034010308.1|2644839_2645712_+	hypothetical protein	NA	A0A0U1UNM5	Pseudomonas_phage	99.3	1.2e-164
WP_034010309.1|2645708_2646386_+	hypothetical protein	NA	A0A0U1UNR8	Pseudomonas_phage	99.6	2.5e-130
WP_004349207.1|2646382_2646589_+	hypothetical protein	NA	A0A0U1SXT5	Pseudomonas_phage	100.0	1.3e-29
WP_004349209.1|2646569_2646977_+	hypothetical protein	NA	A0A0U1UNR7	Pseudomonas_phage	100.0	8.7e-70
WP_020750783.1|2647000_2647426_+	hypothetical protein	NA	A0A2K8HN63	Pseudomonas_phage	99.3	2.9e-84
WP_004354920.1|2647425_2648283_+	hypothetical protein	NA	A0A0U1VYN7	Pseudomonas_phage	100.0	4.0e-157
WP_128623115.1|2648285_2651249_+	hypothetical protein	NA	A0A0U1W084	Pseudomonas_phage	98.3	0.0e+00
WP_019486217.1|2651248_2652439_+	hypothetical protein	NA	A0A2K8HL79	Pseudomonas_phage	97.7	3.8e-222
WP_010793297.1|2652506_2653097_+	hypothetical protein	NA	A0A0U1VYN6	Pseudomonas_phage	99.0	8.1e-101
WP_019486216.1|2653101_2655699_+	hypothetical protein	NA	A0A0U1W0G7	Pseudomonas_phage	99.3	0.0e+00
WP_079200511.1|2656249_2656855_+	hypothetical protein	NA	Q5QF56	Pseudomonas_virus	81.6	2.1e-88
WP_044727374.1|2656855_2658748_+	hypothetical protein	NA	A0A0U1SZM6	Pseudomonas_phage	99.3	7.2e-183
>prophage 6
NZ_CP039988	Pseudomonas aeruginosa strain T2436 chromosome, complete genome	6782092	2662773	2676157	6782092	holin	Pseudomonas_phage(75.0%)	8	NA	NA
WP_058160662.1|2662773_2672643_+	PLxRFG domain-containing protein	NA	L7TID4	Pseudomonas_virus	97.1	0.0e+00
WP_004349234.1|2672737_2672995_+|holin	holin	holin	A0A0U1UNM6	Pseudomonas_phage	98.8	6.8e-36
WP_033949896.1|2672978_2673512_+	glycoside hydrolase family protein	NA	A0A0U1UNS2	Pseudomonas_phage	97.7	2.8e-100
WP_033957455.1|2673508_2674027_+	hypothetical protein	NA	A0A0U1UNS0	Pseudomonas_phage	95.9	1.1e-69
WP_033949890.1|2674037_2674631_+	DUF1737 domain-containing protein	NA	A0A0U1VYP2	Pseudomonas_phage	98.0	1.0e-74
WP_071536198.1|2674707_2675337_+	DUF4124 domain-containing protein	NA	A0A2K8IBL8	Pseudomonas_phage	61.7	5.5e-55
WP_023082390.1|2675374_2675641_+	hypothetical protein	NA	L7TP56	Pseudomonas_virus	100.0	6.3e-45
WP_128622988.1|2675644_2676157_-	hypothetical protein	NA	A0A2K8HVM8	Pseudomonas_phage	92.9	9.2e-93
>prophage 7
NZ_CP039988	Pseudomonas aeruginosa strain T2436 chromosome, complete genome	6782092	3788235	3856810	6782092	tRNA,holin,terminase	Pseudomonas_phage(58.18%)	63	NA	NA
WP_078452316.1|3788235_3788868_-	DUF4124 domain-containing protein	NA	A0A2K8IBL8	Pseudomonas_phage	49.3	9.2e-42
WP_004349239.1|3788976_3789570_-	DUF1737 domain-containing protein	NA	A0A0U1VYP2	Pseudomonas_phage	89.8	5.7e-70
WP_004349238.1|3789580_3790102_-	hypothetical protein	NA	L7THB0	Pseudomonas_virus	84.4	8.6e-62
WP_023091947.1|3790105_3790633_-	glycoside hydrolase family protein	NA	A0A0U1UNS2	Pseudomonas_phage	96.6	2.9e-97
WP_004349234.1|3790616_3790874_-|holin	holin	holin	A0A0U1UNM6	Pseudomonas_phage	98.8	6.8e-36
WP_096229650.1|3790968_3800802_-	PLxRFG domain-containing protein	NA	L7TID4	Pseudomonas_virus	92.4	0.0e+00
WP_023091949.1|3802295_3804383_-	hypothetical protein	NA	Q5QF54	Pseudomonas_virus	99.3	0.0e+00
WP_023091950.1|3804464_3806357_-	hypothetical protein	NA	L7THA5	Pseudomonas_virus	98.8	1.0e-181
WP_004349225.1|3806356_3806962_-	hypothetical protein	NA	Q5QF56	Pseudomonas_virus	100.0	2.2e-109
WP_004349223.1|3807512_3810020_-	hypothetical protein	NA	Q5QF48	Pseudomonas_virus	99.4	0.0e+00
WP_004349221.1|3810114_3810705_-	hypothetical protein	NA	A0A0U1VYN6	Pseudomonas_phage	100.0	1.3e-101
WP_004349219.1|3810772_3811963_-	hypothetical protein	NA	A0A0U1UNT0	Pseudomonas_phage	100.0	7.4e-226
WP_004349217.1|3811962_3814926_-	hypothetical protein	NA	A0A0U1W084	Pseudomonas_phage	100.0	0.0e+00
WP_004349215.1|3814928_3815786_-	hypothetical protein	NA	Q5QF52	Pseudomonas_virus	100.0	1.2e-156
WP_023091954.1|3816104_3816500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004349209.1|3816525_3816933_-	hypothetical protein	NA	A0A0U1UNR7	Pseudomonas_phage	100.0	8.7e-70
WP_004349207.1|3816913_3817120_-	hypothetical protein	NA	A0A0U1SXT5	Pseudomonas_phage	100.0	1.3e-29
WP_004349205.1|3817116_3817794_-	hypothetical protein	NA	A0A0U1UNR8	Pseudomonas_phage	99.6	4.3e-130
WP_004349203.1|3817790_3818663_-	hypothetical protein	NA	A0A0U1UNM5	Pseudomonas_phage	99.7	2.4e-165
WP_004349201.1|3818727_3819207_-	hypothetical protein	NA	A0A2K8HNV7	Pseudomonas_phage	99.4	8.4e-80
WP_004349199.1|3819265_3820558_-	DUF4043 family protein	NA	A0A2K8IBP1	Pseudomonas_phage	100.0	2.2e-252
WP_063456221.1|3820570_3821701_-	hypothetical protein	NA	Q5QF43	Pseudomonas_virus	97.9	2.2e-179
WP_128623117.1|3821862_3822774_-	hypothetical protein	NA	Q5QF73	Pseudomonas_virus	95.7	1.0e-163
WP_004349195.1|3822853_3825175_-	hypothetical protein	NA	L7TJP4	Pseudomonas_virus	99.0	0.0e+00
WP_023082374.1|3825184_3826468_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2K8HZU7	Pseudomonas_phage	99.5	1.2e-258
WP_004349191.1|3826464_3827031_-	hypothetical protein	NA	A0A2K8HN72	Pseudomonas_phage	94.7	4.2e-94
WP_023980885.1|3827183_3827408_+	hypothetical protein	NA	A0A0U1UNS7	Pseudomonas_phage	98.6	2.7e-33
WP_004349189.1|3827410_3827905_-	hypothetical protein	NA	A0A0U1VYN2	Pseudomonas_phage	99.4	3.2e-82
WP_023082373.1|3827983_3828598_-	hypothetical protein	NA	A0A0U1VZM0	Pseudomonas_phage	98.5	9.0e-111
WP_004349186.1|3828653_3829205_-	hypothetical protein	NA	A0A2K8I9A9	Pseudomonas_phage	98.9	4.9e-100
WP_004349183.1|3829197_3830055_-	hypothetical protein	NA	A0A2K8HNW6	Pseudomonas_phage	99.3	1.4e-146
WP_034085198.1|3830041_3831073_-	hypothetical protein	NA	A0A0U1UNR4	Pseudomonas_phage	98.3	2.7e-147
WP_004349179.1|3831074_3831275_-	Cro/Cl family transcriptional regulator	NA	A0A2K8HL98	Pseudomonas_phage	100.0	1.8e-28
WP_004349176.1|3831382_3832180_+	helix-turn-helix transcriptional regulator	NA	A0A2K8HKD5	Pseudomonas_phage	99.6	5.4e-148
WP_004349174.1|3832216_3832483_-	DUF1654 domain-containing protein	NA	A0A2K8HZW3	Pseudomonas_phage	100.0	2.3e-42
WP_004349170.1|3833116_3833323_+	hypothetical protein	NA	Q5QF70	Pseudomonas_virus	97.1	3.3e-33
WP_004349169.1|3833387_3833600_+	hypothetical protein	NA	L7TKR9	Pseudomonas_virus	94.3	4.9e-32
WP_004349168.1|3833634_3834006_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	77.2	2.9e-48
WP_034058628.1|3834062_3834632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023091958.1|3834900_3835122_+	hypothetical protein	NA	A0A0U1SZL8	Pseudomonas_phage	95.9	7.1e-34
WP_023091959.1|3835118_3835490_+	hypothetical protein	NA	A0A2K8HNX4	Pseudomonas_phage	98.4	1.3e-59
WP_023091960.1|3835760_3836459_+	hypothetical protein	NA	A0A1Y0T023	Pseudomonas_phage	54.3	1.2e-31
WP_023091961.1|3836455_3838093_+	hypothetical protein	NA	A0A2H4J6F0	uncultured_Caudovirales_phage	63.1	5.5e-139
WP_004349164.1|3838214_3838820_+	3'-5' exonuclease	NA	A0A0U1W072	Pseudomonas_phage	100.0	7.3e-113
WP_023091962.1|3838823_3839321_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	98.8	4.9e-91
WP_023091963.1|3839347_3840568_+	recombination-associated protein RdgC	NA	L7TP07	Pseudomonas_virus	97.7	1.7e-161
WP_004355019.1|3840673_3840988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124117754.1|3841277_3841604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004349415.1|3841720_3842521_+	hypothetical protein	NA	A0A1J0GVP2	Pseudoalteromonas_phage	47.4	8.6e-45
WP_023980880.1|3842520_3844290_+	DNA methyltransferase	NA	Q9ZXI4	Pseudomonas_virus	94.0	1.5e-286
WP_023091964.1|3844471_3845536_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003451766.1|3845539_3845863_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_023091965.1|3846529_3846904_+	hypothetical protein	NA	Q5QF32	Pseudomonas_virus	96.8	2.2e-67
WP_023091966.1|3846911_3847106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004349158.1|3847098_3847605_+	hypothetical protein	NA	L7TI83	Pseudomonas_virus	94.6	1.8e-85
WP_004349157.1|3847702_3848377_+	hypothetical protein	NA	A0A2K8HL62	Pseudomonas_phage	88.4	2.6e-26
WP_004349155.1|3849457_3849691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004349153.1|3849961_3850195_+	AlpA family phage regulatory protein	NA	A0A0U1W0F1	Pseudomonas_phage	100.0	2.4e-40
WP_004349150.1|3850195_3851431_-	DUF4102 domain-containing protein	NA	A0A0U1UNT3	Pseudomonas_phage	98.8	8.4e-233
WP_003087898.1|3852215_3853070_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.7	3.0e-27
WP_003113587.1|3853127_3854510_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	31.6	6.9e-42
WP_003139945.1|3854519_3856190_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	60.3	4.8e-199
WP_003087890.1|3856312_3856810_+	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	32.9	1.4e-13
>prophage 8
NZ_CP039988	Pseudomonas aeruginosa strain T2436 chromosome, complete genome	6782092	4725606	4768531	6782092	integrase,terminase,tail	Pseudomonas_phage(75.51%)	59	4722609:4722668	4767637:4767700
4722609:4722668	attL	ATGGCGGAGAGATAGGGATTTGAACCCTAGGAGCCATTGCTGACTCAACGGATTTCGAAT	NA	NA	NA	NA
WP_128622954.1|4725606_4728150_-	hypothetical protein	NA	A0A193GZ61	Enterobacter_phage	44.9	1.3e-198
WP_128622955.1|4728149_4730072_-	hypothetical protein	NA	A0A2H4J9W0	uncultured_Caudovirales_phage	38.8	4.4e-95
WP_128622956.1|4730068_4732105_-	hypothetical protein	NA	W6MYA2	Pseudomonas_phage	41.1	3.5e-58
WP_017001675.1|4732104_4732569_-	hypothetical protein	NA	W6MVK9	Pseudomonas_phage	97.4	1.1e-73
WP_023127492.1|4732553_4733033_-	hypothetical protein	NA	W6MW30	Pseudomonas_phage	95.0	1.3e-83
WP_128622957.1|4733013_4735353_-	hypothetical protein	NA	W6MWW6	Pseudomonas_phage	98.1	0.0e+00
WP_128622958.1|4735349_4735979_-	hypothetical protein	NA	W6MVD9	Pseudomonas_phage	98.1	8.1e-115
WP_017001680.1|4736208_4736667_-	hypothetical protein	NA	W6MVK6	Pseudomonas_phage	99.3	5.2e-71
WP_023125056.1|4736677_4737682_-	hypothetical protein	NA	W6MW28	Pseudomonas_phage	99.7	4.5e-184
WP_023980925.1|4737694_4738318_-	hypothetical protein	NA	W6MWW5	Pseudomonas_phage	97.1	1.1e-82
WP_033990173.1|4738314_4738626_-	hypothetical protein	NA	W6MVD5	Pseudomonas_phage	93.2	5.5e-48
WP_128622959.1|4738626_4740315_-|tail	phage tail protein	tail	W6MYA0	Pseudomonas_phage	98.8	0.0e+00
WP_017001685.1|4740316_4740571_-	hypothetical protein	NA	W6MVK3	Pseudomonas_phage	95.2	2.2e-34
WP_058171613.1|4740582_4742007_-	hypothetical protein	NA	W6MW26	Pseudomonas_phage	98.1	1.0e-282
WP_124167595.1|4742032_4742479_-|terminase	terminase	terminase	W6MWW3	Pseudomonas_phage	98.0	5.1e-79
WP_128622960.1|4742714_4743203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128622980.1|4743311_4743641_-	hypothetical protein	NA	B5WZZ2	Pseudomonas_phage	92.7	9.0e-49
WP_128622961.1|4743833_4744268_-	lysozyme	NA	A0A0S2SYD0	Pseudomonas_phage	51.4	4.1e-33
WP_034063048.1|4744264_4744657_-	hypothetical protein	NA	B5WZY9	Pseudomonas_phage	99.2	5.6e-66
WP_128622962.1|4745480_4746053_-	hypothetical protein	NA	H2BDI9	Pseudomonas_virus	37.4	2.6e-27
WP_058836762.1|4746049_4747063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128622963.1|4747062_4747365_-	DUF3310 domain-containing protein	NA	Q774Z7	Bordetella_phage	78.5	2.4e-24
WP_128622964.1|4747364_4747748_-	hypothetical protein	NA	A0A140XG32	Salmonella_phage	35.0	1.2e-07
WP_128622965.1|4747744_4747963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025997431.1|4747959_4748262_-	hypothetical protein	NA	A0A0H5ARP9	Pseudomonas_phage	70.0	3.4e-34
WP_128622966.1|4748258_4748528_-	hypothetical protein	NA	B5WZY5	Pseudomonas_phage	50.0	1.3e-13
WP_003158992.1|4748524_4748926_-	NinB family protein	NA	A0A059VG13	Pseudomonas_phage	53.6	5.8e-34
WP_023125070.1|4748918_4749134_-	hypothetical protein	NA	A0A125RNK4	Pseudomonas_phage	93.0	1.2e-33
WP_128622967.1|4749275_4750091_-	AAA family ATPase	NA	A0A059VK34	Pseudomonas_phage	53.8	4.0e-74
WP_128622968.1|4750080_4750881_-	phage replication protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	49.8	4.4e-65
WP_033990280.1|4750956_4751160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023125075.1|4751179_4751380_-	hypothetical protein	NA	A0A2H4J528	uncultured_Caudovirales_phage	64.6	1.1e-14
WP_079992473.1|4751730_4752402_+	helix-turn-helix domain-containing protein	NA	B5WZX5	Pseudomonas_phage	51.4	2.5e-61
WP_079866880.1|4752837_4753227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128622969.1|4753844_4754108_+	hypothetical protein	NA	H2BD57	Pseudomonas_phage	95.4	3.1e-44
WP_003140707.1|4754149_4754689_+	hypothetical protein	NA	J7HXB1	Pseudomonas_phage	99.4	1.6e-95
WP_070874785.1|4754745_4755114_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	97.5	1.6e-62
WP_128666723.1|4755588_4756587_+	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	80.7	1.0e-74
WP_128622971.1|4756769_4756955_+	DUF551 domain-containing protein	NA	H2BDH1	Pseudomonas_virus	91.8	6.2e-31
WP_025297920.1|4756971_4757283_+	hypothetical protein	NA	B5WZX2	Pseudomonas_phage	39.3	5.7e-05
WP_033972687.1|4757317_4757731_+	hypothetical protein	NA	A0A0U4JNY7	Pseudomonas_phage	98.5	2.8e-76
WP_128622972.1|4758044_4758341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058199615.1|4758337_4758703_+	hypothetical protein	NA	W6MYA8	Pseudomonas_phage	95.8	1.4e-63
WP_058199614.1|4758699_4759227_+	hypothetical protein	NA	A0A127KN62	Pseudomonas_phage	56.6	1.5e-53
WP_128622973.1|4759223_4759511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128622974.1|4759961_4760282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070136378.1|4760327_4760861_+	hypothetical protein	NA	A0A0F7L6F4	uncultured_marine_virus	35.6	9.2e-11
WP_128622975.1|4760829_4761447_+	YqaJ-like viral recombinase	NA	S0A2A9	Cellulophaga_phage	46.8	6.9e-42
WP_128622976.1|4761450_4761729_+	hypothetical protein	NA	A0A0H5AW97	Pseudomonas_phage	71.4	1.1e-23
WP_033991227.1|4761792_4762434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052151589.1|4762596_4762821_+	hypothetical protein	NA	A0A0U4J8X2	Pseudomonas_phage	98.6	2.7e-36
WP_124209041.1|4764043_4764271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033989678.1|4764263_4764446_+	hypothetical protein	NA	A0A2H5BQE7	Pseudomonas_phage	90.4	4.5e-18
WP_094867540.1|4764438_4764855_+	hypothetical protein	NA	H2BDE9	Pseudomonas_virus	94.1	8.5e-20
WP_128622977.1|4764899_4765217_+	hypothetical protein	NA	A0A0U4JVQ0	Pseudomonas_phage	92.4	2.4e-51
WP_128622981.1|4765431_4765710_+	hypothetical protein	NA	B5WZV5	Pseudomonas_phage	62.0	9.6e-20
WP_128622978.1|4765702_4766239_+	ead/Ea22-like family protein	NA	A0A0S2SY48	Pseudomonas_phage	52.5	1.8e-30
WP_074198342.1|4766553_4767528_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	98.8	1.8e-177
WP_003108622.1|4767820_4768531_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	37.6	1.5e-40
4767637:4767700	attR	ATGGCGGAGAGATAGGGATTTGAACCCTAGGAGCCATTGCTGACTCAACGGATTTCGAATCCGT	NA	NA	NA	NA
>prophage 9
NZ_CP039988	Pseudomonas aeruginosa strain T2436 chromosome, complete genome	6782092	4981249	4992569	6782092	integrase	Pseudomonas_phage(90.91%)	15	4980706:4980732	4991165:4991191
4980706:4980732	attL	GGGTTCAAATCCCCCCGGCTCCACCAA	NA	NA	NA	NA
WP_058143883.1|4981249_4982272_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	54.3	2.9e-98
WP_058143884.1|4982271_4983564_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	96.8	4.5e-253
WP_058148051.1|4983820_4985083_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	54.3	1.0e-116
WP_003133726.1|4985084_4985435_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	40.2	1.6e-19
WP_126859635.1|4985444_4986389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003124953.1|4986705_4986924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034018048.1|4986937_4987189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|4987200_4987293_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_034018047.1|4987309_4987744_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	99.3	8.4e-63
WP_058143887.1|4987877_4988255_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	98.4	1.1e-61
WP_034017784.1|4988258_4988549_-	hypothetical protein	NA	Q56VP7	Pseudomonas_phage	96.9	7.4e-55
WP_058143888.1|4988552_4988765_-	hypothetical protein	NA	Q56VP8	Pseudomonas_phage	92.9	3.7e-32
WP_024918435.1|4988767_4988983_-	hypothetical protein	NA	Q56VP9	Pseudomonas_phage	95.8	2.8e-35
WP_128623003.1|4989904_4991023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034075128.1|4991363_4992569_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	47.8	2.6e-101
4991165:4991191	attR	GGGTTCAAATCCCCCCGGCTCCACCAA	NA	NA	NA	NA
>prophage 10
NZ_CP039988	Pseudomonas aeruginosa strain T2436 chromosome, complete genome	6782092	5674965	5714481	6782092	tRNA,coat,integrase	Enterobacteria_phage(14.29%)	34	5694075:5694090	5718933:5718948
WP_023100253.1|5674965_5675514_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003146046.1|5675544_5676078_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_004355220.1|5676077_5676620_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003121045.1|5676638_5677427_+	molecular chaperone	NA	NA	NA	NA	NA
WP_034074165.1|5677443_5679819_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_003099330.1|5679815_5680763_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_034074163.1|5680764_5682138_-	MFS transporter	NA	NA	NA	NA	NA
WP_021264089.1|5682417_5683440_-	ferrochelatase	NA	NA	NA	NA	NA
WP_003114699.1|5683436_5684354_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_003094987.1|5684767_5685751_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021264088.1|5685903_5686860_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_003141623.1|5686869_5687769_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	39.1	8.5e-17
WP_021264087.1|5687765_5689211_+	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	28.0	1.1e-45
WP_003099307.1|5689336_5689858_-	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	69.8	1.4e-59
WP_003099300.1|5689991_5690789_-	glutamate racemase	NA	NA	NA	NA	NA
WP_033996051.1|5690778_5691537_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_022580113.1|5691530_5692361_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003094997.1|5692362_5693445_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	48.3	4.3e-07
WP_003095001.1|5693462_5694731_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
5694075:5694090	attL	CAGGCTGGCGCGCTCC	NA	NA	NA	NA
WP_003135130.1|5694874_5696647_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003095005.1|5696651_5697269_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_009878189.1|5697270_5698119_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003099281.1|5698285_5699227_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	4.1e-46
WP_003095013.1|5699343_5699958_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_003099278.1|5699999_5700584_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003099270.1|5700624_5701725_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_034074160.1|5701932_5703144_+|integrase	site-specific integrase	integrase	B7SYF8	Stenotrophomonas_phage	35.7	1.6e-58
WP_024914550.1|5703389_5704451_+	Fic family protein	NA	NA	NA	NA	NA
WP_034074158.1|5704577_5707376_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_024914548.1|5707391_5709056_+	type I restriction-modification system subunit M	NA	A0A1V0SLK8	Klosneuvirus	30.0	4.9e-26
WP_079385712.1|5709052_5710669_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_034074155.1|5710665_5712504_+	restriction system-associated AAA family ATPase	NA	NA	NA	NA	NA
WP_024914545.1|5712503_5713562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024914544.1|5713617_5714481_-|integrase	integrase	integrase	NA	NA	NA	NA
5718933:5718948	attR	GGAGCGCGCCAGCCTG	NA	NA	NA	NA
>prophage 11
NZ_CP039988	Pseudomonas aeruginosa strain T2436 chromosome, complete genome	6782092	5933937	5975120	6782092	capsid,head,transposase,integrase,tail	Pseudomonas_phage(90.74%)	55	5943832:5943848	5972667:5972683
WP_015649550.1|5933937_5934162_-	hypothetical protein	NA	H1ZZG9	Pseudomonas_virus	100.0	4.2e-34
WP_034040253.1|5934240_5934459_-	hypothetical protein	NA	I6PBD6	Pseudomonas_phage	88.9	1.3e-27
WP_034040256.1|5934455_5934758_-	hypothetical protein	NA	A0SMR0	Pseudomonas_virus	84.0	5.2e-43
WP_034040259.1|5934757_5935603_-	DUF2793 domain-containing protein	NA	I6P8E4	Pseudomonas_phage	94.7	3.8e-152
WP_128622592.1|5935599_5937807_-	hypothetical protein	NA	I6PCB1	Pseudomonas_phage	98.5	0.0e+00
WP_004367213.1|5937796_5938015_-	hypothetical protein	NA	I6P9E8	Pseudomonas_phage	100.0	3.4e-36
WP_003126844.1|5938011_5938251_-	hypothetical protein	NA	I6P9F0	Pseudomonas_phage	98.7	4.4e-37
WP_052163572.1|5938259_5939081_-	DUF2163 domain-containing protein	NA	I6PBD5	Pseudomonas_phage	99.2	2.1e-155
WP_034040267.1|5939070_5940774_-	hypothetical protein	NA	B7SE08	Pseudomonas_virus	98.2	0.0e+00
WP_014604005.1|5940773_5941697_-	hypothetical protein	NA	B7SE07	Pseudomonas_virus	93.8	5.4e-176
WP_128622769.1|5941698_5942655_-	hypothetical protein	NA	A0A0A7DK02	Pseudomonas_phage	96.5	6.6e-185
WP_033965901.1|5942662_5946505_-|tail	phage tail tape measure protein	tail	A0A0S4L7E6	Pseudomonas_phage	95.2	0.0e+00
5943832:5943848	attL	TCGCCTGCAGCTTCTGC	NA	NA	NA	NA
WP_003152203.1|5946731_5947238_-	hypothetical protein	NA	J9STK7	Pseudomonas_phage	96.4	1.3e-86
WP_003094267.1|5947239_5947992_-	hypothetical protein	NA	A0A0S4L1I6	Pseudomonas_phage	100.0	4.6e-141
WP_003139972.1|5947995_5948205_-	hypothetical protein	NA	A0A0S4L313	Pseudomonas_phage	100.0	2.4e-31
WP_003094263.1|5948201_5948657_-	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	100.0	8.5e-82
WP_003094261.1|5948658_5949168_-	DUF1320 domain-containing protein	NA	A0A0S4L0B5	Pseudomonas_phage	100.0	1.0e-91
WP_003094258.1|5949175_5949502_-	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	100.0	1.1e-51
WP_003094256.1|5949501_5949696_-	hypothetical protein	NA	A0A0S4L2Y0	Pseudomonas_phage	100.0	6.0e-29
WP_128622770.1|5949742_5950672_-|capsid	phage capsid protein	capsid	Q5ZQX7	Pseudomonas_phage	97.1	1.1e-173
WP_003152198.1|5950683_5951061_-	hypothetical protein	NA	A0A0S4L3C3	Pseudomonas_phage	98.4	3.5e-57
WP_023442965.1|5951064_5952312_-	peptidase	NA	J9SGT4	Pseudomonas_phage	93.3	7.3e-184
WP_031630686.1|5952530_5953103_-	phage virion morphogenesis protein	NA	J9SN67	Pseudomonas_phage	96.8	4.3e-99
WP_031630688.1|5953099_5954350_-|head	phage head morphogenesis protein	head	J9SWK6	Pseudomonas_phage	100.0	1.5e-240
WP_003152194.1|5954349_5955828_-	DUF935 family protein	NA	J9RWN4	Pseudomonas_phage	100.0	1.4e-287
WP_003139988.1|5955827_5957531_-	hypothetical protein	NA	A0A0S4L072	Pseudomonas_phage	99.8	0.0e+00
WP_003094238.1|5957532_5958108_-	DUF3486 family protein	NA	J9SNV5	Pseudomonas_phage	100.0	7.4e-91
WP_003139994.1|5958113_5958410_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	100.0	4.6e-52
WP_003094234.1|5958411_5958801_-	hypothetical protein	NA	A0A0S4L2V7	Pseudomonas_phage	100.0	5.2e-64
WP_023657073.1|5958804_5959416_-	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	97.5	3.5e-99
WP_031638435.1|5959596_5960226_-	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	99.5	8.4e-120
WP_003094225.1|5960383_5960641_-	membrane protein	NA	A0A0S4L5C0	Pseudomonas_phage	100.0	7.2e-38
WP_031636321.1|5960853_5961609_+	hypothetical protein	NA	A0A0S4L2W3	Pseudomonas_phage	84.3	2.5e-70
WP_031636322.1|5961581_5961785_-	hypothetical protein	NA	A0A0S4L2S2	Pseudomonas_phage	65.7	5.9e-19
WP_126620882.1|5961801_5962269_-	hypothetical protein	NA	J9SVN1	Pseudomonas_phage	79.9	2.4e-63
WP_044264506.1|5962293_5962680_-	helix-turn-helix domain-containing protein	NA	J9SH16	Pseudomonas_phage	65.4	3.9e-11
WP_023123664.1|5962769_5963000_+	DNA-binding protein	NA	J9RWM8	Pseudomonas_phage	100.0	3.2e-37
WP_023127889.1|5963284_5963509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031636324.1|5963632_5964121_+	hypothetical protein	NA	J9SVV8	Pseudomonas_phage	98.8	1.4e-90
WP_031636325.1|5964113_5964374_+	hypothetical protein	NA	J9RWD0	Pseudomonas_phage	94.2	4.3e-38
WP_031636327.1|5964370_5964685_+	hypothetical protein	NA	J9SVM2	Pseudomonas_phage	99.0	2.0e-50
WP_031636328.1|5964694_5965669_+	hypothetical protein	NA	J9SND0	Pseudomonas_phage	88.0	1.5e-139
WP_031636329.1|5965672_5967457_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	J9STP5	Pseudomonas_phage	98.0	0.0e+00
WP_016852441.1|5967456_5968623_+	AAA family ATPase	NA	J9SVV1	Pseudomonas_phage	100.0	1.0e-216
WP_016852440.1|5968624_5968966_+	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	99.1	3.5e-56
WP_014603990.1|5968962_5969247_+	hypothetical protein	NA	J9SGZ7	Pseudomonas_phage	100.0	3.4e-44
WP_033953838.1|5969246_5969927_+	hypothetical protein	NA	J9SNC1	Pseudomonas_phage	97.3	8.4e-126
WP_033953841.1|5969916_5970450_+	hypothetical protein	NA	J9STN6	Pseudomonas_phage	98.9	5.6e-93
WP_033953843.1|5970442_5970643_+	bacteriophage protein	NA	J9RWL7	Pseudomonas_phage	95.5	4.8e-29
WP_033953845.1|5970635_5971259_+	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	93.2	1.1e-103
WP_016852434.1|5971944_5972136_+	hypothetical protein	NA	J9RW45	Pseudomonas_phage	100.0	5.0e-28
WP_034075666.1|5972135_5972603_+	hypothetical protein	NA	J9STM8	Pseudomonas_phage	83.2	2.5e-60
WP_031638311.1|5972589_5973153_+	regulatory protein GemA	NA	Q5ZR14	Pseudomonas_phage	98.9	5.6e-99
5972667:5972683	attR	GCAGAAGCTGCAGGCGA	NA	NA	NA	NA
WP_003094179.1|5973155_5973515_+	hypothetical protein	NA	A0A0S4L0M4	Pseudomonas_phage	100.0	6.5e-61
WP_003105134.1|5974421_5975120_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	1.7e-12
>prophage 1
NZ_CP039989	Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence	422811	121154	128608	422811	protease	Acinetobacter_phage(33.33%)	9	NA	NA
WP_020191931.1|121154_121913_+	Trehalose-6-phosphatase	NA	A0A172Q0Q4	Acinetobacter_phage	26.8	2.5e-09
WP_020191932.1|121905_123000_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.4	2.8e-38
WP_020191933.1|122999_123947_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_020191934.1|123946_124675_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_010794508.1|124677_125271_+	TerD family protein	NA	A0A2I7QY07	Vibrio_phage	36.8	1.8e-23
WP_020191935.1|125267_126458_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_010792504.1|126505_126955_+	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	30.2	1.3e-10
WP_010792503.1|126966_128001_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.2	3.1e-71
WP_010792502.1|128029_128608_+	TerD family protein	NA	A0A2L1IWC0	Streptomyces_phage	31.0	5.7e-06
>prophage 2
NZ_CP039989	Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence	422811	155105	202971	422811	integrase,transposase	Salmonella_phage(22.22%)	44	168833:168847	182125:182139
WP_079991011.1|155105_156215_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010794451.1|158334_159426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010794452.1|159457_160663_-	hypothetical protein	NA	J9Q6K3	Salmonella_phage	38.7	2.6e-08
WP_010794453.1|160796_161831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058199422.1|163009_164320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010794458.1|164650_165289_+	SOS response-associated peptidase	NA	A0A218MNF5	uncultured_virus	39.4	6.7e-32
WP_021263721.1|165661_166096_+	hypothetical protein	NA	A0A141E1X8	Streptococcus_phage	46.6	1.1e-25
WP_079993529.1|166145_166562_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010794461.1|166655_167012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057382825.1|167137_168418_+	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_034000482.1|168573_169521_+	hypothetical protein	NA	NA	NA	NA	NA
168833:168847	attL	TCGATGCGCTGGCCA	NA	NA	NA	NA
WP_034000480.1|169820_170423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034000478.1|170505_171288_+	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	32.3	3.4e-22
WP_034000477.1|171432_172137_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_034000476.1|172194_172989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058199483.1|173551_174820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023111089.1|174960_176541_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_034000470.1|176547_176844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058199484.1|176845_177271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010794474.1|177466_177850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052150492.1|177948_179004_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_070091420.1|179291_179795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021263295.1|180029_180533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018614.1|180565_180862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021263294.1|180887_181733_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_034000467.1|181811_184400_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
182125:182139	attR	TCGATGCGCTGGCCA	NA	NA	NA	NA
WP_010794530.1|184703_185666_-	SdiA-regulated domain-containing protein	NA	NA	NA	NA	NA
WP_003090764.1|185711_186071_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_026014172.1|186070_186910_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	63.8	1.2e-94
WP_000480968.1|187018_187855_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_010794532.1|187854_188658_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000904906.1|188723_189338_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_001389365.1|189892_190657_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_023835631.1|190852_191836_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_000214125.1|192052_193267_+	chloramphenicol/florfenicol efflux MFS transporter FloR2	NA	S4TR35	Salmonella_phage	23.7	9.8e-16
WP_001747812.1|193294_193477_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000163574.1|193473_194100_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044062376.1|194203_195379_+	tetracycline efflux MFS transporter Tet(G)	NA	NA	NA	NA	NA
WP_001253717.1|195399_196191_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155375935.1|196282_197665_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_128623110.1|197557_198670_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_039843394.1|198705_199461_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155375934.1|199785_201315_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001389365.1|202206_202971_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
