The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046251	Leclercia adecarboxylata strain P12375 chromosome, complete genome	4925851	2130417	2145642	4925851		Escherichia_phage(33.33%)	15	NA	NA
WP_155166687.1|2130417_2131017_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.7	1.7e-29
WP_155166688.1|2131060_2131915_-	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	35.3	1.4e-24
WP_059307999.1|2131916_2132534_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	4.7e-75
WP_155166689.1|2132544_2134983_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.8	3.6e-219
WP_032617956.1|2135133_2135439_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_150872811.1|2135545_2136256_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_155166690.1|2136295_2136625_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_144884486.1|2136773_2137100_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	3.2e-22
WP_155166691.1|2137210_2138425_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.7	2.8e-47
WP_117386567.1|2138436_2139450_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.9	5.1e-18
WP_155166692.1|2139634_2140918_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	59.5	2.5e-155
WP_127472210.1|2140950_2141187_-	excisionase family protein	NA	S4TND0	Salmonella_phage	43.8	5.7e-13
WP_155166693.1|2141301_2141541_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	89.9	2.7e-31
WP_155166694.1|2141578_2142694_-	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	86.0	7.0e-178
WP_155166695.1|2142705_2145642_-	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	55.5	1.6e-293
>prophage 2
NZ_CP046251	Leclercia adecarboxylata strain P12375 chromosome, complete genome	4925851	2148840	2199159	4925851	lysis,terminase,tail	Enterobacteria_phage(20.0%)	60	NA	NA
WP_155166701.1|2148840_2149251_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	75.0	5.2e-46
WP_001568772.1|2149323_2149542_+	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	64.8	1.5e-20
WP_155166702.1|2149553_2150111_+	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	39.9	1.1e-19
WP_155166703.1|2150195_2150387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155167638.1|2150451_2151288_+	hypothetical protein	NA	V5URT9	Shigella_phage	28.6	7.6e-28
WP_155166704.1|2151290_2152067_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	79.5	6.7e-111
WP_155166705.1|2152056_2152368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155166706.1|2152364_2153012_+	hypothetical protein	NA	G8C7U8	Escherichia_phage	38.8	4.1e-05
WP_155166707.1|2153008_2153503_+	hypothetical protein	NA	G9L662	Escherichia_phage	45.5	4.7e-17
WP_155166708.1|2153502_2153760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155166709.1|2153756_2155730_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	51.2	1.2e-191
WP_139156339.1|2155798_2155993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103179500.1|2156764_2157004_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	54.2	7.2e-16
WP_155166710.1|2157038_2157638_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	83.8	5.2e-95
WP_155166711.1|2157845_2158136_+	DUF1364 family protein	NA	K7PGZ6	Enterobacteria_phage	91.7	2.1e-46
WP_155166712.1|2158132_2158495_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.9	3.9e-53
WP_155166713.1|2158491_2158632_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	73.7	8.0e-07
WP_155166714.1|2158628_2159411_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	73.9	4.1e-108
WP_103179507.1|2160087_2160273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103179202.1|2160434_2160758_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_086539048.1|2161279_2161504_+|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	82.4	1.4e-29
WP_155166715.1|2161481_2161976_+	glycoside hydrolase family protein	NA	M9P0E5	Enterobacteria_phage	88.4	4.2e-82
WP_155166716.1|2161972_2162365_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	60.2	3.3e-34
WP_155166717.1|2162512_2162725_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_155166718.1|2162703_2162904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155166719.1|2162927_2163134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155166720.1|2163381_2163759_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	43.8	4.3e-23
WP_155166721.1|2164627_2165617_+|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	43.0	6.5e-42
WP_155166722.1|2165594_2166902_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	1.9e-150
WP_155166723.1|2166903_2168310_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.5	6.4e-128
WP_155166724.1|2168293_2169400_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	59.3	3.9e-120
WP_155166725.1|2169513_2170221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155166726.1|2170453_2171227_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	60.9	7.5e-70
WP_155166727.1|2171239_2172193_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	73.7	9.4e-131
WP_155166728.1|2172279_2172474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155167640.1|2172511_2172994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155166729.1|2172995_2173346_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	62.9	4.2e-36
WP_155166730.1|2173347_2173956_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	56.8	2.6e-54
WP_155166731.1|2173927_2174338_+	hypothetical protein	NA	A0A2H4J130	uncultured_Caudovirales_phage	38.0	3.5e-18
WP_155166732.1|2174393_2175071_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	67.4	7.2e-77
WP_155166733.1|2175123_2175435_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.0	3.3e-37
WP_155166734.1|2175431_2175746_+	hypothetical protein	NA	I6PD79	Cronobacter_phage	68.6	4.4e-21
WP_155167642.1|2176264_2179102_+|tail	phage tail tape measure protein	tail	A0A2P0WA05	Enterobacter_phage	42.3	2.3e-177
WP_155166735.1|2179152_2179503_+	hypothetical protein	NA	G8C7R0	Escherichia_phage	88.8	5.4e-52
WP_155166736.1|2179499_2180273_+|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	88.7	2.5e-134
WP_103792435.1|2180285_2181017_+	C40 family peptidase	NA	G8C7R2	Escherichia_phage	92.2	1.1e-144
WP_103792434.1|2181004_2181604_+|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	92.5	2.9e-98
WP_155166737.1|2181658_2186587_+	DUF1983 domain-containing protein	NA	G8C7R4	Escherichia_phage	42.5	3.0e-15
WP_155166738.1|2186650_2188315_+	hypothetical protein	NA	A0A0F7L427	uncultured_marine_virus	37.7	4.9e-26
WP_155166739.1|2188314_2188614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155166740.1|2188625_2189624_+	hypothetical protein	NA	O64338	Escherichia_phage	48.8	1.3e-42
WP_103792429.1|2190711_2190951_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	67.9	4.5e-26
WP_103792428.1|2190950_2191265_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.0	4.3e-16
WP_103792427.1|2191412_2192708_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	25.4	1.9e-25
WP_150870808.1|2192989_2194453_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.1	8.6e-43
WP_155166741.1|2194497_2194701_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	61.2	5.8e-14
WP_155166742.1|2194964_2195396_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	36.6	7.0e-17
WP_032618024.1|2195436_2196123_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032618025.1|2196214_2196961_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_155166743.1|2197113_2199159_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.0	5.8e-21
>prophage 3
NZ_CP046251	Leclercia adecarboxylata strain P12375 chromosome, complete genome	4925851	2655989	2717534	4925851	lysis,portal,protease,tail,head,integrase,terminase,capsid	Enterobacteria_phage(50.0%)	69	2663435:2663449	2720911:2720925
WP_150871406.1|2655989_2657036_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	28.7	2.1e-19
WP_059307713.1|2657285_2658047_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.3	5.2e-07
WP_077226988.1|2658043_2658634_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_032611205.1|2658666_2659542_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_059307712.1|2659816_2660308_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_032611209.1|2660309_2660582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155166886.1|2660550_2661075_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_032611213.1|2661276_2661897_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_155166887.1|2661893_2662775_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_106993556.1|2662913_2662958_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_144837211.1|2663052_2664615_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
2663435:2663449	attL	GCCTGTTGCAGAACC	NA	NA	NA	NA
WP_155166888.1|2664614_2666210_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	43.4	2.7e-50
WP_155166889.1|2666213_2667572_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.8	5.0e-37
WP_032611228.1|2667582_2668776_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_103793305.1|2668775_2669585_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_032611232.1|2669741_2670953_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_039030671.1|2670949_2671183_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_051915983.1|2671340_2671613_+	DUF883 family protein	NA	NA	NA	NA	NA
WP_155166890.1|2672091_2672187_+	DinI-like family protein	NA	K7PKR6	Enterobacteria_phage	80.6	8.6e-05
WP_155166891.1|2672557_2673496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155166892.1|2674636_2675635_-	hypothetical protein	NA	O64338	Escherichia_phage	47.8	7.2e-41
WP_155166893.1|2675646_2675949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155166894.1|2675948_2677619_-	hypothetical protein	NA	A0A0F7L427	uncultured_marine_virus	33.3	1.2e-27
WP_155166895.1|2677683_2682612_-	DUF1983 domain-containing protein	NA	E4WL39	Enterobacteria_phage	43.6	2.6e-14
WP_155166896.1|2683255_2684002_-	peptidase P60	NA	M9NZD8	Enterobacteria_phage	72.4	1.8e-108
WP_155166897.1|2684004_2684742_-|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	84.5	3.5e-125
WP_103179224.1|2684799_2685138_-|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	83.0	6.2e-53
WP_155166898.1|2685140_2687636_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	79.2	0.0e+00
WP_155166899.1|2687613_2687934_-|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	91.4	2.1e-50
WP_155166900.1|2687942_2688356_-|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	65.0	6.8e-38
WP_155166901.1|2688391_2689129_-|tail	phage tail protein	tail	O64327	Escherichia_phage	89.0	2.2e-119
WP_103179219.1|2689136_2689535_-|tail	phage tail protein	tail	K7P7G5	Enterobacteria_phage	87.1	7.0e-64
WP_103179218.1|2689531_2690086_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	96.9	2.8e-79
WP_155166902.1|2690095_2690449_-|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	87.2	4.5e-54
WP_155166903.1|2690459_2690885_-	DNA-packaging protein	NA	K7P7M3	Enterobacteria_phage	78.0	2.2e-31
WP_103179215.1|2690931_2691957_-|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	90.6	5.1e-175
WP_103179214.1|2692024_2692357_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	85.5	1.5e-48
WP_155166904.1|2692366_2693692_-	S49 family peptidase	NA	O64320	Escherichia_phage	81.7	9.5e-182
WP_155166905.1|2693672_2695265_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	92.1	1.8e-291
WP_138368721.1|2695261_2695468_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	92.6	1.6e-27
WP_155166906.1|2695467_2697390_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	92.8	0.0e+00
WP_155166907.1|2697364_2697910_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	95.6	4.9e-92
WP_155166908.1|2698346_2698550_-	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	50.8	4.1e-12
WP_155166909.1|2699118_2699397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155166910.1|2699588_2699810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155166911.1|2699855_2700308_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	56.2	2.4e-36
WP_155166912.1|2700297_2700801_-	glycoside hydrolase family protein	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	74.9	1.0e-72
WP_032617614.1|2700802_2701042_-|lysis	lysis protein	lysis	A0A2H4JCI1	uncultured_Caudovirales_phage	59.2	1.3e-17
WP_155166913.1|2701564_2701888_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_155166914.1|2702049_2702235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155166915.1|2702685_2703300_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	62.2	4.9e-64
WP_155166916.1|2703313_2704330_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.5	2.0e-107
WP_155166917.1|2704329_2704686_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	65.5	3.9e-42
WP_155166918.1|2704682_2704889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155166919.1|2705302_2705536_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	74.0	1.8e-27
WP_155166920.1|2706180_2708097_+	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_155166921.1|2708605_2708866_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	70.0	1.7e-26
WP_155166922.1|2708869_2709289_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_155166923.1|2709304_2709850_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	78.1	1.1e-67
WP_155166924.1|2709761_2710766_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	57.9	2.9e-98
WP_155166925.1|2710804_2711017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155166926.1|2711082_2711637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155166927.1|2711639_2711867_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	77.3	8.4e-30
WP_155166928.1|2711985_2712408_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	46.8	1.3e-28
WP_155166929.1|2712593_2712788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155166930.1|2712784_2712967_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_155167660.1|2713023_2713353_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_063160322.1|2716180_2716429_+	excisionase	NA	NA	NA	NA	NA
WP_155166931.1|2716406_2717534_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	52.7	7.2e-106
2720911:2720925	attR	GGTTCTGCAACAGGC	NA	NA	NA	NA
>prophage 4
NZ_CP046251	Leclercia adecarboxylata strain P12375 chromosome, complete genome	4925851	2925415	3012963	4925851	portal,plate,protease,holin,tail,head,integrase,terminase,capsid,coat	Shigella_phage(25.93%)	102	2972525:2972584	3013083:3013146
WP_077227038.1|2925415_2926381_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_155166981.1|2926377_2928762_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_032611981.1|2928737_2929496_-	molecular chaperone	NA	NA	NA	NA	NA
WP_077227036.1|2929512_2929992_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_032611985.1|2930076_2930646_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_130588609.1|2931071_2932331_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_032611989.1|2933406_2933910_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_130588608.1|2933931_2935953_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_032611993.1|2935957_2936887_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_032611994.1|2936883_2937771_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_098946253.1|2937894_2938479_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_032611998.1|2938475_2938826_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_059307626.1|2939615_2940044_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_032612003.1|2940064_2941489_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_032612005.1|2941463_2942270_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_032612007.1|2942444_2943425_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_059307625.1|2943439_2944954_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	6.9e-11
WP_155166982.1|2945023_2946013_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155166983.1|2946327_2946885_-	DJ-1 family protein	NA	NA	NA	NA	NA
WP_032612117.1|2947430_2947934_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_155166984.1|2948104_2949448_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_032612018.1|2949528_2949780_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_098946254.1|2949875_2949959_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_032612021.1|2950171_2951593_+	MFS transporter	NA	NA	NA	NA	NA
WP_032612023.1|2951633_2952272_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_032612025.1|2952566_2952902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155166985.1|2953109_2953607_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_155166986.1|2953641_2953881_-	DUF2492 family protein	NA	NA	NA	NA	NA
WP_032612032.1|2953948_2954290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155166987.1|2954539_2955751_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_032612036.1|2955836_2956505_-	YecA family protein	NA	V5LQX0	Emiliania_huxleyi_virus	29.4	5.6e-05
WP_155166988.1|2956925_2958047_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059309089.1|2958141_2959056_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_072250872.1|2959065_2960367_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_032612040.1|2960363_2961239_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_117385392.1|2961235_2961952_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	3.0e-12
WP_155166989.1|2961990_2963565_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_059307619.1|2963850_2964132_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_032612050.1|2964128_2964485_-	membrane protein	NA	NA	NA	NA	NA
WP_155166990.1|2964462_2965605_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_103792093.1|2966196_2967180_+	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144837060.1|2967253_2968735_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	26.8	3.0e-11
WP_117385388.1|2968727_2969708_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_117385387.1|2969704_2970670_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_155166991.1|2970690_2971035_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_130588599.1|2971234_2971717_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_130588597.1|2972191_2972452_+	hypothetical protein	NA	NA	NA	NA	NA
2972525:2972584	attL	TTTCCCATGGTAGCCGGAGTGGGACTTGAACCCACACAGCGCGAACGCCGAGGGATTTTA	NA	NA	NA	NA
WP_155166992.1|2973261_2973624_+	GtrA family protein	NA	F1C5B1	Cronobacter_phage	79.2	1.5e-44
WP_155166993.1|2973620_2974544_+	glycosyltransferase	NA	U5P087	Shigella_phage	89.1	7.4e-157
WP_155166994.1|2974540_2976004_+	hypothetical protein	NA	A8CG94	Salmonella_phage	24.1	9.3e-21
WP_155166995.1|2976580_2976997_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	38.8	1.5e-16
WP_155166996.1|2977589_2978171_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	78.8	1.1e-89
WP_155166997.1|2978161_2979220_-|plate	phage baseplate protein	plate	M1FQW3	Enterobacteria_phage	77.3	3.9e-162
WP_151585414.1|2979212_2979632_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	79.9	1.1e-59
WP_155166998.1|2979634_2980177_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	70.0	7.1e-67
WP_155167670.1|2980176_2981247_-|plate	baseplate protein	plate	M1FN92	Enterobacteria_phage	82.2	2.2e-168
WP_155166999.1|2981249_2981534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155167000.1|2981533_2983057_-	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	28.0	1.7e-25
WP_155167001.1|2983065_2984487_-	DNA circularization protein	NA	M1FPN5	Enterobacteria_phage	67.9	7.1e-167
WP_155167002.1|2984544_2985069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155167003.1|2985138_2986923_-|tail	phage tail tape measure protein	tail	Q8W620	Enterobacteria_phage	55.3	1.8e-114
WP_155167004.1|2987040_2987328_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	60.9	2.1e-22
WP_155167005.1|2987327_2987684_-|tail	phage tail protein	tail	U5P076	Shigella_phage	85.6	4.1e-55
WP_155167006.1|2987683_2989180_-|tail	phage tail protein	tail	U5P0H3	Shigella_phage	74.5	2.2e-211
WP_155167007.1|2989176_2989359_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	78.6	8.2e-12
WP_155167008.1|2989367_2989928_-	hypothetical protein	NA	S5FM61	Shigella_phage	81.7	1.1e-86
WP_155167009.1|2989924_2990431_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	82.7	1.4e-77
WP_155167010.1|2990405_2990819_-|head	phage head closure protein	head	U5P0R0	Shigella_phage	67.2	9.5e-48
WP_155167011.1|2990815_2991139_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	63.6	8.0e-34
WP_155167012.1|2991211_2992432_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	74.4	8.8e-166
WP_155167013.1|2992441_2993041_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	79.0	5.2e-87
WP_155167014.1|2993033_2994260_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	89.2	9.0e-219
WP_155167015.1|2994407_2996141_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	94.7	0.0e+00
WP_155167016.1|2996137_2996632_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	90.9	3.2e-82
WP_155167017.1|2996762_2997113_-	HNH endonuclease	NA	S5FKR6	Shigella_phage	81.0	2.9e-53
WP_155167018.1|2997277_2997658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155167019.1|2997820_2998171_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	37.3	6.7e-10
WP_155167020.1|2998167_2998782_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.3	3.9e-90
WP_103822564.1|2998781_2999063_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	44.8	4.5e-17
WP_103822565.1|2999049_2999436_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	94.5	1.9e-58
WP_155167021.1|2999536_2999869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155167022.1|3000024_3000603_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.9	6.6e-47
WP_155167023.1|3000615_3001605_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	75.4	4.8e-154
WP_155167024.1|3001601_3002327_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	53.6	3.7e-55
WP_155167025.1|3002342_3002732_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	84.9	6.6e-59
WP_155167026.1|3002728_3003049_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	64.4	5.3e-30
WP_144837568.1|3003045_3003270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155167027.1|3003266_3003926_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	79.3	9.4e-98
WP_155167028.1|3003925_3004459_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	31.5	1.6e-15
WP_155167029.1|3004371_3005295_-	transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	85.6	2.0e-61
WP_155167030.1|3005251_3005464_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.4	2.5e-12
WP_155167031.1|3005627_3006182_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	67.4	1.1e-67
WP_155167032.1|3006210_3006408_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	65.0	2.0e-16
WP_155167033.1|3006512_3007160_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.4	6.4e-75
WP_155167034.1|3008042_3008456_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	78.8	9.2e-51
WP_155167035.1|3008455_3009481_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	82.3	1.1e-153
WP_155167036.1|3009910_3010282_+	hypothetical protein	NA	R9TPK2	Aeromonas_phage	72.3	5.1e-16
WP_155167037.1|3010283_3010472_+	hypothetical protein	NA	Q9G079	Enterobacteria_phage	77.4	1.3e-20
WP_155167672.1|3010826_3011162_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	82.3	7.5e-43
WP_155167038.1|3011158_3011341_+	hypothetical protein	NA	R9TNE4	Aeromonas_phage	60.0	2.6e-13
WP_088567137.1|3011722_3011953_+	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	94.7	1.1e-37
WP_155167039.1|3011952_3012963_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	84.5	7.0e-169
3013083:3013146	attR	TTTCCCATGGTAGCCGGAGTGGGACTTGAACCCACACAGCGCGAACGCCGAGGGATTTTAAATC	NA	NA	NA	NA
>prophage 5
NZ_CP046251	Leclercia adecarboxylata strain P12375 chromosome, complete genome	4925851	3722840	3730287	4925851		Mycobacterium_phage(33.33%)	8	NA	NA
WP_155167185.1|3722840_3723101_+	glutaredoxin-like protein NrdH	NA	A0A222ZNS6	Mycobacterium_phage	42.9	1.1e-06
WP_032613493.1|3723097_3723508_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	43.9	1.3e-17
WP_059307333.1|3723480_3725625_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.2	8.4e-196
WP_155167186.1|3725634_3726594_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.6	7.0e-134
WP_059307331.1|3726674_3727295_+	LysE family translocator	NA	NA	NA	NA	NA
WP_032613504.1|3727484_3727697_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	1.7e-24
WP_155167187.1|3727975_3728140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155167188.1|3728139_3730287_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.4	8.8e-28
>prophage 6
NZ_CP046251	Leclercia adecarboxylata strain P12375 chromosome, complete genome	4925851	3977470	4040063	4925851	integrase,tRNA,protease,transposase	Enterobacteria_phage(27.27%)	51	3969611:3969629	4033924:4033942
3969611:3969629	attL	ATGTTGAAGGCCATACCCG	NA	NA	NA	NA
WP_130588232.1|3977470_3977968_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_032613924.1|3978062_3978770_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_032613955.1|3978881_3979613_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_032613926.1|3979632_3980580_+	glutathione synthase	NA	NA	NA	NA	NA
WP_098946270.1|3980608_3981232_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_130588229.1|3981231_3981648_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_032613957.1|3981687_3982377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155167280.1|3982476_3983454_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_032613935.1|3983471_3984173_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032613937.1|3984194_3984761_+	YggT family protein	NA	NA	NA	NA	NA
WP_032613939.1|3984757_3985054_+	YggU family protein	NA	NA	NA	NA	NA
WP_059307228.1|3985057_3985651_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_155167282.1|3985643_3986786_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_103792619.1|3986846_3987209_+	endonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_103792620.1|3987749_3988469_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_155167284.1|3988521_3988848_-	DUF469 family protein	NA	NA	NA	NA	NA
WP_032613969.1|3988847_3989567_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_155167285.1|3989711_3990764_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_032613973.1|3990789_3991062_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_032613975.1|3991183_3992263_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_032613978.1|3992500_3993757_+	nucleoside permease	NA	NA	NA	NA	NA
WP_155167287.1|3993810_3995946_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_032613982.1|3996343_3997054_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_016154414.1|3997400_3998591_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	54.7	1.5e-122
WP_016154415.1|3998992_4000015_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016154416.1|4000582_4001806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016154417.1|4001802_4002291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016154418.1|4002287_4004249_+	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_094898333.1|4004700_4005941_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	79.4	1.4e-131
WP_016154424.1|4008274_4009012_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	32.6	9.7e-27
WP_016154425.1|4009438_4009651_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_016154429.1|4011061_4012429_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_016154430.1|4012605_4013058_+	peptide deformylase	NA	Q6VT21	Vibrio_phage	32.6	7.8e-11
WP_023302365.1|4014103_4017544_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023336667.1|4017693_4018128_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_023302364.1|4018347_4019295_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_009654822.1|4019607_4019871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071687229.1|4019860_4020283_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016154432.1|4020357_4022853_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.8	3.9e-144
WP_009654812.1|4022934_4023387_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_016154433.1|4023476_4023941_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_009654818.1|4023954_4026450_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.6	2.0e-92
WP_032950072.1|4026635_4027646_+	cation diffusion facilitator family transporter	NA	A0A1V0SED0	Indivirus	25.1	7.8e-19
WP_016154435.1|4027691_4028054_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100216202.1|4028672_4029840_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
WP_009654821.1|4030219_4032358_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016154438.1|4033634_4034261_+	hypothetical protein	NA	A0A2H4J137	uncultured_Caudovirales_phage	42.6	5.7e-44
4033924:4033942	attR	ATGTTGAAGGCCATACCCG	NA	NA	NA	NA
WP_009654824.1|4034253_4035390_+	hypothetical protein	NA	A0A2H4J138	uncultured_Caudovirales_phage	43.6	5.6e-74
WP_016154439.1|4035829_4036159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009652402.1|4038085_4038328_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_085954962.1|4038912_4040063_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.6	9.8e-50
