The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	8320	67215	3575377	transposase	unidentified_phage(33.33%)	54	NA	NA
WP_155079413.1|8320_9490_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079415.1|9631_9940_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_155066245.1|9945_10401_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_155066246.1|10468_11398_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_155066247.1|11403_11724_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_155066248.1|11723_13448_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_155081463.1|13404_14937_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_155079417.1|14902_16297_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_155079419.1|16290_17331_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_155079421.1|17332_18706_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_155079422.1|18702_19866_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_155081464.1|19882_20965_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_155079424.1|20939_22397_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_155079426.1|22393_23431_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_155066256.1|23432_24152_+	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_016209355.1|24197_25445_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_016209342.1|25489_26623_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_155066257.1|26701_27562_+	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_155079429.1|27703_30436_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_155066259.1|30645_31779_+	acyl-CoA desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	31.8	2.4e-40
WP_155068597.1|31808_32081_-	acylphosphatase	NA	NA	NA	NA	NA
WP_155066260.1|32188_33001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079431.1|33014_33236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079433.1|33442_34798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066264.1|35391_35760_-	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_155079435.1|36875_38651_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_155079437.1|39552_39693_-	phosphatase	NA	NA	NA	NA	NA
WP_155066936.1|39760_40111_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|40142_40595_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079439.1|41134_42021_-|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	28.8	1.7e-09
WP_155079441.1|44356_47050_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	31.0	5.2e-70
WP_155068598.1|47081_47669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079443.1|47713_48754_+	beta-eliminating lyase	NA	NA	NA	NA	NA
WP_155066269.1|48874_49099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|49384_50359_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079447.1|50707_51442_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_155079448.1|52065_53592_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_155068599.1|53731_54805_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|54844_56152_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_155079450.1|56126_57296_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_155079452.1|57350_58076_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_155079454.1|58513_58705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079457.1|58815_59745_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079459.1|59796_59997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079461.1|60133_61108_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	7.5e-27
WP_155079463.1|61572_62376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079465.1|62601_63090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|63098_63551_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079467.1|63582_63828_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079470.1|64312_65167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079472.1|65342_65687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079474.1|65828_66272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|66287_66674_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|66657_67215_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	75064	126950	3575377	transposase	Hokovirus(20.0%)	52	NA	NA
WP_155079487.1|75064_76114_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079488.1|76130_76250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079490.1|76327_77302_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.5	2.3e-28
WP_155079492.1|77325_77559_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|77590_78043_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079495.1|78293_79247_-	glutathione synthase	NA	NA	NA	NA	NA
WP_155079497.1|79291_80455_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_155079499.1|80460_81060_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_155081467.1|81247_81739_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_155079501.1|81765_82854_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_155079503.1|82992_84237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079505.1|84233_85076_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_155079507.1|85055_85859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068602.1|86057_86273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079509.1|86273_87242_+	TonB family protein	NA	NA	NA	NA	NA
WP_155081468.1|87297_87849_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_155066294.1|87975_88398_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_155081469.1|88390_89152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066295.1|89206_89905_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_155079511.1|89915_90740_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	2.1e-25
WP_155066936.1|90915_91266_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081470.1|91297_91750_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079513.1|92277_92562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079515.1|92785_92923_-	phosphatase	NA	NA	NA	NA	NA
WP_155079517.1|92991_93132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066301.1|93266_94481_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_155068606.1|94792_95854_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_155066302.1|95867_97595_+	oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_155066303.1|97627_98359_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_155068607.1|98358_99147_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155079519.1|99251_99875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079521.1|100064_100253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066306.1|100340_101093_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155066307.1|106772_107396_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_155081471.1|107435_107918_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_155066308.1|107966_109112_+	polysaccharide biosynthesis/export family protein	NA	NA	NA	NA	NA
WP_155079523.1|109113_111384_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_155081472.1|111385_112234_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.0e-67
WP_155079524.1|112240_113113_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.3	3.9e-91
WP_155079526.1|113109_114114_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	48.5	5.7e-78
WP_155066313.1|114133_114541_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	48.9	1.8e-27
WP_155079528.1|114568_115957_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_155079530.1|115953_117126_+	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_155079533.1|117157_118009_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_155079535.1|118024_119182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068609.1|119256_120186_+	glycosyltransferase	NA	B6EFC4	Stygiolobus_rod-shaped_virus	34.2	2.7e-05
WP_155066318.1|120182_121319_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_155066319.1|121315_122242_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	45.0	1.7e-57
WP_155066320.1|122331_123729_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.4	9.7e-52
WP_155079537.1|124003_125416_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_155079539.1|125497_126325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|126392_126950_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	197092	242060	3575377	transposase	unidentified_phage(80.0%)	54	NA	NA
WP_155079617.1|197092_197746_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155079619.1|198260_199049_-	MFS transporter	NA	NA	NA	NA	NA
WP_155079620.1|199115_200090_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079478.1|200239_200797_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|200780_201167_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079622.1|201235_201514_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155066404.1|201575_202461_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079624.1|202488_202845_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155079626.1|202968_204228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079627.1|204716_205754_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079629.1|205882_206476_+	CDP-alcohol phosphatidyltransferase	NA	NA	NA	NA	NA
WP_155066393.1|206444_207098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079631.1|207276_208266_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155066395.1|208288_209185_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_017377592.1|209344_209788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066396.1|209784_210426_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_155066397.1|210536_211115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|211691_212042_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079634.1|211968_212208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081475.1|212707_212986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079635.1|213038_213227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|213281_213632_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|213663_214116_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079638.1|214753_215215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079640.1|215500_215971_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079642.1|216013_216415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079644.1|216472_217063_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079646.1|217192_217480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079648.1|217996_218203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079650.1|218241_218958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|218976_219363_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066610.1|219442_220018_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079588.1|219963_220329_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079653.1|220392_220863_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079655.1|221339_222314_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	9.8e-27
WP_155079657.1|222518_222779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081476.1|222806_224813_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155079659.1|224949_227280_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_155079660.1|227411_228254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|228254_228812_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|228795_229182_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079662.1|229361_229757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|229896_230871_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155068789.1|231102_232362_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.1e-13
WP_155068500.1|232610_233135_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_155068499.1|233242_234244_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155079663.1|234331_235228_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155079665.1|235371_236589_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_155068496.1|237052_238369_+	MFS transporter	NA	NA	NA	NA	NA
WP_155079667.1|238467_238776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079669.1|239386_240361_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	7.5e-27
WP_155079671.1|240398_241016_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_155068622.1|241225_241678_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|241709_242060_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	282538	314841	3575377	protease,transposase	Faustovirus(25.0%)	29	NA	NA
WP_155079478.1|282538_283096_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068461.1|283566_284421_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378137.1|284895_285114_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_155079703.1|285215_286466_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_155079705.1|286521_287004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079706.1|287348_287705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|289268_289826_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079708.1|289809_290196_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079710.1|290597_291563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079712.1|292745_293570_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_155079713.1|293772_294849_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_155079714.1|294933_295920_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_155079716.1|295938_296583_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_155079718.1|296594_297704_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	2.1e-17
WP_155079720.1|297816_298548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068448.1|299043_300927_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_155068447.1|301240_302740_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_155079722.1|302829_303612_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.3	4.1e-31
WP_155068445.1|303739_304660_+	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_155068444.1|304683_305142_+	NfeD family protein	NA	NA	NA	NA	NA
WP_155079724.1|305772_306954_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079726.1|307939_308914_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.8	1.4e-28
WP_155079728.1|309474_310080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079730.1|310180_310342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079731.1|310606_310855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|310838_311396_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079733.1|311529_312579_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068441.1|312905_313883_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_155068440.1|313992_314841_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
>prophage 6
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	426369	435829	3575377	transposase	unidentified_phage(100.0%)	12	NA	NA
WP_155079478.1|426369_426927_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079803.1|426907_427126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066524.1|427388_427691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079804.1|428272_429442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|429856_430243_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|430226_430784_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079805.1|430784_431360_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155079806.1|431663_432749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079807.1|432732_433599_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079808.1|433672_433981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079809.1|434023_434998_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.8e-27
WP_155079810.1|435037_435829_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	439107	486785	3575377	protease,transposase,tRNA	unidentified_phage(28.57%)	53	NA	NA
WP_155079445.1|439107_440082_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079814.1|440105_440411_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155079815.1|440430_441405_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	4.0e-28
WP_017376982.1|441632_442106_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_155079816.1|442147_442663_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_155079817.1|442662_443679_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155079818.1|444086_444872_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155079819.1|444935_445550_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210574.1|445690_446110_+	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_155079820.1|446165_446789_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_155079821.1|447011_448769_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155081480.1|448890_449874_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376975.1|449954_450506_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_017376974.1|450516_451884_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_155068778.1|452034_452271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079822.1|452329_453073_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_155079823.1|453072_453714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079824.1|453713_455378_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	1.1e-33
WP_155079825.1|455405_455741_+	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_155081481.1|455868_457467_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_155079826.1|457679_458566_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079827.1|458629_459571_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068353.1|459639_459930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081482.1|460142_460574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079828.1|460636_463117_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.0	5.9e-193
WP_155079829.1|463204_463684_+	lipopolysaccharide-assembly family protein	NA	NA	NA	NA	NA
WP_155079830.1|463656_464697_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_155068349.1|464633_465350_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|465362_465698_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_155079831.1|465734_466205_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_155081483.1|466250_468086_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_155068346.1|468082_469219_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_155068345.1|469240_470302_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_155068344.1|470379_470895_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|470935_472213_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_155079832.1|472227_473079_+	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_155079833.1|473104_473755_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_155081484.1|473751_474711_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_155079834.1|476261_476447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|476511_477069_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|477052_477439_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079835.1|477549_477822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079836.1|477901_478108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079837.1|479011_479995_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079838.1|480155_481358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079839.1|481510_482086_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155079478.1|482086_482644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|482627_483014_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079840.1|483746_484625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079841.1|485134_485317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079842.1|485408_485801_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_155079476.1|485857_486244_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|486227_486785_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	508421	592013	3575377	transposase,tRNA	Acinetobacter_phage(28.57%)	95	NA	NA
WP_155066278.1|508421_509471_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079445.1|509832_510807_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079851.1|511028_511769_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_155079852.1|511872_512601_-	DUF541 domain-containing protein	NA	NA	NA	NA	NA
WP_155079445.1|512996_513971_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079853.1|514013_515057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|515373_515634_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_155079854.1|515807_517346_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_155068776.1|517524_518451_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	33.6	7.2e-11
WP_155068307.1|518590_521404_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.7	3.9e-76
WP_155068306.1|521396_521906_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377277.1|521909_522353_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_155079855.1|522439_523759_-	MFS transporter	NA	NA	NA	NA	NA
WP_155068304.1|524021_524402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068303.1|524393_525116_-	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	2.1e-26
WP_155079478.1|528075_528633_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|528616_529003_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079856.1|530035_530365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079857.1|530750_531116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068300.1|531239_532100_+	DUF692 family protein	NA	NA	NA	NA	NA
WP_155079858.1|532086_532866_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_016210168.1|532942_533626_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079859.1|533786_534317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377265.1|534608_535112_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_155068297.1|535313_535568_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_155079860.1|536069_536537_+	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_155079861.1|536772_536916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079862.1|537552_537906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079863.1|538474_538939_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	45.9	5.9e-30
WP_155079864.1|539007_540163_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.4e-50
WP_155079864.1|540471_541628_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.4e-50
WP_155079865.1|542630_543248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079866.1|543654_544722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079867.1|545005_545257_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079868.1|545213_546370_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155079869.1|546586_547396_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.1	2.4e-47
WP_155079627.1|547411_548449_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079870.1|548491_548830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079871.1|548801_549098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079872.1|549287_549908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|549945_550831_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079873.1|550795_551305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|551780_552338_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|552321_552708_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079874.1|553062_553452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079875.1|553378_553729_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079476.1|554153_554540_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|554523_555081_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068292.1|555233_556394_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.1e-120
WP_155079876.1|556687_556828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068291.1|556977_558981_+	transketolase	NA	NA	NA	NA	NA
WP_155079877.1|559049_560057_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_155079878.1|560130_561315_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_155079879.1|561324_562779_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376008.1|562809_563847_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_155079476.1|564263_564650_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079880.1|564633_565143_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079478.1|565244_565802_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|565785_566172_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079881.1|566194_566608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|566591_566978_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079882.1|566993_567308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079883.1|567253_567829_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079884.1|567957_568776_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_155081485.1|568938_569463_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_155068294.1|569462_569993_+	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_155079885.1|570113_570821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079886.1|571022_571391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079887.1|571614_572157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079888.1|572131_572278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079889.1|572253_572796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079890.1|572902_573553_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_155068276.1|573653_574313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081486.1|574542_574995_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|575026_575377_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068773.1|576256_576538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079891.1|577420_578548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068273.1|579235_579478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066488.1|579532_579883_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079892.1|579809_580277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|580390_581620_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079893.1|581719_582007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079730.1|582022_582184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079731.1|582448_582697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|582680_583238_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079894.1|583522_584641_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079895.1|584655_584871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079896.1|584874_585429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|585409_585967_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079897.1|585950_586337_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079898.1|586435_587164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079899.1|587192_587819_-	ribonuclease T	NA	NA	NA	NA	NA
WP_155079900.1|587848_589048_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_155068263.1|589285_590383_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	2.8e-06
WP_155079901.1|590495_592013_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.1	1.7e-86
>prophage 9
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	599953	650272	3575377	protease,transposase,tRNA	unidentified_phage(20.0%)	56	NA	NA
WP_155079910.1|599953_600484_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_155068247.1|600661_600802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079911.1|600819_601467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|601584_602142_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|602125_602512_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079912.1|602750_603455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079913.1|603749_603974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068241.1|604053_604509_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155079914.1|604477_605419_-	EamA family transporter	NA	NA	NA	NA	NA
WP_155079915.1|605667_606855_+	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.6	2.2e-20
WP_016210937.1|606946_607228_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_027242634.1|607313_607991_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_155079916.1|608036_609296_-	phosphate permease	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.5e-24
WP_155079917.1|609493_610543_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_155068236.1|610621_611428_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_155079918.1|611449_612244_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	66.7	1.2e-102
WP_155068769.1|612342_613362_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_155079919.1|613408_614020_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_155079920.1|614023_614710_+	acireductone synthase	NA	NA	NA	NA	NA
WP_155068232.1|614706_615249_+	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_155079921.1|615330_616518_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_155079922.1|616763_617501_+	D-Ala-D-Ala dipeptidase	NA	NA	NA	NA	NA
WP_155068768.1|618459_618756_-	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_155081487.1|619474_619651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079923.1|619822_620224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079924.1|620280_620565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|620664_621639_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079925.1|622113_623937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079926.1|624387_625647_-	diphosphate--fructose-6-phosphate 1-phosphotransferase	NA	NA	NA	NA	NA
WP_155068224.1|626260_627643_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_155068767.1|627635_628253_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_155079927.1|628331_629048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068222.1|629219_631544_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.1	1.7e-21
WP_155079634.1|632399_632639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|632565_632916_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079928.1|632970_633720_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	29.8	1.3e-10
WP_155079929.1|634495_635917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079930.1|636103_637195_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155079931.1|637228_637867_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_155068218.1|637905_638178_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_144420763.1|638258_638501_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_155068216.1|638518_638821_-	YciI family protein	NA	NA	NA	NA	NA
WP_155068215.1|638904_639447_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|639608_640235_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_155079932.1|640240_641080_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.8	3.6e-09
WP_155079933.1|641069_641720_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.9	1.1e-18
WP_155068213.1|641723_642557_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_155079934.1|643017_643224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079874.1|643510_643900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066739.1|643826_644177_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066936.1|644521_644872_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|644903_645356_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079935.1|645572_646247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079936.1|646498_647590_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_155079937.1|647586_648951_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_155068208.1|649075_650272_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1V0SHQ2	Klosneuvirus	24.8	1.6e-10
>prophage 10
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	656424	707051	3575377	transposase,integrase	Vibrio_phage(21.43%)	59	656391:656450	699428:700741
656391:656450	attL	AGTAACGGGACAAAAATAACTTCCCGCTTACCTGCTAAAAAACAGGTGCACAGGAGTAGT	NA	NA	NA	NA
WP_155079940.1|656424_657606_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_036777829.1|657936_658341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079941.1|658574_659657_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	1.7e-19
WP_155068204.1|659641_660244_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155079942.1|660308_661184_+	6-pyruvoyl tetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_122942894.1|661261_661837_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_155079943.1|662567_663701_+	DUF4102 domain-containing protein	NA	A0A1V0E8G8	Vibrio_phage	48.5	1.9e-90
WP_155081489.1|663701_663971_+|integrase	integrase	integrase	A0A1V0E8G8	Vibrio_phage	55.1	1.2e-14
WP_155079476.1|664190_664577_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|664560_665118_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079944.1|665125_665770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079945.1|665852_666227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079946.1|666331_666520_+	AlpA family phage regulatory protein	NA	A0A0R6PC61	Moraxella_phage	49.1	1.1e-06
WP_155079947.1|666476_667535_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	35.5	5.0e-32
WP_155079948.1|667531_668737_+	hypothetical protein	NA	A0A1L6BZE6	Pasteurella_phage	29.9	1.0e-17
WP_155079487.1|668783_669833_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079949.1|669849_670095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079950.1|670545_671238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079951.1|671280_672330_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079952.1|672346_672730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079953.1|672767_673109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079954.1|673219_673588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|673630_674680_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079955.1|674851_675337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|675651_676209_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|676192_676579_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079956.1|677465_677954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079957.1|678243_678396_-	phosphatase	NA	NA	NA	NA	NA
WP_155079958.1|678671_678980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079959.1|678976_679327_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.2	7.6e-14
WP_155079960.1|679369_680767_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.6	5.9e-65
WP_155079961.1|681130_681784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079962.1|682566_683625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079963.1|683903_684293_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079476.1|684289_684676_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|684659_685217_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079964.1|686436_687228_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155079965.1|687768_688335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|689003_689978_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079966.1|690037_690436_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079967.1|690481_691111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079968.1|691477_693118_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_155068160.1|693230_694580_+	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	37.0	1.8e-74
WP_155068159.1|694576_695446_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	1.2e-68
WP_155079969.1|696192_696507_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079970.1|696503_697211_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.1	4.8e-47
WP_155066936.1|697326_697677_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079971.1|697603_697774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079940.1|698271_699453_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_155079972.1|700212_701169_-|transposase	transposase	transposase	NA	NA	NA	NA
699428:700741	attR	ACTACTCCTGTGCACCTGTTTTTTAGCAGGTAAGCGGGAAGTTATTTTTGTCCCGTTACTTAATTCTGATGTGTTTTATGCATGGCTAGTTAAAGATTTATTGCCTAAATTGCCAGCACATTCAGTAATTGTTATGGATAATGCGCGCTTTCACAAACGCTCTGACATGATTGAAGCGATTGAAGAGCAAGGGCATACACTTGAGTATTTACCATCTTATAGCCCTGACCTTAACCCGATTGAGAGAAAATGGGCAGAAGCTAAAGCCATTCGAAGAAAGTATCACTGTAGTATCGAAGATCTTTTTTTAGAACATCTACATTATGTCAATTTATAAGGTTTTAACTATATTATTAACAGTCTCTTTATTTACTGGGTCAATCGCTAAGGGTCTGATTCCCCGCAGCTTGCTGCGAAAAAAAACAAAGCGCATTACGACCCGAAGGGGTAATTTTCCGAAATACCTCGTAGCTTGCTGCGAGGATAGGTAAATTGAGTTTTGCGCAAATTTATTTAATTCTGATGTGTTTTATGCATGGCTAGTTAAAGATTTATTGCCTAAATTGCCAGCACATTCAGTAATTGTTATGGATAATGCGCGCTTTCACAAACGCTCTGACATGATTGAAGCGATTGAAGAGCAAGGGTATACACTTGAGTATTTACCATCTTATAGCCCTGACCTTAACCCGATTGAGAGAAAATGGGCAGAAGCTAAAGCCATTCGAAGAAAGTATCACTGTAGTATCGAAGATCTTTTTTTAGAACATCTACATTATGTCAATTTATAAGGTTTTAGCTATAGAACAGCTAATCCCCACTTTTATCACATCCCAATCTTGCTGGTACAAACTAATTTTTTCATTGAGCTTCCGTTTATACTTATCAACCCACGCAGCAATTGATAAGCTAATATGGTTTCTCTGCGCTCGGCCAGTACGAGCCTGACAGCGCTCAATACCACACGTTTGCTTTAATTCCCGGTGATAGACTTCAATTGACCAACGTGCCTTGACAATGACTTCAACTTGATCACGAGATGGCTCTTCAATATTCGTTCCAATGTAATCCGTGCGACCATTTTTTGCTACAAACCGAAATACAGTGATCCAGCCATAACCACGTAAGTGCAACTTTAGCCCTTCATCAGGAAAGTCAAGCATTTCAAGTGTTTCGTTACGATTAACTTTGCGATTTTTTTTAAGTCCTGCCACCCAATTCCAATGAAGATCACGGGCTGCTTTTAAATTATTCAAGCTAGAATACCATGCATCAAATACAACAGCGGATGGAGTCATACCTCGGTTTTTACCT	NA	NA	NA	NA
WP_155068155.1|701681_702128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081490.1|702214_702715_+	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_155079973.1|702824_703019_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066278.1|703015_704065_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079974.1|704389_704755_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079975.1|704700_705276_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|705461_705848_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|705831_706389_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079976.1|706439_707051_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	35.0	4.1e-23
>prophage 11
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	714944	747593	3575377	transposase,tRNA	unidentified_phage(40.0%)	42	NA	NA
WP_155068124.1|714944_715664_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_155068123.1|715822_716029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079979.1|716028_716265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079980.1|716277_716655_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_155079981.1|717151_718003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068119.1|718095_718293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079982.1|718386_719772_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_155068117.1|719898_720489_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_155081491.1|720930_721383_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068097.1|721414_721765_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079983.1|722730_723519_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155079906.1|723522_723795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|723881_724232_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|724263_724716_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|725065_725452_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|725435_725993_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079984.1|726279_727761_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.9	1.4e-69
WP_155079959.1|727803_728154_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.2	7.6e-14
WP_155079478.1|728218_728776_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|728759_729146_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079985.1|729168_729417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079986.1|729465_730131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079987.1|730458_731433_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079988.1|731679_732630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|732652_733039_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|733022_733580_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079989.1|733582_734572_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155079990.1|735442_736207_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155079478.1|736187_736745_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079897.1|736728_737115_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079991.1|737183_737789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066404.1|738002_738889_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068114.1|739211_739877_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_155079992.1|739936_740893_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.8e-33
WP_155067468.1|741234_741381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|741477_742035_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|742018_742405_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079993.1|742423_743374_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068112.1|743476_744094_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155079994.1|744133_745270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079995.1|745746_746595_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079741.1|746618_747593_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
>prophage 12
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	767767	803442	3575377	transposase,integrase,tRNA	unidentified_phage(33.33%)	41	773018:773077	803795:803933
WP_155080005.1|767767_768653_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080006.1|768617_768890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081491.1|770122_770575_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068097.1|770606_770957_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080007.1|771150_772125_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.8e-27
WP_155080008.1|772263_772728_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080009.1|772757_773441_-	hypothetical protein	NA	NA	NA	NA	NA
773018:773077	attL	CATCAATCGCTAAGGGTCTGATTCCCCGCAGCTTGCTGCGAAAAAAAACAAAGCGCATTA	NA	NA	NA	NA
WP_155079478.1|773466_774024_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|774007_774394_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080010.1|774390_774897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080011.1|775022_775190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|775835_776288_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|776319_776670_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080012.1|776869_778306_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_155068095.1|778382_779843_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_155068094.1|779963_780251_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|780440_781484_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_155068093.1|781499_782399_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_155068092.1|782395_782914_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_155080013.1|782983_783601_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_155080014.1|783610_785098_+	ribonuclease G	NA	NA	NA	NA	NA
WP_155080015.1|785107_788788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080016.1|788861_789674_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_155068087.1|789670_790351_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_155080017.1|791264_792494_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080018.1|793230_793686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080019.1|793911_794097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081492.1|794023_794413_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|794444_794795_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080020.1|794860_795787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|796737_797124_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|797107_797665_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|797761_798148_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|798131_798689_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080021.1|798774_799041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081493.1|800693_800870_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066936.1|800903_801254_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|801285_801738_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080022.1|801732_801978_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	47.9	5.3e-14
WP_155079868.1|802044_803200_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080023.1|803157_803442_-|transposase	transposase	transposase	NA	NA	NA	NA
803795:803933	attR	CATCAATCGCTAAGGGTCTGATTCCCCGCAGCTTGCTGCGAAAAAAAACAAAGCGCATTACGACCCGAAGGGGTAATTTTCCGAAATACCTCGTAGCTTGCTGCGAGGATAGGTAAATTGAGTTTTGCGCAAATTTATT	NA	NA	NA	NA
>prophage 14
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	878771	913349	3575377	transposase,integrase	unidentified_phage(37.5%)	39	888014:888073	897937:898676
WP_155068622.1|878771_879224_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|879255_879606_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080054.1|880757_881693_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	1.7e-23
WP_155080055.1|882002_883469_+	protein kinase	NA	NA	NA	NA	NA
WP_155080056.1|884951_885455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|885573_886623_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079487.1|886893_887943_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080057.1|887957_888779_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
888014:888073	attL	TTCTTAACTGACTGCCGCACAAGATGCATTTAAGAGGGTTGTAGTTGAAATTACTTTTCA	NA	NA	NA	NA
WP_155081497.1|888923_889277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|889791_890766_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080058.1|891503_891779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|893088_893439_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|893470_893923_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080059.1|894087_894480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080060.1|894583_895618_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_155068017.1|895614_896325_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	1.3e-31
WP_155080061.1|896533_897001_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6H9S3	Enterobacteria_phage	30.9	7.3e-12
WP_155080062.1|896967_897135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080063.1|897191_897365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080064.1|897506_897710_-	phosphatase	NA	NA	NA	NA	NA
WP_155079612.1|897850_899080_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
897937:898676	attR	TTCTTAACTGACTGCCGCACAAGATGCATTTAAGAGGGTTGTAGTTGAAATTACTTTTCATCAGTGAAACAAACGTGACCTGGTTATATGCCTCAATAGTTTGCCCGACTAAATCATAAATTTTTGGTAGTATTATTGTCCGAGTGCGATAGCTTAGAAATCCATAGTAGCGGATCATTTTAAAGAACTTGTCCGGGATGTGTTGGGTAAGGCGATCAATAAAATCGTCGATACTCTGCTTTTTCATTTTCTGCTGTTTGGTTTTGTGATCCAGGTAACGAAAGATCACAACATTACCATCATAGTGCTCCATTCTGGCGTTGGCGAGAGCCGGGCGTTTAATGTAGCGGCCGAGGTAATCGACATTGTGCTGGTGATTTTCTTTGGGTTGAGCAAAGTGGACTTTCCAAAATTTCTGGTATTCACGATTTAAAAATCGATTGAAGGTTGTAAGGTCACTGATTTCACTCTGGTATTCATCAGGAATAGTCAACTCCCCAGCTTTGTAGGTTTGCCTAAGCAGGTTGGTGACGGCATAGCGCCACATTGGCATAATAACTTTGCGAGTAAAATAAATCTCACACCAAGAATCATTAGCTTCGTCATAACCTCCACGTGTGACGGAGATATGAACATGTACATTCCATTTCAGATCTCGACCAAATGTATGTAAAGCGGCGAAAATGCCAATGATAAGGCCTTTCTTCTTTGCGGTTTCTAGTAACGTATTGGCTGCAGTC	NA	NA	NA	NA
WP_155080065.1|899179_899374_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080066.1|899605_900190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080067.1|900155_900302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080068.1|900460_900943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080069.1|900946_901423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080070.1|901644_902175_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|902134_902521_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|902504_903062_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|903143_903530_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080071.1|903697_904851_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	2.6e-58
WP_155080072.1|905233_905737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068012.1|905855_906188_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	35.4	2.8e-05
WP_155080073.1|906223_909175_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_155080074.1|909221_909728_-	chagasin	NA	NA	NA	NA	NA
WP_155079461.1|910274_911249_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	7.5e-27
WP_155066936.1|911445_911796_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|911827_912280_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080075.1|912284_913349_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	933290	979282	3575377	transposase,tRNA	Staphylococcus_phage(14.29%)	50	NA	NA
WP_155066936.1|933290_933641_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|933672_934125_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080087.1|934405_935255_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066440.1|935331_936306_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155080088.1|936516_936906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080089.1|937567_938617_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080090.1|939274_939685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080091.1|939771_940422_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	50.3	1.5e-47
WP_155080092.1|940418_941129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080093.1|942566_942782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081498.1|943160_943949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079887.1|944691_945234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080094.1|945208_945487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|945502_946060_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|946043_946430_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|947214_947772_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|947755_948142_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080095.1|948195_948675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|948988_949339_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|949370_949823_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080096.1|950095_950809_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_155080097.1|950898_951990_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_155080098.1|952061_952643_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_155080099.1|952648_953275_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_155067986.1|953372_954320_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	2.6e-40
WP_155068753.1|954666_955329_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|955502_956162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080100.1|956330_957590_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|957586_958672_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_155080101.1|958664_959546_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_155068752.1|959534_960791_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_155079887.1|960994_961537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080102.1|961575_962028_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_155080103.1|962084_962600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080104.1|963320_964370_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080105.1|964785_965355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068903.1|965490_965688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080106.1|966862_967834_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080107.1|967701_968097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067975.1|968963_971417_+	kinase	NA	NA	NA	NA	NA
WP_155080108.1|971504_972554_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067973.1|972667_973027_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_155067972.1|973023_973341_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_155080109.1|973405_974515_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_155080110.1|974541_975627_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_155067968.1|975749_976790_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	7.7e-70
WP_155067967.1|976804_977455_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.7	1.1e-21
WP_155080111.1|977572_978115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080112.1|978089_978263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|978307_979282_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
>prophage 16
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	993379	1066527	3575377	transposase,integrase,tRNA	Pseudomonas_phage(18.18%)	57	978307:978366	1070329:1071340
978307:978366	attL	AATGGCTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGTTTATCAGA	NA	NA	NA	NA
WP_155079445.1|993379_994354_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080120.1|994339_994771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080121.1|995125_996271_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	1.9e-61
WP_016211408.1|996479_997826_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_155066807.1|997940_998933_+	AAA family ATPase	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_155066808.1|998935_999433_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_155066809.1|999429_1000269_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155080122.1|1000301_1001834_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_155079940.1|1001879_1003061_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_155080123.1|1003246_1003753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080124.1|1003736_1005929_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	28.5	8.6e-71
WP_155080125.1|1005946_1006480_-	single-stranded DNA-binding protein	NA	A0A2K8I3B4	Pseudomonas_phage	64.6	1.0e-33
WP_155080126.1|1007116_1007500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080127.1|1007500_1008433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080128.1|1009051_1009678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080129.1|1009674_1010478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080130.1|1010988_1011516_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	31.3	1.2e-13
WP_155079413.1|1012273_1013443_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080131.1|1013715_1014102_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080132.1|1014395_1015019_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.3	4.2e-23
WP_155080133.1|1015198_1016083_-	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_155080134.1|1016212_1017034_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_155080135.1|1017035_1018073_-	asparaginase	NA	NA	NA	NA	NA
WP_155080136.1|1018073_1020731_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_155080137.1|1020808_1021618_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376219.1|1022027_1022795_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_155066817.1|1022974_1023853_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_064004235.1|1023856_1024594_+	UMP kinase	NA	NA	NA	NA	NA
WP_017376216.1|1024597_1025155_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_155080138.1|1025162_1025909_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.3	3.3e-22
WP_155066819.1|1025916_1026723_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_155080139.1|1026814_1027690_+	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_155080140.1|1028391_1029609_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080141.1|1029673_1030933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080142.1|1031409_1033362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066825.1|1033903_1034443_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_155080143.1|1034439_1035468_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_155080144.1|1035457_1036522_-	GHMP kinase	NA	NA	NA	NA	NA
WP_155080145.1|1036509_1038738_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_155080146.1|1038724_1039792_-	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_155080147.1|1040079_1042479_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_155066831.1|1042565_1043102_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_155066832.1|1043150_1044200_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|1044217_1044664_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_016209377.1|1044663_1045437_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_155080148.1|1045455_1046610_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_155080149.1|1046824_1047394_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	42.9	3.4e-27
WP_155080150.1|1047417_1050924_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.5	1.4e-192
WP_155080151.1|1051001_1051961_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_155080152.1|1051935_1053381_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_155080153.1|1053704_1055234_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.5e-85
WP_155080154.1|1055810_1057508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080155.1|1058050_1059019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080156.1|1059374_1060223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080157.1|1060514_1063205_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_155080158.1|1063451_1064615_+	MFS transporter	NA	NA	NA	NA	NA
WP_155079724.1|1065345_1066527_-|transposase	transposase	transposase	NA	NA	NA	NA
1070329:1071340	attR	AATGGCTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGTTTATCAGAAGGGGACTCCATGAGATCAATTGCTAGAGCACTTGGCTTTGCTCCTAGCACAGTCAGTCGTGAGACTAAACGGCATACCCCAAGCGATTTTAACGGTCTTTATTGCCATCGCTTGGCCTCGCGTTGTGCGCAAGAAAAACGGTCTAATGCTAAGCAAGGGCAGGATTTTCAGAAAATTTCAGAGAAAGCAAAAGTATTAATTCATGAGCGGTTAAGCACCCATACGTCACCCGATGTTATTAGTAAAGAGCTTATACAGGAGCATAATATCCAAGTGAGTGAGAGCACCATCTACCGTTATATTCATGAGGATCGAGAGAAAGGAGGAGAGCTTTACAAAAGCCTGCCCCACTCTGGAAAACCTTATAAGAAGAAGGTGAAAAGTGGTGATAAAACTAAAATACCGAACCGCGTTGGTATTGAACAAAGGCCCGCTATTGCTGACGAAAAGACTGAATTTGGACATTTTGAAATTGATACCATAGTAGGTCGAGATCACAAATCTTACTTGTTAACCCTTGTTGATAAAGCCAATAAGATGTGTTGTATAAGGAAAATGGCTAACAAATGTGCAGAAACCGTTGTTGAGACCTTCAGAAGTATAGTCGCCTCAACTTTCTTTGACTTTAAAACGATTACCTCAGATAACGGGACAGAATTCGCTGGTCATGAGGATATTTCAAAGATTACTGATGCTGATTTCTACTTTGCTAGACCTTATCGCTCTTGCGACAGAGGCCTAAATGAGCACACGAATGGTTTGATTAGGCGTTTTCTTCCTAAAGGAACAGACTTTAATGAAATAAGTGATGCTAAAATAGCAAAAATAGAGCATACATTGAATGCGAGAAGAAGGGCGAGTTTAGATTATCGCGCACCTAATCATGTTTTTTTAGAGAATTTAATGGCGGCTTAGTGTAGAGTGGTGTTGCACTTCATATGACGGAGGGCG	NA	NA	NA	NA
>prophage 17
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	1070329	1116043	3575377	transposase,integrase	unidentified_phage(57.14%)	50	1074986:1075045	1104336:1105295
WP_155079445.1|1070329_1071304_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079974.1|1071516_1071882_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080161.1|1071938_1072154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066848.1|1072506_1073046_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	53.8	2.4e-35
WP_155080162.1|1073210_1074548_-	hypothetical protein	NA	NA	NA	NA	NA
1074986:1075045	attL	TATAGCTGACACGGTTGAGTTAACCTTTTGATTTTGCTATTATTCTTACATGAAAAATAT	NA	NA	NA	NA
WP_155079476.1|1075012_1075399_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1075382_1075940_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080163.1|1076731_1077241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|1077917_1078892_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155066852.1|1080156_1080570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080164.1|1081187_1082162_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_155080165.1|1082348_1082816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|1082877_1083763_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080166.1|1083760_1085071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080167.1|1085073_1085802_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	1.5e-43
WP_155068622.1|1085993_1086446_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1086477_1086828_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080168.1|1087054_1087783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080169.1|1088522_1088705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|1088811_1089861_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080170.1|1090004_1090664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079741.1|1091169_1092144_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155067098.1|1092277_1092598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080171.1|1092543_1093119_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068846.1|1093182_1093344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068847.1|1093353_1094808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080172.1|1094908_1095883_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	8.9e-28
WP_155080173.1|1096082_1096667_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1096741_1097092_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|1097123_1097576_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079487.1|1097629_1098679_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080174.1|1098852_1099395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|1099409_1100459_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080175.1|1100500_1100878_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155080176.1|1101043_1102531_+	sodium/solute symporter	NA	NA	NA	NA	NA
WP_155079478.1|1103440_1103998_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1103981_1104368_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079836.1|1104733_1104940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1105561_1105948_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1104336:1105295	attR	ATATTTTTCATGTAAGAATAATAGCAAAATCAAAAGGTTAACTCAACCGTGTCAGCTATATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATAGTTTTAAAACGCCCTCCGTCATATGAAGTGCAACACCCAGTAGAGAGTTCACTCCCATAAAGATAAACTCTCTAGTTCGCCTTTTTGACTTAGAGGGTACAAATGGCTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGTTTATCAGAAGGGGACTCCATGAGATCAATCGCTAAGGGTCTGATTCCCCGCAGCTTGCTGCGAAAAAAAACAAAGCGCATTACGACCCGAAGGGGTAATTTTCCGAAATACCTCGTAGCTTGCTGCGAGGATAGGTAAATTGAGTTTTGCGCAAATTTATTTGCTAGAGCACTTGGCTTTGCTCCTAGCACAGTCAGTCGTGAGACTAAACGGCATACCCCAAGCGATTTTAACGGTCTTTATTGCCATCGCTTGGCCTCGCGTTGTGCGCAAGAAAAACGGTCTAATGCTAAGCAAGGGCAGGATTTTCAGAAAATTTCAGAGAAAGCAAAAGTATTAATTCATGAGCGGTTAAGCACCCATACGTCACCCGATGTTATTAGTAAAGAGCTTATACAGGAGCATAATATCCAAGTGAGTGAGAGCACCATCTACCGTTATATTCATGAGGATCGAGAGAAAGGAGGAGAGCTTTACAAAAGCCTGCCCCACTCTGGAAAACCTTATAAGAAGAAGGTGAAAAGTGGTGATAAAACTAAAATACCG	NA	NA	NA	NA
WP_155079478.1|1105931_1106489_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080177.1|1106725_1107259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080178.1|1107116_1107968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080179.1|1108412_1109465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080180.1|1111188_1111578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080181.1|1111774_1112167_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126790.1|1112171_1113077_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155080161.1|1113199_1113415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081500.1|1113571_1113796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|1114318_1115548_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080182.1|1115647_1116043_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	1129852	1229904	3575377	transposase,tRNA	Leptospira_phage(21.43%)	114	NA	NA
WP_155080192.1|1129852_1130638_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.2	1.2e-14
WP_155067557.1|1131853_1132087_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080193.1|1132159_1132387_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	45.5	3.1e-08
WP_155080194.1|1132604_1135358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080195.1|1135593_1136886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066370.1|1138602_1138884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067770.1|1139104_1139377_-	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_155080196.1|1141934_1142372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080197.1|1142796_1143864_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080198.1|1144348_1144501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080019.1|1145248_1145434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081492.1|1145360_1145750_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1145781_1146132_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080199.1|1146589_1147327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081501.1|1147471_1148086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080200.1|1148170_1149709_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_155080201.1|1149721_1150765_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_155080202.1|1151260_1151428_-	phosphatase	NA	NA	NA	NA	NA
WP_155080203.1|1151388_1152274_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1152472_1152859_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1152842_1153400_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079887.1|1153479_1154022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080204.1|1154161_1154545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080205.1|1154818_1154965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080206.1|1156130_1157126_-	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_155067762.1|1157295_1158258_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_155080207.1|1158436_1158916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079883.1|1158912_1159488_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080208.1|1159433_1159799_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080209.1|1160126_1160318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|1160314_1160872_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1160855_1161242_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080210.1|1161306_1161627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080211.1|1161601_1161790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|1161786_1162943_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080212.1|1162993_1163293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080213.1|1163380_1164862_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_155081502.1|1164866_1165319_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067136.1|1165350_1165701_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079974.1|1165818_1166184_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080161.1|1166240_1166456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080214.1|1166552_1166813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080215.1|1166872_1167847_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.1	1.3e-26
WP_155080216.1|1168336_1169419_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.7	3.8e-144
WP_155080217.1|1169500_1170606_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.9e-50
WP_155080218.1|1170718_1171252_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080219.1|1171268_1172318_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080220.1|1172360_1172915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080221.1|1172957_1174040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|1174129_1174687_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1174670_1175057_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080222.1|1175529_1177107_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.3	3.7e-15
WP_155067751.1|1177242_1177632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067750.1|1177817_1178633_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_155080223.1|1178920_1179751_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079487.1|1179765_1180815_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080224.1|1180913_1181792_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	35.8	1.5e-26
WP_155079478.1|1181799_1182357_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1182340_1182727_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080225.1|1182723_1183353_-|transposase	transposase	transposase	S5VLC8	Leptospira_phage	41.1	5.9e-33
WP_155080226.1|1183395_1183554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080227.1|1183570_1184182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|1184223_1184676_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1184707_1185058_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080228.1|1185119_1185353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|1185360_1185918_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1185901_1186288_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080229.1|1186284_1186626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080230.1|1186668_1186899_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.4	3.5e-07
WP_155079958.1|1186895_1187204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080231.1|1187259_1187508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080232.1|1187540_1188446_-	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211119.1|1188599_1189361_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_155080233.1|1189364_1190231_+	OmpA family protein	NA	NA	NA	NA	NA
WP_155067747.1|1190313_1190925_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_155067746.1|1191305_1192553_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	70.4	2.5e-14
WP_155080234.1|1192689_1193406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080235.1|1193539_1194193_-	hypothetical protein	NA	R4ZFK6	Choristoneura_rosaceana_entomopoxvirus	27.2	1.5e-07
WP_155080236.1|1194740_1195835_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_027242998.1|1195916_1196438_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_155080237.1|1196489_1196966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067739.1|1197021_1197324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080238.1|1197388_1198096_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_155067737.1|1198461_1198860_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242993.1|1198905_1199337_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242992.1|1199347_1200031_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1200106_1202302_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_155080239.1|1202405_1203143_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_064005418.1|1203170_1203956_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_155068730.1|1204024_1204729_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_155080240.1|1204716_1205886_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_155067733.1|1205940_1206768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080241.1|1206837_1209825_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_155080242.1|1209866_1211258_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_155067730.1|1211271_1211988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080243.1|1212680_1213223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079888.1|1213198_1213345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079887.1|1213319_1213862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|1214416_1215466_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080244.1|1215508_1216468_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_155067727.1|1216522_1218535_+	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_155067726.1|1218587_1218881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080245.1|1219134_1220334_+	enoyl-[acyl-carrier-protein] reductase FabV	NA	NA	NA	NA	NA
WP_155080246.1|1220409_1221993_-	amino acid permease	NA	NA	NA	NA	NA
WP_155079445.1|1222093_1223068_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080247.1|1223551_1223899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|1223941_1224991_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080248.1|1225007_1226090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080249.1|1226732_1226897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080250.1|1226981_1227401_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080251.1|1227583_1227730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080208.1|1227862_1228228_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066610.1|1228173_1228749_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080252.1|1228752_1229904_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	1235503	1269410	3575377	transposase	Leptospira_phage(42.86%)	41	NA	NA
WP_155080256.1|1235503_1236061_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080257.1|1237730_1237910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080258.1|1238727_1239981_-	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_155080259.1|1239940_1241353_-	bifunctional enoyl-CoA hydratase/phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_155080260.1|1241359_1241653_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_155080261.1|1241740_1242037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080262.1|1242015_1242900_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.0	4.0e-27
WP_155080263.1|1243044_1243785_-|transposase	transposase	transposase	S5VLC8	Leptospira_phage	42.2	4.0e-36
WP_155079476.1|1243951_1244338_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1244321_1244879_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080264.1|1244875_1245136_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.0	3.8e-10
WP_155068622.1|1245208_1245661_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1245692_1246043_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080265.1|1246108_1246264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080266.1|1246404_1247634_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080267.1|1247733_1247889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080268.1|1247944_1248757_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080269.1|1248753_1249236_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_155080270.1|1250292_1251540_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155080271.1|1252326_1253289_-	hypothetical protein	NA	A0A160DHD3	Gordonia_phage	26.5	8.0e-13
WP_155079445.1|1253312_1254287_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080272.1|1254346_1255321_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.1	8.3e-26
WP_155080273.1|1256208_1256421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081503.1|1256659_1257187_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_155080274.1|1257359_1257644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1258736_1259123_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079940.1|1259156_1260338_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_155080275.1|1260475_1260979_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067718.1|1260994_1261654_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155067717.1|1261728_1262430_+	cyclase family protein	NA	NA	NA	NA	NA
WP_155067716.1|1262453_1263260_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_155080276.1|1263520_1264003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080277.1|1264147_1264924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080278.1|1265068_1265410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080279.1|1265717_1265897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|1265877_1266435_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1266418_1266805_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155068622.1|1266919_1267372_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080280.1|1268122_1268521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|1268575_1268926_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|1268957_1269410_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	1289925	1359915	3575377	transposase,tRNA	Leptospira_phage(20.0%)	58	NA	NA
WP_155066936.1|1289925_1290276_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|1290307_1290760_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080286.1|1290754_1291285_-|transposase	transposase	transposase	S5VTP8	Leptospira_phage	37.1	2.7e-23
WP_155080287.1|1292249_1292636_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080288.1|1292619_1292994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080289.1|1292968_1293187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080290.1|1293291_1293681_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080291.1|1293951_1294599_-|transposase	transposase	transposase	S5VLC8	Leptospira_phage	41.2	2.7e-33
WP_155079959.1|1294641_1294992_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.2	7.6e-14
WP_155079958.1|1294988_1295297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080292.1|1295437_1298740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080293.1|1299440_1300409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080294.1|1300517_1301006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080295.1|1301447_1301864_+	response regulator	NA	NA	NA	NA	NA
WP_155080296.1|1301920_1302796_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155080297.1|1303149_1304511_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079741.1|1305017_1305992_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155080298.1|1306029_1306527_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_155080299.1|1306556_1307882_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_155080300.1|1307904_1308552_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155080301.1|1308745_1310692_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.8	4.7e-44
WP_155080302.1|1310835_1313766_+	peptidase M16	NA	NA	NA	NA	NA
WP_155080303.1|1314019_1314595_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080304.1|1314540_1314708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067991.1|1314752_1315169_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080305.1|1316070_1316226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|1316152_1316503_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080306.1|1316579_1316984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080307.1|1317243_1318374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|1318378_1318831_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1318862_1319213_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080308.1|1319720_1320740_-	FUSC family protein	NA	NA	NA	NA	NA
WP_155080309.1|1320732_1321779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080310.1|1322753_1322918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|1323525_1324755_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080311.1|1325780_1326815_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079478.1|1327219_1327777_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1327760_1328147_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155067684.1|1328492_1330433_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	2.1e-73
WP_155080312.1|1330570_1331224_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_155080313.1|1331392_1332568_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_155067681.1|1332936_1334262_+	fimbrial protein FimV	NA	NA	NA	NA	NA
WP_155081505.1|1334352_1335135_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_155080314.1|1335236_1336109_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_155080315.1|1336295_1337558_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_155067678.1|1337631_1338162_+	colicin V production family protein	NA	NA	NA	NA	NA
WP_155080316.1|1338183_1339689_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	4.5e-87
WP_155080317.1|1339701_1340367_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_155080318.1|1340460_1342221_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_155080319.1|1342579_1342861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080320.1|1343472_1344528_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080321.1|1346927_1347977_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080322.1|1348013_1350689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080323.1|1352332_1353232_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.1e-23
WP_155079612.1|1353345_1354575_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080324.1|1355068_1355731_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_155080325.1|1355757_1356987_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_155080326.1|1357143_1359915_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.1	1.3e-148
>prophage 21
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	1364260	1411949	3575377	transposase,integrase,tRNA	uncultured_Mediterranean_phage(36.36%)	43	1386957:1387016	1392277:1392374
WP_155080328.1|1364260_1365301_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_026063528.1|1365495_1366611_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_064004815.1|1366649_1367003_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_155067660.1|1367023_1368892_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_155067659.1|1368913_1369858_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	34.8	5.4e-38
WP_155079612.1|1370339_1371569_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209938.1|1371801_1372440_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_155080329.1|1372414_1373839_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.9	3.5e-41
WP_155067657.1|1374029_1374707_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_155067656.1|1374827_1376102_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.5	8.8e-92
WP_155080330.1|1376169_1376925_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_155080331.1|1378293_1379184_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155081506.1|1379323_1380706_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	1.9e-39
WP_155080332.1|1380905_1381094_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_122942662.1|1381107_1382241_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_155080333.1|1382439_1386285_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_155080334.1|1386322_1386982_-	hypothetical protein	NA	NA	NA	NA	NA
1386957:1387016	attL	TGAAATGACCCCCTTCCTTCCGACAAAAAGGAACCTCAATTAAGAAATTATTTTTGCCTC	NA	NA	NA	NA
WP_155080335.1|1388145_1388367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|1388487_1388838_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|1388869_1389322_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080336.1|1389316_1389640_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	45.6	9.8e-16
WP_155080337.1|1389784_1390390_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.2	5.2e-26
WP_155080338.1|1390449_1390737_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.3	2.2e-06
WP_155080339.1|1390790_1391075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080340.1|1391163_1392189_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.0	2.6e-25
WP_155068722.1|1392415_1392769_-	hypothetical protein	NA	NA	NA	NA	NA
1392277:1392374	attR	GAGGCAAAAATAATTTCTTAATTGAGGTTCCTTTTTGTCGGAAGGAAGGGGGTCATTTCAAGTAGTTAGGTGGTAGGTTTATTTTTGAGAGGTAAGAC	NA	NA	NA	NA
WP_107517381.1|1392982_1393177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080341.1|1393244_1393757_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155080342.1|1393893_1394643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080343.1|1394697_1395294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080344.1|1395327_1396143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067640.1|1396912_1397260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080345.1|1397375_1398158_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_155081507.1|1398240_1399191_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_155080346.1|1399729_1402579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080347.1|1402596_1403178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080348.1|1403297_1404026_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_155080349.1|1404390_1405494_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080350.1|1405508_1406285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080351.1|1407363_1408110_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155081508.1|1409022_1409511_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080352.1|1409660_1410740_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079864.1|1410793_1411949_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.4e-50
>prophage 22
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	1458202	1697731	3575377	protease,transposase,integrase,tRNA	unidentified_phage(28.89%)	250	1623427:1623486	1658561:1659675
WP_155067991.1|1458202_1458619_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|1458788_1459241_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1459272_1459623_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080372.1|1459760_1460990_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080182.1|1461089_1461485_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067584.1|1462178_1463525_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_155080373.1|1463672_1464971_-	PAS domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_155080374.1|1465148_1466000_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_155080375.1|1466008_1466680_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_155081511.1|1467089_1468364_+	endonuclease/exonuclease/phosphatase	NA	NA	NA	NA	NA
WP_155080376.1|1468428_1470351_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.4	9.2e-85
WP_155080377.1|1470357_1471287_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_155080378.1|1471383_1474080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067577.1|1474614_1475091_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_155080379.1|1475161_1476025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081512.1|1476152_1476971_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_155067571.1|1477077_1477539_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_155080380.1|1477555_1478479_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_155080381.1|1478502_1479564_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_155068713.1|1479701_1480295_+	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	31.4	8.1e-16
WP_155067568.1|1480317_1480788_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_155080382.1|1480876_1482148_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	2.5e-14
WP_155067544.1|1482264_1483428_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.0	2.2e-25
WP_155080383.1|1483471_1484446_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.7	4.4e-27
WP_155079487.1|1485416_1486466_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080384.1|1486807_1487542_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.3e-44
WP_155066936.1|1487609_1487960_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|1487991_1488444_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080338.1|1488592_1488880_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.3	2.2e-06
WP_155066936.1|1489257_1489608_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080385.1|1489684_1490083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|1490228_1491458_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1491757_1492144_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080386.1|1492140_1492488_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_155080387.1|1492665_1492902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080388.1|1492979_1494542_-	peptide-binding protein	NA	NA	NA	NA	NA
WP_155080389.1|1494732_1495035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|1495402_1495855_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080390.1|1496035_1496914_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080391.1|1497094_1497553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080392.1|1497763_1499239_-	amino acid permease	NA	NA	NA	NA	NA
WP_155067233.1|1499474_1499669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080393.1|1499761_1500784_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_155080394.1|1501114_1502482_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_026063533.1|1502707_1502962_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_155067236.1|1502977_1504264_+	GTPase HflX	NA	NA	NA	NA	NA
WP_155080395.1|1504283_1505498_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_155067238.1|1505497_1506391_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_155067239.1|1506588_1507887_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.8	3.2e-65
WP_155080396.1|1507975_1509253_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.9	3.4e-51
WP_155080397.1|1509266_1511666_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	4.7e-70
WP_155067241.1|1511662_1512421_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_155080398.1|1513154_1513388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080399.1|1513650_1513956_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080400.1|1514152_1514920_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1514935_1515322_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1515305_1515863_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080401.1|1515863_1516340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|1516445_1517003_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1516986_1517373_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080402.1|1517442_1518417_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	2.6e-27
WP_155080403.1|1518542_1519640_-|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	38.1	4.9e-51
WP_155080404.1|1519682_1519931_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	37.3	5.8e-08
WP_155079476.1|1519946_1520333_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1520316_1520874_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080405.1|1520874_1520991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080406.1|1520987_1521248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080407.1|1521443_1522259_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080402.1|1522419_1523394_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	2.6e-27
WP_155080408.1|1523538_1524768_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080409.1|1524881_1525121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080410.1|1525278_1526085_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	29.3	3.3e-12
WP_155080411.1|1527437_1527971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080412.1|1528179_1528473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080413.1|1528594_1529458_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	28.4	1.2e-07
WP_155081513.1|1529566_1530046_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080414.1|1530128_1530707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080415.1|1530931_1531624_+	acid phosphatase	NA	NA	NA	NA	NA
WP_155080416.1|1531662_1532472_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	30.4	1.4e-15
WP_155080417.1|1532477_1533680_-	siderophore biosynthesis PLP-dependent protein	NA	NA	NA	NA	NA
WP_155080418.1|1533710_1535582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080419.1|1535568_1536801_-	MFS transporter	NA	NA	NA	NA	NA
WP_155080420.1|1536785_1538627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080421.1|1538611_1539817_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_155080422.1|1539828_1542018_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_155067253.1|1542585_1543215_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_155067254.1|1543237_1543657_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_155067255.1|1543592_1544054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080423.1|1544053_1544890_+	TonB family protein	NA	NA	NA	NA	NA
WP_155066936.1|1548039_1548390_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|1548421_1548874_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080424.1|1548868_1549207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080425.1|1549203_1550090_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081514.1|1550334_1550496_-	phosphatase	NA	NA	NA	NA	NA
WP_155080426.1|1550937_1551252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067258.1|1551557_1551938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067259.1|1552108_1552327_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_155080427.1|1552874_1554902_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_155067263.1|1554984_1556235_-	MFS transporter	NA	NA	NA	NA	NA
WP_155067264.1|1556526_1556862_-	DUF3470 domain-containing protein	NA	NA	NA	NA	NA
WP_016211283.1|1557173_1557422_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377443.1|1557457_1557967_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_155067265.1|1557966_1558746_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_155067266.1|1558763_1559111_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_155080428.1|1559222_1559495_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	2.5e-12
WP_155079476.1|1559677_1560064_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066610.1|1560143_1560719_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079588.1|1560664_1561030_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079653.1|1561093_1561564_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079612.1|1561823_1563053_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080429.1|1563369_1563516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080430.1|1563650_1564169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080431.1|1564313_1564697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080432.1|1564784_1565066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080433.1|1565231_1565702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067468.1|1565752_1565899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080434.1|1566072_1568358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080435.1|1568346_1569075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080436.1|1569186_1569819_+	NAAT family transporter	NA	NA	NA	NA	NA
WP_155080437.1|1569854_1570031_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_155080438.1|1570105_1571251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080439.1|1571484_1572798_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	1.0e-50
WP_155080440.1|1573020_1573419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080441.1|1573689_1574538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080442.1|1574718_1575846_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080443.1|1576570_1577620_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079958.1|1578464_1578773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079959.1|1578769_1579120_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.2	7.6e-14
WP_155080444.1|1579162_1580644_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.9	8.4e-70
WP_155079612.1|1581524_1582754_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080445.1|1583026_1583932_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155067454.1|1584161_1584347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080446.1|1584388_1584925_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_155080447.1|1584942_1585299_+	DUF4131 domain-containing protein	NA	NA	NA	NA	NA
WP_155079476.1|1585317_1585704_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1585687_1586245_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081515.1|1586314_1587223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080441.1|1587452_1588301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080440.1|1588571_1588970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079439.1|1589456_1590342_+|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	28.8	1.7e-09
WP_155080448.1|1590366_1591257_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_155067446.1|1591272_1591656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080449.1|1592444_1592705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080372.1|1592870_1594100_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080450.1|1594199_1594454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|1594550_1595780_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080451.1|1595893_1596457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1599401_1599788_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080452.1|1599771_1600185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080019.1|1600432_1600618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081492.1|1600544_1600934_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1600965_1601316_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771628.1|1601927_1603049_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_155081516.1|1604840_1605962_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_144420790.1|1606058_1606274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068704.1|1606360_1607041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080453.1|1607718_1608078_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080454.1|1608619_1609594_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.5	3.1e-28
WP_155080408.1|1609738_1610968_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155067334.1|1611283_1611484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080219.1|1611873_1612923_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080455.1|1613014_1613821_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155079445.1|1613917_1614892_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155067336.1|1615041_1616013_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155067337.1|1615994_1616966_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155080456.1|1617514_1617655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|1617754_1618984_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080457.1|1619124_1619325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080458.1|1619377_1619785_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	56.0	4.2e-32
WP_155080459.1|1620014_1621787_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	8.1e-27
WP_155080460.1|1622072_1622255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080461.1|1622304_1623480_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	1.6e-18
1623427:1623486	attL	GATATCGCCCTCCGTCATATGAAGTGCAACACCCAGTAGAGAGTTCACTCCCATAAAGAT	NA	NA	NA	NA
WP_155079445.1|1623524_1624499_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_047927692.1|1624518_1624707_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079445.1|1624829_1625804_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080462.1|1625904_1626135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080463.1|1626139_1627621_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.7	8.4e-70
WP_155080464.1|1627663_1628014_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	39.2	5.8e-14
WP_155079958.1|1628010_1628319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080251.1|1628405_1628552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067341.1|1628768_1629209_-	universal stress family protein	NA	NA	NA	NA	NA
WP_155080465.1|1629861_1630182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1630214_1630601_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1630584_1631142_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1631280_1631631_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|1631662_1632115_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1632276_1632663_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080466.1|1632725_1632932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080467.1|1632940_1634094_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	6.8e-59
WP_155080468.1|1634762_1635551_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155080469.1|1635947_1636331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080470.1|1636442_1637309_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080471.1|1637584_1637962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080472.1|1638020_1638497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080473.1|1638641_1639082_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155067424.1|1639272_1641843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068702.1|1642008_1642770_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_155081517.1|1644244_1645951_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_155080474.1|1646124_1646280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080475.1|1646296_1647424_-	DUF4172 domain-containing protein	NA	D7RWK9	Brochothrix_phage	22.7	1.8e-08
WP_016210843.1|1647510_1647741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068701.1|1648351_1649131_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155080476.1|1649422_1650640_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_155080477.1|1650755_1651634_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155067416.1|1651744_1652062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067415.1|1652055_1652298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080478.1|1652585_1653587_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	5.4e-28
WP_155080479.1|1654156_1654477_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080442.1|1655846_1656974_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080480.1|1657198_1657528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|1657547_1658522_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080481.1|1658566_1658887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|1658814_1659971_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
1658561:1659675	attR	ATCTTTATGGGAGTGAACTCTCTACTGGGTGTTGCACTTCATATGACGGAGGGCGATATCTTGACAGCGATGGTGCGCTACGGAGACGTACGCTTGCCTATCGCTTATGAAGTGATAGAGAAAACCATTCGTTATAGTGACCTTCAAACCAAAAAAGAACGAAGAAAGTCTTCTTTTACAAAAAATGACCTTTTTCTAAAACTTCTGAATGTCGCTATTCGTAACGACTTAAAGTTTGCATATGTGTGTTCTGGTCAAGTCAAACAGGACACCTTCTTGCGAGAATTTTCAAAGTTAACGGGAGACAGGTATTCATTTGCTGTATGAAGCCTGTCATGATTGTAATAACGAATATAAGCTTTTACATCTTCTGCCATAGATTCCCTTGTTAAATGCACAACATTTAGCAACCATTCATTCTTCAAGCTACCAAAAAAACGCTCAACAGGCGCATTATCTAAACACGCACCAACACTACTCATGGAAGCTTCAATTTTGTGTTTTGAAAGCAGTTTTCTATACTTTTTGCTGGTATACTGTGAGCCACGATCACTATGAAAAAGAACACCTTCGCCAGGTTGACGTAAATTAATTGCCATTTCCATAGCACTCATTACTAATGGAGTGGTCATTCTCTTGTTAATTGAACAACCAATGATTTTTCTAGAATATAAATCCATCACAATAGCAAGGTACATCCAGCCTTCATTTGTTCTCAAATAGGTCACATCACCCGCCCAAGCCACATTTGGAGTCGTTGGGTTAAACTGCTGATTAAGTAAATTATCAGCGATTTCGTGGTGATGTTTACGCTTTGTTGTCACTTTATAAGCAATACGCTGCCTAACTTTCAGCCCAAGCTTTCGCATCAAGCTTCTCGCTCGATAGCGCCCAACAGTAACGCCTTCTTCTTGAAGTTTTTTAGCCATCATACGAGATCCCAAGCTTTCACGACTCTGTTTAAATAGCTCTTTGCATCGCCTGTATAGTTGCAGCTCCTCTACTGAGATTACTTTGGCAGGGCGCTCTTGCCAACTATAGAAGGCTGATGTGCTCACCTTCATAATTTTACACATCAAATTAACAGGGCATAAGTCTTTGTTATCTCTAATAAA	NA	NA	NA	NA
WP_155080482.1|1660037_1660589_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080483.1|1660625_1661594_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_155081518.1|1661799_1663212_-	MFS transporter	NA	NA	NA	NA	NA
WP_155067405.1|1663399_1664113_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.5	1.0e-36
WP_155080484.1|1664261_1664771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080485.1|1664774_1665239_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079612.1|1665385_1666615_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155067407.1|1666844_1667918_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_155080486.1|1668041_1668938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067409.1|1669262_1669451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080487.1|1669934_1670399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080488.1|1670464_1671382_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_155079487.1|1671435_1672485_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079655.1|1672794_1673769_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	9.8e-27
WP_155081519.1|1673765_1674191_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1674222_1674573_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067412.1|1674686_1675190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067413.1|1675266_1676568_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_155080489.1|1676736_1677837_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_155079655.1|1678034_1679009_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	9.8e-27
WP_155080490.1|1679137_1680514_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_155079741.1|1681085_1682060_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155067398.1|1683556_1684840_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_155080491.1|1684913_1685534_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_155067991.1|1685826_1686243_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079612.1|1686468_1687698_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080492.1|1687834_1688797_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080493.1|1688843_1689551_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155067392.1|1689716_1691075_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_155080494.1|1691149_1691713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080495.1|1691907_1693137_-	nucleoside:proton symporter	NA	B2YG43	Musca_hytrovirus	22.1	3.4e-08
WP_017376484.1|1693182_1693809_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_155080496.1|1693958_1695146_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.1	4.4e-21
WP_155080497.1|1695156_1695708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080498.1|1695999_1696530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080102.1|1696575_1697028_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_155079586.1|1697155_1697731_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	1723664	1766051	3575377	transposase	unidentified_phage(28.57%)	46	NA	NA
WP_155079445.1|1723664_1724639_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155067370.1|1724837_1726781_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	34.0	1.7e-14
WP_155080507.1|1726826_1727450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080508.1|1727618_1728284_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080509.1|1728229_1728403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080510.1|1728547_1728883_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080511.1|1728843_1729011_+	phosphatase	NA	NA	NA	NA	NA
WP_155080512.1|1729620_1731219_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	3.3e-56
WP_155080513.1|1731385_1732570_-	MFS transporter	NA	NA	NA	NA	NA
WP_155081521.1|1732866_1733418_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	26.3	8.4e-07
WP_155080514.1|1734189_1734642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080515.1|1734782_1735112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|1735112_1735670_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080516.1|1735875_1736040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080517.1|1736256_1736604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067364.1|1736588_1737263_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_155079612.1|1738231_1739461_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080518.1|1739850_1741299_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_155080519.1|1741478_1742393_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155067361.1|1742560_1742767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080520.1|1743845_1744427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|1744390_1745277_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080521.1|1745314_1746001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|1746062_1746413_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|1746444_1746897_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080522.1|1747090_1747375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080523.1|1747568_1747898_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_155067359.1|1747928_1748309_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_155067358.1|1748399_1749428_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_155067357.1|1749490_1749955_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_155067356.1|1749975_1750899_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_155067355.1|1750965_1751568_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
WP_155068695.1|1751678_1753673_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_155080524.1|1754034_1755255_+	amino acid permease	NA	NA	NA	NA	NA
WP_155080525.1|1755485_1755848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080338.1|1755813_1756101_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.3	2.2e-06
WP_155080526.1|1756160_1756583_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	35.3	4.1e-14
WP_155080527.1|1756659_1757634_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	4.1e-25
WP_155080528.1|1758306_1759401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081522.1|1759691_1760999_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377177.1|1761250_1762129_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_017377178.1|1762125_1762593_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|1762720_1762906_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_155080529.1|1764052_1764469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081523.1|1764613_1764973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|1765001_1766051_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	1774293	1891448	3575377	protease,transposase,tRNA	unidentified_phage(23.53%)	117	NA	NA
WP_155079612.1|1774293_1775523_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080534.1|1775622_1776198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081524.1|1776149_1776248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080535.1|1776199_1776550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080536.1|1777034_1778363_-	amino acid carrier protein	NA	NA	NA	NA	NA
WP_155079445.1|1778585_1779560_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080537.1|1779733_1780303_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	38.4	1.4e-28
WP_155080538.1|1780318_1780630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080539.1|1780639_1781608_-	ferrochelatase	NA	NA	NA	NA	NA
WP_155080540.1|1781730_1782084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080541.1|1782087_1783152_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_155080542.1|1783152_1784892_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.0	7.6e-54
WP_155067433.1|1784898_1785321_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_155067434.1|1785304_1785934_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_155067435.1|1786169_1786268_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155080543.1|1786387_1786594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080544.1|1786723_1787281_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1787264_1787651_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080545.1|1787666_1788785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080546.1|1788753_1789482_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155080547.1|1789511_1789808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081525.1|1790250_1791204_-	response regulator	NA	NA	NA	NA	NA
WP_144420684.1|1791372_1791621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080548.1|1791825_1792800_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	4.9e-26
WP_155067333.1|1792910_1793522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067332.1|1793889_1794717_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_155080549.1|1794852_1795317_+	amino acid permease	NA	NA	NA	NA	NA
WP_155080550.1|1795428_1796580_+	amino acid permease	NA	NA	NA	NA	NA
WP_155079478.1|1796742_1797300_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1797283_1797670_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080551.1|1797800_1798229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|1798292_1799178_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080552.1|1799182_1800001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080553.1|1800087_1800342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080554.1|1800627_1801206_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	35.5	1.3e-05
WP_155079445.1|1801336_1802311_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080555.1|1802490_1802784_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080556.1|1803103_1803652_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1803781_1804339_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080557.1|1804322_1804661_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080558.1|1805318_1805867_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080559.1|1806085_1806463_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080560.1|1806530_1806839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080561.1|1806983_1807283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080562.1|1807286_1807472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376830.1|1807767_1808082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080563.1|1810120_1810315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080564.1|1810411_1811218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|1811279_1811630_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|1811661_1812114_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080565.1|1812158_1812557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067327.1|1814532_1815522_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_155067326.1|1815858_1816044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|1816407_1817637_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155067325.1|1817942_1819898_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_155079612.1|1820061_1821291_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080566.1|1821593_1821818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079586.1|1821814_1822390_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079588.1|1822335_1822701_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080567.1|1822762_1823782_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155068678.1|1824020_1824140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080568.1|1824395_1825370_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.1	1.7e-26
WP_155080569.1|1825412_1825877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1825860_1826247_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079826.1|1826489_1827375_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080570.1|1827372_1828455_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080571.1|1828458_1828983_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.5	5.3e-19
WP_054300641.1|1829228_1829594_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081526.1|1829761_1829914_+	phosphatase	NA	NA	NA	NA	NA
WP_155080572.1|1830058_1830403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080573.1|1831292_1832654_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155067322.1|1833012_1833474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378301.1|1833643_1834441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067321.1|1834909_1836715_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_155079487.1|1837972_1839022_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1841189_1841576_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1841559_1842117_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1842385_1842736_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|1842767_1843220_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017377201.1|1845260_1845731_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_155080574.1|1846274_1847042_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080042.1|1847103_1847454_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1847697_1848048_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|1848079_1848532_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079906.1|1849015_1849288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080575.1|1850570_1852058_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_155080576.1|1852119_1853577_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_155067314.1|1853682_1854078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080577.1|1854105_1854684_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	34.7	1.5e-14
WP_155066936.1|1855421_1855772_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|1855803_1856256_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080578.1|1856835_1857402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080579.1|1857805_1858582_+	methyltransferase domain-containing protein	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	1.5e-14
WP_155081527.1|1858727_1859108_-	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
WP_155080580.1|1859610_1860168_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079731.1|1860151_1860400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|1861195_1861648_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080581.1|1861679_1861934_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080582.1|1861955_1862162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080583.1|1862475_1862700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080584.1|1862799_1864029_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080585.1|1864679_1865825_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_155080586.1|1865848_1867444_-	cytochrome bd-I ubiquinol oxidase subunit CydA	NA	NA	NA	NA	NA
WP_155067298.1|1874781_1875282_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_155080587.1|1876559_1877306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080588.1|1877576_1877975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067296.1|1879229_1879712_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_155067295.1|1879870_1881136_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_155080589.1|1881227_1882487_+	phosphoesterase	NA	NA	NA	NA	NA
WP_155068686.1|1882559_1882832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080590.1|1883115_1884378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080591.1|1884534_1885728_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080592.1|1885818_1886064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080593.1|1886514_1887564_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.1	1.0e-29
WP_155067289.1|1887734_1888508_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	1.5e-65
WP_155080594.1|1888568_1890158_-	amino acid permease	NA	NA	NA	NA	NA
WP_155080595.1|1890356_1891448_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 25
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	1898840	1947780	3575377	transposase,tRNA	unidentified_phage(16.67%)	50	NA	NA
WP_155079478.1|1898840_1899398_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080557.1|1899381_1899720_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079741.1|1900015_1900990_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155080600.1|1901066_1901387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080601.1|1901332_1901908_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080389.1|1901984_1902287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|1902654_1903107_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080602.1|1903101_1903935_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155080161.1|1905050_1905266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|1905322_1905688_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080603.1|1905749_1906055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080604.1|1907659_1908853_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080605.1|1909366_1910221_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_155080606.1|1910250_1911078_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155080607.1|1911333_1912140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067541.1|1912264_1913263_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080608.1|1913199_1913337_+	phosphatase	NA	NA	NA	NA	NA
WP_155079868.1|1915014_1916171_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155067466.1|1917422_1918247_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	8.1e-06
WP_155080609.1|1918302_1919691_-	protein kinase	NA	NA	NA	NA	NA
WP_155080610.1|1921204_1921906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1921980_1922160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080611.1|1922221_1922578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080612.1|1922655_1923399_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_155080613.1|1923412_1924456_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_155080614.1|1924588_1926361_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	39.5	6.4e-08
WP_155068706.1|1926567_1927701_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	1.6e-15
WP_155081528.1|1928250_1931070_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.1	5.2e-312
WP_155080615.1|1931443_1932172_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_155080616.1|1932286_1932550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080617.1|1933557_1934559_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081465.1|1934563_1935016_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1935047_1935398_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080618.1|1935671_1936238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079906.1|1936261_1936534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080619.1|1936511_1936700_+	phosphatase	NA	NA	NA	NA	NA
WP_155080620.1|1936837_1937092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079888.1|1937067_1937214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080621.1|1937188_1937803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080622.1|1938021_1938381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080623.1|1938467_1939619_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.0	5.2e-27
WP_155081529.1|1939763_1940150_-	hypothetical protein	NA	S5VLC8	Leptospira_phage	37.2	2.1e-09
WP_155079959.1|1940279_1940630_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.2	7.6e-14
WP_155079958.1|1940626_1940935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080624.1|1941315_1941876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|1941895_1942870_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080625.1|1942914_1943472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080626.1|1943455_1944430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080627.1|1944849_1946235_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.8	3.4e-49
WP_155080628.1|1946241_1947780_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 26
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	1958605	2003516	3575377	transposase,tRNA	Acinetobacter_phage(50.0%)	58	NA	NA
WP_155080631.1|1958605_1958989_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080632.1|1959024_1959390_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080633.1|1959335_1959911_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080634.1|1960106_1960850_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.9	2.2e-18
WP_155080635.1|1960878_1961538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080636.1|1961573_1961759_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066404.1|1961805_1962692_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1962779_1963130_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|1963161_1963614_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067835.1|1963646_1963814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080161.1|1963870_1964086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081531.1|1964242_1964467_+	hypothetical protein	NA	A0A2P0VP61	Tetraselmis_virus	45.8	8.3e-06
WP_155080637.1|1964740_1965721_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_155080638.1|1965814_1965976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|1966416_1967466_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067494.1|1967490_1968489_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.2e-34
WP_155067495.1|1968624_1968972_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_155067496.1|1968968_1969571_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_155080639.1|1969658_1971179_+	NOL1/NOP2/sun family putative RNA methylase	NA	NA	NA	NA	NA
WP_155080640.1|1971247_1971712_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_155080641.1|1971988_1972402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080642.1|1972767_1973007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|1973001_1973454_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1973485_1973836_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080643.1|1973905_1974604_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080644.1|1974596_1974752_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155080645.1|1974776_1975340_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.5	1.9e-35
WP_155080646.1|1975456_1975750_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.5	2.2e-06
WP_155067468.1|1975833_1975980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080647.1|1976511_1976685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080648.1|1976681_1979738_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_155080649.1|1979819_1981268_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155080650.1|1981700_1982705_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_155067505.1|1982827_1983226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080651.1|1983265_1985089_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_155080652.1|1985085_1988388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080653.1|1988418_1989333_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_155080654.1|1989407_1990037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067510.1|1990081_1990516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081532.1|1990496_1991237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080655.1|1992832_1993003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080656.1|1992962_1993232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080657.1|1993277_1993493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080658.1|1993436_1993751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|1993778_1994935_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080659.1|1994985_1995786_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080660.1|1995800_1996739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080661.1|1996754_1996922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080662.1|1996985_1997132_+	phosphatase	NA	NA	NA	NA	NA
WP_155080663.1|1997460_1998576_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080664.1|1999763_1999922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080665.1|2001523_2001676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068709.1|2001757_2001832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080666.1|2001887_2002274_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080667.1|2002335_2002488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080582.1|2002549_2002756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080581.1|2002777_2003032_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081533.1|2003063_2003516_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	2014374	2068585	3575377	transposase	Streptococcus_phage(20.0%)	51	NA	NA
WP_155079478.1|2014374_2014932_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2014915_2015302_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080671.1|2016539_2016746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377969.1|2016777_2017017_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_155067536.1|2017338_2017683_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_155067537.1|2017772_2018357_-	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_155067538.1|2018492_2019179_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.5	1.6e-28
WP_155067539.1|2019302_2020487_-	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
WP_155080672.1|2020702_2022145_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X9I5H2	Streptococcus_phage	24.2	5.9e-20
WP_155067540.1|2022281_2023232_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155080673.1|2023330_2024104_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_155068622.1|2025460_2025913_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2025944_2026295_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079881.1|2026360_2026774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2026757_2027144_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080674.1|2027247_2028606_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_155080675.1|2028527_2028716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080676.1|2029189_2029741_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2030018_2030405_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080677.1|2031385_2031958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080678.1|2032066_2033569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080679.1|2033661_2036091_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_155080680.1|2036284_2036491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080681.1|2036628_2037825_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_155080682.1|2037872_2040239_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_155080683.1|2041017_2041809_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.2	2.2e-24
WP_155079445.1|2041988_2042963_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080684.1|2042959_2043517_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079974.1|2043462_2043828_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080685.1|2043863_2044091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080383.1|2044114_2045089_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.7	4.4e-27
WP_155079974.1|2045563_2045929_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080686.1|2045874_2046450_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080687.1|2046413_2047382_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211833.1|2047469_2047970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|2048552_2048906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080688.1|2049206_2050934_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_155067546.1|2051037_2051763_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.2	2.9e-31
WP_155067547.1|2051755_2052994_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155080689.1|2053131_2054169_+	agmatine deiminase	NA	M1H3B1	Paramecium_bursaria_Chlorella_virus	29.1	8.3e-40
WP_155067549.1|2054222_2055125_+	acyltransferase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	41.0	7.2e-56
WP_155080690.1|2055234_2056488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080691.1|2056545_2060037_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_155067552.1|2060096_2060825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080692.1|2060952_2061501_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_155080693.1|2061715_2062369_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.9	1.0e-35
WP_016211467.1|2062421_2062988_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_155067560.1|2062990_2064115_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_155068712.1|2064199_2065012_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_155080694.1|2065142_2067122_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_155080442.1|2067457_2068585_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	2192740	2260631	3575377	transposase	Acinetobacter_phage(42.86%)	55	NA	NA
WP_155079612.1|2192740_2193970_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080762.1|2194034_2194679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2194833_2195220_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2195203_2195761_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080716.1|2196823_2198005_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079478.1|2198372_2198930_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2198913_2199300_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080763.1|2199376_2199670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2199692_2200079_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2200062_2200620_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080764.1|2200751_2201195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080765.1|2201573_2201768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080766.1|2201972_2202329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|2202385_2202751_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079868.1|2203167_2204323_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080767.1|2204280_2205879_-	dolichyl-phosphate-mannose-protein mannosyltransferase	NA	NA	NA	NA	NA
WP_155080768.1|2206173_2206929_+	zinc transporter	NA	NA	NA	NA	NA
WP_155080769.1|2207582_2208736_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.0	3.4e-58
WP_155067135.1|2208990_2209662_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_155079487.1|2211149_2212199_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080161.1|2212448_2212664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|2212720_2213086_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080770.1|2213336_2216738_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	1.0e-09
WP_155067131.1|2216734_2219428_-	DNA repair protein	NA	NA	NA	NA	NA
WP_155080771.1|2219731_2221204_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.8	2.4e-32
WP_155080772.1|2221863_2222685_-	DUF1338 family protein	NA	NA	NA	NA	NA
WP_155080773.1|2222756_2224289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080774.1|2224558_2226733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067125.1|2226755_2227436_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
WP_155080775.1|2227752_2229741_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155067123.1|2229755_2230097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067122.1|2230101_2230539_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_155080776.1|2230564_2231950_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_155080777.1|2232069_2232501_-	flaG family protein	NA	NA	NA	NA	NA
WP_155067119.1|2232606_2234184_-	B-type flagellin	NA	NA	NA	NA	NA
WP_155080778.1|2234408_2236001_-	B-type flagellin	NA	NA	NA	NA	NA
WP_155080779.1|2236201_2238403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080780.1|2238496_2239930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080781.1|2239972_2240488_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155080782.1|2240487_2241435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080783.1|2241418_2242093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080784.1|2242080_2242809_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155067107.1|2242798_2243545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080785.1|2243528_2244593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067105.1|2244797_2245994_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_155067104.1|2246044_2247166_-	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	27.8	3.0e-11
WP_155080786.1|2247685_2249434_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155067102.1|2249485_2250745_-	threonine synthase	NA	NA	NA	NA	NA
WP_155068677.1|2250731_2251700_-	homoserine kinase	NA	NA	NA	NA	NA
WP_155081540.1|2251713_2254182_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_155080787.1|2254603_2255125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|2255081_2256238_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080788.1|2256774_2257488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080789.1|2259400_2259592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080790.1|2259656_2260631_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
>prophage 30
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	2280367	2328925	3575377	protease,transposase,tRNA	unidentified_phage(50.0%)	41	NA	NA
WP_155081541.1|2280367_2280784_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080806.1|2281335_2282706_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_155080807.1|2283321_2283513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079975.1|2284821_2285397_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079974.1|2285342_2285708_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080808.1|2285852_2286287_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080809.1|2286592_2287171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080810.1|2288364_2288634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080811.1|2288661_2289815_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	6.8e-59
WP_155080812.1|2290588_2291977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068675.1|2292144_2292438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067075.1|2292513_2292897_-	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_032126790.1|2295174_2296080_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155080813.1|2296130_2296661_-	exsB family protein	NA	NA	NA	NA	NA
WP_155080814.1|2296671_2297724_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_155080815.1|2297739_2299779_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	41.2	7.1e-128
WP_155080816.1|2299765_2300596_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_155080817.1|2300663_2304203_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_155079445.1|2304548_2305523_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079478.1|2309218_2309776_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2309759_2310146_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080818.1|2310259_2310409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080819.1|2310609_2311893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080820.1|2312319_2313948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080821.1|2314329_2315184_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080822.1|2315202_2315424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|2315485_2315836_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081541.1|2315903_2316320_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067991.1|2316332_2316749_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080823.1|2317423_2318902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080824.1|2319340_2320657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2320735_2321122_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2321105_2321663_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080825.1|2321729_2322425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079741.1|2322467_2323442_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155080826.1|2323529_2323967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080608.1|2323903_2324041_+	phosphatase	NA	NA	NA	NA	NA
WP_155080827.1|2325766_2327476_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155067055.1|2327648_2328011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|2328090_2328543_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2328574_2328925_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	2343463	2396131	3575377	protease,transposase,tRNA	unidentified_phage(21.43%)	52	NA	NA
WP_155067038.1|2343463_2344885_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155080832.1|2344974_2346573_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_155067036.1|2346729_2347356_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_155080833.1|2347437_2350110_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_155080834.1|2350593_2351550_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_016209435.1|2351650_2352022_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_155067033.1|2352047_2352911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080835.1|2352900_2353689_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_155067031.1|2353976_2354462_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2354538_2355060_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_155080836.1|2355105_2355999_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_027242840.1|2355995_2356817_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_016209408.1|2357129_2357300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067028.1|2357452_2358856_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_155080837.1|2358965_2360273_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_155080838.1|2360296_2361271_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.7	2.6e-27
WP_155080839.1|2361330_2362032_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_155067025.1|2362043_2363321_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	4.8e-21
WP_017376087.1|2363420_2363795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080840.1|2363879_2364767_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080841.1|2364823_2365552_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_155081542.1|2365548_2366658_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_155067022.1|2366809_2367238_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	4.0e-17
WP_155067021.1|2367333_2367693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080842.1|2367682_2368894_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7C038	Faustovirus	31.1	6.1e-34
WP_155067019.1|2368890_2369679_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_122940639.1|2369841_2370636_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_155080843.1|2371111_2371852_-	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_155080844.1|2371855_2374387_-	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	2.2e-86
WP_155080845.1|2374654_2375611_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.3	3.5e-61
WP_155081543.1|2375594_2376350_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_016211259.1|2376439_2376685_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_155067011.1|2376744_2379018_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	2.3e-167
WP_122940630.1|2379072_2379426_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|2379615_2379909_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_155068670.1|2380334_2380910_-	DedA family protein	NA	NA	NA	NA	NA
WP_155080846.1|2381192_2382509_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2382519_2382888_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_155067009.1|2382918_2383581_-	adenylate kinase	NA	NA	NA	NA	NA
WP_155079476.1|2383716_2384103_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2384086_2384644_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080847.1|2384808_2385528_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.1e-19
WP_155080848.1|2385507_2386326_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_155081544.1|2386338_2388516_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_155067006.1|2388619_2389969_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	26.9	1.3e-32
WP_155080849.1|2390042_2390732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080850.1|2390864_2392052_+	MFS transporter	NA	NA	NA	NA	NA
WP_155080851.1|2392282_2393461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080852.1|2393730_2394075_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2394055_2394613_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2394596_2394983_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079445.1|2395156_2396131_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
>prophage 32
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	2410864	2451496	3575377	transposase,tRNA	Acinetobacter_phage(28.57%)	44	NA	NA
WP_155080857.1|2410864_2411839_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	3.4e-27
WP_155080858.1|2412421_2414149_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_155066993.1|2414138_2415347_+	MFS transporter	NA	NA	NA	NA	NA
WP_155080859.1|2415435_2416437_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155080860.1|2416665_2417877_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155080861.1|2418188_2418818_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_155080862.1|2418866_2419883_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.9	1.6e-99
WP_016211035.1|2420130_2420346_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_155066988.1|2420398_2420848_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	5.4e-20
WP_155080863.1|2420927_2422673_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	3.8e-45
WP_155080864.1|2422764_2424636_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	31.1	7.2e-34
WP_155080102.1|2424824_2425277_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_155080865.1|2425638_2426688_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300641.1|2427137_2427503_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079413.1|2428060_2429230_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080866.1|2431061_2432176_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.4	2.0e-44
WP_155080867.1|2432522_2432786_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080868.1|2432827_2433187_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080869.1|2433890_2434460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122942521.1|2434452_2434749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080870.1|2434745_2435354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080871.1|2435627_2435828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081546.1|2435839_2436175_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_016211873.1|2436168_2436426_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155067063.1|2436685_2437636_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2437651_2438038_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2438021_2438579_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080174.1|2438707_2439250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080872.1|2439781_2440267_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_155080467.1|2440367_2441520_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	6.8e-59
WP_155080873.1|2441529_2441787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080874.1|2442012_2442834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080875.1|2443221_2443497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|2444370_2445256_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080876.1|2445216_2445795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|2445897_2446248_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|2446279_2446732_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080877.1|2446726_2447305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079906.1|2447352_2447625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080878.1|2447602_2447746_+	phosphatase	NA	NA	NA	NA	NA
WP_155080219.1|2448682_2449732_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079971.1|2450219_2450390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|2450316_2450667_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080879.1|2450728_2451496_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	2460115	2511785	3575377	transposase	Acinetobacter_phage(25.0%)	54	NA	NA
WP_155080885.1|2460115_2460709_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080886.1|2460991_2461456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|2461677_2462834_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080887.1|2463076_2463379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080888.1|2463788_2464115_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2464146_2464599_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066610.1|2465052_2465628_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079588.1|2465573_2465939_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080889.1|2466326_2466932_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2466891_2467278_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2467261_2467819_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2467825_2468212_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080890.1|2468331_2468970_+	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_155080891.1|2468994_2469561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080892.1|2469569_2470802_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_155066960.1|2470889_2472326_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155066956.1|2472550_2473798_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036773927.1|2474233_2474869_-	peroxiredoxin C	NA	NA	NA	NA	NA
WP_155080893.1|2475421_2476924_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_155080894.1|2476910_2480747_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_155080895.1|2480895_2482074_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.9	1.2e-50
WP_016210416.1|2482146_2482677_-	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_155079476.1|2482953_2483340_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080896.1|2483401_2483644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080897.1|2483824_2484025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|2484033_2484486_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2484517_2484868_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080898.1|2485392_2485914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|2486300_2487350_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080899.1|2487364_2487685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066949.1|2488315_2489452_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_155080900.1|2489470_2491426_-	HAD-IC family P-type ATPase	NA	M1HK51	Paramecium_bursaria_Chlorella_virus	29.4	2.7e-55
WP_155079476.1|2491441_2491828_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2491811_2492369_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066948.1|2493335_2494511_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_155080901.1|2494848_2496105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080902.1|2496182_2497424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080903.1|2497520_2498018_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066610.1|2497963_2498539_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080904.1|2498542_2499265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080905.1|2499645_2500620_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155080906.1|2500643_2501141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080907.1|2501321_2501801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080908.1|2502071_2502407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080909.1|2502482_2502950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080910.1|2502925_2503102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068662.1|2503778_2503847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080911.1|2504002_2504953_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079940.1|2504918_2506100_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_155079454.1|2506252_2506444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080912.1|2506635_2508078_-	MFS transporter	NA	NA	NA	NA	NA
WP_155081548.1|2508591_2510013_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_155080913.1|2510505_2510952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080914.1|2511128_2511785_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	2525471	2578780	3575377	protease,transposase	Bacillus_phage(15.38%)	48	NA	NA
WP_155079413.1|2525471_2526641_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080925.1|2527423_2529748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066921.1|2530040_2531933_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	33.0	1.6e-81
WP_155079476.1|2533460_2533847_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066919.1|2534653_2534836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080926.1|2535730_2535946_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080927.1|2535964_2536705_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	35.1	4.2e-22
WP_155080928.1|2536878_2537817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080929.1|2539698_2540577_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300641.1|2540598_2540964_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080930.1|2541020_2541335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080931.1|2541515_2541773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080932.1|2541951_2542437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080933.1|2542548_2544063_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_155080934.1|2544189_2545218_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_155081551.1|2545274_2546417_+	galactokinase	NA	NA	NA	NA	NA
WP_155080935.1|2546550_2548254_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.0	1.3e-21
WP_155080936.1|2548250_2550371_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.0	2.0e-16
WP_155080937.1|2550367_2551717_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155080938.1|2551688_2553836_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	2.4e-25
WP_155080939.1|2554240_2554393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080940.1|2554423_2554966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080941.1|2554941_2555088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079887.1|2555062_2555605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066469.1|2555690_2555963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|2556305_2556656_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2556687_2557140_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080942.1|2557335_2557731_+	CrcB family protein	NA	NA	NA	NA	NA
WP_155080943.1|2557739_2558624_-	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	36.0	2.2e-41
WP_155080944.1|2558656_2560555_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_016209655.1|2560637_2560910_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_155066897.1|2561013_2563446_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.6e-219
WP_016209663.1|2563513_2564815_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_016209647.1|2564896_2565502_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_155066896.1|2565614_2566919_-	trigger factor	NA	NA	NA	NA	NA
WP_155080945.1|2567520_2568396_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.4	6.8e-35
WP_155080946.1|2568510_2569011_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_155066936.1|2569092_2569443_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2569474_2569927_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081552.1|2569921_2570134_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_155080947.1|2570187_2570346_+	phosphatase	NA	NA	NA	NA	NA
WP_155080948.1|2570564_2571920_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_155080949.1|2572040_2572778_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_155080950.1|2572855_2573569_-	aldolase	NA	NA	NA	NA	NA
WP_155080951.1|2574220_2575495_+	MFS transporter	NA	NA	NA	NA	NA
WP_155080952.1|2575525_2576101_+	bleomycin resistance protein	NA	NA	NA	NA	NA
WP_155080953.1|2576146_2577112_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	37.8	1.1e-43
WP_155079445.1|2577805_2578780_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
>prophage 35
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	2605554	2633340	3575377	transposase,tRNA	Burkholderia_phage(20.0%)	30	NA	NA
WP_155079478.1|2605554_2606112_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080967.1|2606108_2606507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080968.1|2606855_2607152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080969.1|2607391_2607604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080161.1|2607524_2607740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067835.1|2607796_2607964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080970.1|2607888_2608179_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066863.1|2608395_2608851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080971.1|2608925_2609837_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079826.1|2609872_2610758_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080205.1|2610787_2610934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210741.1|2611028_2611352_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_155066862.1|2611358_2615255_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	2.0e-118
WP_155080972.1|2615300_2615861_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_155080973.1|2615901_2617482_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	26.8	8.8e-17
WP_155066859.1|2617550_2619008_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.3	6.5e-99
WP_155081556.1|2619452_2621411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066857.1|2621729_2622350_-	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155080974.1|2622516_2622741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080975.1|2623298_2623547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080976.1|2623467_2624274_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.0	3.1e-10
WP_155079487.1|2624793_2625843_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080977.1|2626273_2627323_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068734.1|2627393_2627963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080978.1|2628193_2628598_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|2628610_2628751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|2628845_2630045_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_155080979.1|2630065_2630677_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_155080980.1|2630878_2631640_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155079612.1|2632110_2633340_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	2642669	2692427	3575377	transposase,tRNA	unidentified_phage(16.67%)	45	NA	NA
WP_155079478.1|2642669_2643227_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080987.1|2643207_2644125_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	1.5e-24
WP_155081560.1|2644255_2645350_-	FUSC family protein	NA	NA	NA	NA	NA
WP_155067817.1|2645474_2646791_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.6	9.4e-65
WP_155080988.1|2646845_2651732_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_155081561.1|2651824_2652127_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_155067819.1|2652237_2654160_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_155067820.1|2654181_2655477_+	DUF444 family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_155080989.1|2655473_2657096_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_155080990.1|2657202_2657469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081562.1|2658705_2659404_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_155080991.1|2659550_2660120_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_155080992.1|2660403_2661030_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_155079974.1|2661769_2662135_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079975.1|2662080_2662656_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080993.1|2662730_2663606_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155080994.1|2663694_2664408_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.8	7.9e-42
WP_155080995.1|2664404_2664671_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081563.1|2664705_2664966_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080996.1|2664988_2665291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068097.1|2665217_2665568_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067839.1|2667124_2667964_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	34.9	1.8e-32
WP_016210463.1|2668014_2668362_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_155080997.1|2668552_2669440_+	ROK family protein	NA	NA	NA	NA	NA
WP_155080998.1|2669554_2670157_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_155080999.1|2670153_2670873_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_080963631.1|2670941_2672654_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_155079478.1|2674100_2674658_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2674641_2675028_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081564.1|2675717_2676767_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_155067844.1|2676766_2677042_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_155081000.1|2678100_2680692_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_155081001.1|2680856_2681015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081002.1|2681216_2681759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079888.1|2681734_2681881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080210.1|2681855_2682176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081003.1|2682254_2682398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081004.1|2682467_2683326_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079612.1|2683463_2684693_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081005.1|2686105_2687131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081006.1|2687386_2687656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081007.1|2687930_2688854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067849.1|2688867_2689791_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_155081008.1|2689738_2690356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|2691869_2692427_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	2704004	2753977	3575377	transposase,integrase	unidentified_phage(25.0%)	58	2703969:2704028	2741176:2742281
2703969:2704028	attL	CGCCCTCCGTCATATGAAGTGCAACACCACTCTACACTAAGCCGCCATTAAATTCTCTAA	NA	NA	NA	NA
WP_155079445.1|2704004_2704979_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080465.1|2705085_2705406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2705696_2706083_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2706066_2706624_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081016.1|2706664_2706841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210305.1|2706970_2707375_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2707435_2708161_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_155081017.1|2708246_2709140_+	YicC family protein	NA	NA	NA	NA	NA
WP_155067858.1|2709180_2709801_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	35.1	4.8e-19
WP_016210310.1|2709861_2710068_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_155081018.1|2710089_2712234_+	RelA/SpoT family protein	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_155081019.1|2712251_2712389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079741.1|2712645_2713620_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155081020.1|2713696_2713900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081021.1|2714980_2715340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080546.1|2715421_2716150_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155081022.1|2716192_2716468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081023.1|2716776_2718018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|2719232_2719790_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2719773_2720160_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2720944_2721502_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2721485_2721872_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081024.1|2722343_2723267_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.9	2.2e-23
WP_155081025.1|2723467_2723653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081026.1|2723736_2724549_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2724545_2724932_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2724915_2725473_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081027.1|2725480_2725858_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155081565.1|2725989_2726472_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081533.1|2726885_2727338_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080581.1|2727369_2727624_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080582.1|2727645_2727852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080172.1|2728144_2729119_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	8.9e-28
WP_155067098.1|2729177_2729498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066610.1|2729443_2730019_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067869.1|2730503_2731523_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_017376520.1|2731509_2731932_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_155067870.1|2731933_2732407_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	8.1e-27
WP_155081028.1|2732514_2733138_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	45.1	1.0e-40
WP_155081029.1|2733168_2733843_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	2.3e-30
WP_155067873.1|2733848_2734997_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	6.8e-43
WP_155067874.1|2734993_2735455_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_155081030.1|2735552_2736803_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A219Y950	Aeromonas_phage	54.4	4.1e-102
WP_155081031.1|2736929_2738609_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.5	1.3e-37
WP_155081032.1|2738719_2739601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081033.1|2739793_2740114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081034.1|2740141_2740885_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155079445.1|2741211_2742186_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155081035.1|2742280_2742991_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
2741176:2742281	attR	CGCCCTCCGTCATATGAAGTGCAACACCACTCTACACTAAGCCGCCATTAAATTCTCTAAAAAAACATGATTAGGTGCGCGATAATCTAAACTCGCCCTTCTTCTCGCATTCAATGTATGCTCTATTTTTGCTATTTTAGCATCACTTATTTCATTAAAGTCTGTTCCTTTAGGAAGAAAACGCCTAATCAAACCATTCGTGTGCTCATTTAGGCCTCTGTCGCAAGAGCGATAAGGTCTAGCAAAGTAGAAATCAGCATCAGTAATCTTTGAAATATCCTCATGACCAGCGAATTCTGTCCCGTTATCTGAGGTAATCGTTTTAAAGTCAAAGAAAGTTGAGGCGACTATACTTCTGAAGGTCTCAACAACGGTTTCTGCACATTTGTTAGCCATTTTCCTTATACAACACATCTTATTGGCTTTATCAACAAGGGTTAACAAGTAAGATTTGTGATCTCGACCTACTATGGTATCAATTTCAAAATGTCCAAATTCAGTCTTTTCGTCAGCAATAGCGGGCCTTTGTTCAATACCAACGCGGTTCGGTATTTTAGTTTTATCACCACTTTTCACCTTCTTCTTATAAGGTTTTCCAGAGTGGGGCAGGCTTTTGTAAAGCTCTCCTCCTTTCTCTCGATCCTCATGAATATAACGGTAGATGGTGCTCTCACTCACTTGGATATTATGCTCCTGTATAAGCTCTTTACTAATAACATCGGGTGACGTATGGGTGCTTAACCGCTCATGAATTAATACTTTTGCTTTCTCTGAAATTTTCTGAAAATCCTGCCCTTGCTTAGCATTAGACCGTTTTTCTTGCGCACAACGCGAGGCCAAGCGATGGCAATAAAGACCGTTAAAATCGCTTGGGGTATGCCGTTTAGTCTCACGACTGACTGTGCTAGGAGCAAAGCCAAGTGCTCTAGCAATTGATCTCATGGAGTCCCCTTCTGATAAACGTTGTTCGATATAAAAACGATCTTTTTCATTTAAGTGCCGATAAGCCATTTGTACCCTCTAAGTCAAAAAGGCGAACTAGAGAGTTTATCTTTATGGGAGTGAACTCTCTACTGGGTGTTGCACTTCATATGACGGAGGGCGTA	NA	NA	NA	NA
WP_155081036.1|2743626_2743938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081037.1|2743917_2744316_-	VOC family protein	NA	NA	NA	NA	NA
WP_155067882.1|2744492_2744798_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_155067883.1|2744875_2745130_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_155081038.1|2745282_2746944_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_155067885.1|2747004_2747688_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_155067886.1|2747687_2748776_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.6	9.8e-76
WP_155081039.1|2748814_2751451_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.5	3.4e-98
WP_155081040.1|2753091_2753977_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 38
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	2759165	2807639	3575377	transposase,integrase,tRNA	Halovirus(16.67%)	52	2804501:2804560	2809013:2809301
WP_155066936.1|2759165_2759516_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2759547_2760000_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067895.1|2760049_2760394_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_155079476.1|2761418_2761805_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2761788_2762346_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081046.1|2762919_2763951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067902.1|2764151_2764418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067903.1|2764474_2764822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067904.1|2764856_2765519_-	PAS fold family protein	NA	NA	NA	NA	NA
WP_155081566.1|2765562_2766165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941797.1|2766394_2767450_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	2.0e-49
WP_155067906.1|2767453_2770639_+	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_155081047.1|2770716_2771673_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.4e-49
WP_155081048.1|2771721_2772258_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_155067909.1|2772254_2773016_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_155081049.1|2773118_2775707_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.2	8.8e-123
WP_155081567.1|2776423_2777074_-	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_155081050.1|2777425_2778301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067916.1|2778529_2778931_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_155081051.1|2778947_2779496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2779647_2780034_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2780017_2780575_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081052.1|2780765_2781143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|2781845_2782298_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2782329_2782680_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079478.1|2782882_2783440_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2783423_2783810_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081053.1|2783806_2784442_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155081054.1|2784695_2784887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081055.1|2784887_2787098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080005.1|2787205_2788092_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2789147_2789534_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081056.1|2789517_2790075_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081568.1|2790077_2790338_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2790332_2790785_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2790816_2791167_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081057.1|2792592_2793066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081058.1|2793598_2794546_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081059.1|2794726_2795116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081060.1|2795301_2796594_-	MFS transporter	NA	NA	NA	NA	NA
WP_155081061.1|2796920_2798984_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_155081062.1|2798986_2799634_+	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_017376743.1|2799649_2800282_+	endonuclease III	NA	NA	NA	NA	NA
WP_155067929.1|2800350_2800788_+	DUF1841 family protein	NA	NA	NA	NA	NA
WP_155079889.1|2801029_2801572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079888.1|2801547_2801694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081063.1|2801668_2802211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081569.1|2802611_2802767_+	phosphatase	NA	NA	NA	NA	NA
WP_155079445.1|2803135_2804110_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
2804501:2804560	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_155067931.1|2805328_2805595_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081064.1|2805669_2806281_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	42.3	1.1e-36
WP_155081065.1|2807450_2807639_+|transposase	transposase	transposase	NA	NA	NA	NA
2809013:2809301	attR	TGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGCGTCTATTAAAAAGACCAGAGTATAGCTTTATGCGAGCGGAACTGAATATAAACAAAACTCAGGTAACTCCTGATAATTTACGTATGATTGCATGCTATGGCCGTATTAAAAGTGATCAAGAATCAATTCGTACAGCCAGAGAATTTTTTTCATCAACAAGAGTCGACAAAGGCAGCTCTAGTGCCAGTAAATTTTTTCAAACCCACACAGGCGCATCATCGCCTCGCT	NA	NA	NA	NA
>prophage 39
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	2827079	2861405	3575377	transposase,tRNA	Planktothrix_phage(28.57%)	33	NA	NA
WP_155081074.1|2827079_2827997_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066800.1|2828341_2829028_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066799.1|2829092_2830379_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_155066739.1|2830535_2830886_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2830917_2831370_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017376633.1|2831603_2831873_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_155081075.1|2832057_2833035_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.0	1.7e-15
WP_155066797.1|2833095_2834070_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.8	3.3e-14
WP_155066796.1|2834169_2835246_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155081076.1|2835326_2836313_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155066795.1|2836323_2838126_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155066794.1|2838140_2839442_-	aspartate kinase	NA	NA	NA	NA	NA
WP_155066793.1|2839457_2840741_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_155081077.1|2840873_2841263_+	RidA family protein	NA	NA	NA	NA	NA
WP_155081078.1|2841367_2842549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066790.1|2842737_2843754_-	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	26.1	3.2e-12
WP_155066789.1|2843756_2844764_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.2	1.1e-36
WP_155081570.1|2844767_2845922_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	32.1	8.6e-38
WP_016209558.1|2845936_2846299_-	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_155081079.1|2846295_2848011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081080.1|2848074_2848785_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2848813_2849218_+	RidA family protein	NA	NA	NA	NA	NA
WP_155081571.1|2850622_2851804_-	MFS transporter	NA	NA	NA	NA	NA
WP_155080465.1|2851865_2852186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|2852204_2852762_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2852745_2853132_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080667.1|2853150_2853303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2853364_2853751_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081081.1|2854488_2855499_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	41.6	6.6e-58
WP_155079612.1|2856527_2857757_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081082.1|2857953_2858247_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080320.1|2858312_2859368_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079868.1|2860249_2861405_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
>prophage 40
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	2876828	2933251	3575377	transposase	Bacillus_virus(14.29%)	52	NA	NA
WP_155081058.1|2876828_2877776_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081092.1|2877956_2878346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081093.1|2878997_2879327_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_155081575.1|2879560_2880265_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_155081094.1|2880245_2882474_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.2	3.4e-83
WP_155066766.1|2882638_2883652_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_155066765.1|2883759_2883981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066764.1|2883985_2885623_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	4.4e-88
WP_155066763.1|2885761_2886295_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_155081095.1|2886415_2887534_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155081096.1|2887526_2888849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066756.1|2888835_2889972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066755.1|2890202_2890628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080389.1|2892913_2893216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|2893583_2894036_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066753.1|2894340_2894694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068648.1|2894757_2895162_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155081097.1|2895309_2896485_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_155081576.1|2897033_2897537_-	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	32.8	6.2e-09
WP_155081098.1|2897576_2899061_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	2.5e-45
WP_155066747.1|2899283_2900237_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	3.8e-31
WP_155066746.1|2900217_2901309_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_155081099.1|2901396_2901639_-	response regulator SirA	NA	NA	NA	NA	NA
WP_155068647.1|2902255_2902594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081100.1|2902590_2903166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081101.1|2903738_2904011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068646.1|2904164_2904419_-	DUF493 family protein	NA	NA	NA	NA	NA
WP_155081102.1|2904533_2905937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081103.1|2906064_2906289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081577.1|2906353_2906854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081104.1|2907419_2909237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081105.1|2909306_2910356_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081106.1|2910442_2911045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064006185.1|2912596_2913313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081107.1|2914046_2914286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066739.1|2914212_2914563_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081108.1|2915925_2916534_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155081109.1|2917701_2919690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081110.1|2920959_2921763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081111.1|2921931_2923371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|2923717_2924767_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081112.1|2925267_2926233_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_155066693.1|2926186_2926882_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	3.5e-10
WP_155079476.1|2927490_2927877_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2927860_2928418_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081113.1|2928476_2928851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066695.1|2928944_2929502_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155079815.1|2930229_2931204_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	4.0e-28
WP_155081114.1|2931250_2931529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081115.1|2931827_2932049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081116.1|2932077_2932218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|2932201_2933251_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 41
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	2938921	3048991	3575377	transposase	unidentified_phage(35.71%)	116	NA	NA
WP_155079741.1|2938921_2939896_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155081122.1|2939990_2940305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2940687_2941074_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2941057_2941615_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081123.1|2942292_2942724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081124.1|2942801_2943086_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_155081125.1|2943118_2944168_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068639.1|2947184_2947586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066706.1|2947578_2948592_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-15
WP_155066707.1|2948578_2949367_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_155081126.1|2949560_2950532_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_155081127.1|2950544_2951012_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155066936.1|2951276_2951627_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|2951658_2952111_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081128.1|2952290_2953661_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.8	2.9e-109
WP_155081129.1|2953964_2954435_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	37.3	1.6e-22
WP_155079490.1|2954650_2955625_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.5	2.3e-28
WP_155081578.1|2956411_2957362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081130.1|2957636_2959802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081131.1|2960249_2961224_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	8.9e-28
WP_155081132.1|2961269_2961464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079974.1|2961976_2962342_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080686.1|2962287_2962863_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080208.1|2963349_2963715_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081133.1|2963771_2964011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|2964072_2964958_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081134.1|2964970_2965285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081135.1|2965372_2966269_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079940.1|2966234_2967416_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_155081136.1|2967551_2967869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081137.1|2968054_2968204_+	phosphatase	NA	NA	NA	NA	NA
WP_155081138.1|2969305_2970535_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081139.1|2971123_2973811_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_155066714.1|2973915_2974341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066716.1|2974985_2975825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081140.1|2975827_2977021_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_155081141.1|2977026_2978007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081142.1|2978022_2979060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081143.1|2979074_2979497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066721.1|2979549_2980053_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_155066722.1|2980045_2980792_+	type IV secretion system protein DotC	NA	NA	NA	NA	NA
WP_155066723.1|2980784_2981891_+	ATPase	NA	NA	NA	NA	NA
WP_155081579.1|2982179_2984483_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_155081144.1|2984491_2984965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066725.1|2984973_2986017_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_027242623.1|2986016_2986598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081145.1|2986629_2987055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081146.1|2987057_2990066_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155081147.1|2990067_2990889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081148.1|2990928_2994144_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_155081149.1|2994188_2994695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242618.1|2995014_2995665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209685.1|2995666_2996002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081150.1|2996006_2996417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081580.1|2996407_2997361_+	PAP2 family protein	NA	NA	NA	NA	NA
WP_155066732.1|2997430_2997658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081151.1|2997806_2999222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081152.1|2999468_3000053_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	3.4e-35
WP_155081153.1|3000239_3000605_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3000620_3001007_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3000990_3001548_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080338.1|3001583_3001871_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.3	2.2e-06
WP_155081154.1|3002001_3002721_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155080205.1|3004282_3004429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081155.1|3004543_3004912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081156.1|3005056_3005752_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081157.1|3005744_3006904_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	6.8e-59
WP_155079476.1|3006899_3007286_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3007269_3007827_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067468.1|3007939_3008086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081158.1|3008082_3008280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081159.1|3008589_3009261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081160.1|3009880_3010285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|3010361_3011336_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155081161.1|3011359_3011575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080323.1|3011688_3012588_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.1e-23
WP_155081162.1|3013172_3014666_-	amino acid permease	NA	NA	NA	NA	NA
WP_155081163.1|3015116_3016508_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_155081164.1|3016936_3017131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081165.1|3017173_3017569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|3017573_3018026_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|3018057_3018408_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079644.1|3018548_3019139_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066687.1|3019373_3019802_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_155066686.1|3020857_3021397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081166.1|3021593_3021986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|3022011_3022569_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3022552_3022939_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081167.1|3022968_3023190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081168.1|3023817_3024459_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155081169.1|3025076_3026537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|3026614_3027001_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3026984_3027542_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081170.1|3027522_3027741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066678.1|3027794_3028634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081171.1|3029156_3030017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|3029944_3031101_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155081172.1|3031164_3031620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080029.1|3032224_3033352_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081173.1|3033810_3034056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081174.1|3034200_3034371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081175.1|3034446_3035901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081176.1|3036641_3037340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081177.1|3037432_3037669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081178.1|3037868_3038894_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_155081179.1|3039001_3040207_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	6.4e-36
WP_155079487.1|3040413_3041463_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|3041514_3041967_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|3041998_3042349_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081180.1|3042528_3042942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081181.1|3043070_3043640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081182.1|3043643_3043976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081183.1|3044079_3044412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081184.1|3044404_3045058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081185.1|3045696_3047142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081186.1|3047761_3048991_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 42
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	3063849	3115879	3575377	transposase,tRNA	Acinetobacter_phage(28.57%)	64	NA	NA
WP_155079864.1|3063849_3065006_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.4e-50
WP_155081581.1|3065912_3068723_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_155081197.1|3068957_3069692_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_155068600.1|3069681_3069906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080161.1|3070062_3070278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|3070334_3070700_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081198.1|3071384_3071678_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	39.6	2.6e-07
WP_155081199.1|3071794_3072241_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.0e-22
WP_155066936.1|3072306_3072657_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081582.1|3072688_3073156_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079487.1|3073139_3074189_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081200.1|3074275_3074602_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	49.5	6.6e-20
WP_155081201.1|3074909_3075206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068636.1|3075781_3076330_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_155081583.1|3076433_3077006_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_155081202.1|3077214_3077973_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_155081203.1|3078532_3079378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|3079452_3080682_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081204.1|3080931_3081699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081205.1|3081843_3082116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081206.1|3082326_3083904_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_155068634.1|3084037_3084979_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_155081207.1|3084980_3085754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081208.1|3085795_3086506_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_155081209.1|3086718_3086922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081210.1|3087190_3087475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081211.1|3087416_3088241_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081212.1|3088349_3088706_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079445.1|3088691_3089666_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155081213.1|3089765_3090482_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.2	2.6e-24
WP_155081214.1|3090526_3090823_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	38.5	4.5e-07
WP_155081215.1|3090791_3090986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066611.1|3091248_3091779_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_155068600.1|3091994_3092219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|3092411_3092864_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|3092895_3093246_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081216.1|3093300_3093507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|3093563_3093929_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211707.1|3094052_3094340_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_155081217.1|3094345_3096727_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|3096739_3097735_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_155081218.1|3097866_3098226_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016210493.1|3098268_3098463_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|3098497_3099028_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_155081219.1|3099032_3100964_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.3	7.5e-119
WP_155081220.1|3101371_3102106_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081221.1|3102179_3102779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081222.1|3102856_3103837_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	2.6e-27
WP_155081223.1|3103860_3104343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081224.1|3104522_3105200_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081225.1|3105207_3105510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081226.1|3105633_3106419_+	hypothetical protein	NA	A0A1V0SBR2	Catovirus	28.3	1.1e-07
WP_155079478.1|3107443_3108001_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3107984_3108371_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079612.1|3108667_3109897_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3110513_3110900_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079476.1|3110928_3111315_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3111298_3111856_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080171.1|3111999_3112575_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080011.1|3112520_3112688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081227.1|3113067_3113208_+	phosphatase	NA	NA	NA	NA	NA
WP_155081228.1|3113483_3114452_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081229.1|3114572_3115070_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081230.1|3115378_3115879_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 43
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	3190953	3281069	3575377	transposase	unidentified_phage(46.15%)	93	NA	NA
WP_155079487.1|3190953_3192003_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081269.1|3192053_3194723_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	23.9	7.9e-18
WP_155081270.1|3195022_3196168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081271.1|3196328_3196871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081586.1|3197054_3197279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080161.1|3197435_3197651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|3197707_3198073_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081272.1|3198802_3200044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081273.1|3200589_3201378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080029.1|3201574_3202702_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081274.1|3202894_3203086_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079445.1|3203145_3204120_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079864.1|3204260_3205417_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.4e-50
WP_155081275.1|3205535_3205733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066610.1|3205678_3206254_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081276.1|3206286_3206457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081277.1|3206663_3208187_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155081278.1|3208323_3212808_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_155081279.1|3213536_3215114_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_155066543.1|3215341_3215710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066542.1|3216401_3217187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081280.1|3217490_3218435_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_155081281.1|3218453_3219638_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_155081282.1|3219753_3220587_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.7	3.5e-17
WP_155081587.1|3220643_3221219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081283.1|3221233_3221434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081284.1|3221514_3222564_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081285.1|3222606_3222897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080172.1|3223208_3224183_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	8.9e-28
WP_155081286.1|3224179_3224668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|3224706_3225264_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3225247_3225634_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081287.1|3225656_3225983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081588.1|3225995_3226163_+	phosphatase	NA	NA	NA	NA	NA
WP_155081288.1|3226311_3226986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081289.1|3227023_3227314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|3227546_3228521_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155081290.1|3228665_3230069_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_155081291.1|3230326_3231385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081292.1|3231711_3232674_-	amino acid permease	NA	NA	NA	NA	NA
WP_155081293.1|3232715_3233669_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.8	6.7e-28
WP_155081294.1|3233685_3234174_-	amino acid permease	NA	NA	NA	NA	NA
WP_155066529.1|3234889_3235144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081295.1|3235867_3237064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079784.1|3237138_3237915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081296.1|3238095_3238479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080219.1|3238482_3239532_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081297.1|3239597_3239804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081298.1|3240059_3240767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|3240832_3241183_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081299.1|3241109_3241325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081300.1|3241941_3242700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|3242921_3243479_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3243462_3243849_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081301.1|3243845_3243986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066521.1|3244102_3245401_+	MFS transporter	NA	NA	NA	NA	NA
WP_155081302.1|3245620_3246172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081303.1|3246152_3246458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|3246466_3246919_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|3246950_3247301_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081304.1|3247368_3247818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081305.1|3247851_3249150_+	MFS transporter	NA	NA	NA	NA	NA
WP_155081306.1|3249239_3250478_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155066517.1|3250716_3251064_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155066516.1|3251064_3252837_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	25.6	2.1e-14
WP_155081307.1|3252826_3253801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066515.1|3254426_3255119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081308.1|3255972_3256434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081309.1|3256449_3256674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|3256963_3257938_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155081310.1|3259852_3260671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081311.1|3260705_3262133_-	amino acid permease	NA	NA	NA	NA	NA
WP_155081589.1|3262842_3265212_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.2	2.4e-159
WP_016210132.1|3265287_3266106_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_155081312.1|3266568_3267345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|3267538_3268588_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081313.1|3268584_3268773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081531.1|3268769_3268994_-	hypothetical protein	NA	A0A2P0VP61	Tetraselmis_virus	45.8	8.3e-06
WP_155080161.1|3269150_3269366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|3269422_3269788_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081314.1|3269849_3270617_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081315.1|3270837_3271152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081316.1|3271538_3272426_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_155081590.1|3272582_3274055_-	sodium/solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.9	3.9e-19
WP_155081317.1|3274153_3275035_-	ROK family protein	NA	NA	NA	NA	NA
WP_155081318.1|3275031_3275754_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_155081319.1|3276228_3277140_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.5	6.6e-25
WP_155079784.1|3277413_3278190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081296.1|3278370_3278754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080219.1|3278757_3279807_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081320.1|3279872_3280079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081321.1|3280402_3280792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|3280718_3281069_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 44
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	3297708	3331001	3575377	transposase,tRNA	unidentified_phage(33.33%)	37	NA	NA
WP_155079478.1|3297708_3298266_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080879.1|3298262_3299030_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081334.1|3300316_3300670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081592.1|3300946_3301723_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_155081335.1|3301731_3303783_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_155081336.1|3303816_3304116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079620.1|3304160_3305135_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155081337.1|3305131_3305857_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155081338.1|3305956_3306364_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155081339.1|3306391_3306922_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_155081340.1|3307124_3307358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081341.1|3307565_3307841_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081593.1|3308871_3311049_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.7	3.5e-141
WP_016211609.1|3311081_3311390_-	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_155081342.1|3311564_3312566_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081343.1|3312740_3313085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081344.1|3313422_3314256_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081594.1|3314413_3314896_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081345.1|3314910_3315474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066464.1|3315556_3316288_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_155068620.1|3316284_3316821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066463.1|3316874_3317639_-	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
WP_155081346.1|3317642_3319220_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_155066461.1|3319226_3319703_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_155068619.1|3319678_3320083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066460.1|3320115_3320871_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|3321045_3321333_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_155081347.1|3321754_3321967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081348.1|3321983_3322952_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081349.1|3323878_3325042_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081350.1|3325076_3326054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066456.1|3326047_3326734_-	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_155066455.1|3326672_3327788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|3328052_3329027_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155081351.1|3329478_3330450_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081352.1|3330594_3330801_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	71.1	5.7e-09
WP_155081353.1|3330716_3331001_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 45
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	3341802	3399908	3575377	tail,transposase,tRNA	Acinetobacter_phage(28.57%)	54	NA	NA
WP_155066739.1|3341802_3342153_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081360.1|3342207_3343233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081361.1|3343854_3345822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066438.1|3345919_3347029_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.1	1.0e-35
WP_155081362.1|3347084_3348566_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	27.6	3.7e-49
WP_155066436.1|3348993_3349440_+	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211800.1|3349753_3350539_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_155081363.1|3350535_3351519_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_155081364.1|3351575_3352847_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_155081365.1|3358222_3358828_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_155081595.1|3358890_3360252_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_155066432.1|3360525_3361806_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_155081366.1|3361823_3362480_+	DedA family protein	NA	NA	NA	NA	NA
WP_155081367.1|3363232_3363517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081368.1|3363992_3364847_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_155081369.1|3365145_3365958_+	trfA family protein	NA	NA	NA	NA	NA
WP_016210080.1|3366064_3366358_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_155067136.1|3366478_3366829_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081370.1|3366755_3367181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079593.1|3367196_3367403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|3367433_3367991_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3367974_3368361_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081371.1|3368936_3369791_-	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_017377631.1|3369780_3370458_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_155081372.1|3370426_3371482_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.7	5.1e-29
WP_155081373.1|3371803_3373234_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_155081374.1|3373220_3373847_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_155081375.1|3373852_3374125_-	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_155081376.1|3374211_3376005_-	M24 family metallopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	40.9	7.7e-118
WP_155081596.1|3376330_3377893_+	amino acid permease	NA	NA	NA	NA	NA
WP_155066421.1|3377994_3378693_+	response regulator	NA	NA	NA	NA	NA
WP_155066420.1|3378860_3379358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080716.1|3381142_3382324_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081377.1|3383780_3385175_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_155081378.1|3385216_3386503_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_155081379.1|3386549_3388094_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.2	2.5e-64
WP_016209851.1|3388216_3388459_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_155081380.1|3388451_3389438_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_155081381.1|3389499_3390405_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_155081382.1|3390404_3391751_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_155081383.1|3391844_3392309_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_155081597.1|3392373_3392829_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209850.1|3393054_3393345_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_155081384.1|3393417_3395079_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.5	3.5e-181
WP_155081385.1|3395242_3395464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081386.1|3396666_3396852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|3396913_3397264_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081387.1|3397190_3397637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081388.1|3397633_3397804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081389.1|3397733_3397916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081390.1|3398074_3398308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|3398291_3398849_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|3399073_3399424_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|3399455_3399908_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 46
NZ_CP039240	Piscirickettsia salmonis strain MR5 chromosome, complete genome	3575377	3410353	3518231	3575377	protease,transposase,tRNA	Acinetobacter_phage(36.36%)	115	NA	NA
WP_155069770.1|3410353_3412336_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.1	1.8e-115
WP_155066407.1|3412413_3413040_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_155066406.1|3413017_3413275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081394.1|3413329_3413773_+	CRS1 / YhbY domain protein	NA	NA	NA	NA	NA
WP_155081395.1|3414017_3415067_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3415134_3415521_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3415504_3416062_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081396.1|3416042_3416459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081397.1|3416564_3416792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|3416848_3417214_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079815.1|3417408_3418383_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	4.0e-28
WP_155081398.1|3418423_3418723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066610.1|3418668_3419244_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081399.1|3419233_3419464_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_155079478.1|3419619_3420177_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081400.1|3420160_3420547_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081401.1|3420702_3421524_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081402.1|3422143_3422335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|3422367_3422754_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3422737_3423295_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081403.1|3423572_3424805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081404.1|3424980_3425142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|3425195_3426245_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081405.1|3426738_3426900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081406.1|3426941_3428339_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	1.3e-77
WP_155068509.1|3428459_3429407_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_155068510.1|3429403_3429919_-	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_155068511.1|3429905_3431105_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
WP_155081407.1|3431101_3431431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068792.1|3431432_3432662_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_155068513.1|3432661_3433705_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_155081408.1|3433704_3434400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081409.1|3434384_3436874_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377396.1|3436890_3437145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3437145_3437502_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_155046733.1|3438258_3438396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067541.1|3438332_3439331_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068516.1|3439724_3440882_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155081410.1|3440901_3444003_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_155081411.1|3445538_3445820_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3445968_3446310_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_155068520.1|3446430_3448311_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_155068521.1|3448394_3449912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081412.1|3450010_3451126_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155068524.1|3451247_3452246_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_155068525.1|3452249_3453017_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_155068526.1|3453009_3454209_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_155068527.1|3454192_3454864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081413.1|3454885_3455662_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	30.7	7.6e-22
WP_155081414.1|3455665_3456664_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	2.7e-40
WP_155081415.1|3456665_3457244_-	anthranilate/aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	4.8e-45
WP_155081416.1|3457240_3458710_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3458753_3459041_-	trp operon repressor	NA	NA	NA	NA	NA
WP_155068532.1|3459241_3460162_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155081417.1|3460275_3460830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081418.1|3460945_3461596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|3461596_3462154_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3462137_3462524_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081419.1|3462539_3463274_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300641.1|3463525_3463891_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081420.1|3463947_3464148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|3464153_3464711_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3464694_3465081_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081421.1|3465148_3465595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068015.1|3465603_3466757_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	3.4e-58
WP_017378398.1|3467333_3467732_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_017378399.1|3468597_3469548_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_155081422.1|3469547_3471626_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_155081423.1|3471773_3472289_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155081424.1|3472297_3472861_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_155068540.1|3472841_3473588_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_155081425.1|3473726_3474179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081426.1|3474314_3475151_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_155068543.1|3475147_3476044_+	EamA family transporter	NA	NA	NA	NA	NA
WP_122941163.1|3476076_3477144_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_155068544.1|3477168_3477537_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_155081427.1|3477562_3479014_-	potassium transporter	NA	NA	NA	NA	NA
WP_155068546.1|3479020_3480400_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_155081598.1|3480440_3481754_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_155068548.1|3481743_3482718_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_155081599.1|3482811_3483315_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_155081428.1|3483449_3484601_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3484597_3485077_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_155068550.1|3485223_3487545_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.5	6.7e-98
WP_155068551.1|3487489_3488116_+|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
WP_155068552.1|3488120_3489020_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_155068793.1|3489116_3489671_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_155081429.1|3489953_3491078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081430.1|3491434_3492208_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155081431.1|3493662_3493953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|3494025_3494412_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080821.1|3494580_3495435_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066610.1|3496224_3496800_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210338.1|3496834_3496972_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079445.1|3499734_3500709_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_032126718.1|3500992_3501373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081432.1|3501536_3502232_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_155081433.1|3502228_3503656_+	dihydrolipoamide dehydrogenase	NA	NA	NA	NA	NA
WP_155079826.1|3503737_3504624_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081434.1|3504584_3505175_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155068568.1|3505171_3506008_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_155068569.1|3506008_3506350_-	cytochrome C oxidase subunit IV	NA	NA	NA	NA	NA
WP_155081435.1|3506351_3506957_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_155068570.1|3506953_3508948_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_155068571.1|3508967_3509909_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_155081436.1|3510136_3511555_+	MFS transporter	NA	NA	NA	NA	NA
WP_155081437.1|3511709_3512861_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080005.1|3512922_3513808_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080566.1|3513805_3514030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081438.1|3514476_3514770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081439.1|3515121_3515337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081440.1|3515495_3515723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081441.1|3515756_3516353_-	methyltransferase	NA	NA	NA	NA	NA
WP_155081442.1|3516525_3517020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079940.1|3517049_3518231_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039241	Piscirickettsia salmonis strain MR5 plasmid unnamed1, complete sequence	201207	1087	165478	201207	head,integrase,transposase,tail	unidentified_phage(20.55%)	189	55752:55811	142474:143579
WP_155081606.1|1087_2125_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081607.1|2167_3109_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.1	2.4e-22
WP_155081608.1|3413_3932_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.4	1.4e-08
WP_155080208.1|3877_4243_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081609.1|4203_4389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081610.1|4412_4670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|4867_5425_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|5408_5795_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081611.1|6380_7610_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081612.1|8456_9410_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081613.1|9614_9974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081614.1|10073_10913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081615.1|10999_11377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081616.1|11887_12166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081617.1|12151_13126_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.6e-24
WP_155079826.1|13392_14278_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	9.0e-11
WP_155081618.1|14401_14830_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_155081619.1|14826_15126_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155081620.1|15168_15846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081621.1|15859_16900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081622.1|17119_18430_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	36.6	8.6e-26
WP_155066936.1|18618_18969_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155068622.1|19000_19453_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
WP_155079612.1|19533_20763_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081623.1|20899_22021_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081624.1|22178_22907_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	1.2e-37
WP_155081625.1|23273_24734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|25002_25977_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155080257.1|26036_26216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081626.1|26980_27781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081627.1|27820_28351_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.6	1.6e-34
WP_155081628.1|28523_29207_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_155081629.1|29211_29781_+	recombinase family protein	NA	W6CWV1	Ralstonia_phage	36.4	8.6e-23
WP_155081630.1|29902_30805_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.5	7.2e-24
WP_155079476.1|30801_31188_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079868.1|31255_32411_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155081631.1|32434_32725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080216.1|33131_34214_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.7	3.8e-144
WP_155081632.1|36005_36476_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066936.1|36644_36995_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155079826.1|37705_38591_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	9.0e-11
WP_155081633.1|39035_39215_+	hypothetical protein	NA	A0A0R6PJ17	Moraxella_phage	52.6	1.7e-09
WP_155081634.1|39216_39513_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_064006305.1|39509_39731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081635.1|40075_41374_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080267.1|41473_41629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081636.1|42720_43683_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155081637.1|43706_44036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080442.1|44419_45547_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081638.1|45703_45934_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081639.1|46050_46590_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.7	4.5e-29
WP_155081640.1|48306_49869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081641.1|50082_50808_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.8	4.3e-11
WP_155079478.1|51078_51636_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|51619_52006_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079836.1|52627_52834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|53199_53586_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|53569_54127_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_047927838.1|54391_54637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081642.1|54633_54933_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_155081643.1|55042_55768_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.3e-44
55752:55811	attL	AGATTCAGGAATTTCAAAAAAATGATCCTGGCGGCAATGTTTAGGAGGATGTTAAATTCT	NA	NA	NA	NA
WP_155079612.1|55908_57138_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
55752:55811	attL	AGATTCAGGAATTTCAAAAAAATGATCCTGGCGGCAATGTTTAGGAGGATGTTAAATTCT	NA	NA	NA	NA
WP_155081644.1|57612_58587_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.3	1.1e-25
WP_155081645.1|58651_59038_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155081646.1|59100_59871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081647.1|60460_60649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081648.1|61350_62058_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.0	3.0e-09
WP_155080068.1|62957_63440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080067.1|63598_63745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080066.1|63710_64295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122943230.1|66179_67115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080338.1|67485_67773_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.3	2.2e-06
WP_155079478.1|67797_68355_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|68338_68725_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081649.1|68778_69462_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.6	1.2e-42
WP_155080546.1|69491_70220_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155081650.1|70327_71215_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080557.1|71416_71755_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|71738_72296_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081651.1|72276_72513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081652.1|72903_75177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081653.1|75261_75618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081654.1|75655_75796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|75761_76917_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155081655.1|76914_77052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081656.1|77111_77699_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.7	2.3e-31
WP_155081657.1|77823_78552_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	1.2e-37
WP_155081731.1|78686_79193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|79254_79605_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081465.1|79636_80089_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	3.3e-09
WP_155066739.1|80241_80592_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081107.1|80518_80758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081658.1|81322_81916_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.2	9.6e-09
WP_155081607.1|81875_82817_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.1	2.4e-22
WP_155081659.1|82859_83309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|83416_84646_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081660.1|84871_85684_+	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	24.4	2.4e-10
83260:84792	attR	AGATTCAGGAATTTCAAAAAAATGATCCTGGCGGCAATGTTTAGGAGGATGTTAAATTCTGGTCAGTATTGCTGTGGCCATTACCGAATATAATGCCTGCAGGCGGTTTTTTAGGTGAAAATAGGCGAATTCTCTAATTTCTGGCGGAGTTATCCTACTAAAAGCCTCTAAATCGGCTGGTTGCTAGCTCTTCATAGTAACTGTACTTTTCCCTAAGAGTCAGACCAAATTGGGTGCTTATCCTTCTTAACTGACTGCCGCACAAGATGCATTTAAGAGGGTTGTAGTTGAAATTACTTTTCATCAGTGAAACAAACGTGACCTGGTTATATGCCTCAATAGTTTGCCCGACTAAATCATAAATTTTTGGTAGTATTATTGTCCGAGTGCGATAGCTTAGAAATCCATAGTAGCGGATCATTTTAAAGAACTTGTCCGGGATGTGTTGGGTAAGGCGATCAATAAAATCGTCGATACTCTGCTTTTTCATTTTCTGCTGTTTGGTTTTGTGATCCAGGTAACGAAAGATCACAACATTACCATCATAGTGCTCCATTCTGGCGTTGGCGAGAGCCGGGCGTTTAATGTAGCGGCCGAGGTAATCGACATTGTGCTGGTGATTTTCTTTGGGTTGAGCAAAGTGGACTTTCCAAAATTTCTGGTATTCACGATTTAAAAATCGATTGAAGGTTGTAAGGTCACTGATTTCACTCTGGTATTCATCAGGAATAGTCAACTCCCCAGCTTTGTAGGTTTGCCTAAGCAGGTTGGTGACGGCATAGCGCCACATTGGCATAATAACTTTGCGAGTAAAATAAATCTCACACCAAGAATCATTAGCTTCGTCATAACCTCCACGTGTGACGGAGATATGAACATGTACATTCCATTTCAGATCTCGACCAAATGTATGTAAAGCGGCGAAAATGCCAATGATAAGGCCTTTCTTCTTTGCGGTTTCTAGTAACGTATTGGCTGCAGTCCTAAAGATTATATTGAGTAATTCACGATTGAATAAGAAAAATGCCCAGAATTTTCTAGGCATAGTAAATGTGATGTGTTGCCATTTGCACTGTGGGAGAGTGGCGTTTTGCTCTTCGATCCATTGCTCTGTTGCTTTTTTTCCACAGGTTGAGCAAAAGCGGGACTTGCATGTGAAACAAACGACCTTGGTATGTTCGCAGTTTGGATTGGAACAACCGTAAACATCACACCCCATTAACTTGGTGCGACAACCGAGCACTTTGAGAACATTTTCATCAACGGCAGGTCGAATGGAATCAGCGTGTTTAGCGCGATAGTTCCACCAAGCACTTCGATATTGAAGTACGTGCTTCAGTGTGAATTGAATTTGATAGGTTTCATCTTTCTGCCGCTGGATCACCATTGAGAACAAATTACCATATTAAACAACGAATCAGGATAACAAGGTTAGATCAGATCTAACAAGACTAATGTGAGTTAATAAGCGGTAAAGTGACGGGTGTTAGCAGGGACATCCGAAAGTCGCGAGCTGTGCGAGCCTATTCTTGA	NA	NA	NA	NA
WP_155081661.1|85676_86621_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
83260:84792	attR	AGATTCAGGAATTTCAAAAAAATGATCCTGGCGGCAATGTTTAGGAGGATGTTAAATTCTGGTCAGTATTGCTGTGGCCATTACCGAATATAATGCCTGCAGGCGGTTTTTTAGGTGAAAATAGGCGAATTCTCTAATTTCTGGCGGAGTTATCCTACTAAAAGCCTCTAAATCGGCTGGTTGCTAGCTCTTCATAGTAACTGTACTTTTCCCTAAGAGTCAGACCAAATTGGGTGCTTATCCTTCTTAACTGACTGCCGCACAAGATGCATTTAAGAGGGTTGTAGTTGAAATTACTTTTCATCAGTGAAACAAACGTGACCTGGTTATATGCCTCAATAGTTTGCCCGACTAAATCATAAATTTTTGGTAGTATTATTGTCCGAGTGCGATAGCTTAGAAATCCATAGTAGCGGATCATTTTAAAGAACTTGTCCGGGATGTGTTGGGTAAGGCGATCAATAAAATCGTCGATACTCTGCTTTTTCATTTTCTGCTGTTTGGTTTTGTGATCCAGGTAACGAAAGATCACAACATTACCATCATAGTGCTCCATTCTGGCGTTGGCGAGAGCCGGGCGTTTAATGTAGCGGCCGAGGTAATCGACATTGTGCTGGTGATTTTCTTTGGGTTGAGCAAAGTGGACTTTCCAAAATTTCTGGTATTCACGATTTAAAAATCGATTGAAGGTTGTAAGGTCACTGATTTCACTCTGGTATTCATCAGGAATAGTCAACTCCCCAGCTTTGTAGGTTTGCCTAAGCAGGTTGGTGACGGCATAGCGCCACATTGGCATAATAACTTTGCGAGTAAAATAAATCTCACACCAAGAATCATTAGCTTCGTCATAACCTCCACGTGTGACGGAGATATGAACATGTACATTCCATTTCAGATCTCGACCAAATGTATGTAAAGCGGCGAAAATGCCAATGATAAGGCCTTTCTTCTTTGCGGTTTCTAGTAACGTATTGGCTGCAGTCCTAAAGATTATATTGAGTAATTCACGATTGAATAAGAAAAATGCCCAGAATTTTCTAGGCATAGTAAATGTGATGTGTTGCCATTTGCACTGTGGGAGAGTGGCGTTTTGCTCTTCGATCCATTGCTCTGTTGCTTTTTTTCCACAGGTTGAGCAAAAGCGGGACTTGCATGTGAAACAAACGACCTTGGTATGTTCGCAGTTTGGATTGGAACAACCGTAAACATCACACCCCATTAACTTGGTGCGACAACCGAGCACTTTGAGAACATTTTCATCAACGGCAGGTCGAATGGAATCAGCGTGTTTAGCGCGATAGTTCCACCAAGCACTTCGATATTGAAGTACGTGCTTCAGTGTGAATTGAATTTGATAGGTTTCATCTTTCTGCCGCTGGATCACCATTGAGAACAAATTACCATATTAAACAACGAATCAGGATAACAAGGTTAGATCAGATCTAACAAGACTAATGTGAGTTAATAAGCGGTAAAGTGACGGGTGTTAGCAGGGACATCCGAAAGTCGCGAGCTGTGCGAGCCTATTCTTGA	NA	NA	NA	NA
WP_155081662.1|86856_87504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080444.1|87879_89361_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.0	6.7e-27
WP_155079959.1|89403_89754_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	39.2	4.5e-14
WP_155079958.1|89750_90059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081663.1|90132_90810_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.0	6.4e-09
WP_155081664.1|91614_92217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080372.1|92512_93742_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081665.1|94193_95063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081666.1|95452_96496_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080444.1|96492_97974_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.0	6.7e-27
WP_155079959.1|98016_98367_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	39.2	4.5e-14
WP_155079958.1|98363_98672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081667.1|98745_98964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081664.1|99918_100521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081668.1|100657_101104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081669.1|101374_101767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|101874_102225_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155079958.1|102485_102794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081670.1|102973_103273_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.6	1.8e-11
WP_155079476.1|103355_103742_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081671.1|103725_104271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081672.1|104273_105860_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.0	7.2e-27
WP_155081673.1|106407_107103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081674.1|107123_107360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|107460_108435_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081675.1|108458_109463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|109528_109879_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081732.1|109910_110309_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	30.2	7.1e-08
WP_155079445.1|110328_111303_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081676.1|111347_111542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081677.1|112136_113027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081678.1|113606_113822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081679.1|114004_114316_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	2.5e-08
WP_155081680.1|114312_114636_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	6.0e-13
WP_155081681.1|114976_115237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|115260_116235_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081733.1|116805_117363_-	helix-turn-helix domain-containing protein	NA	A0A1S6L009	Salmonella_phage	56.2	5.1e-52
WP_155081682.1|117362_117680_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_155081683.1|117634_117895_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_155081684.1|118329_118650_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.4	5.9e-13
WP_155081685.1|118869_119094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081686.1|119250_119829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081687.1|120300_120900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081688.1|120974_121292_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081689.1|121595_122399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081690.1|122807_123377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122942947.1|123502_123781_+	peptidase	NA	A0A2L1IV28	Escherichia_phage	52.2	4.9e-24
WP_122942945.1|123791_124097_+	HigA family addiction module antidote protein	NA	A0A2I7RCV5	Vibrio_phage	39.7	1.1e-05
WP_155081691.1|124251_125865_-	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	1.2e-61
WP_155068933.1|125906_126260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079741.1|128384_129359_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	2.4e-25
WP_155081692.1|129990_130563_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.6	4.0e-36
WP_155081693.1|130955_131096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068941.1|131630_132086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081694.1|132802_133174_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155079868.1|133181_134338_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155081695.1|134455_135064_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.0	2.6e-09
WP_155079478.1|135044_135602_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|135585_135972_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079741.1|136135_137110_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	2.4e-25
WP_155081696.1|137560_138088_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.6	1.3e-09
WP_155080573.1|138247_139609_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081697.1|140677_141319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|141464_142439_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081698.1|142558_143149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081699.1|143441_144176_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.3	1.2e-08
WP_155079730.1|144172_144334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079731.1|144598_144847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|144830_145388_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081700.1|146215_146404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081701.1|147620_148310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081702.1|148357_149011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080215.1|148996_149971_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.3	1.4e-25
WP_155079445.1|151138_152113_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155079478.1|152219_152777_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|152760_153147_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081703.1|153905_154574_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.3e-38
WP_155066936.1|154767_155118_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155068622.1|155149_155602_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
WP_155081704.1|155861_156518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081705.1|156577_156808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081706.1|156982_157162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079741.1|157181_158156_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	2.4e-25
WP_155081734.1|158384_158630_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_155081707.1|158713_159085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064006304.1|159533_159767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081708.1|159887_162056_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.9	3.5e-72
WP_155080568.1|162075_163050_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081709.1|163190_163592_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.9	6.0e-23
WP_122943400.1|163588_163900_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.8	6.1e-15
WP_155081710.1|164497_165478_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	1.7e-23
>prophage 2
NZ_CP039241	Piscirickettsia salmonis strain MR5 plasmid unnamed1, complete sequence	201207	168552	177080	201207	transposase	unidentified_phage(28.57%)	8	NA	NA
WP_155081712.1|168552_170418_+	AAA family ATPase	NA	A0A2I7R5Z1	Vibrio_phage	30.7	8.7e-56
WP_155081713.1|171721_172450_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.0e-37
WP_032126138.1|172940_173204_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_155079445.1|173404_174379_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081714.1|174509_175175_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.3	9.0e-40
WP_155079445.1|175352_176327_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081715.1|176346_176745_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	32.3	1.1e-08
WP_155080338.1|176792_177080_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.3	2.2e-06
>prophage 1
NZ_CP039242	Piscirickettsia salmonis strain MR5 plasmid unnamed2, complete sequence	158411	915	57804	158411	transposase	Streptococcus_phage(39.13%)	56	NA	NA
WP_155081739.1|915_1650_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155079478.1|4174_4732_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|4715_5102_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081740.1|5314_6649_-	hypothetical protein	NA	A0A1X9I6W8	Streptococcus_phage	30.0	3.1e-39
WP_155081741.1|6663_7086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081742.1|7138_7873_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	1.5e-27
WP_155081829.1|8284_8599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036775032.1|8820_9636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081701.1|9683_10373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|11006_11981_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081743.1|12984_13179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081744.1|13225_13870_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.9	2.4e-37
WP_155081745.1|13946_14921_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	9.2e-25
WP_032126138.1|15240_15504_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_155068802.1|15751_16132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|16626_16977_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081465.1|17008_17461_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	3.3e-09
WP_155080821.1|20710_21566_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.0	3.1e-08
WP_155081746.1|22069_22213_-	phosphatase	NA	NA	NA	NA	NA
WP_155079476.1|22360_22747_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|22730_23288_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081747.1|23335_23602_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081748.1|23964_24357_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	5.0e-14
WP_155081749.1|24353_25328_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	7.1e-25
WP_155081611.1|25564_26794_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081750.1|26999_27365_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	47.1	7.2e-23
WP_155081751.1|27485_27686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664873.1|27688_28003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081752.1|29702_31427_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155081753.1|32078_32741_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	36.1	8.2e-25
WP_155079487.1|32813_33863_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079487.1|34133_35183_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079612.1|35654_36884_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079478.1|37501_38059_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|38042_38429_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081754.1|39271_40003_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	31.1	1.0e-07
WP_155068622.1|40060_40513_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
WP_155066936.1|40544_40895_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_122943070.1|41297_41540_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155081830.1|41541_41868_+	mRNA-degrading endonuclease	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.9e-11
WP_155080251.1|42034_42181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081755.1|42967_43135_-	phosphatase	NA	NA	NA	NA	NA
WP_155066610.1|43200_43776_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.2	1.6e-08
WP_155080567.1|43779_44799_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081756.1|45770_47540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|47790_48348_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|48331_48718_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080664873.1|49199_49514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081739.1|49674_50409_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155081757.1|50455_50986_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	36.2	1.8e-14
WP_155081758.1|51229_52249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081739.1|52280_53015_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155081759.1|53142_53313_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081760.1|53437_54460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081761.1|54975_56712_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.2	2.1e-24
WP_155081762.1|57138_57804_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	3.6e-36
>prophage 2
NZ_CP039242	Piscirickettsia salmonis strain MR5 plasmid unnamed2, complete sequence	158411	61342	106498	158411	integrase,transposase	Streptococcus_phage(36.84%)	57	67152:67211	100919:101880
WP_155081831.1|61342_62314_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081765.1|62706_63435_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	9.3e-38
WP_155081766.1|63742_64717_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	2.4e-25
WP_155081767.1|64927_65191_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|65209_65767_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|65750_66137_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081768.1|66172_66436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081739.1|66379_67114_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
67152:67211	attL	TATAGCTGACACGGTTGAGTTAACCTTTTGATTTTGCTATTATTCTTACATGAAAAATAT	NA	NA	NA	NA
WP_155079476.1|67178_67565_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|67548_68106_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081769.1|68959_69238_-	antitoxin	NA	NA	NA	NA	NA
WP_016211674.1|69227_69509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081770.1|69710_70064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081771.1|71200_71440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081739.1|71512_72247_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155081772.1|72827_73490_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_155081773.1|73628_73949_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	40.7	1.5e-11
WP_155081774.1|73985_74321_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_155081775.1|75127_75838_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	1.9e-27
WP_155081776.1|75837_76494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081832.1|76570_77929_-	DEAD/DEAH box helicase	NA	D2J050	Enterococcus_phage	50.5	1.4e-127
WP_054300664.1|78018_78585_-	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	35.0	1.4e-20
WP_017377658.1|78588_79275_-	Fic family protein	NA	NA	NA	NA	NA
WP_155081739.1|79635_80370_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155081777.1|80327_80645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081778.1|80756_81629_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|81647_82034_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066610.1|82113_82689_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.2	1.6e-08
WP_155079588.1|82634_83000_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079653.1|83063_83534_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081779.1|83929_85213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081780.1|85559_85937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081781.1|85941_86274_+|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	36.9	1.7e-10
WP_155079612.1|86373_87603_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081782.1|87710_88208_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6C6	Streptococcus_phage	33.6	1.2e-09
WP_016211671.1|89404_90142_+	ParA family protein	NA	E5FFJ3	Burkholderia_phage	25.8	1.7e-10
WP_122942012.1|90134_90500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081783.1|90517_90712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081784.1|90840_91650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|91841_93071_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079478.1|93688_94246_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|94229_94616_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079476.1|94644_95031_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081785.1|95503_95677_-	hypothetical protein	NA	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	84.8	6.2e-09
WP_155080320.1|96627_97683_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081786.1|97756_98461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081787.1|98553_99249_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.2	5.2e-46
WP_155081788.1|99948_100653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|100945_101332_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|101315_101873_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081789.1|101853_102582_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.3	4.1e-09
100919:101880	attR	TATAGCTGACACGGTTGAGTTAACCTTTTGATTTTGCTATTATTCTTACATGAAAAATATAGCAGGATTTTAGAATTGCAAGCTTATAGTCAGGATTTGCGAGAGCGCGTTATTGAAGCTTATAAAGATGGGCTTAGCCGAAGAGAAATATCCACTCTTTTCAAGGTGCATTATGATACAGCTTGTGAATGGATTCGACGTTATTTATCAACAGGTGACTACTCTTCAAAACAAGGAGTTGGCTGTGGCGCACAAATAAGGTTTAATGACAAACAAACTATTCTAGATTTCATAAAGAAAAATCCAGATGCAAATGGGATTGCCATTCGTGATGGCATTGCTCCTGACCTCCCTATGTCAACCTTTTATGACGCATTGAAACGATTAAAAGTCACATATAAAAAAAGAGCCTAAGTATAAGCAAAGACGTGACGCCGAAAGATCTGAATTTATAGAAAAGCTAACAGGAATTGATTTGAGCCAATTAGTTTATCTTGATGAGGTTGGCGTTGATGATAATATCGTTGTTGAATATGGCTGGTCAGCTGCCGGAGTGCGAAGTTATGCTGAACAAGCAGGCTTCAAGAGGAAAAGGTTAAGCCTTGTTGCTGGCTTGAAGTATAGTGATAAAAGTTTGGTTGCTCCTTTCGAATTTTCAGGTGCAATGAATAAGGATTTGTTTTTAGGCTGGTTTGAACAGGAATTATGTCCGAAGCTAAATCCTGGGCAAGTAATTATCATGGATAATGCAAGCTTCCATAAAAGCCCTGAACTTTATGATATGGTTGAAGCTGTTGATTGTGAACTATTATACTTGCCAGCCTACTCACCAGACTTAAATCCAATTGAAAAATTCTGGGCTAATTTTAAACGAAATATAAGAAAGGTGATTAAAAAACATGAGCATCTTTGCAACGCAATTACTGACGCATTAATTAAGACTCTTCCGGGTTAGCTATATC	NA	NA	NA	NA
WP_155081790.1|102712_103141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081791.1|104021_104222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081792.1|104218_105385_-	hypothetical protein	NA	A0A1X9I6W8	Streptococcus_phage	31.0	1.4e-35
WP_155081793.1|105323_105578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|105663_106014_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155068622.1|106045_106498_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
>prophage 1
NZ_CP039243	Piscirickettsia salmonis strain MR5 plasmid unnamed3, complete sequence	65228	3613	48333	65228	transposase,integrase	unidentified_phage(27.78%)	56	NA	NA
WP_155080408.1|3613_4843_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081838.1|4979_5129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081873.1|5358_6231_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155081839.1|6497_6638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122943008.1|6637_7435_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155081840.1|9116_9983_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080469.1|10094_10478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|10892_11942_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079445.1|12537_13512_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081161.1|13535_13751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081841.1|13918_14386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081842.1|14564_14879_-	universal stress family protein	NA	NA	NA	NA	NA
WP_155081843.1|16159_16456_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081844.1|16683_17910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081845.1|18159_18732_-	hypothetical protein	NA	A0A1P8DTK0	Proteus_phage	51.0	2.5e-30
WP_155079476.1|18967_19354_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|19337_19895_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079487.1|19953_21003_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081846.1|21017_21179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081847.1|21365_21812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081848.1|21957_22977_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081849.1|23182_24142_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	1.7e-23
WP_155066936.1|24209_24560_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081465.1|24591_25044_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	3.3e-09
WP_155081850.1|25132_25342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081851.1|25478_26294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|26464_27439_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_080963620.1|27625_27982_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_027242953.1|27965_28220_-	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_155079478.1|28805_29363_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|29346_29733_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081739.1|29859_30594_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155081852.1|31291_32083_+	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	55.6	2.9e-77
WP_155080444.1|32074_33556_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.0	6.7e-27
WP_155079959.1|33598_33949_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	39.2	4.5e-14
WP_155079958.1|33945_34254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081853.1|34366_34924_+	hypothetical protein	NA	K7PK19	Enterobacteria_phage	40.6	5.3e-33
WP_155079445.1|34943_35918_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081874.1|36247_36577_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|36669_37227_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|37210_37597_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081854.1|37615_37909_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_155081855.1|38005_38371_-|integrase	tyrosine-type recombinase/integrase	integrase	K4K327	Caulobacter_virus	33.0	4.2e-07
WP_155079476.1|38524_38911_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|38894_39452_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081856.1|39569_40283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|40304_41190_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	9.0e-11
WP_155079445.1|41874_42849_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155080163.1|43525_44035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081857.1|44207_44582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081858.1|44722_45007_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|45010_45271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081859.1|45973_46198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079958.1|46379_46688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081860.1|46684_46945_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.0	5.0e-10
WP_155081861.1|47076_48333_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.0	1.1e-49
>prophage 1
NZ_CP039244	Piscirickettsia salmonis strain MR5 plasmid unnamed4, complete sequence	51367	28336	40779	51367	transposase	unidentified_phage(22.22%)	15	NA	NA
WP_155081897.1|28336_29722_+	hypothetical protein	NA	M1I670	Acanthocystis_turfacea_Chlorella_virus	25.3	2.1e-06
WP_155081911.1|29711_29897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081898.1|29924_30647_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.5	4.9e-47
WP_155068889.1|31048_31363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081899.1|31768_32761_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	1.4e-23
WP_155081900.1|33883_34858_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	2.4e-25
WP_155066936.1|35054_35405_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081901.1|35331_35490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|35484_35937_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	3.3e-09
WP_155066936.1|35968_36319_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155067991.1|36388_36805_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081902.1|36791_37379_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.0	6.8e-07
WP_155080102.1|37394_37847_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_155081903.1|38538_39408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066610.1|40203_40779_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.2	1.6e-08
>prophage 1
NZ_CP039245	Piscirickettsia salmonis strain MR5 plasmid unnamed5, complete sequence	50242	6661	41300	50242	head,tail,capsid,transposase,protease,portal	unidentified_phage(23.81%)	46	NA	NA
WP_155081922.1|6661_7588_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	21.0	4.8e-07
WP_155081923.1|7568_10187_-	hypothetical protein	NA	A0A0R6PIC0	Moraxella_phage	32.8	1.2e-108
WP_155081924.1|10183_10741_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	9.3e-22
WP_155066440.1|10801_11776_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	4.9e-26
WP_155081925.1|12091_12904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081926.1|12956_13721_-	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	1.7e-42
WP_155081927.1|13671_14343_-|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.3	2.3e-27
WP_155081928.1|14339_14681_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_155081929.1|14673_16752_-|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	32.8	6.7e-57
WP_155081930.1|16755_17019_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_155081931.1|17075_17399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081964.1|17400_17823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|18072_19047_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081932.1|19276_19672_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	38.4	3.7e-09
WP_155081933.1|19664_19988_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	38.8	6.0e-13
WP_155081934.1|19984_20296_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	35.6	1.0e-09
WP_155081935.1|20484_20901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081936.1|21283_21868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081937.1|22022_22880_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	46.3	6.4e-62
WP_155081938.1|23025_24219_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079445.1|24256_25231_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081939.1|25498_25855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081940.1|25910_26582_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	45.4	2.5e-45
WP_155081941.1|26529_27771_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	45.5	1.0e-84
WP_155081942.1|27767_28745_-	hypothetical protein	NA	A0A1P8DTK0	Proteus_phage	42.4	2.1e-69
WP_155079741.1|28782_29757_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	2.4e-25
WP_155081943.1|29816_30047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081944.1|30267_31053_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	41.8	4.5e-38
WP_016210974.1|31064_31472_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242932.1|31480_31708_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155081945.1|31855_32221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081946.1|32369_32840_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	63.4	5.8e-33
WP_155081947.1|32843_33074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081450.1|33320_34295_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081948.1|34354_34525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081949.1|34517_34856_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	3.5e-24
WP_155079478.1|35090_35648_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|35631_36018_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081950.1|36014_37133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081951.1|37240_37408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081952.1|37666_37828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081953.1|37905_38208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081954.1|38547_39006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081955.1|39005_39473_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081956.1|39502_39934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|40070_41300_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
