The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	4062	96991	3541633	transposase	unidentified_phage(27.27%)	91	NA	NA
WP_155079478.1|4062_4620_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066241.1|4778_7190_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	33.9	1.2e-110
WP_155079411.1|7221_8535_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
WP_155079413.1|9266_10436_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079415.1|10577_10886_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_155066245.1|10891_11347_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_155066246.1|11414_12344_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_155066247.1|12349_12670_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_155066248.1|12669_14394_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_155081463.1|14350_15883_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_155079417.1|15848_17243_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_155079419.1|17236_18277_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_155079421.1|18278_19652_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_155079422.1|19648_20812_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_155081464.1|20828_21911_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_155079424.1|21885_23343_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_155079426.1|23339_24377_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_155066256.1|24378_25098_+	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_016209355.1|25143_26391_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_016209342.1|26435_27569_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_155066257.1|27647_28508_+	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_155079429.1|28649_31382_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_155066259.1|31591_32725_+	acyl-CoA desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	31.8	2.4e-40
WP_155068597.1|32754_33027_-	acylphosphatase	NA	NA	NA	NA	NA
WP_155066260.1|33134_33947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079431.1|33960_34182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079433.1|34388_35744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066264.1|36337_36706_-	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_155079435.1|37821_39597_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_155079437.1|40498_40639_-	phosphatase	NA	NA	NA	NA	NA
WP_155066936.1|40706_41057_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|41088_41541_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079439.1|42080_42967_-|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	28.8	1.7e-09
WP_155079441.1|45302_47996_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	31.0	5.2e-70
WP_155068598.1|48027_48615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079443.1|48659_49700_+	beta-eliminating lyase	NA	NA	NA	NA	NA
WP_155079445.1|50322_51297_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079447.1|51645_52380_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_155079448.1|53003_54530_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_155068599.1|54669_55743_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|55782_57090_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_155079450.1|57064_58234_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_155079452.1|58288_59014_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_155079454.1|59451_59643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|59753_60803_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|60978_61431_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|61462_61813_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085049.1|61874_62522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079459.1|62573_62774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079461.1|62910_63885_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	7.5e-27
WP_155085050.1|64349_64790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085051.1|64777_65065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|65358_65916_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|65899_66286_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081699.1|66282_67017_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155085052.1|67061_67622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|67630_68083_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|68114_68465_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079470.1|68556_69411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079472.1|69586_69931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079474.1|70072_70516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|70531_70918_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|70901_71459_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079480.1|71459_71822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079481.1|72249_73782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079483.1|73801_74254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079485.1|74878_77941_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.5	6.6e-61
WP_155081466.1|77937_79002_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155085053.1|79308_80358_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079488.1|80374_80494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079490.1|80571_81546_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.5	2.3e-28
WP_155079492.1|81569_81803_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|81834_82287_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079495.1|82537_83491_-	glutathione synthase	NA	NA	NA	NA	NA
WP_155079497.1|83535_84699_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_155079499.1|84704_85304_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_155081467.1|85491_85983_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_155079501.1|86009_87098_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_155079503.1|87236_88481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079505.1|88477_89320_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_155079507.1|89299_90103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068602.1|90301_90517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079509.1|90517_91486_+	TonB family protein	NA	NA	NA	NA	NA
WP_155081468.1|91541_92093_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_155066294.1|92219_92642_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_155081469.1|92634_93396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066295.1|93450_94149_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_155079511.1|94159_94984_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	2.1e-25
WP_155079476.1|95431_95818_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|95801_96359_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085311.1|96508_96991_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	131633	184942	3541633	transposase,protease	Bacillus_phage(22.22%)	55	NA	NA
WP_155079478.1|131633_132191_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|132174_132561_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079541.1|132729_133734_+	OmpA family protein	NA	NA	NA	NA	NA
WP_155066325.1|133785_134016_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.7e-06
WP_036771588.1|134024_134903_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_155066327.1|135265_136366_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.1	3.1e-21
WP_155079543.1|136431_137142_+	response regulator	NA	NA	NA	NA	NA
WP_036771603.1|137191_138433_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_155079545.1|138499_139084_+	YggT family protein	NA	NA	NA	NA	NA
WP_155066330.1|139149_139809_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_155066331.1|139812_140739_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_155079547.1|140735_141521_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_155079549.1|141522_142491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079550.1|142492_143662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079552.1|143773_143965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064004641.1|144313_144838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079555.1|144894_145080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209612.1|145215_145584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079556.1|145621_145894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079558.1|145984_147400_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_155066340.1|147744_148647_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.1	5.9e-18
WP_155085056.1|148670_149567_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155066342.1|150120_152130_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	3.0e-110
WP_155081473.1|152574_153987_-	amino acid permease	NA	NA	NA	NA	NA
WP_155081474.1|154480_154807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079560.1|154857_155199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079562.1|155238_156759_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.6	1.4e-32
WP_155079564.1|157748_159056_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_155079566.1|159158_159542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079568.1|160809_163881_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	21.0	2.7e-54
WP_155079569.1|163944_165048_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155066351.1|165071_165626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066352.1|165740_166310_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155066353.1|166429_167182_+	DUF2076 family protein	NA	NA	NA	NA	NA
WP_155079571.1|167344_168220_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_155066355.1|168450_169017_-	DUF1415 family protein	NA	NA	NA	NA	NA
WP_155066356.1|169028_169814_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_155066357.1|170441_171362_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_155066358.1|171422_172418_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_155066359.1|172449_172944_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_017376129.1|173034_173292_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	42.1	1.2e-11
WP_155066360.1|173388_173811_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_155079573.1|174382_175141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066362.1|175184_175436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079574.1|175440_176877_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_155079576.1|176904_178347_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_155079578.1|178420_178759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066366.1|178838_179369_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_155079580.1|179443_181636_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.3	3.7e-106
WP_155066368.1|181678_182158_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_155079584.1|182302_182785_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079586.1|182810_183386_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079588.1|183331_183697_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079590.1|183718_184099_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079478.1|184384_184942_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	196714	234171	3541633	tRNA,transposase,protease	unidentified_phage(16.67%)	37	NA	NA
WP_155079608.1|196714_197116_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079476.1|197216_197603_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|197586_198144_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081399.1|198299_198530_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_155066610.1|198519_199095_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081398.1|199040_199340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079815.1|199380_200355_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	4.0e-28
WP_054300641.1|200549_200915_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081397.1|200971_201199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|201701_202259_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|202242_202629_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081395.1|202696_203746_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081394.1|203990_204434_-	CRS1 / YhbY domain protein	NA	NA	NA	NA	NA
WP_155066406.1|204488_204746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066407.1|204723_205350_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_155069770.1|205427_207410_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.1	1.8e-115
WP_016209869.1|207619_208963_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_155081393.1|209229_211899_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_155085057.1|211922_213839_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_155068614.1|214008_215430_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	1.4e-45
WP_155081391.1|215574_216549_+	phospholipase	NA	NA	NA	NA	NA
WP_155081465.1|217565_218018_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|218049_218400_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081386.1|218461_218647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081385.1|219849_220071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081384.1|220234_221896_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.5	3.5e-181
WP_016209850.1|221968_222259_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_155081597.1|222484_222940_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_155081383.1|223004_223469_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_155081382.1|223562_224909_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_155081381.1|224908_225814_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_155081380.1|225875_226862_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|226854_227097_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_155081379.1|227219_228764_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.2	2.5e-64
WP_155081378.1|228810_230097_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_155081377.1|230138_231533_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_155080716.1|232989_234171_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	247610	305814	3541633	tRNA,tail,transposase	Acinetobacter_phage(20.0%)	57	NA	NA
WP_155079478.1|247610_248168_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079593.1|248198_248405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081370.1|248420_248846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067136.1|248772_249123_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210080.1|249243_249537_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_155081369.1|249643_250456_-	trfA family protein	NA	NA	NA	NA	NA
WP_155081368.1|250754_251609_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_155081367.1|252084_252369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081366.1|253121_253778_-	DedA family protein	NA	NA	NA	NA	NA
WP_155066432.1|253795_255076_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_155081595.1|255349_256711_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_155081365.1|256773_257379_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_155081364.1|262754_264026_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_155081363.1|264082_265066_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|265062_265848_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_155066436.1|266161_266608_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_155081362.1|267035_268517_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	27.6	3.7e-49
WP_155066438.1|268572_269682_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.1	1.0e-35
WP_155081361.1|269779_271747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081360.1|272368_273394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066739.1|273448_273799_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081107.1|273725_273965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085060.1|274587_275004_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|275245_275803_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081359.1|276673_276880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085061.1|276881_277538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085062.1|277546_278605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081356.1|281891_282329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081355.1|282570_283788_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_155081103.1|284196_284421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066453.1|284532_285060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066454.1|285315_285588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081354.1|285762_286080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081353.1|286381_286666_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_155081352.1|286581_286788_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	71.1	5.7e-09
WP_155081351.1|286932_287904_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079445.1|288355_289330_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155066455.1|289594_290710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066456.1|290648_291335_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_155081350.1|291328_292306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081349.1|292340_293504_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081348.1|294430_295399_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081347.1|295415_295628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|296044_296332_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_155066460.1|296506_297262_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_155068619.1|297294_297699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066461.1|297674_298151_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_155081346.1|298157_299735_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_155066463.1|299738_300503_+	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
WP_155068620.1|300556_301093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066464.1|301089_301821_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_155081345.1|301903_302467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081594.1|302481_302964_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081491.1|303121_303574_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068097.1|303605_303956_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081343.1|304293_304638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081342.1|304812_305814_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	311521	358948	3541633	transposase	unidentified_phage(33.33%)	49	NA	NA
WP_155081337.1|311521_312247_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155079620.1|312243_313218_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155081336.1|313262_313562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081335.1|313595_315647_-	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_155081592.1|315655_316432_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_155081334.1|316708_317062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085063.1|318348_319308_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081332.1|320732_322022_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_155081331.1|322202_322535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211034.1|323431_323611_+	rubredoxin	NA	NA	NA	NA	NA
WP_155081330.1|323622_324054_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_016211029.1|324267_324630_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.6e-25
WP_155081329.1|324706_326350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081328.1|326873_328076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081327.1|328397_328634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081326.1|328778_329639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210864.1|330090_331389_-	MFS transporter	NA	NA	NA	NA	NA
WP_155081325.1|331642_332608_+	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.1	9.5e-14
WP_155081591.1|332604_332910_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_155085064.1|332935_333715_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_155081323.1|333744_334032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376546.1|334075_334372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081322.1|334549_335341_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155066936.1|335639_335990_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079874.1|335916_336306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081320.1|336629_336836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085065.1|336901_337453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085066.1|337601_337754_-	phosphatase	NA	NA	NA	NA	NA
WP_155085067.1|337723_338239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081296.1|338242_338626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079784.1|338806_339583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081319.1|339856_340768_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.5	6.6e-25
WP_155081318.1|341242_341965_+	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_155085068.1|341961_342843_+	ROK family protein	NA	NA	NA	NA	NA
WP_155081590.1|342941_344414_+	sodium/solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.9	3.9e-19
WP_155081316.1|344570_345458_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_155081315.1|345844_346159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081314.1|346379_347147_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300641.1|347208_347574_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080161.1|347630_347846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081531.1|348002_348227_+	hypothetical protein	NA	A0A2P0VP61	Tetraselmis_virus	45.8	8.3e-06
WP_155085069.1|348223_348520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081312.1|348503_349280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|349742_350561_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_155081589.1|350636_353006_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.2	2.4e-159
WP_155081311.1|353715_355143_+	amino acid permease	NA	NA	NA	NA	NA
WP_155081310.1|355177_355996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085070.1|356356_356599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|357973_358948_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
>prophage 6
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	368874	420599	3541633	transposase	unidentified_phage(50.0%)	56	NA	NA
WP_155066936.1|368874_369225_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|369256_369709_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081303.1|369717_370023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081302.1|370003_370555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066521.1|370774_372073_-	MFS transporter	NA	NA	NA	NA	NA
WP_155081301.1|372189_372330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|372326_372713_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|372696_373254_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081300.1|373475_374234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081299.1|374850_375066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|374992_375343_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081298.1|375408_376116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081297.1|376371_376578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080219.1|376643_377693_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081296.1|377696_378080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079784.1|378260_379037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081295.1|379111_380308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066529.1|381031_381286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081294.1|382001_382490_+	amino acid permease	NA	NA	NA	NA	NA
WP_155081293.1|382506_383460_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.8	6.7e-28
WP_155081292.1|383501_384464_+	amino acid permease	NA	NA	NA	NA	NA
WP_155081291.1|384790_385849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081290.1|386100_387504_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_155081289.1|387748_388039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081288.1|388076_388751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081588.1|388899_389067_-	phosphatase	NA	NA	NA	NA	NA
WP_155081287.1|389079_389406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|389428_389815_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|389798_390356_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081286.1|390394_390883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080172.1|390879_391854_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	8.9e-28
WP_155081285.1|392165_392456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081284.1|392498_393548_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085074.1|393601_393829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081587.1|393843_394419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081282.1|394475_395309_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.7	3.5e-17
WP_155081281.1|395424_396609_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_155081280.1|396627_397572_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_155066542.1|397875_398661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066543.1|399352_399721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081279.1|399948_401526_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_155081278.1|402253_406738_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_155085075.1|406874_407039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085076.1|407017_408397_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155081276.1|408603_408774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066610.1|408806_409382_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080903.1|409327_409825_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085077.1|409886_410675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081272.1|411220_412462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|413479_413845_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080161.1|413901_414117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081586.1|414273_414498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081271.1|414681_415224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081270.1|415384_416530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081269.1|416829_419499_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	23.9	7.9e-18
WP_155079487.1|419549_420599_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	447351	544934	3541633	tRNA,transposase	Acinetobacter_phage(13.04%)	112	NA	NA
WP_155068622.1|447351_447804_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|447835_448186_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085080.1|448251_449004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085081.1|449126_449834_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_155080970.1|450055_450346_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155067835.1|450270_450438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080161.1|450494_450710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085312.1|450866_451091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085082.1|451087_452038_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085083.1|452258_452834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081256.1|453098_453590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081255.1|454122_455409_-	MFS transporter	NA	NA	NA	NA	NA
WP_155081254.1|455824_457108_-	citrate synthase	NA	NA	NA	NA	NA
WP_017378336.1|457839_458214_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_016210223.1|458207_458555_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_155081253.1|458558_460322_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210209.1|460334_461033_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_155081252.1|461139_463941_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_155066580.1|463951_465100_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_016210208.1|465214_466375_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378341.1|466384_467260_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_155081251.1|467329_467608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081250.1|467834_469418_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_155081249.1|469635_470571_+	ras family protein	NA	A0A2K9L182	Tupanvirus	27.0	3.5e-05
WP_017378346.1|470674_471145_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155066585.1|471389_471662_-	feoC like transcriptional regulator family protein	NA	NA	NA	NA	NA
WP_155081248.1|471704_474029_-	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
WP_155081247.1|474025_474259_-	iron transporter	NA	NA	NA	NA	NA
WP_017378349.1|474760_475189_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_155081246.1|475200_475590_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_155066587.1|475756_476383_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_155081245.1|476394_476823_+	stringent starvation protein B	NA	A0A1S5R3H3	Pseudomonas_phage	39.1	5.7e-19
WP_016210685.1|476857_477442_-	phosphoheptose isomerase	NA	NA	NA	NA	NA
WP_155068631.1|477533_477869_-	YraN family protein	NA	NA	NA	NA	NA
WP_155081244.1|477858_479649_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155081243.1|479735_480284_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.6	1.1e-27
WP_155081242.1|480315_481290_-	octaprenyl diphosphate synthase	NA	NA	NA	NA	NA
WP_032126122.1|481565_481877_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_155066591.1|481896_482157_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_155081241.1|482262_483339_+	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_155066593.1|483546_485118_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	2.3e-09
WP_155081240.1|485155_486190_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_017378362.1|486238_486808_+	elongation factor P	NA	NA	NA	NA	NA
WP_155066595.1|487027_487993_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.6	4.7e-21
WP_155081239.1|488004_489594_+	dolichyl-phosphate-mannose-protein mannosyltransferase	NA	NA	NA	NA	NA
WP_155066597.1|489734_490766_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_155081238.1|491091_492201_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155081237.1|492225_493314_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155081236.1|493418_494603_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_155081235.1|494680_496669_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_155081234.1|496829_497912_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	69.8	5.6e-140
WP_155081233.1|497918_498848_+	NAD-dependent epimerase/dehydratase family protein	NA	M4R1H4	Synechococcus_phage	38.9	9.6e-56
WP_155081584.1|498860_500018_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1D8KU11	Synechococcus_phage	35.8	2.2e-49
WP_155081232.1|500021_500924_+	hypothetical protein	NA	A0A2H4UUT1	Bodo_saltans_virus	39.2	1.0e-25
WP_155081231.1|500939_501980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|502059_502617_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|502600_502987_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081230.1|503035_503536_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081229.1|503844_504342_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081228.1|504462_505431_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080208.1|505452_505818_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080171.1|505763_506339_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079478.1|506482_507040_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|507023_507410_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079476.1|508020_508407_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|508390_508948_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081226.1|509972_510758_-	hypothetical protein	NA	A0A1V0SBR2	Catovirus	28.3	1.1e-07
WP_155081225.1|510881_511184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081224.1|511191_511869_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081223.1|512048_512531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081222.1|512554_513535_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	2.6e-27
WP_155081221.1|513612_514212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081220.1|514285_515020_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081219.1|515427_517359_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.3	7.5e-119
WP_075273353.1|517363_517894_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|517928_518123_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_155081218.1|518165_518525_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378383.1|518656_519652_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_155081217.1|519664_522046_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|522051_522339_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_054300641.1|522462_522828_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081216.1|522884_523091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|523145_523496_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|523527_523980_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068600.1|524171_524396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066611.1|524611_525142_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_155081215.1|525404_525599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081214.1|525567_525864_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	38.5	4.5e-07
WP_155081213.1|525908_526625_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.2	2.6e-24
WP_155079445.1|526724_527699_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155081212.1|527684_528041_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085084.1|528149_528953_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081210.1|528915_529200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081209.1|529468_529672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081208.1|529884_530595_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_155081207.1|530636_531410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068634.1|531411_532353_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_155081206.1|532486_534064_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_155085085.1|534274_535171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|535420_536650_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155085086.1|536724_537285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085087.1|537429_537786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081202.1|538345_539104_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_155085313.1|539312_539885_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_155068636.1|539988_540537_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_155081201.1|541112_541409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081200.1|541716_542043_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	49.5	6.6e-20
WP_155079487.1|542129_543179_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081582.1|543162_543630_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|543661_544012_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085088.1|544077_544596_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.7	1.1e-27
WP_155081198.1|544640_544934_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	39.6	2.6e-07
>prophage 8
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	566093	662619	3541633	transposase	unidentified_phage(38.46%)	106	NA	NA
WP_155081186.1|566093_567323_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081185.1|567942_569388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081184.1|570026_570680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081183.1|570672_571005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081182.1|571108_571441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081181.1|571444_572014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081180.1|572142_572556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|572628_572979_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|573010_573463_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|573651_574002_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|574033_574486_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079487.1|574536_575586_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081179.1|575792_576998_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	6.4e-36
WP_155081178.1|577105_578131_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_155081177.1|578330_578567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081176.1|578659_579358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085091.1|580098_580335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085092.1|580560_581037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|581037_581595_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|581578_581965_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085093.1|581980_582799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081174.1|582874_583045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081173.1|583189_583435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085094.1|583893_584715_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155085095.1|584859_585309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081172.1|585625_586081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085096.1|586144_587300_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	1.2e-50
WP_155081171.1|587228_588089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085097.1|588962_589739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081170.1|589792_590011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|589991_590549_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|590532_590919_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085098.1|590963_592457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|592453_593428_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155081167.1|594055_594277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|594306_594693_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|594676_595234_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081166.1|595259_595652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066686.1|595848_596388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066687.1|597443_597872_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_155085099.1|598106_599156_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081164.1|599198_599393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081163.1|599821_601213_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_155081162.1|601663_603157_+	amino acid permease	NA	NA	NA	NA	NA
WP_155080323.1|603741_604641_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.1e-23
WP_155081161.1|604754_604970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|604993_605968_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155081160.1|606044_606449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085100.1|607068_607719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|607699_608257_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|608240_608627_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081158.1|609007_609205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067468.1|609201_609348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080467.1|609431_610584_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	6.8e-59
WP_155085101.1|610577_611498_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080205.1|611612_611759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081154.1|613320_614040_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155080338.1|614170_614458_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.3	2.2e-06
WP_155079478.1|614493_615051_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|615034_615421_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085102.1|615606_615777_-	phosphatase	NA	NA	NA	NA	NA
WP_155085103.1|615751_616090_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155081152.1|616276_616861_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	3.4e-35
WP_155081151.1|617107_618523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066732.1|618671_618899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081580.1|618968_619922_-	PAP2 family protein	NA	NA	NA	NA	NA
WP_155081150.1|619912_620323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209685.1|620327_620663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242618.1|620664_621315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081149.1|621634_622141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081148.1|622185_625401_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_155081147.1|625440_626262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081146.1|626263_629272_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_155081145.1|629274_629700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242623.1|629731_630313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066725.1|630312_631356_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_155081144.1|631364_631838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081579.1|631846_634150_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_155066723.1|634438_635545_-	ATPase	NA	NA	NA	NA	NA
WP_155066722.1|635537_636284_-	type IV secretion system protein DotC	NA	NA	NA	NA	NA
WP_155066721.1|636276_636780_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_155081143.1|636832_637255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081142.1|637269_638307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081141.1|638322_639303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081140.1|639308_640502_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_155066716.1|640504_641344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066714.1|641988_642414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081139.1|642518_645206_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_155085104.1|645794_647024_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081137.1|648125_648275_-	phosphatase	NA	NA	NA	NA	NA
WP_155080716.1|648460_649642_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081134.1|649729_650044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|650055_650942_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081133.1|651003_651243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080208.1|651299_651665_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085105.1|651700_651919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085106.1|651954_652371_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081132.1|652431_652626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081131.1|652671_653646_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	8.9e-28
WP_155081130.1|654093_656259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081578.1|656533_657484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079490.1|658270_659245_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.5	2.3e-28
WP_155081129.1|659460_659931_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	37.3	1.6e-22
WP_155081128.1|660234_661605_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.8	2.9e-109
WP_155081465.1|661784_662237_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|662268_662619_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	669439	718858	3541633	transposase	Streptococcus_phage(33.33%)	50	NA	NA
WP_155081125.1|669439_670489_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081124.1|670521_670806_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_155081123.1|670883_671315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|671992_672550_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|672533_672920_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081122.1|673302_673617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079741.1|673711_674686_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155081121.1|674682_675105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081120.1|675151_675484_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_155081119.1|675628_676291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081118.1|676336_676789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081117.1|677055_677688_+	LysE family translocator	NA	NA	NA	NA	NA
WP_155066699.1|677688_678939_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	1.3e-92
WP_155066698.1|678972_680070_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.1	5.7e-47
WP_155081115.1|680410_680632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081114.1|680930_681209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079815.1|681255_682230_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	4.0e-28
WP_155066695.1|682957_683515_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155085107.1|683608_684115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066693.1|684619_685315_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	3.5e-10
WP_155081112.1|685268_686234_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_155066278.1|686734_687784_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081111.1|688130_689570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081110.1|689738_690542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081109.1|691811_693800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081108.1|694967_695576_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155066739.1|696938_697289_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081107.1|697215_697455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064006185.1|698188_698905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081106.1|700455_701058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081105.1|701144_702194_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081104.1|702263_704081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081577.1|704646_705147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081103.1|705211_705436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085108.1|705563_706283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081739.1|706279_707014_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155085109.1|706971_707790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068646.1|707904_708159_+	DUF493 family protein	NA	NA	NA	NA	NA
WP_155081101.1|708312_708585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081100.1|709157_709733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068647.1|709729_710068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081099.1|710802_711045_+	response regulator SirA	NA	NA	NA	NA	NA
WP_155066746.1|711132_712224_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_155066747.1|712204_713158_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	3.8e-31
WP_155081098.1|713380_714865_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	2.5e-45
WP_155081576.1|714904_715408_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	32.8	6.2e-09
WP_155081097.1|715956_717132_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_155068648.1|717279_717684_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155066753.1|717747_718101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|718405_718858_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	734665	787272	3541633	tRNA,transposase	Acinetobacter_phage(22.22%)	49	NA	NA
WP_155081058.1|734665_735613_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081091.1|736090_737389_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_155081090.1|738308_739907_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155085110.1|739977_740556_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155081574.1|740844_741189_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155081573.1|741250_742141_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155079478.1|742967_743525_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|743508_743895_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079476.1|744729_745116_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|745099_745657_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081087.1|746187_746526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081086.1|746522_747098_+	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.0	2.4e-33
WP_155081085.1|747146_747362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081572.1|747548_748388_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.8	2.4e-45
WP_155081084.1|748419_751821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081083.1|751848_752433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|752951_754108_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080320.1|754989_756045_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081082.1|756110_756404_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079612.1|756600_757830_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081081.1|758858_759869_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	41.6	6.6e-58
WP_155079476.1|760606_760993_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080667.1|761054_761207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|761225_761612_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|761595_762153_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080465.1|762171_762492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081571.1|762553_763735_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376619.1|765139_765544_-	RidA family protein	NA	NA	NA	NA	NA
WP_155081080.1|765572_766283_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_155081079.1|766346_768062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209558.1|768058_768421_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_155081570.1|768435_769590_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	32.1	8.6e-38
WP_155066789.1|769593_770601_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.2	1.1e-36
WP_155066790.1|770603_771620_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	26.1	3.2e-12
WP_155081078.1|771808_772990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081077.1|773094_773484_-	RidA family protein	NA	NA	NA	NA	NA
WP_155066793.1|773616_774900_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_155066794.1|774915_776217_+	aspartate kinase	NA	NA	NA	NA	NA
WP_155066795.1|776231_778034_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155081076.1|778044_779031_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155066796.1|779111_780188_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155066797.1|780287_781262_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.8	3.3e-14
WP_155081075.1|781322_782300_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.0	1.7e-15
WP_017376633.1|782484_782754_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_155068622.1|782987_783440_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066739.1|783471_783822_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066799.1|783978_785265_+	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_155066800.1|785329_786016_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085111.1|786360_787272_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	805314	835281	3541633	tRNA,transposase,integrase	Acinetobacter_phage(25.0%)	33	808912:808971	809918:810310
WP_155079868.1|805314_806471_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155085112.1|806754_807696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081065.1|807947_808136_-|transposase	transposase	transposase	NA	NA	NA	NA
808912:808971	attL	CTTGCATGCTTTATTCCCGCTCAATGCATGAGCTTTGACAGCATAATCAACTAAGTGACG	NA	NA	NA	NA
WP_155081064.1|809305_809917_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	42.3	1.1e-36
WP_155067931.1|809991_810258_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085113.1|810316_811108_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
809918:810310	attR	CTTGCATGCTTTATTCCCGCTCAATGCATGAGCTTTGACAGCATAATCAACTAAGTGACGCCGACTCGCTGCGGTTATAGCTTTTTTTCAACAATATCCTTGAGCACTTTGTGCTCTAGGCTAATGTCTGCGTACATCTGTTTCAAACGACGGTTTTCGTCTTCAAGCTCTTTTAAACGCTGTAGATCTGAAACGCCCATGCCTTGATACTTGGACCTGAGTTTGTAGTAGCTGCTTTTAGCAATACCATACTGGCGACAAATATCTTCAACTTTAATACCCGCTTGGCCTTCATTAAGCATGGCTACAATTTGTGATTCTGTTAGTTTTGATCGTTTCATCTTCTCTCTCCTGTCTAAGCTAATTTAACAGAAGATTCCACTTATCACTTGT	NA	NA	NA	NA
WP_155079478.1|811809_812367_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|812350_812737_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081569.1|813489_813645_-	phosphatase	NA	NA	NA	NA	NA
WP_155081063.1|814045_814588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079888.1|814562_814709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079889.1|814684_815227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067929.1|815468_815906_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|815974_816607_-	endonuclease III	NA	NA	NA	NA	NA
WP_155081062.1|816622_817270_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_155081061.1|817272_819336_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_155081060.1|819662_820955_+	MFS transporter	NA	NA	NA	NA	NA
WP_155081059.1|821140_821530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081058.1|821710_822658_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081057.1|823190_823664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|825089_825440_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|825471_825924_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081568.1|825918_826179_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079478.1|826181_826739_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|826722_827109_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080005.1|828164_829050_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081055.1|829158_831369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081054.1|831369_831561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079928.1|831814_832564_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	29.8	1.3e-10
WP_155066936.1|832618_832969_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|833000_833453_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081052.1|834155_834533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|834723_835281_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	852987	897779	3541633	transposase,integrase	unidentified_phage(25.0%)	53	875142:875201	896769:897469
WP_155079478.1|852987_853545_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|853528_853915_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085114.1|855452_855860_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_155068622.1|855909_856362_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|856393_856744_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081045.1|856843_857002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081044.1|856991_857237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081043.1|857381_857744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080208.1|857800_858166_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081042.1|858620_858995_-	VOC family protein	NA	NA	NA	NA	NA
WP_155067890.1|858987_859629_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|859625_860342_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_155081041.1|860345_861665_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155085115.1|861880_862498_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155085116.1|862606_863143_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	35.3	7.1e-11
WP_155079826.1|863326_864213_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081039.1|865853_868490_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.5	3.4e-98
WP_155067886.1|868528_869617_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.6	9.8e-76
WP_155067885.1|869616_870300_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_155081038.1|870360_872022_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_155067883.1|872174_872429_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_155067882.1|872506_872812_+	competence protein ComEA	NA	NA	NA	NA	NA
WP_155081037.1|872988_873387_+	VOC family protein	NA	NA	NA	NA	NA
WP_155081035.1|874025_874736_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155079445.1|874830_875805_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
875142:875201	attL	TATACAGGAGCATAATATCCAAGTGAGTGAGAGCACCATCTACCGTTATATTCATGAGGA	NA	NA	NA	NA
WP_155081034.1|876132_876876_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155081033.1|876903_877224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081032.1|877416_878298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081031.1|878408_880088_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.5	1.3e-37
WP_155081030.1|880214_881465_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A219Y950	Aeromonas_phage	54.4	4.1e-102
WP_155067874.1|881562_882024_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_155067873.1|882020_883169_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	6.8e-43
WP_155081029.1|883174_883849_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	2.3e-30
WP_155081028.1|883879_884503_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	45.1	1.0e-40
WP_155067870.1|884610_885084_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	8.1e-27
WP_017376520.1|885085_885508_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_155067869.1|885494_886514_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155066610.1|886992_887568_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067098.1|887513_887834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080172.1|887892_888867_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	8.9e-28
WP_155080582.1|889159_889366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080581.1|889387_889642_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081533.1|889673_890126_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081565.1|890539_891022_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081027.1|891153_891531_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155079478.1|891538_892096_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|892079_892466_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081025.1|893358_893544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081024.1|893744_894668_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.9	2.2e-23
WP_155079476.1|895139_895526_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|895509_896067_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|896851_897238_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|897221_897779_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
896769:897469	attR	TCCTCATGAATATAACGGTAGATGGTGCTCTCACTCACTTGGATATTATGCTCCTGTATAGCTGACACGGTTGAGTTAACCTTTTGATTTTGCTATTATTCTTACATGAAAAATATAGCAGGATTTTAGAATTGCAAGCTTATAGTCAGGATTTGCGAGAGCGCGTTATTGAAGCTTATAAAGATGGGCTTAGCCGAAGAGAAATATCCACTCTTTTCAAGGTGCATTATGATACAGCTTGTGAATGGATTCGACGTTATTTATCAACAGGTGACTACTCTTCAAAACAAGGAGTTGGCTGTGGCGCACAAATAAGGTTTAATGACAAACAAACTATTCTAGATTTCATAAAGAAAAATCCAGATGCAAATGGGATTGCCATTCGTGATGGCATTGCTCCTGACCTCCCTATGTCAACCTTTTATGACGCATTGAAACGATTAAAAGTCACATATAAAAAAAGAGCCTAAGTATAAGCAAAGACGTGACGCCGAAAGATCTGAATTTATAGAAAAGCTAACAGGAATTGATTTGAGCCAATTAGTTTATCTTGATGAGGTTGGCGTTGATGATAATATCGTTGTTGAATATGGCTGGTCAGCTGCCGGAGTGCGAAGTTATGCTGAACAAGCAGGCTTCAAGAGGAAAAGGTTAAGCCTTGTTGCTGGCTTGAAGTATAGTGATAAAAGTTTGGTTGCTCC	NA	NA	NA	NA
>prophage 13
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	900861	1070842	3541633	tRNA,transposase,protease	unidentified_phage(14.29%)	177	NA	NA
WP_155080546.1|900861_901590_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155085117.1|901790_902000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085118.1|902148_902331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085314.1|902877_903450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080686.1|903477_904053_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079974.1|903998_904364_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081021.1|904675_905035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|905651_906209_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|906192_906579_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081020.1|907073_907277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|907353_907911_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|907894_908281_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079741.1|908311_909286_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155081019.1|909542_909680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081018.1|909697_911842_-	RelA/SpoT family protein	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|911863_912070_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_155067858.1|912130_912751_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	35.1	4.8e-19
WP_155081017.1|912791_913685_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|913770_914496_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|914556_914961_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155081016.1|915090_915267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|915307_915865_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|915848_916235_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080465.1|916525_916846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085119.1|916952_917927_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	3.4e-27
WP_155081015.1|917923_918112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080516.1|918395_918560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081014.1|920510_921560_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_155081013.1|921556_923023_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_155081012.1|923165_924503_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_155068743.1|924565_926062_-	nuclease	NA	NA	NA	NA	NA
WP_155081011.1|926290_926662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081010.1|926813_927641_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_155081009.1|928958_929102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|929134_929521_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|929504_930062_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081008.1|931575_932193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067849.1|932140_933064_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_155081007.1|933077_934001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085120.1|934230_934545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081005.1|934800_935826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|937045_937932_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081003.1|938001_938145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080210.1|938223_938544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079888.1|938518_938665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081002.1|938640_939183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085121.1|939393_939543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081000.1|939707_942299_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_155067844.1|943357_943633_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_155081564.1|943632_944682_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_155085122.1|945371_945752_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|946029_946587_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080963631.1|948033_949746_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_155080999.1|949814_950534_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_155080998.1|950530_951133_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_155080997.1|951247_952135_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|952325_952673_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_155067839.1|952723_953563_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	34.9	1.8e-32
WP_155068097.1|955119_955470_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079476.1|955670_956057_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|956040_956598_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081563.1|956679_956940_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080995.1|956974_957241_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080994.1|957237_957951_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.8	7.9e-42
WP_155080993.1|958039_958915_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155079975.1|958989_959565_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079974.1|959510_959876_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080992.1|960615_961242_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_155080991.1|961525_962095_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_155081562.1|962241_962940_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_155080990.1|964176_964443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080989.1|964549_966172_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_155067820.1|966168_967464_-	DUF444 family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_155067819.1|967485_969408_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_155081561.1|969518_969821_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_155080988.1|969913_974800_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_155067817.1|974854_976171_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.6	9.4e-65
WP_155081560.1|976295_977390_+	FUSC family protein	NA	NA	NA	NA	NA
WP_155079461.1|977520_978495_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	7.5e-27
WP_155081559.1|978548_979487_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	2.2e-15
WP_155081558.1|979567_980152_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_155080986.1|980333_981224_-	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_155080985.1|981426_981918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080984.1|982057_982549_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_016209885.1|982717_983431_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_155081557.1|983859_984834_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_155080983.1|985181_986327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080982.1|986300_986474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080981.1|986438_987134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085123.1|987477_987741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085124.1|988011_988995_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|989830_990217_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|990200_990758_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080167.1|991361_992090_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	1.5e-43
WP_155079612.1|992554_993784_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155085125.1|994254_994536_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155081465.1|994522_994975_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|995006_995357_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085126.1|995422_995932_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155080979.1|996133_996745_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_051929560.1|996765_997965_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_017377024.1|998059_998200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080978.1|998212_998617_-	SufE family protein	NA	NA	NA	NA	NA
WP_155068734.1|998847_999417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|999487_1000537_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080976.1|1001388_1002195_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.0	3.1e-10
WP_155085127.1|1002154_1002364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080974.1|1002921_1003146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066857.1|1003312_1003933_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155081556.1|1004251_1006210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066859.1|1006654_1008112_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.3	6.5e-99
WP_155080973.1|1008180_1009761_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	26.8	8.8e-17
WP_155085128.1|1009801_1010368_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_155066862.1|1010413_1014310_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	2.0e-118
WP_016210741.1|1014316_1014640_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_155080089.1|1014734_1015784_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066863.1|1015858_1016314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080970.1|1016530_1016821_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155067835.1|1016745_1016913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080161.1|1016969_1017185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080969.1|1017105_1017318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080968.1|1017557_1017854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081491.1|1018032_1018485_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068097.1|1018516_1018867_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080967.1|1019394_1019793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|1019789_1020347_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1020330_1020717_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080966.1|1020781_1021594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080965.1|1022180_1022885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080964.1|1023136_1023403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080963.1|1023402_1024770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068654.1|1025129_1026077_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.9	7.3e-35
WP_017377238.1|1026395_1026740_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_155081555.1|1026869_1027505_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_155081554.1|1027545_1028373_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_036772199.1|1028459_1028987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066866.1|1029874_1030294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080962.1|1030403_1030985_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_155080961.1|1031338_1032619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066869.1|1032739_1033603_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_155080959.1|1033691_1034486_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155080958.1|1034728_1035715_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155066872.1|1035720_1037256_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_155068657.1|1037336_1038593_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_155066873.1|1038649_1040029_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_155080957.1|1040116_1040932_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.9	2.5e-31
WP_016211687.1|1041273_1041918_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_155080956.1|1041948_1043754_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|1043777_1044353_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_155085129.1|1044896_1045703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1045756_1046143_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1046126_1046684_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085130.1|1046664_1046934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080954.1|1047172_1047598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080556.1|1048793_1049342_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080953.1|1050035_1051001_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	37.8	1.1e-43
WP_155080952.1|1051046_1051622_-	bleomycin resistance protein	NA	NA	NA	NA	NA
WP_155080951.1|1051652_1052927_-	MFS transporter	NA	NA	NA	NA	NA
WP_155080950.1|1053578_1054292_+	aldolase	NA	NA	NA	NA	NA
WP_155080949.1|1054369_1055107_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_155080948.1|1055227_1056583_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_155080947.1|1056801_1056960_-	phosphatase	NA	NA	NA	NA	NA
WP_155081552.1|1057013_1057226_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_155068622.1|1057220_1057673_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1057704_1058055_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080946.1|1058136_1058637_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_155080945.1|1058751_1059627_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.4	6.8e-35
WP_155066896.1|1060228_1061533_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|1061645_1062251_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|1062332_1063634_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_155066897.1|1063701_1066134_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.6e-219
WP_016209655.1|1066237_1066510_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_155080944.1|1066592_1068491_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_155080943.1|1068523_1069408_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	36.0	2.2e-41
WP_155080942.1|1069416_1069812_-	CrcB family protein	NA	NA	NA	NA	NA
WP_155068622.1|1070007_1070460_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1070491_1070842_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	1085373	1140927	3541633	transposase	Bacillus_phage(42.86%)	51	NA	NA
WP_155079826.1|1085373_1086260_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080929.1|1086281_1087160_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066919.1|1091307_1091490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1092296_1092683_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066921.1|1094210_1096103_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	33.0	1.6e-81
WP_155080925.1|1096395_1098720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079413.1|1099502_1100672_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081922.1|1100739_1101666_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080924.1|1101694_1102048_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080923.1|1102104_1102320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080922.1|1102416_1102587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080921.1|1102583_1103333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|1103896_1104079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080920.1|1104142_1104370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066928.1|1104582_1105347_+	DNA/RNA endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	32.6	1.1e-28
WP_026063577.1|1105573_1105867_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_155080919.1|1105938_1106556_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	29.8	6.5e-16
WP_155080918.1|1106716_1107694_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_155081550.1|1107790_1109257_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_155080917.1|1109283_1109937_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155066933.1|1110061_1110628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080916.1|1110876_1112655_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	29.4	3.4e-33
WP_155081549.1|1112726_1114433_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.8	9.8e-22
WP_155080915.1|1114424_1115123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080914.1|1115315_1115972_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_155080913.1|1116148_1116595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068661.1|1117081_1118503_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_155080912.1|1119016_1120459_+	MFS transporter	NA	NA	NA	NA	NA
WP_155085131.1|1120739_1121777_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068662.1|1121932_1122001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080910.1|1122677_1122854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085132.1|1122829_1123297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080908.1|1123372_1123708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080907.1|1123978_1124458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085133.1|1124638_1125178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080904.1|1125407_1126130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066610.1|1126133_1126709_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085134.1|1126654_1126864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085135.1|1127134_1127440_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080902.1|1127536_1128778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080901.1|1128855_1130112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066948.1|1130449_1131625_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_155079478.1|1132591_1133149_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1133132_1133519_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080900.1|1133534_1135490_+	HAD-IC family P-type ATPase	NA	M1HK51	Paramecium_bursaria_Chlorella_virus	29.4	2.7e-55
WP_155066949.1|1135508_1136645_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_155080899.1|1137275_1137596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|1137610_1138660_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080898.1|1139046_1139568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|1140092_1140443_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|1140474_1140927_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	1157141	1201293	3541633	tRNA,transposase	Acinetobacter_phage(28.57%)	45	NA	NA
WP_155079478.1|1157141_1157699_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1157682_1158069_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080889.1|1158028_1158634_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079588.1|1159021_1159387_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066610.1|1159332_1159908_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068622.1|1160361_1160814_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080888.1|1160845_1161172_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080887.1|1161581_1161884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|1162126_1163282_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080886.1|1163504_1163969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085136.1|1164251_1164845_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085137.1|1165178_1166291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080883.1|1166388_1167750_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155066971.1|1167860_1168232_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_155081547.1|1168454_1169105_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155080882.1|1169147_1170230_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_155080881.1|1170283_1172167_+	amino acid permease	NA	NA	NA	NA	NA
WP_155080880.1|1172636_1173449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|1173464_1174514_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211873.1|1174773_1175031_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155081546.1|1175024_1175360_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_155080871.1|1175371_1175572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080870.1|1175845_1176454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122942521.1|1176450_1176747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080869.1|1176739_1177309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080868.1|1178012_1178372_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080867.1|1178413_1178677_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080866.1|1179023_1180137_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.4	2.0e-44
WP_155079413.1|1181969_1183139_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300641.1|1183696_1184062_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080865.1|1184511_1185561_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080102.1|1185922_1186375_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_155080864.1|1186563_1188435_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	31.1	7.2e-34
WP_155080863.1|1188526_1190272_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	3.8e-45
WP_155066988.1|1190351_1190801_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	5.4e-20
WP_016211035.1|1190853_1191069_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_155080862.1|1191316_1192333_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.9	1.6e-99
WP_155080861.1|1192381_1193011_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_155080860.1|1193322_1194534_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155080859.1|1194762_1195764_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155066993.1|1195852_1197061_-	MFS transporter	NA	NA	NA	NA	NA
WP_155080858.1|1197050_1198778_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_155079478.1|1199733_1200291_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1200274_1200661_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085138.1|1200657_1201293_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	1216026	1251861	3541633	tRNA,transposase,protease	unidentified_phage(16.67%)	37	NA	NA
WP_155079445.1|1216026_1217001_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079476.1|1217174_1217561_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1217544_1218102_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080852.1|1218082_1218427_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080851.1|1218696_1219875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080850.1|1220105_1221293_-	MFS transporter	NA	NA	NA	NA	NA
WP_155080849.1|1221425_1222115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067006.1|1222188_1223538_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	26.9	1.3e-32
WP_155081544.1|1223641_1225819_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_155080848.1|1225831_1226650_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_155080847.1|1226629_1227349_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.1e-19
WP_155079478.1|1227513_1228071_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1228054_1228441_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155067009.1|1228576_1229239_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1229269_1229638_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_155080846.1|1229648_1230965_-	MFS transporter	NA	NA	NA	NA	NA
WP_155068670.1|1231247_1231823_+	DedA family protein	NA	NA	NA	NA	NA
WP_016211261.1|1232248_1232542_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_122940630.1|1232731_1233085_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_155067011.1|1233139_1235413_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	2.3e-167
WP_016211259.1|1235472_1235718_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_155081543.1|1235807_1236563_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_155085139.1|1236546_1237503_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.2e-61
WP_155080844.1|1237770_1240302_+	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	2.2e-86
WP_155080843.1|1240305_1241046_+	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_122940639.1|1241521_1242316_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_155067019.1|1242478_1243267_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_155080842.1|1243263_1244475_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7C038	Faustovirus	31.1	6.1e-34
WP_155067021.1|1244464_1244824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067022.1|1244919_1245348_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	4.0e-17
WP_155081542.1|1245499_1246609_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_155080841.1|1246605_1247334_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_155080840.1|1247390_1248278_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376087.1|1248362_1248737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067025.1|1248836_1250114_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	4.8e-21
WP_155080839.1|1250125_1250827_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_155080838.1|1250886_1251861_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.7	2.6e-27
>prophage 17
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	1267273	1331221	3541633	tRNA,transposase,protease	unidentified_phage(36.36%)	59	NA	NA
WP_155067038.1|1267273_1268695_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377891.1|1268725_1269247_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_155067040.1|1269243_1269849_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_155067041.1|1269925_1270936_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.9e-07
WP_155067042.1|1271048_1271753_+	protein TolQ	NA	NA	NA	NA	NA
WP_155067043.1|1271787_1272219_+	protein TolR	NA	NA	NA	NA	NA
WP_155080831.1|1272221_1273316_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_155067045.1|1273375_1274728_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_155067046.1|1274763_1275405_+	OmpA family protein	NA	NA	NA	NA	NA
WP_155067047.1|1275441_1276368_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_155080830.1|1276370_1277018_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.8	7.0e-37
WP_155067049.1|1277068_1277872_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	1.2e-41
WP_155080829.1|1278053_1278269_+	slyX family protein	NA	NA	NA	NA	NA
WP_155067051.1|1278275_1278506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068674.1|1278567_1280160_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_155067052.1|1280361_1281291_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	31.3	1.6e-13
WP_155067053.1|1281292_1282060_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_155080828.1|1282426_1283179_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_155066936.1|1283233_1283584_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|1283615_1284068_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067055.1|1284147_1284510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080827.1|1284682_1286392_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155080608.1|1288117_1288255_-	phosphatase	NA	NA	NA	NA	NA
WP_155080826.1|1288191_1288629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079741.1|1288716_1289691_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155085140.1|1289733_1290063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|1290157_1291132_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079852.1|1291527_1292256_+	DUF541 domain-containing protein	NA	NA	NA	NA	NA
WP_155079851.1|1292359_1293100_+	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_155079445.1|1293321_1294296_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155085141.1|1294292_1294700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|1294766_1295324_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1295307_1295694_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080824.1|1295772_1297089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080823.1|1297527_1299006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085142.1|1299225_1299882_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_155080821.1|1299899_1300755_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080820.1|1301136_1302765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080819.1|1303191_1304475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080818.1|1304675_1304825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|1308603_1309578_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080817.1|1309923_1313463_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_155080816.1|1313530_1314361_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_155080815.1|1314347_1316387_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	41.2	7.1e-128
WP_155080814.1|1316402_1317455_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_155080813.1|1317465_1317996_+	exsB family protein	NA	NA	NA	NA	NA
WP_032126790.1|1318046_1318952_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155067075.1|1321229_1321613_+	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_155068675.1|1321688_1321982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085143.1|1322149_1323538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|1324044_1324602_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1324585_1324972_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080811.1|1325269_1326422_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	6.8e-59
WP_155080810.1|1326450_1326720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080809.1|1327913_1328492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|1329049_1329607_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1329590_1329977_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079974.1|1330334_1330700_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079975.1|1330645_1331221_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	1353468	1455276	3541633	transposase	Acinetobacter_phage(36.36%)	85	NA	NA
WP_155085146.1|1353468_1354044_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080788.1|1355956_1356670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|1357206_1358362_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080787.1|1358319_1358841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081540.1|1359263_1361732_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_155068677.1|1361745_1362714_+	homoserine kinase	NA	NA	NA	NA	NA
WP_155067102.1|1362700_1363960_+	threonine synthase	NA	NA	NA	NA	NA
WP_155080786.1|1364011_1365760_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155067104.1|1366279_1367401_+	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	27.8	3.0e-11
WP_155085147.1|1367451_1368648_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_155080785.1|1368852_1369917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067107.1|1369900_1370647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080784.1|1370636_1371365_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155080783.1|1371352_1372027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080782.1|1372010_1372958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080781.1|1372957_1373473_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155080780.1|1373515_1374949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080779.1|1375042_1377244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080778.1|1377444_1379037_+	B-type flagellin	NA	NA	NA	NA	NA
WP_155067119.1|1379261_1380839_+	B-type flagellin	NA	NA	NA	NA	NA
WP_155080777.1|1380944_1381376_+	flaG family protein	NA	NA	NA	NA	NA
WP_155080776.1|1381495_1382881_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_155067122.1|1382906_1383344_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_155067123.1|1383348_1383690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080775.1|1383704_1385693_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155067125.1|1386009_1386690_+	glycosyl transferase family 2	NA	NA	NA	NA	NA
WP_155080774.1|1386712_1388887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080773.1|1389156_1390689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080772.1|1390760_1391582_+	DUF1338 family protein	NA	NA	NA	NA	NA
WP_155080771.1|1392241_1393714_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.8	2.4e-32
WP_155067131.1|1394017_1396711_+	DNA repair protein	NA	NA	NA	NA	NA
WP_155080770.1|1396707_1400109_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	1.0e-09
WP_054300641.1|1400359_1400725_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080161.1|1400781_1400997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|1401246_1402296_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079868.1|1402453_1403609_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155085148.1|1403679_1403850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067135.1|1405093_1405765_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_155080769.1|1406019_1407172_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.0	3.4e-58
WP_155080768.1|1407826_1408582_-	zinc transporter	NA	NA	NA	NA	NA
WP_155080767.1|1408876_1410475_+	dolichyl-phosphate-mannose-protein mannosyltransferase	NA	NA	NA	NA	NA
WP_155079868.1|1410431_1411588_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_054300641.1|1412004_1412370_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080766.1|1412426_1412783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080765.1|1412987_1413182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085149.1|1413560_1414004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|1414135_1414693_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1414676_1415063_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085150.1|1415085_1415460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080716.1|1415792_1416974_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079612.1|1418869_1420099_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155085151.1|1420322_1422395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085152.1|1422504_1422660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|1423827_1424714_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080759.1|1424821_1425850_+	chorismate mutase	NA	NA	NA	NA	NA
WP_155067150.1|1425903_1427208_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_155067151.1|1427198_1427765_+	shikimate kinase	NA	NA	NA	NA	NA
WP_155080758.1|1427754_1428837_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	3.5e-73
WP_155080757.1|1428879_1429983_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_155067154.1|1430023_1430512_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_155080756.1|1430660_1431269_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242778.1|1432108_1432435_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_016209480.1|1432484_1432712_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_155067160.1|1432723_1433176_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_155068679.1|1433385_1434807_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	1.3e-152
WP_155080755.1|1434839_1435937_+	alanine racemase	NA	NA	NA	NA	NA
WP_155080754.1|1435961_1436693_-	hypothetical protein	NA	M1IDP9	Pelagibacter_phage	35.0	3.4e-08
WP_155080753.1|1436808_1438179_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_155068680.1|1438296_1438770_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_016209463.1|1439126_1439510_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_155079620.1|1439778_1440753_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080751.1|1441073_1441397_+	YqcC family protein	NA	NA	NA	NA	NA
WP_155080750.1|1441485_1443504_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_155080749.1|1443526_1444480_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155085315.1|1446172_1446346_-	phosphatase	NA	NA	NA	NA	NA
WP_155079476.1|1446956_1447343_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081465.1|1447504_1447957_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1447988_1448339_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079478.1|1448477_1449035_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1449018_1449405_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085153.1|1449401_1451120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085154.1|1452048_1452798_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080744.1|1452665_1453025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080743.1|1453724_1454042_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_155066278.1|1454226_1455276_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	1472016	1590825	3541633	tRNA,transposase,protease,integrase	unidentified_phage(15.38%)	117	1473111:1473170	1534930:1535739
WP_155066918.1|1472016_1472844_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079478.1|1472964_1473522_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
1473111:1473170	attL	ATAGTTCACAATCAACAGCTTCAACCATATCATAAAGTTCAGGGCTTTTATGGAAGCTTG	NA	NA	NA	NA
WP_155079476.1|1473505_1473892_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080737.1|1474118_1474472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080736.1|1476143_1476731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080735.1|1476796_1477462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080734.1|1477660_1479223_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.7	6.8e-70
WP_155079959.1|1479265_1479616_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.2	7.6e-14
WP_155079958.1|1479612_1479921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080733.1|1480050_1480407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080732.1|1480733_1481117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080731.1|1481270_1481489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080730.1|1481531_1481891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085316.1|1481895_1482348_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1482379_1482730_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085317.1|1484055_1485417_-	histidine kinase	NA	NA	NA	NA	NA
WP_155080729.1|1485512_1486172_-	response regulator	NA	NA	NA	NA	NA
WP_155085155.1|1486673_1486982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080727.1|1487333_1487600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080726.1|1487897_1489457_-	amino acid permease	NA	NA	NA	NA	NA
WP_155080725.1|1489809_1491780_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.2	5.5e-77
WP_155080724.1|1491977_1493048_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155080723.1|1493105_1493312_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_155080722.1|1493318_1494794_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_155067225.1|1495413_1495728_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080720.1|1495764_1496739_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.7e-29
WP_155080719.1|1496774_1497254_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0N7C035	Escherichia_phage	33.1	1.2e-12
WP_155079826.1|1497336_1498223_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085156.1|1498258_1498582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080717.1|1499321_1500638_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080716.1|1500821_1502003_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085157.1|1502534_1502768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|1503173_1504060_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080714.1|1504081_1504780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080713.1|1504948_1505977_+	YHYH protein	NA	NA	NA	NA	NA
WP_155080712.1|1505984_1507667_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.7	6.5e-26
WP_155067209.1|1507833_1508760_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155081534.1|1508855_1509839_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	2.8e-53
WP_155067210.1|1509831_1510053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080711.1|1510080_1510722_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_155080710.1|1511053_1511239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080709.1|1511704_1512565_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_155080708.1|1512581_1513022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085158.1|1513044_1514580_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_155067214.1|1514704_1516189_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_155080443.1|1516640_1517690_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079868.1|1518224_1519381_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155079445.1|1519972_1520947_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080706.1|1521050_1521212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080705.1|1521437_1521908_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	47.5	5.8e-33
WP_155067218.1|1521921_1522077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080704.1|1522235_1522697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067220.1|1522769_1525340_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.8	3.5e-31
WP_155080703.1|1525447_1525933_+	nicotinamide-nucleotide amidohydrolase family protein	NA	B5TK85	Pseudomonas_phage	55.6	8.9e-37
WP_122941088.1|1526104_1527145_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_155080702.1|1527122_1527605_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_155080701.1|1527601_1530196_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	1.8e-88
WP_155080700.1|1530502_1530766_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_155085159.1|1531044_1531383_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_155085160.1|1531618_1531753_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1533440_1533791_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081486.1|1534027_1534480_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1534511_1534862_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079881.1|1534927_1535341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1535324_1535711_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080386.1|1535707_1536055_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
1534930:1535739	attR	ATAGTTCACAATCAACAGCTTCAACCATATCATAAAGTTCAGGGCTTTTATGGAAGCTTGCATTATCCATGATAATTACTTGCCCAGGATTTAGCTTCGGACATAATTCCTGTTCAAACCAGCCTAAAAACAAATCCTTATTCATTGCACCTGAAAATTCGAAAGGAGCAACCAAACTTTTATCACTATACTTCAAGCCAGCAACAAGGCTTAACCTTTTCCTCTTGAAGCCTGCTTGTTCAGCATAACTTCGCACTCCGGCAGCTGACCAGCCATATTCAACAACGATATTATCATCAACGCCAACCTCATCAAGATAAACTAATTGGCTCAAATCAATTCCTGTTAGCTTTTCTATAAATTCAGATCTTTCGGCGTCACGTCTTTGCTTATACTTAGGCTCTTTTTTTATATGTGACTTTTAATCGTTTCAATGCGTCATAAAAGGTTGACATAGGGAGGTCAGGAGCAATGCCATCACGAATGGCAATCCCATTTGCATCTGGATTTTTCTTTATGAAATCTAGAATAGTTTGTTTGTCATTAAACCTTATTTGTGCGCCACAGCCAACTCCTTGTTTTGAAGAGTAGTCACCTGTTGATAAATAACGTCGAATCCATTCACAAGCTGTATCATAATGCACCTTGAAAAGAGTGGATATTTCTCTTCGGCTAAGCCCATCTTTATAAGCTTCAATAACGCGCTCTCGCAAATCCTGACTATAAGCTTGCAATTCTAAAATCCTGCTATATTTTTCATGTAAGAATAATAGCAAAATCAAAAGGTTAACTCAACCGTGTCAGCTATAT	NA	NA	NA	NA
WP_155080387.1|1536232_1536469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080388.1|1536546_1538109_-	peptide-binding protein	NA	NA	NA	NA	NA
WP_155079612.1|1538398_1539628_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080392.1|1539838_1541314_-	amino acid permease	NA	NA	NA	NA	NA
WP_155067233.1|1541549_1541744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080393.1|1541836_1542859_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_155080394.1|1543189_1544557_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_026063533.1|1544782_1545037_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_155067236.1|1545052_1546339_+	GTPase HflX	NA	NA	NA	NA	NA
WP_155080395.1|1546358_1547573_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_155067238.1|1547572_1548466_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_155067239.1|1548663_1549962_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.8	3.2e-65
WP_155080396.1|1550050_1551328_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.9	3.4e-51
WP_155085161.1|1551341_1553741_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	1.0e-69
WP_155067241.1|1553737_1554496_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_155085162.1|1555229_1555436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080399.1|1555725_1556031_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080400.1|1556515_1557283_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1557298_1557685_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1557668_1558226_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080401.1|1558226_1558703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080402.1|1558847_1559822_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	2.6e-27
WP_155080403.1|1559947_1561045_-|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	38.1	4.9e-51
WP_155080464.1|1561087_1561438_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	39.2	5.8e-14
WP_155080406.1|1561434_1561695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080407.1|1561890_1562706_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080402.1|1562866_1563841_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	2.6e-27
WP_155080408.1|1563985_1565215_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080409.1|1565328_1565568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080410.1|1565725_1566532_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	29.3	3.3e-12
WP_155080411.1|1567884_1568418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085163.1|1568626_1568887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080413.1|1569329_1570193_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	28.4	1.2e-07
WP_155081513.1|1570301_1570781_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080414.1|1570863_1571442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080415.1|1571666_1572359_+	acid phosphatase	NA	NA	NA	NA	NA
WP_155080416.1|1572397_1573207_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	30.4	1.4e-15
WP_155080417.1|1573212_1574415_-	siderophore biosynthesis PLP-dependent protein	NA	NA	NA	NA	NA
WP_155080418.1|1574445_1576317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080419.1|1576303_1577536_-	MFS transporter	NA	NA	NA	NA	NA
WP_155080420.1|1577520_1579362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080421.1|1579346_1580552_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_155080422.1|1580563_1582753_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_155067253.1|1583320_1583950_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_155067254.1|1583972_1584392_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_155085164.1|1584327_1584789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080423.1|1584788_1585625_+	TonB family protein	NA	NA	NA	NA	NA
WP_155066936.1|1588774_1589125_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|1589156_1589609_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080424.1|1589603_1589942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|1589938_1590825_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	1598701	1703337	3541633	tRNA,transposase,integrase	unidentified_phage(33.33%)	108	1659745:1659804	1695448:1696562
WP_155067265.1|1598701_1599481_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_155067266.1|1599498_1599846_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_155080428.1|1599957_1600230_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	2.5e-12
WP_155081922.1|1600412_1601339_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085165.1|1601598_1602486_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1602641_1603028_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079476.1|1603056_1603443_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1603426_1603984_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081651.1|1603964_1604201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080430.1|1604510_1605029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085166.1|1605173_1605926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080433.1|1606091_1606562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067468.1|1606612_1606759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080434.1|1606932_1609218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080435.1|1609206_1609935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080436.1|1610046_1610679_+	NAAT family transporter	NA	NA	NA	NA	NA
WP_155080437.1|1610714_1610891_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_155080438.1|1610965_1612111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080439.1|1612344_1613658_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	1.0e-50
WP_155085167.1|1614234_1614567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085318.1|1614837_1614981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085168.1|1615161_1615974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080442.1|1616154_1617282_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080443.1|1618006_1619056_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085169.1|1619178_1620489_+	protein kinase	NA	M1I5I0	Acanthocystis_turfacea_Chlorella_virus	37.1	3.4e-06
WP_155079612.1|1620687_1621917_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080445.1|1622189_1623095_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155067454.1|1623324_1623510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080446.1|1623551_1624088_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_155080447.1|1624105_1624462_+	DUF4131 domain-containing protein	NA	NA	NA	NA	NA
WP_155079476.1|1624480_1624867_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1624850_1625408_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081515.1|1625477_1626386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080441.1|1626614_1627463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080440.1|1627733_1628132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079439.1|1628618_1629504_+|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	28.8	1.7e-09
WP_155080448.1|1629528_1630419_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_155067446.1|1630434_1630818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080449.1|1631606_1631867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080372.1|1632032_1633262_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080450.1|1633361_1633616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|1633712_1634942_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080451.1|1635055_1635619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085170.1|1638566_1638950_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080544.1|1638933_1639491_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036771628.1|1639885_1641007_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_155081516.1|1643086_1644208_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_144420790.1|1644304_1644520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068704.1|1644606_1645287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080454.1|1646469_1647444_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.5	3.1e-28
WP_155080408.1|1647588_1648818_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155067334.1|1649133_1649334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080219.1|1649723_1650773_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080455.1|1650864_1651671_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155085171.1|1651767_1652742_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155085172.1|1652891_1653863_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155067337.1|1653844_1654816_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155080459.1|1656332_1658105_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	8.1e-27
WP_155080460.1|1658390_1658573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080461.1|1658622_1659798_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	1.6e-18
1659745:1659804	attL	GATATCGCCCTCCGTCATATGAAGTGCAACACCCAGTAGAGAGTTCACTCCCATAAAGAT	NA	NA	NA	NA
WP_155079445.1|1659842_1660817_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_047927692.1|1660836_1661025_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079445.1|1661147_1662122_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080462.1|1662222_1662453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080463.1|1662457_1663939_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.7	8.4e-70
WP_155080464.1|1663981_1664332_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	39.2	5.8e-14
WP_155079958.1|1664328_1664637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080251.1|1664723_1664870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067341.1|1665086_1665527_-	universal stress family protein	NA	NA	NA	NA	NA
WP_155080465.1|1666179_1666500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1666532_1666919_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1666902_1667460_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1667598_1667949_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|1667980_1668433_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1668882_1669269_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080466.1|1669331_1669538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080467.1|1669546_1670700_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	6.8e-59
WP_155080468.1|1671368_1672157_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155080469.1|1672553_1672937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080470.1|1673048_1673915_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080471.1|1674190_1674568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080472.1|1674626_1675103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080473.1|1675247_1675688_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155067424.1|1675878_1678449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068702.1|1678614_1679376_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_155081517.1|1680843_1682550_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_155080474.1|1682723_1682879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080475.1|1682895_1684023_-	DUF4172 domain-containing protein	NA	D7RWK9	Brochothrix_phage	22.7	1.8e-08
WP_016210843.1|1684109_1684340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068701.1|1684950_1685730_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155080476.1|1686021_1687239_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_155080477.1|1687354_1688233_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155067416.1|1688343_1688661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067415.1|1688654_1688897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080478.1|1689184_1690186_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	5.4e-28
WP_155080479.1|1690755_1691076_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080442.1|1692733_1693861_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080480.1|1694085_1694415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|1694434_1695409_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080481.1|1695453_1695774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|1695701_1696858_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
1695448:1696562	attR	ATCTTTATGGGAGTGAACTCTCTACTGGGTGTTGCACTTCATATGACGGAGGGCGATATCTTGACAGCGATGGTGCGCTACGGAGACGTACGCTTGCCTATCGCTTATGAAGTGATAGAGAAAACCATTCGTTATAGTGACCTTCAAACCAAAAAAGAACGAAGAAAGTCTTCTTTTACAAAAAATGACCTTTTTCTAAAACTTCTGAATGTCGCTATTCGTAACGACTTAAAGTTTGCATATGTGTGTTCTGGTCAAGTCAAACAGGACACCTTCTTGCGAGAATTTTCAAAGTTAACGGGAGACAGGTATTCATTTGCTGTATGAAGCCTGTCATGATTGTAATAACGAATATAAGCTTTTACATCTTCTGCCATAGATTCCCTTGTTAAATGCACAACATTTAGCAACCATTCATTCTTCAAGCTACCAAAAAAACGCTCAACAGGCGCATTATCTAAACACGCACCAACACTACTCATGGAAGCTTCAATTTTGTGTTTTGAAAGCAGTTTTCTATACTTTTTGCTGGTATACTGTGAGCCACGATCACTATGAAAAAGAACACCTTCGCCAGGTTGACGTAAATTAATTGCCATTTCCATAGCACTCATTACTAATGGAGTGGTCATTCTCTTGTTAATTGAACAACCAATGATTTTTCTAGAATATAAATCCATCACAATAGCAAGGTACATCCAGCCTTCATTTGTTCTCAAATAGGTCACATCACCCGCCCAAGCCACATTTGGAGTCGTTGGGTTAAACTGCTGATTAAGTAAATTATCAGCGATTTCGTGGTGATGTTTACGCTTTGTTGTCACTTTATAAGCAATACGCTGCCTAACTTTCAGCCCAAGCTTTCGCATCAAGCTTCTCGCTCGATAGCGCCCAACAGTAACGCCTTCTTCTTGAAGTTTTTTAGCCATCATACGAGATCCCAAGCTTTCACGACTCTGTTTAAATAGCTCTTTGCATCGCCTGTATAGTTGCAGCTCCTCTACTGAGATTACTTTGGCAGGGCGCTCTTGCCAACTATAGAAGGCTGATGTGCTCACCTTCATAATTTTACACATCAAATTAACAGGGCATAAGTCTTTGTTATCTCTAATAAA	NA	NA	NA	NA
WP_155080482.1|1696924_1697476_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080483.1|1697512_1698481_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_155085319.1|1698686_1700099_-	MFS transporter	NA	NA	NA	NA	NA
WP_155067405.1|1700286_1701000_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.5	1.0e-36
WP_155080484.1|1701148_1701658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|1701661_1702548_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085173.1|1702611_1703337_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	1708157	1736390	3541633	transposase	unidentified_phage(42.86%)	30	NA	NA
WP_155079487.1|1708157_1709207_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079655.1|1709516_1710491_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	9.8e-27
WP_155081519.1|1710487_1710913_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1710944_1711295_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085174.1|1711408_1711912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067413.1|1711988_1713290_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_155080489.1|1713458_1714559_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_155079669.1|1714756_1715731_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	7.5e-27
WP_155079478.1|1715891_1716449_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1716432_1716819_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085175.1|1716841_1718194_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_155067398.1|1720129_1721413_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_155085176.1|1721486_1722107_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_155085320.1|1722399_1722843_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066610.1|1722848_1723424_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079588.1|1723369_1723735_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085177.1|1724000_1724639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|1724769_1725744_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079996.1|1725763_1726177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080492.1|1726313_1727276_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080493.1|1727322_1728030_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155067392.1|1728195_1729554_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_155085178.1|1729628_1730192_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155080495.1|1730386_1731616_-	nucleoside:proton symporter	NA	B2YG43	Musca_hytrovirus	22.1	3.4e-08
WP_017376484.1|1731661_1732288_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_155080496.1|1732437_1733625_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.1	4.4e-21
WP_155085179.1|1733635_1734367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080498.1|1734658_1735189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080102.1|1735234_1735687_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_155079586.1|1735814_1736390_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	1762324	1815672	3541633	transposase	unidentified_phage(28.57%)	58	NA	NA
WP_155079445.1|1762324_1763299_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155067370.1|1763497_1765441_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	34.0	1.7e-14
WP_155080507.1|1765486_1766110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080508.1|1766278_1766944_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080208.1|1766889_1767255_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080511.1|1767215_1767383_+	phosphatase	NA	NA	NA	NA	NA
WP_155080512.1|1767992_1769591_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	3.3e-56
WP_155080513.1|1769757_1770942_-	MFS transporter	NA	NA	NA	NA	NA
WP_155081521.1|1771238_1771790_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	26.3	8.4e-07
WP_155080514.1|1772561_1773014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080515.1|1773154_1773484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|1773484_1774042_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080516.1|1774247_1774412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080517.1|1774628_1774976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067364.1|1774960_1775635_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_155085181.1|1776603_1777755_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155085321.1|1777899_1778376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085182.1|1778520_1779369_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155085183.1|1779482_1779653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080518.1|1780042_1781491_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_155085184.1|1781670_1782573_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155068622.1|1782581_1783034_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1783065_1783416_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067361.1|1783668_1783875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080484.1|1784953_1785463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079975.1|1785466_1786042_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079974.1|1785987_1786353_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085173.1|1786416_1787142_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080523.1|1787335_1787665_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_155067359.1|1787695_1788076_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_155067358.1|1788166_1789195_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_155067357.1|1789257_1789722_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_155067356.1|1789742_1790666_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_155067355.1|1790732_1791335_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
WP_155068695.1|1791445_1793440_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_155080524.1|1793801_1795022_+	amino acid permease	NA	NA	NA	NA	NA
WP_155080525.1|1795252_1795615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080338.1|1795580_1795868_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.3	2.2e-06
WP_155085185.1|1795927_1796350_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.6	5.4e-14
WP_155080527.1|1796426_1797401_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	4.1e-25
WP_155085186.1|1797386_1798880_-	IraAB	NA	NA	NA	NA	NA
WP_155081522.1|1799170_1800478_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377177.1|1800729_1801608_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_017377178.1|1801604_1802072_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|1802199_1802385_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_155085187.1|1803531_1804176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|1804330_1804888_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1804871_1805258_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085188.1|1805276_1806200_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1806302_1806689_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080530.1|1806672_1807077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080531.1|1807498_1808113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080532.1|1808824_1810057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080533.1|1810132_1810471_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_032127067.1|1810467_1811070_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1811066_1813061_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_155067343.1|1813124_1814063_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_155079612.1|1814442_1815672_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	1818775	1935561	3541633	tRNA,transposase,protease	Escherichia_phage(11.76%)	113	NA	NA
WP_155080537.1|1818775_1819345_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	38.4	1.4e-28
WP_155080538.1|1819360_1819672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080539.1|1819681_1820650_-	ferrochelatase	NA	NA	NA	NA	NA
WP_155080540.1|1820772_1821126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080541.1|1821129_1822194_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_155080542.1|1822194_1823934_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.0	7.6e-54
WP_155067433.1|1823940_1824363_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_155067434.1|1824346_1824976_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_155067435.1|1825211_1825310_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155080543.1|1825429_1825636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085189.1|1825780_1826131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080546.1|1826160_1826889_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155085190.1|1827540_1827864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080546.1|1827900_1828629_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155079476.1|1830062_1830449_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079881.1|1830432_1830846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|1830911_1831262_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068744.1|1831293_1831746_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085191.1|1832340_1832781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|1832707_1833058_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085192.1|1833719_1834172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085193.1|1834820_1835360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085194.1|1835471_1836182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081525.1|1836624_1837578_-	response regulator	NA	NA	NA	NA	NA
WP_144420684.1|1837746_1837995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080548.1|1838199_1839174_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	4.9e-26
WP_155067333.1|1839284_1839896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067332.1|1840263_1841091_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_155080549.1|1841226_1841691_+	amino acid permease	NA	NA	NA	NA	NA
WP_155080550.1|1841802_1842954_+	amino acid permease	NA	NA	NA	NA	NA
WP_155079478.1|1843116_1843674_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1843657_1844044_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085195.1|1844174_1845416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080553.1|1845502_1845757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080554.1|1846042_1846621_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	35.5	1.3e-05
WP_155079445.1|1846751_1847726_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155081739.1|1847970_1848705_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155079478.1|1849237_1849795_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1849778_1850165_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085196.1|1850234_1851091_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080560.1|1851158_1851467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080561.1|1851611_1851911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080562.1|1851914_1852100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376830.1|1852395_1852710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080563.1|1854748_1854943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080564.1|1855039_1855846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|1855907_1856258_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|1856289_1856742_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080565.1|1856786_1857185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067327.1|1859160_1860150_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_155067326.1|1860486_1860672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|1861035_1862265_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155067325.1|1862575_1864531_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_155080566.1|1864694_1864919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079586.1|1864915_1865491_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079588.1|1865436_1865802_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080567.1|1865863_1866883_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155068678.1|1867121_1867241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1867925_1868312_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1868295_1868853_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085197.1|1868853_1869429_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155080569.1|1869471_1869936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1869919_1870306_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079826.1|1870548_1871434_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080570.1|1871431_1872514_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080571.1|1872517_1873042_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.5	5.3e-19
WP_155079826.1|1873287_1874173_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080573.1|1875063_1876425_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155067322.1|1876783_1877245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378301.1|1877414_1878212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067321.1|1878680_1880486_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_155085198.1|1881743_1881959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085199.1|1882103_1883081_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1885248_1885635_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1885618_1886176_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017377201.1|1888403_1888874_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_155080574.1|1889417_1890185_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080042.1|1890246_1890597_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1890840_1891191_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|1891222_1891675_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079906.1|1892158_1892431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080575.1|1893713_1895201_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_155080576.1|1895262_1896720_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_155067314.1|1896825_1897221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080577.1|1897248_1897827_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	34.7	1.5e-14
WP_155066936.1|1898564_1898915_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|1898946_1899399_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080578.1|1899978_1900545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080579.1|1900948_1901725_+	methyltransferase domain-containing protein	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	1.5e-14
WP_155081527.1|1901870_1902251_-	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
WP_155079478.1|1902753_1903311_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079731.1|1903294_1903543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079730.1|1903807_1903969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|1905596_1906049_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080581.1|1906080_1906335_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080582.1|1906356_1906563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080583.1|1906876_1907101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080584.1|1907200_1908430_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155085200.1|1909080_1910226_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_155080586.1|1910249_1911845_-	cytochrome bd-I ubiquinol oxidase subunit CydA	NA	NA	NA	NA	NA
WP_155067298.1|1919182_1919683_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_155080591.1|1920894_1922088_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155067296.1|1923342_1923825_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_155067295.1|1923983_1925249_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_155080589.1|1925340_1926600_+	phosphoesterase	NA	NA	NA	NA	NA
WP_155068686.1|1926672_1926945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080590.1|1927228_1928491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080591.1|1928647_1929841_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080592.1|1929931_1930177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080593.1|1930627_1931677_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.1	1.0e-29
WP_155067289.1|1931847_1932621_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	1.5e-65
WP_155080594.1|1932681_1934271_-	amino acid permease	NA	NA	NA	NA	NA
WP_155080595.1|1934469_1935561_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 24
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	1943172	2000310	3541633	tRNA,transposase	unidentified_phage(13.33%)	52	NA	NA
WP_155079741.1|1943172_1944147_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155080600.1|1944223_1944544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080686.1|1944489_1945065_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085201.1|1945054_1945888_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155080161.1|1947004_1947220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|1947276_1947642_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080603.1|1947703_1948009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080604.1|1949613_1950807_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080605.1|1951320_1952175_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_155085202.1|1952204_1953032_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155080607.1|1953287_1954094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067541.1|1954218_1955217_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080608.1|1955153_1955291_+	phosphatase	NA	NA	NA	NA	NA
WP_155079868.1|1955679_1956836_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155067466.1|1958087_1958912_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	8.1e-06
WP_155080609.1|1958967_1960356_-	protein kinase	NA	NA	NA	NA	NA
WP_155080610.1|1961869_1962571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1962645_1962825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080611.1|1962886_1963243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080612.1|1963320_1964064_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_155080613.1|1964077_1965121_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_155080614.1|1965253_1967026_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	39.5	6.4e-08
WP_155068706.1|1967232_1968366_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	1.6e-15
WP_155081528.1|1968915_1971735_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.1	5.2e-312
WP_155080615.1|1972108_1972837_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_155080616.1|1972951_1973215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080442.1|1974222_1975350_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080618.1|1975420_1975987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079906.1|1976010_1976283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080620.1|1976586_1976841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079888.1|1976816_1976963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079887.1|1976937_1977480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085203.1|1977494_1977842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080623.1|1977928_1979080_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.0	5.2e-27
WP_155081529.1|1979224_1979611_-	hypothetical protein	NA	S5VLC8	Leptospira_phage	37.2	2.1e-09
WP_155079959.1|1979740_1980091_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.2	7.6e-14
WP_155079958.1|1980087_1980396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080624.1|1980776_1981337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|1981356_1982331_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080625.1|1982375_1982933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080626.1|1982916_1983891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080627.1|1984310_1985696_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.8	3.4e-49
WP_155080628.1|1985702_1987241_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155067482.1|1987283_1988009_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_155080629.1|1988218_1989445_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	26.9	4.4e-32
WP_155067484.1|1989648_1990470_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155080630.1|1990519_1991329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085322.1|1992976_1996879_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	6.1e-51
WP_155067487.1|1997044_1997920_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155085204.1|1998065_1998449_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066404.1|1998484_1999370_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080634.1|1999566_2000310_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.9	2.2e-18
>prophage 25
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	2004001	2065996	3541633	tRNA,transposase	Bacillus_thuringiensis_phage(25.0%)	59	NA	NA
WP_155079487.1|2004001_2005051_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067494.1|2005075_2006074_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.2e-34
WP_155067495.1|2006209_2006557_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_155067496.1|2006553_2007156_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_155080639.1|2007243_2008764_+	NOL1/NOP2/sun family putative RNA methylase	NA	NA	NA	NA	NA
WP_155080640.1|2008832_2009297_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_155085205.1|2009573_2009987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080642.1|2010352_2010592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|2010586_2011039_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2011070_2011421_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080643.1|2011490_2012189_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067468.1|2013418_2013565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080647.1|2014096_2014270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080648.1|2014266_2017323_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_155080649.1|2017404_2018853_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155080650.1|2019285_2020290_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_155067505.1|2020412_2020811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080651.1|2020850_2022674_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_155085206.1|2022670_2025973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080653.1|2026003_2026918_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_155080654.1|2026992_2027622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067510.1|2027666_2028101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081532.1|2028081_2028822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080655.1|2030417_2030588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080656.1|2030547_2030817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080657.1|2030862_2031078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085207.1|2031021_2031336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|2031363_2032520_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080659.1|2032570_2033371_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080660.1|2033385_2034324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080661.1|2034339_2034507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080662.1|2034570_2034717_+	phosphatase	NA	NA	NA	NA	NA
WP_155080663.1|2035045_2036161_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080664.1|2037348_2037507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068709.1|2039054_2039129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2039184_2039571_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2039554_2040112_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080668.1|2041353_2042322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080669.1|2045082_2048181_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_155067532.1|2048198_2049251_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155080670.1|2050259_2050643_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2050623_2051181_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2051164_2051551_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085208.1|2052788_2052980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377969.1|2053026_2053266_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_155067536.1|2053587_2053932_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_155067537.1|2054021_2054606_-	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_155067538.1|2054741_2055428_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.5	1.6e-28
WP_155067539.1|2055551_2056736_-	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
WP_155085323.1|2056951_2058394_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X9I5H2	Streptococcus_phage	24.2	5.9e-20
WP_155067540.1|2058530_2059481_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155080673.1|2059579_2060353_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_155068622.1|2061709_2062162_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2062193_2062544_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079881.1|2062609_2063023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2063006_2063393_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080674.1|2063496_2064855_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_155080675.1|2064776_2064965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|2065438_2065996_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	2077135	2192917	3541633	tRNA,transposase	unidentified_phage(21.05%)	106	NA	NA
WP_155080683.1|2077135_2077927_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.2	2.2e-24
WP_155079445.1|2078106_2079081_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080684.1|2079077_2079635_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079974.1|2079580_2079946_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080685.1|2079981_2080209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080383.1|2080232_2081207_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.7	4.4e-27
WP_155079974.1|2081681_2082047_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080686.1|2081992_2082568_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080687.1|2082531_2083500_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211833.1|2083587_2084088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|2084670_2085024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080688.1|2085324_2087052_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_155067546.1|2087155_2087881_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.2	2.9e-31
WP_155067547.1|2087873_2089112_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155080689.1|2089249_2090287_+	agmatine deiminase	NA	M1H3B1	Paramecium_bursaria_Chlorella_virus	29.1	8.3e-40
WP_155067549.1|2090340_2091243_+	acyltransferase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	41.0	7.2e-56
WP_155080690.1|2091352_2092606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080691.1|2092663_2096155_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_155067552.1|2096214_2096943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080692.1|2097070_2097619_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_155080693.1|2097833_2098487_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.9	1.0e-35
WP_016211467.1|2098539_2099106_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_155067560.1|2099108_2100233_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_155068712.1|2100317_2101130_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_155080694.1|2101260_2103240_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_155080442.1|2103575_2104703_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080695.1|2105716_2106169_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155067563.1|2106285_2107758_-	catalase	NA	A0A2K9L572	Tupanvirus	46.6	3.8e-99
WP_016211840.1|2107909_2108374_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_155079476.1|2108714_2109101_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080696.1|2109162_2109474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080697.1|2109618_2109930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|2110147_2111122_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080698.1|2111181_2112135_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080383.1|2112817_2113792_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.7	4.4e-27
WP_155067544.1|2113835_2114999_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.0	2.2e-25
WP_155080382.1|2115115_2116387_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	2.5e-14
WP_155067568.1|2116475_2116946_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_155068713.1|2116968_2117562_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	31.4	8.1e-16
WP_155080381.1|2117699_2118761_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_155080380.1|2118784_2119708_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_155067571.1|2119724_2120186_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_155081512.1|2120292_2121111_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_155080379.1|2121238_2122102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067577.1|2122172_2122649_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_155085209.1|2123183_2125892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080377.1|2125988_2126918_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_155080376.1|2126924_2128847_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.4	9.2e-85
WP_155081511.1|2128911_2130186_-	endonuclease/exonuclease/phosphatase	NA	NA	NA	NA	NA
WP_155080375.1|2130595_2131267_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_155080374.1|2131275_2132127_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_155080373.1|2132304_2133603_+	PAS domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_155067584.1|2133750_2135097_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_155080182.1|2135790_2136186_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080372.1|2136285_2137515_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155067991.1|2137740_2138157_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080371.1|2138151_2139033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080370.1|2139275_2139956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080369.1|2141320_2141734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085210.1|2142090_2143368_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_017378241.1|2143364_2143541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080367.1|2144011_2145613_+	cytochrome bd-I ubiquinol oxidase subunit CydA	NA	NA	NA	NA	NA
WP_155067596.1|2145629_2146772_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_155080366.1|2147024_2147762_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_155067602.1|2147786_2149058_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_155080365.1|2149441_2152270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080364.1|2152328_2154068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122942954.1|2154620_2154854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081510.1|2155054_2155675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067605.1|2155641_2156607_-	PAP2 family protein	NA	NA	NA	NA	NA
WP_155067606.1|2156597_2157008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067607.1|2157014_2157350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080363.1|2157350_2157971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080362.1|2158206_2159040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080361.1|2159076_2162190_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_155067611.1|2162219_2163014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080360.1|2163018_2166009_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016209975.1|2166014_2166446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067613.1|2166496_2167063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067614.1|2167062_2168106_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_155068719.1|2168111_2168615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067615.1|2168639_2170946_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_016209962.1|2170992_2171232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081509.1|2171233_2172361_-	ATPase	NA	NA	NA	NA	NA
WP_155067616.1|2172360_2173113_-	type IV secretion system protein DotC	NA	NA	NA	NA	NA
WP_155067617.1|2173105_2173612_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_155067618.1|2173636_2174044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067619.1|2174071_2175097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067620.1|2175137_2176043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080359.1|2176049_2177243_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_155080358.1|2177239_2178166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080357.1|2179148_2179862_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	40.0	1.3e-39
WP_017378274.1|2179937_2180216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080356.1|2180245_2181136_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_155080355.1|2181220_2181694_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_155067624.1|2181838_2182360_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155080354.1|2182400_2183195_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_155067626.1|2183197_2183446_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079826.1|2183708_2184595_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085211.1|2184630_2185245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079864.1|2185354_2186511_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.4e-50
WP_155080352.1|2186564_2187644_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081508.1|2187793_2188282_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080351.1|2189197_2189944_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155080350.1|2191022_2191799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080349.1|2191813_2192917_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	2205118	2274625	3541633	tRNA,transposase,integrase	uncultured_Mediterranean_phage(26.67%)	57	2204972:2205031	2209896:2209993
2204972:2205031	attL	TGAAATGACCCCCTTCCTTCCGACAAAAAGGAACCTCAATTAAGAAATTATTTTTGCCTC	NA	NA	NA	NA
WP_155085212.1|2205118_2206111_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.0	2.5e-25
WP_155080338.1|2206174_2206462_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.3	2.2e-06
WP_155080337.1|2206521_2207127_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.2	5.2e-26
WP_155080336.1|2207271_2207595_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	45.6	9.8e-16
WP_155081465.1|2207589_2208042_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2208073_2208424_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085213.1|2208544_2208766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080334.1|2209929_2210589_+	hypothetical protein	NA	NA	NA	NA	NA
2209896:2209993	attR	GAGGCAAAAATAATTTCTTAATTGAGGTTCCTTTTTGTCGGAAGGAAGGGGGTCATTTCAGGCTTTCAAAGTACAGGTTATGAAAAAAACATTCAAAA	NA	NA	NA	NA
WP_155080333.1|2210626_2214472_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_122942662.1|2214670_2215804_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_155080332.1|2215817_2216006_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_155081506.1|2216205_2217588_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	1.9e-39
WP_155080331.1|2217727_2218618_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155080330.1|2219986_2220742_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_155067656.1|2220809_2222084_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.5	8.8e-92
WP_155067657.1|2222204_2222882_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_155080329.1|2223072_2224497_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.9	3.5e-41
WP_016209938.1|2224471_2225110_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_155085124.1|2225342_2226326_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155085123.1|2226596_2226860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067659.1|2227341_2228286_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	34.8	5.4e-38
WP_155067660.1|2228307_2230176_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_064004815.1|2230196_2230550_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_026063528.1|2230588_2231704_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_155080328.1|2231898_2232939_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_027242800.1|2232941_2233976_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_155067662.1|2233972_2235034_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_155080327.1|2235145_2236618_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	1.8e-43
WP_017376400.1|2236770_2237214_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_155080326.1|2237284_2240056_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.1	1.3e-148
WP_155080325.1|2240212_2241442_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_155080324.1|2241468_2242131_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_155085214.1|2242624_2243503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2243499_2243886_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2243869_2244427_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085215.1|2244437_2244812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080323.1|2244925_2245825_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.1e-23
WP_155080322.1|2247468_2250144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080321.1|2250180_2251230_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066278.1|2253629_2254679_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080319.1|2255290_2255572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080318.1|2255930_2257691_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_155080317.1|2257784_2258450_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_155080316.1|2258462_2259968_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	4.5e-87
WP_155085216.1|2259989_2260520_-	colicin V production family protein	NA	NA	NA	NA	NA
WP_155080315.1|2260593_2261856_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_155085217.1|2262042_2262915_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_155081505.1|2263016_2263799_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_155067681.1|2263889_2265215_-	fimbrial protein FimV	NA	NA	NA	NA	NA
WP_155080313.1|2265583_2266759_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_155080312.1|2266927_2267581_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_155067684.1|2267718_2269659_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	2.1e-73
WP_155079476.1|2270004_2270391_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2270374_2270932_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085218.1|2271336_2271483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085219.1|2271533_2272370_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079612.1|2273395_2274625_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	2280443	2332771	3541633	transposase	unidentified_phage(18.18%)	55	NA	NA
WP_155066936.1|2280443_2280794_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2280825_2281278_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080304.1|2281322_2281490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080303.1|2281435_2282011_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080302.1|2282264_2285195_-	peptidase M16	NA	NA	NA	NA	NA
WP_155080301.1|2285338_2287285_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.8	4.7e-44
WP_155080300.1|2287478_2288126_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155080299.1|2288148_2289474_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_155080298.1|2289503_2290001_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_155079741.1|2290038_2291013_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155085221.1|2291519_2292065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2292061_2292448_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2292431_2292989_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085222.1|2293068_2293839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080296.1|2294192_2295068_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155080295.1|2295124_2295541_-	response regulator	NA	NA	NA	NA	NA
WP_155080294.1|2295982_2296471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080293.1|2296579_2297548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080292.1|2298248_2301551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079958.1|2301691_2302000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079959.1|2301996_2302347_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.2	7.6e-14
WP_155080291.1|2302389_2303037_+|transposase	transposase	transposase	S5VLC8	Leptospira_phage	41.2	2.7e-33
WP_155080290.1|2303307_2303697_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080289.1|2303801_2304020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080288.1|2303994_2304369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2304352_2304739_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085223.1|2304735_2305659_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.9	1.5e-24
WP_155080286.1|2305703_2306234_+|transposase	transposase	transposase	S5VTP8	Leptospira_phage	37.1	2.7e-23
WP_155081465.1|2306228_2306681_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2306712_2307063_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081107.1|2308045_2308285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066739.1|2308211_2308562_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080285.1|2309540_2311454_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	2.6e-116
WP_155067703.1|2311502_2312150_-	methyltransferase	NA	W8CYT3	Bacillus_phage	31.5	3.6e-09
WP_155067704.1|2312285_2313410_-	hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_155067705.1|2313406_2314003_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209821.1|2314033_2314366_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_155080284.1|2314455_2316279_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	1.3e-43
WP_155068727.1|2316754_2318017_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	9.2e-25
WP_155080283.1|2318783_2319323_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_155067708.1|2319668_2320085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080282.1|2320180_2320996_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_155068728.1|2321128_2322622_+	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_155067710.1|2322807_2323230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081504.1|2323229_2325290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080281.1|2325573_2326389_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|2326489_2327308_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_155067713.1|2327304_2327673_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_155067714.1|2328025_2328175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|2328754_2329207_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2329238_2329589_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080280.1|2329643_2330042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|2330792_2331245_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085224.1|2331249_2331489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085225.1|2331796_2332771_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	2335939	2380565	3541633	transposase	unidentified_phage(37.5%)	45	NA	NA
WP_155079478.1|2335939_2336497_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2336480_2336867_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080274.1|2337959_2338244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081503.1|2338416_2338944_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_155080273.1|2339182_2339395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080272.1|2340282_2341257_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.1	8.3e-26
WP_155079445.1|2341316_2342291_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080271.1|2342314_2343277_+	hypothetical protein	NA	A0A160DHD3	Gordonia_phage	26.5	8.0e-13
WP_155080270.1|2344063_2345311_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155080269.1|2346367_2346850_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_155080268.1|2346846_2347659_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080267.1|2347714_2347870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080266.1|2347969_2349199_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080265.1|2349339_2349495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|2349560_2349911_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2349942_2350395_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079959.1|2350467_2350818_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.2	7.6e-14
WP_155080263.1|2350860_2351601_+|transposase	transposase	transposase	S5VLC8	Leptospira_phage	42.2	4.0e-36
WP_155080262.1|2351745_2352630_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.0	4.0e-27
WP_155080261.1|2352608_2352905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080260.1|2352992_2353286_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_155080259.1|2353292_2354705_+	bifunctional enoyl-CoA hydratase/phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_155085226.1|2354664_2355918_+	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_155080257.1|2356735_2356915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080256.1|2358920_2359478_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080255.1|2359608_2360865_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_155067720.1|2361139_2361802_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_155080254.1|2361791_2363030_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	1.2e-93
WP_155080253.1|2363142_2364924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080252.1|2365077_2366229_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155066610.1|2366232_2366808_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080208.1|2366753_2367119_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080251.1|2367251_2367398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080250.1|2367580_2368000_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080249.1|2368084_2368249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080248.1|2368891_2369974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|2369990_2371040_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080247.1|2371082_2371430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|2371913_2372888_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155085227.1|2372988_2374572_+	amino acid permease	NA	NA	NA	NA	NA
WP_155080245.1|2374647_2375847_-	enoyl-[acyl-carrier-protein] reductase FabV	NA	NA	NA	NA	NA
WP_155067726.1|2376100_2376394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067727.1|2376446_2378459_-	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_155080244.1|2378513_2379473_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_155066278.1|2379515_2380565_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	2392729	2566381	3541633	tRNA,transposase,integrase	unidentified_phage(23.08%)	175	2496518:2496577	2529911:2530149
WP_155079826.1|2392729_2393615_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210285.1|2393638_2395834_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242992.1|2395909_2396593_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_027242993.1|2396603_2397035_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_155067737.1|2397080_2397479_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_155080238.1|2397844_2398552_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_155067739.1|2398616_2398919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080237.1|2398974_2399451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242998.1|2399502_2400024_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_155080236.1|2400105_2401200_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_155080235.1|2401747_2402401_+	hypothetical protein	NA	R4ZFK6	Choristoneura_rosaceana_entomopoxvirus	27.2	1.5e-07
WP_155080234.1|2402534_2403251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067746.1|2403387_2404635_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	70.4	2.5e-14
WP_155067747.1|2405015_2405627_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_155080233.1|2405709_2406576_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2406579_2407341_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_155080232.1|2407494_2408400_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_155080231.1|2408432_2408681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079958.1|2408736_2409045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080230.1|2409041_2409272_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.4	3.5e-07
WP_155085229.1|2409314_2409656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2409652_2410039_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2410022_2410580_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080228.1|2410587_2410821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|2410882_2411233_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2411264_2411717_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085230.1|2411758_2412370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080226.1|2412386_2412545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080225.1|2412587_2413217_+|transposase	transposase	transposase	S5VLC8	Leptospira_phage	41.1	5.9e-33
WP_155079476.1|2413213_2413600_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2413583_2414141_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080224.1|2414148_2415027_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	35.8	1.5e-26
WP_155079487.1|2415125_2416175_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080223.1|2416189_2417020_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067750.1|2417307_2418123_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_155067751.1|2418308_2418698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080222.1|2418833_2420411_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.3	3.7e-15
WP_155079476.1|2420883_2421270_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2421253_2421811_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080221.1|2421900_2422983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080220.1|2423025_2423580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080219.1|2423622_2424672_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085231.1|2424688_2424847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085232.1|2424865_2425222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080217.1|2425334_2426439_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.9e-50
WP_155080216.1|2426521_2427604_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.7	3.8e-144
WP_155080215.1|2428093_2429068_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.1	1.3e-26
WP_155080214.1|2429127_2429388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080161.1|2429484_2429700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079974.1|2429756_2430122_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155067136.1|2430239_2430590_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081502.1|2430621_2431074_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080213.1|2431078_2432560_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_155080212.1|2432647_2432947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|2432997_2434153_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080211.1|2434150_2434339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080210.1|2434313_2434634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085325.1|2434767_2435001_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085233.1|2435145_2435373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|2435356_2435914_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080209.1|2435910_2436102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080208.1|2436429_2436795_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079883.1|2436740_2437316_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080207.1|2437312_2437792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067762.1|2437970_2438933_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_155080206.1|2439102_2440098_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_155080205.1|2441263_2441410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080204.1|2441683_2442067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085234.1|2442470_2443037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|2443116_2443674_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2443657_2444044_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085235.1|2444241_2444748_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079741.1|2444869_2445844_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155085236.1|2445863_2446235_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080202.1|2446195_2446363_+	phosphatase	NA	NA	NA	NA	NA
WP_155080201.1|2446858_2447902_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_155080200.1|2447914_2449453_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_155085237.1|2449462_2450746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|2451203_2451554_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081492.1|2451585_2451975_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080019.1|2451901_2452087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080198.1|2452834_2452987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080197.1|2453471_2454539_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080196.1|2454963_2455401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067770.1|2457958_2458231_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_155066370.1|2458451_2458733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080195.1|2460449_2461742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080194.1|2461977_2464731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080193.1|2464948_2465176_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	45.5	3.1e-08
WP_155067557.1|2465248_2465482_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080192.1|2466697_2467483_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.2	1.2e-14
WP_155080191.1|2467812_2468280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080190.1|2468280_2468982_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080189.1|2469243_2469450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067781.1|2469679_2469985_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_155080188.1|2470163_2472161_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_155080187.1|2472144_2473191_-	glutathione synthase	NA	NA	NA	NA	NA
WP_155067783.1|2473612_2474464_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.1e-12
WP_155080186.1|2474464_2475385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080185.1|2477313_2477715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067789.1|2478672_2479203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080184.1|2479434_2480364_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	4.8e-31
WP_144420711.1|2480520_2480946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080183.1|2481029_2481173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080182.1|2481292_2481688_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079612.1|2481787_2483017_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081500.1|2483539_2483764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080161.1|2483920_2484136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2484258_2485164_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155080181.1|2485168_2485561_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080180.1|2485757_2486147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085238.1|2486266_2486611_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080179.1|2487870_2488923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080178.1|2489367_2490219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080177.1|2490076_2490610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|2490846_2491404_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2491387_2491774_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079836.1|2492395_2492602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2492967_2493354_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2493337_2493895_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080176.1|2494804_2496292_-	sodium/solute symporter	NA	NA	NA	NA	NA
2496518:2496577	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_155085239.1|2496757_2497123_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155066278.1|2497164_2498214_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080174.1|2498228_2498771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|2498944_2499994_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2500047_2500500_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2500531_2500882_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080173.1|2500956_2501541_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155079669.1|2501740_2502715_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	7.5e-27
WP_155068847.1|2502815_2504270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068846.1|2504279_2504441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080171.1|2504504_2505080_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067098.1|2505025_2505346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079741.1|2505479_2506454_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155080170.1|2506959_2507619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|2507762_2508812_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080169.1|2508918_2509101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080168.1|2509840_2510569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080167.1|2510905_2511634_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	1.5e-43
WP_155085240.1|2511636_2513400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080164.1|2513586_2514561_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_155066852.1|2515178_2515592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|2516856_2517831_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080163.1|2518507_2519017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080162.1|2520242_2521580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066848.1|2521744_2522284_+	superoxide dismutase	NA	Q9MC02	Salmonella_phage	53.8	2.4e-35
WP_155085241.1|2522636_2522852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079974.1|2522908_2523274_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085242.1|2523486_2524461_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.7	3.4e-27
WP_155080160.1|2524658_2525885_-	MFS transporter	NA	NA	NA	NA	NA
WP_155080159.1|2526473_2528114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079724.1|2528263_2529445_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080158.1|2530175_2531339_-	MFS transporter	NA	NA	NA	NA	NA
2529911:2530149	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAATCCTCGGCTGTCCGCGTCACACAGCGTTACGTGCCTTGAATCGGCACACTCCACTACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGCCTTTCGCAACTCCGCTCTGCTAAAAACCCGAA	NA	NA	NA	NA
WP_155080157.1|2531585_2534276_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_155080156.1|2534567_2535416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085243.1|2535771_2536722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085244.1|2537264_2538968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080153.1|2539538_2541068_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.5e-85
WP_155080152.1|2541391_2542837_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_155080151.1|2542811_2543771_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_155080150.1|2543848_2547355_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.5	1.4e-192
WP_155080149.1|2547378_2547948_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	42.9	3.4e-27
WP_155080148.1|2548162_2549317_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_016209377.1|2549335_2550109_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|2550108_2550555_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_155066832.1|2550572_2551622_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_155066831.1|2551670_2552207_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_155080147.1|2552293_2554693_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_155080146.1|2554980_2556048_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_155080144.1|2558250_2559315_+	GHMP kinase	NA	NA	NA	NA	NA
WP_155080143.1|2559304_2560333_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_155066825.1|2560329_2560869_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_155080142.1|2561410_2563363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080141.1|2563839_2565099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080140.1|2565163_2566381_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	2579753	2747888	3541633	tRNA,transposase,integrase,plate	unidentified_phage(15.62%)	172	2682152:2682211	2690078:2690728
WP_155080132.1|2579753_2580377_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.3	4.2e-23
WP_155079413.1|2581329_2582499_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080122.1|2583007_2584540_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_155066809.1|2584572_2585412_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155066808.1|2585408_2585906_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_155066807.1|2585908_2586901_-	AAA family ATPase	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211408.1|2587015_2588362_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_155080121.1|2588570_2589716_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	1.9e-61
WP_155080120.1|2590070_2590502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|2590487_2591462_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080119.1|2597213_2598071_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_155080118.1|2598057_2598987_-	ATPase	NA	NA	NA	NA	NA
WP_155080117.1|2599183_2600575_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_155080116.1|2600621_2601665_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	27.6	2.4e-18
WP_155067954.1|2601707_2602148_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_155080115.1|2602279_2603470_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_155080114.1|2603499_2603865_-	response regulator	NA	NA	NA	NA	NA
WP_155081499.1|2604221_2605139_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_155080113.1|2605256_2605400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|2605547_2606522_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080112.1|2606566_2606740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080111.1|2606714_2607257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067967.1|2607374_2608025_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.7	1.1e-21
WP_155067968.1|2608039_2609080_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	7.7e-70
WP_155080110.1|2609202_2610288_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_155080109.1|2610314_2611424_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_155067972.1|2611488_2611806_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_155067973.1|2611802_2612162_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_155080108.1|2612275_2613325_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067975.1|2613412_2615866_-	kinase	NA	NA	NA	NA	NA
WP_155080107.1|2616732_2617128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080106.1|2616995_2617967_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155068903.1|2619141_2619339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080105.1|2619474_2620044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085245.1|2620459_2620879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2620875_2621262_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2621245_2621803_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085246.1|2621876_2622467_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080103.1|2623187_2623703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080102.1|2623759_2624212_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_155085247.1|2624250_2624757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|2624775_2625333_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2625316_2625703_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155068752.1|2625954_2627211_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_155080101.1|2627199_2628081_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_017377906.1|2628073_2629159_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_155080100.1|2629155_2630415_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377908.1|2630583_2631243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068753.1|2631416_2632079_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_155067986.1|2632425_2633373_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	2.6e-40
WP_155080099.1|2633470_2634097_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_155080098.1|2634102_2634684_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_155080097.1|2634755_2635847_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_155080096.1|2635936_2636650_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_155081465.1|2636922_2637375_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2637406_2637757_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080243.1|2638070_2638613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080094.1|2638588_2638867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079887.1|2638841_2639384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081498.1|2640126_2640915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080093.1|2641293_2641509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080092.1|2642946_2643657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080091.1|2643653_2644304_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	50.3	1.5e-47
WP_155080090.1|2644390_2644801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080089.1|2645458_2646508_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080088.1|2647169_2647559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066440.1|2647769_2648744_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155080087.1|2648819_2649670_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2649950_2650403_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2650434_2650785_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080086.1|2651322_2652768_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.0	4.5e-60
WP_155067997.1|2652961_2654431_-	aminotransferase class V-fold PLP-dependent enzyme	NA	M4QFZ1	Prochlorococcus_phage	41.7	3.5e-84
WP_155080085.1|2654424_2655801_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.5	3.5e-46
WP_017377930.1|2655813_2656206_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_017377931.1|2656202_2657306_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_155080084.1|2657462_2658758_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377933.1|2658765_2659713_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_155080083.1|2659724_2660543_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155068002.1|2660545_2661325_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155080082.1|2661339_2662398_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_155080081.1|2662394_2663405_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_155080080.1|2663411_2663609_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_155080079.1|2663669_2666582_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_155080078.1|2666623_2667475_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_155080077.1|2667557_2668118_-	chorismate lyase	NA	NA	NA	NA	NA
WP_155080076.1|2668728_2669271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079888.1|2669246_2669393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085248.1|2669367_2669637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085249.1|2669841_2670198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|2671014_2672244_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080074.1|2672608_2673115_+	chagasin	NA	NA	NA	NA	NA
WP_155080073.1|2673161_2676113_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_155068012.1|2676148_2676481_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	35.4	2.8e-05
WP_155085250.1|2676599_2677103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080071.1|2677485_2678638_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	2.6e-58
WP_155079476.1|2678806_2679193_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085251.1|2679274_2679832_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2679815_2680202_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080070.1|2680161_2680692_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080069.1|2680913_2681390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080068.1|2681393_2681876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080067.1|2682034_2682181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080066.1|2682146_2682731_-	hypothetical protein	NA	NA	NA	NA	NA
2682152:2682211	attL	TGATTCCCATGATAAATTTCTTTCCAACATTGTGGATATAGCTCATATTTGATTGACTGC	NA	NA	NA	NA
WP_155080065.1|2682962_2683157_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079612.1|2683256_2684486_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080064.1|2684626_2684830_+	phosphatase	NA	NA	NA	NA	NA
WP_155085252.1|2684971_2685136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080062.1|2685200_2685368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080061.1|2685334_2685802_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6H9S3	Enterobacteria_phage	30.9	7.3e-12
WP_155068017.1|2686010_2686721_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	1.3e-31
WP_155080060.1|2686717_2687752_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_155085253.1|2687855_2688539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|2689557_2690607_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080372.1|2690645_2691875_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
2690078:2690728	attR	GCAGTCAATCAAATATGAGCTATATCCACAATGTTGGAAAGAAATTTATCATGGGAATCAAAAGTAATCGATGTGTCGCACTGACTGAAAAAGATAAAGAGAATGGTAAGTATCAACAACTAAAGCAAATATCATTAGAAGACGGCATTCCTCAGACTGTGTACTTAAAAGGTATGGCTTTCAAAGTACAGGTTATGAAAAAAACATTCAAAAACGAAAATGGTAAGGAAAGTGTCTTATATCTAGTAACTAATGACTTGAGTATTGATGGCCAACCCATCCTGGATACCTATAAAAAACGCTGGAGTATTGAGGAATTTCACAAGTCAGTAAAACAAAATTCGAGCTTTGAAAAGTCGCCTACGCGGATTGTCACATCTCAGTTGAACCATATTTATTACAGTATTCTTGGGTTTTGCAGATTGGAAAGATTAAAATTGAAAAAATCTTTAAACCATTTTGCAATAAAATATAAGCTGATATTAAGGGCTAATCAAATTGCACTTCAGGAGCTTAGAAGTATGGCTTAAAGGTTAAGCGCGTAACATGAGATGGTAATTTGTTCTCAATGGTGATCCAGCGGCAGAAAGATGAAACCTATCAAATTCAATTCACACTGAAGCACGTACTTCAATATCGAAGTGCTTGGTG	NA	NA	NA	NA
WP_155080058.1|2692320_2692596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|2693333_2694308_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155085254.1|2694414_2694888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085255.1|2695032_2695347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085256.1|2695527_2696142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|2696156_2697206_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079487.1|2697476_2698526_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079620.1|2698802_2699777_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155085257.1|2699853_2700255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080055.1|2701737_2703204_-	protein kinase	NA	NA	NA	NA	NA
WP_155080054.1|2703513_2704449_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	1.7e-23
WP_155081496.1|2705853_2706474_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	1.2e-38
WP_155080053.1|2706610_2707663_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_155068023.1|2707659_2708508_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_155080052.1|2708539_2709763_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210413.1|2709828_2710071_-	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_155068025.1|2710159_2710897_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_155068026.1|2710924_2711869_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_155080051.1|2711924_2712875_-	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_155068028.1|2712881_2713931_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210404.1|2714010_2714184_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_155068029.1|2714201_2714732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080050.1|2714972_2715614_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_155080049.1|2715771_2717601_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_155068033.1|2717768_2718641_+	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_155080048.1|2718632_2720798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080047.1|2721066_2721414_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155068036.1|2721423_2722107_-	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	1.7e-46
WP_155068037.1|2722157_2723048_-	OmpA family protein	NA	NA	NA	NA	NA
WP_027242847.1|2723109_2723868_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_155080046.1|2723870_2725139_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_017376373.1|2725213_2725465_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_155068039.1|2725498_2725846_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_155068040.1|2725849_2726503_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209535.1|2726525_2726990_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_155068041.1|2726986_2727754_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_155068042.1|2727757_2728558_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_155068043.1|2728697_2729678_+	KpsF/GutQ family sugar-phosphate isomerase	NA	E3T535	Cafeteria_roenbergensis_virus	25.0	2.8e-13
WP_155080045.1|2729683_2730241_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_155081495.1|2730272_2730800_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209538.1|2730796_2731528_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_155068045.1|2731683_2733072_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209537.1|2733096_2733408_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_155080044.1|2733760_2734615_+	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_155068046.1|2734615_2735218_-	signal peptidase I	NA	NA	NA	NA	NA
WP_155080043.1|2735293_2736139_-	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.8	5.2e-16
WP_155068048.1|2736286_2736931_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_155068049.1|2736947_2737334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|2737553_2738486_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_155068051.1|2738590_2739106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068052.1|2739148_2740105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|2740891_2741344_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2741375_2741726_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080042.1|2741969_2742320_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068054.1|2743867_2744266_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_155068055.1|2745744_2746233_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_155080041.1|2746225_2746483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080040.1|2746658_2747888_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	2755427	2813133	3541633	tRNA,plate,transposase	Acinetobacter_phage(50.0%)	56	NA	NA
WP_155080035.1|2755427_2756735_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_155079612.1|2756882_2758112_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081494.1|2758257_2758899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080034.1|2758911_2761149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080033.1|2761096_2761309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080032.1|2761323_2762052_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_155080031.1|2762035_2763085_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080030.1|2763164_2763653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080028.1|2763720_2764281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376335.1|2764422_2765223_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_155068069.1|2765321_2765897_-	anthranilate/aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	1.9e-57
WP_155080027.1|2765955_2766627_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_155068072.1|2766672_2767572_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_017376331.1|2767606_2767990_-	response regulator	NA	NA	NA	NA	NA
WP_155068073.1|2768138_2768969_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_155080026.1|2768893_2769604_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_155068074.1|2769600_2770626_-	phosphotransferase	NA	NA	NA	NA	NA
WP_155080025.1|2770729_2773261_+	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_155080024.1|2774539_2775523_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_155068078.1|2775535_2776354_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_016210431.1|2776394_2776787_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_155068079.1|2776846_2777653_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_155079476.1|2779320_2779707_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2779690_2780248_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080021.1|2780333_2780600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085258.1|2782252_2782621_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	47.1	3.2e-23
WP_155079868.1|2782687_2783843_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080023.1|2783800_2784085_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079478.1|2784185_2784743_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2784726_2785113_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085259.1|2786063_2787416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085260.1|2788152_2788515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|2788604_2789834_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155085261.1|2789966_2790914_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155068087.1|2791827_2792508_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_155080016.1|2792504_2793317_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_155080015.1|2793390_2797071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080014.1|2797080_2798568_-	ribonuclease G	NA	NA	NA	NA	NA
WP_155080013.1|2798577_2799195_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_155068092.1|2799264_2799783_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_155068093.1|2799779_2800679_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2800694_2801738_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_155068094.1|2801927_2802215_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_155068095.1|2802335_2803796_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_155080012.1|2803872_2805309_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_155080011.1|2806072_2806240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080010.1|2806365_2806872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2806868_2807255_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2807238_2807796_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085262.1|2807821_2808505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080008.1|2808534_2808999_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080007.1|2809137_2810112_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.8e-27
WP_155068097.1|2810305_2810656_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081491.1|2810687_2811140_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2811917_2812304_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085263.1|2812569_2813133_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	2832896	2864887	3541633	tRNA,transposase	Bacillus_thuringiensis_phage(25.0%)	40	NA	NA
WP_155085265.1|2832896_2834126_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155085266.1|2834602_2835739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068112.1|2835778_2836396_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155085267.1|2836498_2837374_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079826.1|2837333_2838220_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085268.1|2838180_2838639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079992.1|2838980_2839937_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.8e-33
WP_155068114.1|2839996_2840662_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_155066404.1|2840984_2841870_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081465.1|2841939_2842392_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2842423_2842774_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079991.1|2843000_2843606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079897.1|2843674_2844061_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2844044_2844602_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079990.1|2844582_2845347_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155079989.1|2846217_2847207_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155079478.1|2847209_2847767_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2847750_2848137_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079988.1|2848159_2849110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079987.1|2849356_2850331_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079986.1|2850658_2851324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079958.1|2851372_2851681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085269.1|2851677_2852028_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	39.2	2.6e-14
WP_155079984.1|2852070_2853552_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.9	1.4e-69
WP_155079478.1|2853838_2854396_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2854379_2854766_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155068622.1|2855115_2855568_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2855599_2855950_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079906.1|2856036_2856309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079983.1|2856312_2857101_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155068097.1|2858066_2858417_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081491.1|2858448_2858901_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068117.1|2859342_2859933_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_155079982.1|2860059_2861445_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_155068119.1|2861538_2861736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085270.1|2861828_2862683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079980.1|2863176_2863554_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_155079979.1|2863566_2863803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068123.1|2863802_2864009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068124.1|2864167_2864887_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
>prophage 34
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	2872780	3062768	3541633	tRNA,transposase,protease,integrase	unidentified_phage(12.82%)	214	2906984:2907043	2917366:2918326
WP_155085271.1|2872780_2873572_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.2	2.2e-24
WP_155079975.1|2873597_2874173_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079974.1|2874118_2874484_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066278.1|2874808_2875858_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079973.1|2875854_2876049_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081490.1|2876158_2876659_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_155068155.1|2876745_2877192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079972.1|2877704_2878661_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067991.1|2879109_2879526_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079971.1|2879784_2879955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|2879881_2880232_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085272.1|2880347_2881055_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.1	6.2e-47
WP_155079969.1|2881051_2881366_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068159.1|2882112_2882982_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	1.2e-68
WP_155068160.1|2882978_2884328_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	37.0	1.8e-74
WP_155079968.1|2884440_2886081_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_155085273.1|2886447_2886714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085274.1|2886984_2887365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079966.1|2887410_2887809_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079445.1|2887868_2888843_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079965.1|2889799_2890366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079964.1|2891194_2891986_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2893205_2893763_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2893746_2894133_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079963.1|2894129_2894519_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079962.1|2894797_2895856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079961.1|2896638_2897292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079960.1|2897655_2899053_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.6	5.9e-65
WP_155079959.1|2899095_2899446_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.2	7.6e-14
WP_155079958.1|2899442_2899751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079956.1|2900180_2900669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085275.1|2900741_2901506_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2901555_2901942_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2901925_2902483_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079955.1|2902797_2903283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|2903454_2904504_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079954.1|2904546_2904915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079953.1|2905025_2905367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079952.1|2905404_2905788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079951.1|2905804_2906854_-|transposase	transposase	transposase	NA	NA	NA	NA
2906984:2907043	attL	ATATAGCTAACCCGGAAGAGTCTTAATTAATGCGTCAGTAATTGCGTTGCAAAGATGCTC	NA	NA	NA	NA
WP_155079478.1|2906989_2907547_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2907530_2907917_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085276.1|2907935_2908547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079949.1|2908997_2909243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|2909259_2910309_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079948.1|2910355_2911561_-	hypothetical protein	NA	A0A1L6BZE6	Pasteurella_phage	29.9	1.0e-17
WP_155079947.1|2911557_2912616_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	35.5	5.0e-32
WP_155079946.1|2912572_2912761_-	AlpA family phage regulatory protein	NA	A0A0R6PC61	Moraxella_phage	49.1	1.1e-06
WP_155079945.1|2912865_2913240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079944.1|2913322_2913967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|2913974_2914532_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2914515_2914902_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081489.1|2915121_2915391_-|integrase	integrase	integrase	A0A1V0E8G8	Vibrio_phage	55.1	1.2e-14
WP_155085277.1|2915391_2916396_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	47.5	9.7e-78
WP_155079476.1|2916491_2916878_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2916861_2917419_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_122942894.1|2918213_2918789_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
2917366:2918326	attR	GAGCATCTTTGCAACGCAATTACTGACGCATTAATTAAGACTCTTCCGGGTTAGCTATATCTCTGGGTTTTGCTTGCTTTACCTCAGTATTGGTTAGCATCGTGGTCTGTCTTGGCATTTTAGTGGTACCAAATATCGTTAAATTTTACAGTACCACGAAGAGTACCACTAAAAATAATAGCTGTCACTGTACACCTCTGGACAGTAATAGATAGAAAAATGGCTATTTATCTAGTGTTTAGTGAAGTATTTGGACTGGATAAGATGGTATTGGATGGTGTAGTGGTGGAGACGGCGGGAATCGAACCCGCGTCCGTAAACCCTCCACTCTCGGATCTACATGCTTAGTTCACCTATTGTGTTTAACTTGGTTTAGCCCGGCAAACATGGCACCACCTTGCGAGTCTGCTTTAGTTTTAGCGTTTAATGCACAGACACATTAAATCGCGAGCTTATATTAAGGTGAACGTTGAAAATCTGGGTCTATAAGCAAACTCAGGCAACGTCGATGAGCTGGTGTTTAGGCAGCAATTGCAGTAGTTTTTGCAACGATTGCATCGTTGGCAACTACTACATCATCGTTGGCAGCTTTAGCTTCGCCAATTATAAAAGTAATATCTCTGATTAACGAGTGTAGATATCATCACTCGGCATGCCCCTTAAGTTTTGCAATCCACGTCGAAGCCATGTCGTCCCCTTAAGAAGTGCAATGATTATAAGGGAAAAGGAGTCATTTTTCAAACTCTACTTGCATTATCTGCCATTAATTAAGCCCAAACCAATCATAGATTTCAGCACATAAAATAATTTCACCCGCCTCTATCAAAGCAGCTGGTCTAATTTACGGGCTAAGACTCAGCCTCTGCAGCCTTAATTTTTTCCTGTTTTAAGCTATCTTGGTCACTAAAAGAATCACAATTTGAGCTACTTAAAGCATACATACGCAACACCGAACGATAAG	NA	NA	NA	NA
WP_155079942.1|2918866_2919742_-	6-pyruvoyl tetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_155068204.1|2919806_2920409_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155085278.1|2920393_2921434_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	1.6e-19
WP_036777829.1|2921709_2922114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081488.1|2922540_2923359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068206.1|2923615_2924917_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_155079939.1|2925064_2925733_+	BAX inhibitor (BI)-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	6.1e-28
WP_155079938.1|2927846_2928443_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_155068208.1|2928463_2929660_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1V0SHQ2	Klosneuvirus	24.8	1.6e-10
WP_155079937.1|2929784_2931149_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_155079936.1|2931145_2932237_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_155079935.1|2932488_2933163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079874.1|2933679_2934069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|2933995_2934346_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066739.1|2934690_2935041_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079874.1|2934967_2935357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068213.1|2936022_2936856_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_155079933.1|2936859_2937510_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.9	1.1e-18
WP_155079932.1|2937499_2938339_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.8	3.6e-09
WP_016210074.1|2938344_2938971_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_155068215.1|2939132_2939675_+	septation protein A	NA	NA	NA	NA	NA
WP_155068216.1|2939758_2940061_+	YciI family protein	NA	NA	NA	NA	NA
WP_144420763.1|2940078_2940321_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_155068218.1|2940401_2940674_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_155079931.1|2940712_2941351_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_155079930.1|2941384_2942476_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155079929.1|2942662_2944084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|2944859_2945834_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155068222.1|2945988_2948313_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.1	1.7e-21
WP_155079927.1|2948484_2949201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068767.1|2949279_2949897_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_155068224.1|2949889_2951272_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_155079926.1|2951885_2953145_+	diphosphate--fructose-6-phosphate 1-phosphotransferase	NA	NA	NA	NA	NA
WP_155079925.1|2953595_2955419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|2955893_2956868_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079924.1|2956967_2957252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079923.1|2957308_2957710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081487.1|2957881_2958058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068768.1|2958776_2959073_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_155079922.1|2960031_2960769_-	D-Ala-D-Ala dipeptidase	NA	NA	NA	NA	NA
WP_155079921.1|2961014_2962202_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_155068232.1|2962283_2962826_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_155079920.1|2962822_2963509_-	acireductone synthase	NA	NA	NA	NA	NA
WP_155079919.1|2963512_2964124_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_155068769.1|2964170_2965190_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_155079918.1|2965288_2966083_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	66.7	1.2e-102
WP_155068236.1|2966104_2966911_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_155079917.1|2966989_2968039_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_155079916.1|2968236_2969496_+	phosphate permease	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.5e-24
WP_027242634.1|2969541_2970219_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2970304_2970586_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_155079915.1|2970677_2971865_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.6	2.2e-20
WP_155079914.1|2972113_2973055_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155068241.1|2973023_2973479_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155079913.1|2973558_2973783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079912.1|2974077_2974782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2975020_2975407_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2975390_2975948_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079911.1|2976065_2976713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068247.1|2976730_2976871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079910.1|2977048_2977579_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_155085279.1|2977575_2979108_+	transglutaminase	NA	NA	NA	NA	NA
WP_155068250.1|2979104_2980055_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_155079908.1|2980258_2980891_+	riboflavin synthase subunit alpha	NA	A0A1V0SE20	Indivirus	32.8	8.1e-14
WP_155079907.1|2981221_2981893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|2981889_2982939_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079904.1|2983062_2983551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079903.1|2983572_2984217_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_155079902.1|2984452_2984950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079901.1|2985518_2987036_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.1	1.7e-86
WP_155068263.1|2987147_2988246_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	2.8e-06
WP_155079900.1|2988483_2989683_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_155079899.1|2989712_2990339_+	ribonuclease T	NA	NA	NA	NA	NA
WP_155079898.1|2990367_2991096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079897.1|2991194_2991581_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2991564_2992122_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079896.1|2992102_2992657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079895.1|2992660_2992876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079894.1|2992890_2994009_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079478.1|2994293_2994851_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079731.1|2994834_2995083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079730.1|2995347_2995509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079893.1|2995524_2995812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|2995911_2997141_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079892.1|2997254_2997722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066488.1|2997648_2997999_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079891.1|2998703_2999831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068773.1|3000713_3000995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|3001874_3002225_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081486.1|3002256_3002709_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068276.1|3002938_3003598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079890.1|3003698_3004349_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_155067468.1|3004455_3004602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|3004702_3005260_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3005243_3005630_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085280.1|3005626_3005956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079888.1|3005931_3006078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079887.1|3006052_3006595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079886.1|3006818_3007187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079885.1|3007388_3008096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068294.1|3008216_3008747_-	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_155081485.1|3008746_3009271_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_155079884.1|3009433_3010252_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_155079883.1|3010380_3010956_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079882.1|3010901_3011216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|3011231_3011618_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3011601_3012159_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079880.1|3012260_3012770_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3012753_3013140_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376008.1|3013556_3014594_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_155079879.1|3014624_3016079_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_155079878.1|3016088_3017273_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_155079877.1|3017346_3018354_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_155068291.1|3018422_3020426_-	transketolase	NA	NA	NA	NA	NA
WP_155079876.1|3020575_3020716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068292.1|3021009_3022170_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.1e-120
WP_155079478.1|3022322_3022880_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3022863_3023250_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079870.1|3023334_3023673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079627.1|3023715_3024753_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079866.1|3024974_3026042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085281.1|3026418_3027066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080338.1|3028068_3028356_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.3	2.2e-06
WP_155085282.1|3028415_3028589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|3029820_3030977_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155079863.1|3031045_3031510_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	45.9	5.9e-30
WP_155085283.1|3032078_3032432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|3033091_3033478_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079881.1|3033461_3033875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|3033883_3034336_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|3034367_3034718_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079860.1|3035321_3035789_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_155068297.1|3036290_3036545_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|3036746_3037250_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_155079859.1|3037541_3038072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|3038232_3038916_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085284.1|3038992_3039772_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_155068300.1|3039758_3040619_-	DUF692 family protein	NA	NA	NA	NA	NA
WP_155079857.1|3040742_3041108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079856.1|3041493_3041823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085285.1|3042136_3043075_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	7.8e-21
WP_155085286.1|3043924_3044242_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155068303.1|3046073_3046796_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	2.1e-26
WP_155068304.1|3046787_3047168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079855.1|3047430_3048750_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|3048836_3049280_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_155068306.1|3049283_3049793_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_155068307.1|3049785_3052599_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.7	3.9e-76
WP_155068776.1|3052738_3053665_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	33.6	7.2e-11
WP_155079854.1|3053843_3055382_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|3055555_3055816_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_155079853.1|3056132_3057176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|3057218_3058193_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079852.1|3058588_3059317_+	DUF541 domain-containing protein	NA	NA	NA	NA	NA
WP_155079851.1|3059420_3060161_+	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_155079445.1|3060382_3061357_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155066278.1|3061718_3062768_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	3084404	3148917	3541633	tRNA,transposase,protease	unidentified_phage(37.5%)	74	NA	NA
WP_155079478.1|3084404_3084962_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3084945_3085332_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079842.1|3085388_3085781_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_155079841.1|3085872_3086055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079840.1|3086564_3087443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|3088175_3088562_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3088545_3089103_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079839.1|3089103_3089679_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155079838.1|3089831_3091034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079837.1|3091194_3092178_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079836.1|3093081_3093288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079835.1|3093367_3093640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|3093750_3094137_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3094120_3094678_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079834.1|3094742_3094928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081484.1|3096190_3097150_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_155079833.1|3097146_3097797_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_155079832.1|3097822_3098674_-	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_017376955.1|3098688_3099966_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_155068344.1|3100006_3100522_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_155068345.1|3100599_3101661_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_155068346.1|3101682_3102819_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_155081483.1|3102815_3104651_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_155079831.1|3104696_3105167_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|3105203_3105539_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_155068349.1|3105551_3106268_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_155079830.1|3106204_3107245_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_155079829.1|3107217_3107697_-	lipopolysaccharide-assembly family protein	NA	NA	NA	NA	NA
WP_155079828.1|3107784_3110265_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.0	5.9e-193
WP_155081482.1|3110327_3110759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068353.1|3110971_3111262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079827.1|3111330_3112272_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079826.1|3112335_3113221_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|3113483_3113834_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|3113865_3114318_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081481.1|3114804_3116403_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_155079825.1|3116530_3116866_-	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_155079824.1|3116893_3118558_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	1.1e-33
WP_155079823.1|3118557_3119199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079822.1|3119198_3119942_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_155068778.1|3120000_3120237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376974.1|3120387_3121755_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376975.1|3121765_3122317_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_155085326.1|3122397_3123381_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_155085288.1|3123502_3125260_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155079820.1|3125482_3126106_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|3126161_3126581_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_155079819.1|3126721_3127336_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155079818.1|3127399_3128185_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155079817.1|3128592_3129609_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155079816.1|3129608_3130124_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_017376982.1|3130165_3130639_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_155079815.1|3130866_3131841_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	4.0e-28
WP_155079814.1|3131860_3132166_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155079445.1|3132189_3133164_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079813.1|3133240_3133939_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_155085289.1|3134602_3135358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085290.1|3135502_3136660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079811.1|3136778_3136952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079810.1|3137018_3137810_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079809.1|3137849_3138824_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.8e-27
WP_155079808.1|3138866_3139175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079807.1|3139248_3140115_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079806.1|3140098_3141184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079805.1|3141487_3142063_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155079478.1|3142063_3142621_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3142604_3142991_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079804.1|3143405_3144575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066524.1|3145156_3145459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079803.1|3145721_3145940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085291.1|3145920_3146427_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079784.1|3146523_3147300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081296.1|3147480_3147864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080219.1|3147867_3148917_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	3231600	3272493	3541633	tRNA,transposase	unidentified_phage(50.0%)	38	NA	NA
WP_155085293.1|3231600_3232545_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_155079747.1|3232544_3232898_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_155068424.1|3232946_3235622_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.0	4.6e-26
WP_155068425.1|3235638_3237156_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_155081478.1|3237232_3237685_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_155079745.1|3237903_3239343_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_155068784.1|3239342_3240881_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_155079743.1|3240895_3242866_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_016209309.1|3242869_3243175_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_155068427.1|3243198_3243822_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_017378114.1|3243841_3244330_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_064004451.1|3244343_3245369_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_155068428.1|3245373_3247767_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_016209307.1|3247816_3249106_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_155085294.1|3249112_3249613_-	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_155068429.1|3249612_3250866_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_155068430.1|3250867_3251545_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_016209262.1|3251562_3252048_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_016209283.1|3252038_3252407_-	NADH-ubiquinone/plastoquinone oxidoreductase chain 3	NA	NA	NA	NA	NA
WP_155079741.1|3252773_3253748_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155068433.1|3254191_3254554_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_155079739.1|3254567_3255329_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_155079737.1|3255632_3256982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068436.1|3257767_3258601_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_155068437.1|3258622_3259216_+	thymidine kinase	NA	A0A023W530	Serratia_phage	53.2	2.6e-54
WP_155068438.1|3259187_3259589_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_155079735.1|3259612_3260623_-	lipase	NA	NA	NA	NA	NA
WP_155068441.1|3261649_3262627_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_155079733.1|3262953_3264003_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085295.1|3264049_3264694_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079731.1|3264677_3264926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079730.1|3265190_3265352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079728.1|3265452_3266058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079726.1|3266618_3267593_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.8	1.4e-28
WP_155079724.1|3268578_3269760_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068444.1|3270390_3270849_-	NfeD family protein	NA	NA	NA	NA	NA
WP_155079476.1|3271565_3271952_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3271935_3272493_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	3278842	3340032	3541633	transposase	unidentified_phage(18.18%)	53	NA	NA
WP_155079612.1|3278842_3280072_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079718.1|3280318_3281428_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	2.1e-17
WP_155079716.1|3281439_3282084_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_155079714.1|3282102_3283089_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_155079713.1|3283173_3284250_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_155079712.1|3284452_3285277_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_155079710.1|3286459_3287425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|3287826_3288213_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3288196_3288754_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085296.1|3290317_3290632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079741.1|3290674_3291649_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155079705.1|3292126_3292609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079703.1|3292664_3293915_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_017378137.1|3294016_3294235_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_155068461.1|3294709_3295564_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3296034_3296592_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3296575_3296962_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079701.1|3297404_3298784_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	1.0e-53
WP_155068464.1|3298811_3299270_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.9	9.2e-52
WP_155068465.1|3299247_3300498_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.7	5.8e-40
WP_017375944.1|3300656_3300893_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|3300906_3301062_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_155079699.1|3301142_3302105_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155079698.1|3302264_3303584_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_155079696.1|3303593_3304262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068468.1|3304477_3304792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079694.1|3304996_3306811_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	1.3e-24
WP_155068470.1|3306939_3307728_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_155079693.1|3308305_3310057_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155068472.1|3310067_3310868_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	39.1	2.0e-33
WP_155079691.1|3310972_3311461_-	diacylglycerol kinase	NA	A0A1B2IDT7	Erwinia_phage	44.3	1.1e-29
WP_155079690.1|3311642_3311960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375799.1|3312980_3313325_+	DMT family protein	NA	NA	NA	NA	NA
WP_155068474.1|3319011_3319974_-	glycerate dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	26.3	2.8e-18
WP_016210039.1|3320162_3321422_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_155079688.1|3321644_3321971_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	2.6e-16
WP_155068475.1|3322165_3323107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081477.1|3323165_3325232_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_155079686.1|3325237_3326233_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_155085297.1|3326808_3328389_+	amino acid permease	NA	NA	NA	NA	NA
WP_155079683.1|3328534_3329944_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_155068479.1|3330003_3331137_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_155079682.1|3331262_3332087_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_155085298.1|3332321_3332948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079678.1|3333261_3333633_-	isochorismatase	NA	NA	NA	NA	NA
WP_155068483.1|3333943_3334231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079676.1|3334382_3335231_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_155079675.1|3335345_3336386_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_155079673.1|3336460_3336952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|3337070_3337421_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|3337452_3337905_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085299.1|3338114_3338678_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_155079669.1|3339057_3340032_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	7.5e-27
>prophage 38
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	3345010	3393089	3541633	tRNA,transposase	unidentified_phage(60.0%)	55	NA	NA
WP_155068622.1|3345010_3345463_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068499.1|3346378_3347380_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_155068500.1|3347487_3348012_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_155068789.1|3348260_3349520_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.1e-13
WP_155079445.1|3349751_3350726_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079662.1|3350865_3351261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|3351440_3351827_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3351810_3352368_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079660.1|3352368_3353211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079659.1|3353341_3355672_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_155081476.1|3355815_3357822_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155079657.1|3357849_3358110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085301.1|3358120_3358291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079655.1|3358314_3359289_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	9.8e-27
WP_155085302.1|3359366_3360470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079648.1|3360508_3360715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079646.1|3361231_3361519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079644.1|3361648_3362239_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079642.1|3362296_3362698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079640.1|3362740_3363211_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079638.1|3363496_3363958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|3364595_3365048_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|3365079_3365430_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079635.1|3365484_3365673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081475.1|3365725_3366004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079634.1|3366503_3366743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|3366669_3367020_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066397.1|3367884_3368463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066396.1|3368573_3369215_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_017377592.1|3369211_3369655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066395.1|3369814_3370711_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_155079631.1|3370733_3371723_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155066393.1|3371901_3372555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079629.1|3372523_3373117_-	CDP-alcohol phosphatidyltransferase	NA	NA	NA	NA	NA
WP_155079627.1|3373245_3374283_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079626.1|3374771_3376031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079624.1|3376154_3376511_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155066404.1|3376537_3377424_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079622.1|3377485_3377764_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155079476.1|3377832_3378219_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3378202_3378760_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079620.1|3378909_3379884_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155085303.1|3380694_3381027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079617.1|3381541_3382195_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155079615.1|3382255_3382969_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_155079613.1|3382979_3384044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|3385411_3386641_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079610.1|3386839_3387007_+	phosphatase	NA	NA	NA	NA	NA
WP_155079476.1|3387117_3387504_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3387487_3388045_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081403.1|3388322_3389555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081404.1|3389730_3389892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|3389945_3390995_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081405.1|3391488_3391650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081406.1|3391691_3393089_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	1.3e-77
>prophage 39
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	3402743	3453197	3541633	tRNA,transposase	Acinetobacter_phage(80.0%)	51	NA	NA
WP_155079487.1|3402743_3403793_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068516.1|3404186_3405344_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155081410.1|3405363_3408465_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_155081411.1|3410000_3410282_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3410430_3410772_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_155068520.1|3410892_3412773_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_155068521.1|3412856_3414374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081412.1|3414472_3415588_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155068524.1|3415709_3416708_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_155068525.1|3416711_3417479_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_155068526.1|3417471_3418671_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_155068527.1|3418654_3419326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081413.1|3419347_3420124_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	30.7	7.6e-22
WP_155081414.1|3420127_3421126_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	2.7e-40
WP_155081415.1|3421127_3421706_-	anthranilate/aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	4.8e-45
WP_155081416.1|3421702_3423172_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3423215_3423503_-	trp operon repressor	NA	NA	NA	NA	NA
WP_155068532.1|3423703_3424624_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155081417.1|3424737_3425292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085304.1|3425407_3426166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085305.1|3426360_3426900_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_155085306.1|3426984_3427521_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_155085307.1|3428175_3428478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068537.1|3428926_3429496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080484.1|3429853_3430363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|3430363_3430921_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3430904_3431291_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3432075_3432633_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3432616_3433003_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081419.1|3433018_3433753_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300641.1|3434004_3434370_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081420.1|3434426_3434627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|3434632_3435190_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3435173_3435560_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081421.1|3435627_3436074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068015.1|3436082_3437236_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	3.4e-58
WP_017378398.1|3437812_3438211_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_017378399.1|3439076_3440027_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_155085308.1|3440026_3442105_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_155081423.1|3442252_3442768_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155081424.1|3442776_3443340_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_155068540.1|3443320_3444067_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_155081425.1|3444205_3444658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081426.1|3444793_3445630_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_155068543.1|3445626_3446523_+	EamA family transporter	NA	NA	NA	NA	NA
WP_122941163.1|3446555_3447623_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_155068544.1|3447647_3448016_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_155081427.1|3448041_3449493_-	potassium transporter	NA	NA	NA	NA	NA
WP_155068546.1|3449499_3450879_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_155081598.1|3450919_3452233_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_155068548.1|3452222_3453197_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
>prophage 40
NZ_CP039234	Piscirickettsia salmonis strain BI1 chromosome, complete genome	3541633	3457968	3513764	3541633	tRNA,transposase	unidentified_phage(42.86%)	58	NA	NA
WP_155068551.1|3457968_3458595_+|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
WP_155068552.1|3458599_3459499_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_155068793.1|3459595_3460150_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_155081429.1|3460432_3461557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081430.1|3461913_3462687_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155081431.1|3464141_3464432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|3464504_3464891_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080821.1|3465059_3465914_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066610.1|3466703_3467279_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210338.1|3467313_3467451_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085327.1|3468179_3468887_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_155085309.1|3469031_3469217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|3470501_3471476_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_032126718.1|3471759_3472140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081432.1|3472303_3472999_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_155068566.1|3472995_3474423_+	dihydrolipoamide dehydrogenase	NA	NA	NA	NA	NA
WP_155079826.1|3474504_3475391_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081434.1|3475351_3475942_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155068568.1|3475938_3476775_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_155068569.1|3476775_3477117_-	cytochrome C oxidase subunit IV	NA	NA	NA	NA	NA
WP_155081435.1|3477118_3477724_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_155068570.1|3477720_3479715_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_155068571.1|3479734_3480676_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_155081436.1|3480903_3482322_+	MFS transporter	NA	NA	NA	NA	NA
WP_155081437.1|3482476_3483628_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080005.1|3483689_3484575_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080566.1|3484572_3484797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081438.1|3485225_3485519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081439.1|3485870_3486086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081440.1|3486244_3486472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081441.1|3486505_3487102_-	methyltransferase	NA	NA	NA	NA	NA
WP_155080442.1|3487274_3488402_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081600.1|3489171_3489603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081444.1|3489872_3490292_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155081445.1|3490538_3491066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081446.1|3491140_3492370_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081447.1|3492434_3492821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376303.1|3493012_3493726_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	2.2e-28
WP_155081601.1|3493784_3494537_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_155081448.1|3494751_3495981_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081602.1|3496134_3496416_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	41.0	1.3e-08
WP_155081449.1|3496457_3497198_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155081450.1|3498800_3499775_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.1	1.3e-26
WP_155080251.1|3499910_3500057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068583.1|3500353_3501010_+	biofilm formation and stress response factor family protein	NA	NA	NA	NA	NA
WP_155080582.1|3501146_3501353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085310.1|3501647_3501818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|3501774_3502931_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155081453.1|3502971_3503805_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079478.1|3503801_3504359_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3504342_3504729_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081454.1|3505537_3506425_-	HrgA protein	NA	NA	NA	NA	NA
WP_155085328.1|3506493_3506664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081455.1|3506716_3507691_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.5	1.8e-28
WP_155081456.1|3510532_3510667_+	phosphatase	NA	NA	NA	NA	NA
WP_155080182.1|3511604_3512000_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081448.1|3512099_3513329_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081602.1|3513482_3513764_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	41.0	1.3e-08
>prophage 1
NZ_CP039235	Piscirickettsia salmonis strain BI1 plasmid unnamed1, complete sequence	200568	1087	91533	200568	transposase,head,tail	unidentified_phage(23.26%)	116	NA	NA
WP_155081606.1|1087_2125_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081607.1|2167_3109_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.1	2.4e-22
WP_155081658.1|3068_3662_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.2	9.6e-09
WP_155081107.1|4226_4466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066739.1|4392_4743_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155066936.1|5087_5438_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155068622.1|5469_5922_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
WP_155081726.1|5926_6253_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081609.1|6213_6399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081610.1|6422_6680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066918.1|6905_7733_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081729.1|7749_7935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081730.1|8490_8718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081605.1|8728_9634_+	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_155081606.1|9815_10853_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081607.1|10895_11837_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.1	2.4e-22
WP_155080171.1|11796_12372_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.2	1.6e-08
WP_155080208.1|12317_12683_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081609.1|12643_12829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081610.1|12852_13110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|13307_13865_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|13848_14235_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081611.1|14798_16028_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080029.1|16475_17603_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155085361.1|17762_18068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081616.1|18578_18857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081617.1|18842_19817_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.6e-24
WP_054300641.1|20083_20449_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085329.1|20781_21258_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081618.1|21380_21809_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_155081619.1|21805_22105_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155081620.1|22147_22825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081621.1|22838_23879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081622.1|24098_25409_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	36.6	8.6e-26
WP_155066936.1|25597_25948_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155068622.1|25979_26432_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
WP_155081624.1|26543_27272_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	1.2e-37
WP_155085330.1|27290_28250_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.1	1.9e-22
WP_155081606.1|28292_29330_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155085331.1|29404_29635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085332.1|29681_30404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|30544_31774_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081660.1|31999_32812_+	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	24.4	2.4e-10
WP_155081661.1|32804_33749_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_155081662.1|33984_34632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080444.1|35007_36489_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.0	6.7e-27
WP_155079959.1|36531_36882_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	39.2	4.5e-14
WP_155079958.1|36878_37187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081667.1|37260_37479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081664.1|38433_39036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081668.1|39172_39619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081669.1|39889_40282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|40389_40740_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155079958.1|41000_41309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081670.1|41488_41788_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.6	1.8e-11
WP_155079476.1|41870_42257_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085333.1|42240_42711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085334.1|42936_43086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081672.1|43088_44675_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.0	7.2e-27
WP_155081673.1|45222_45918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081674.1|45938_46175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|46275_47250_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081675.1|47273_48278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|48343_48694_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155085335.1|48620_49010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085336.1|49469_50090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081678.1|50669_50885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081679.1|51067_51379_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	2.5e-08
WP_155081680.1|51375_51699_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	6.0e-13
WP_155081681.1|52039_52300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|52323_53298_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081733.1|53868_54426_-	helix-turn-helix domain-containing protein	NA	A0A1S6L009	Salmonella_phage	56.2	5.1e-52
WP_155081682.1|54425_54743_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_155081683.1|54697_54958_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_155081684.1|55392_55713_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.4	5.9e-13
WP_155081685.1|55932_56157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081686.1|56313_56892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085337.1|56943_57675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081688.1|57749_58067_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081689.1|58370_59174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081690.1|59582_60152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122942947.1|60277_60556_+	peptidase	NA	A0A2L1IV28	Escherichia_phage	52.2	4.9e-24
WP_122942945.1|60566_60872_+	HigA family addiction module antidote protein	NA	A0A2I7RCV5	Vibrio_phage	39.7	1.1e-05
WP_155085338.1|61026_62379_-	hypothetical protein	NA	A0A2I7RG64	Vibrio_phage	31.7	1.1e-47
WP_155079478.1|62404_62962_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|62945_63332_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085339.1|63328_63598_-	DEAD/DEAH box helicase	NA	A0A0K0MD54	Pseudoalteromonas_phage	44.6	1.1e-09
WP_155068622.1|63663_64116_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
WP_155066936.1|64147_64498_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155085340.1|64552_64909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079741.1|66745_67720_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	2.4e-25
WP_155081692.1|68351_68924_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.6	4.0e-36
WP_155081693.1|69316_69457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068941.1|69991_70447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085341.1|70879_71239_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.6	6.0e-14
WP_155079868.1|71246_72403_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155081695.1|72520_73129_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.0	2.6e-09
WP_155079478.1|73109_73667_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|73650_74037_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081696.1|74518_75046_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.6	1.3e-09
WP_155080573.1|75205_76567_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155085342.1|77522_78278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|78423_79398_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081698.1|79517_80108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081699.1|80400_81135_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.3	1.2e-08
WP_155079730.1|81131_81293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079731.1|81557_81806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|81789_82347_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081700.1|83174_83363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081701.1|84579_85269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081702.1|85316_85970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080215.1|85955_86930_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.3	1.4e-25
WP_155085343.1|88097_89072_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	9.2e-25
WP_155079478.1|89178_89736_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|89719_90106_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081703.1|90864_91533_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.3e-38
>prophage 2
NZ_CP039235	Piscirickettsia salmonis strain BI1 plasmid unnamed1, complete sequence	200568	96218	190947	200568	integrase,transposase	Staphylococcus_phage(14.29%)	116	134444:134503	163301:164371
WP_155081708.1|96218_98387_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.9	3.5e-72
WP_155079445.1|98859_99834_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155085345.1|99876_100488_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.1	9.9e-09
WP_155081709.1|100628_101030_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.9	6.0e-23
WP_122943400.1|101026_101338_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.8	6.1e-15
WP_155081710.1|101935_102916_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	1.7e-23
WP_155079612.1|103251_104481_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081711.1|104726_104927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081712.1|105032_106898_+	AAA family ATPase	NA	A0A2I7R5Z1	Vibrio_phage	30.7	8.7e-56
WP_155085346.1|107269_108022_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.5	6.9e-12
WP_155068622.1|108016_108469_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
WP_155066936.1|108500_108851_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081715.1|109179_109578_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	32.3	1.1e-08
WP_155080338.1|109625_109913_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.3	2.2e-06
WP_155081716.1|109949_110528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|110535_111093_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|111076_111463_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081717.1|111875_112532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081720.1|113454_114228_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155079445.1|114484_115459_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081735.1|115696_115864_-	phosphatase	NA	NA	NA	NA	NA
WP_155085362.1|117031_117757_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.4	3.2e-38
WP_155081721.1|118018_118606_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	45.1	4.7e-40
WP_155081722.1|118598_119201_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_155081736.1|119200_119419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122943131.1|119989_120112_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155085347.1|120186_120903_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	6.3e-39
WP_155081724.1|120957_121512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085348.1|121889_122264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|122290_122743_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	3.3e-09
WP_155066936.1|122774_123125_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081731.1|123186_123693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081657.1|123827_124556_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	1.2e-37
WP_155085349.1|124680_125615_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.6	3.6e-34
WP_155085350.1|125688_126690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|126653_127540_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	9.0e-11
WP_155081653.1|127577_127934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081652.1|128018_130292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081651.1|130682_130919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|130899_131457_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080557.1|131440_131779_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081650.1|131980_132868_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080546.1|132975_133704_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155085351.1|133697_134417_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.6	1.2e-42
134444:134503	attL	TATAGCTGACACGGTTGAGTTAACCTTTTGATTTTGCTATTATTCTTACATGAAAAATAT	NA	NA	NA	NA
WP_155079476.1|134470_134857_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
134444:134503	attL	TATAGCTGACACGGTTGAGTTAACCTTTTGATTTTGCTATTATTCTTACATGAAAAATAT	NA	NA	NA	NA
WP_155079478.1|134840_135398_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080338.1|135422_135710_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.3	2.2e-06
WP_122943230.1|136080_137016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080066.1|138900_139485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080067.1|139450_139597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085352.1|139755_140283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081648.1|140823_141531_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.0	3.0e-09
WP_155081647.1|142232_142421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081646.1|143010_143781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081645.1|143843_144230_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155081644.1|144294_145269_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.3	1.1e-25
WP_155079612.1|145743_146973_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081643.1|147113_147839_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.3e-44
WP_155081642.1|147948_148248_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|148244_148490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|148754_149312_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|149295_149682_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079836.1|150047_150254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|150875_151262_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
149650:150609	attR	ATATTTTTCATGTAAGAATAATAGCAAAATCAAAAGGTTAACTCAACCGTGTCAGCTATATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATAGTTTTAAAACGCCCTCCGTCATATGAAGTGCAACACCCAGTAGAGAGTTCACTCCCATAAAGATAAACTCTCTAGTTCGCCTTTTTGACTTAGAGGGTACAAATGGCTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGTTTATCAGAAGGGGACTCCATGAGATCAATCGCTAAGGGTCTGATTCCCCGCAGCTTGCTGCGAAAAAAAACAAAGCGCATTACGACCCGAAGGGGTAATTTTCCGAAATACCTCGTAGCTTGCTGCGAGGATAGGTAAATTGAGTTTTGCGCAAATTTATTTGCTAGAGCACTTGGCTTTGCTCCTAGCACAGTCAGTCGTGAGACTAAACGGCATACCCCAAGCGATTTTAACGGTCTTTATTGCCATCGCTTGGCCTCGCGTTGTGCGCAAGAAAAACGGTCTAATGCTAAGCAAGGGCAGGATTTTCAGAAAATTTCAGAGAAAGCAAAAGTATTAATTCATGAGCGGTTAAGCACCCATACGTCACCCGATGTTATTAGTAAAGAGCTTATACAGGAGCATAATATCCAAGTGAGTGAGAGCACCATCTACCGTTATATTCATGAGGATCGAGAGAAAGGAGGAGAGCTTTACAAAAGCCTGCCCCACTCTGGAAAACCTTATAAGAAGAAGGTGAAAAGTGGTGATAAAACTAAAATACCG	NA	NA	NA	NA
WP_155080667.1|151323_151476_+	hypothetical protein	NA	NA	NA	NA	NA
149650:150609	attR	ATATTTTTCATGTAAGAATAATAGCAAAATCAAAAGGTTAACTCAACCGTGTCAGCTATATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATAGTTTTAAAACGCCCTCCGTCATATGAAGTGCAACACCCAGTAGAGAGTTCACTCCCATAAAGATAAACTCTCTAGTTCGCCTTTTTGACTTAGAGGGTACAAATGGCTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGTTTATCAGAAGGGGACTCCATGAGATCAATCGCTAAGGGTCTGATTCCCCGCAGCTTGCTGCGAAAAAAAACAAAGCGCATTACGACCCGAAGGGGTAATTTTCCGAAATACCTCGTAGCTTGCTGCGAGGATAGGTAAATTGAGTTTTGCGCAAATTTATTTGCTAGAGCACTTGGCTTTGCTCCTAGCACAGTCAGTCGTGAGACTAAACGGCATACCCCAAGCGATTTTAACGGTCTTTATTGCCATCGCTTGGCCTCGCGTTGTGCGCAAGAAAAACGGTCTAATGCTAAGCAAGGGCAGGATTTTCAGAAAATTTCAGAGAAAGCAAAAGTATTAATTCATGAGCGGTTAAGCACCCATACGTCACCCGATGTTATTAGTAAAGAGCTTATACAGGAGCATAATATCCAAGTGAGTGAGAGCACCATCTACCGTTATATTCATGAGGATCGAGAGAAAGGAGGAGAGCTTTACAAAAGCCTGCCCCACTCTGGAAAACCTTATAAGAAGAAGGTGAAAAGTGGTGATAAAACTAAAATACCG	NA	NA	NA	NA
WP_155068622.1|151480_151933_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
WP_155066936.1|151964_152315_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081465.1|152503_152956_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	3.3e-09
WP_155066936.1|152987_153338_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155080465.1|153421_153742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081641.1|154012_154738_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.8	4.3e-11
WP_155081640.1|154951_156514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081639.1|158230_158770_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.7	4.5e-29
WP_155081638.1|158886_159117_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080442.1|159273_160401_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081637.1|160784_161114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081636.1|161137_162100_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155080267.1|163191_163347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081635.1|163446_164745_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_064006305.1|165089_165311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081634.1|165307_165604_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_155081633.1|165605_165785_-	hypothetical protein	NA	A0A0R6PJ17	Moraxella_phage	52.6	1.7e-09
WP_155080171.1|166228_166804_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.2	1.6e-08
WP_054300641.1|166749_167115_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066936.1|167537_167888_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081611.1|168526_169756_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155085353.1|169921_170059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085354.1|170727_171661_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.6	3.6e-34
WP_155085355.1|171658_171823_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	48.1	1.6e-06
WP_155080216.1|171852_172935_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.7	3.8e-144
WP_155080275.1|173341_173845_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079478.1|173884_174442_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|174425_174812_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079476.1|174840_175227_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081630.1|175223_176126_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.5	7.2e-24
WP_155081629.1|176247_176817_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	36.4	8.6e-23
WP_155081628.1|176821_177505_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_155081627.1|177677_178208_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.6	1.6e-34
WP_155081626.1|178247_179048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085356.1|179480_180455_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.3	1.4e-25
WP_155081625.1|180723_182184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081624.1|182550_183279_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	1.2e-37
WP_155085357.1|183250_183850_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085358.1|183958_184096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081107.1|184789_185029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066739.1|184955_185306_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155079478.1|185774_186332_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|186315_186702_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085359.1|186734_186959_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|186990_187443_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
WP_155085360.1|187447_187774_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081609.1|187734_187920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080444.1|188016_189498_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.0	6.7e-27
WP_155079959.1|189540_189891_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	39.2	4.5e-14
WP_155079958.1|189887_190196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081663.1|190269_190947_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.0	6.4e-09
>prophage 1
NZ_CP039236	Piscirickettsia salmonis strain BI1 plasmid unnamed2, complete sequence	156158	1560	108040	156158	integrase,transposase	Streptococcus_phage(36.59%)	117	90532:90591	93759:94810
WP_155085393.1|1560_2013_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	26.8	8.4e-05
WP_155066936.1|2044_2395_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155085363.1|2480_3839_+	hypothetical protein	NA	A0A1X9I6W8	Streptococcus_phage	29.7	3.7e-40
WP_155081791.1|3835_4036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081790.1|4916_5345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081789.1|5475_6204_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.3	4.1e-09
WP_155079478.1|6184_6742_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|6725_7112_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081788.1|7404_8109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081787.1|8808_9504_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.2	5.2e-46
WP_155081786.1|9596_10301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080320.1|10374_11430_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085364.1|12380_13490_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.9	5.2e-141
WP_155081769.1|13561_13840_-	antitoxin	NA	NA	NA	NA	NA
WP_016211674.1|13829_14111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081770.1|14312_14666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081772.1|15613_16276_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_155081773.1|16414_16735_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	40.7	1.5e-11
WP_155081774.1|16771_17107_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_155081775.1|17913_18624_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	1.9e-27
WP_155081776.1|18623_19280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081832.1|19356_20715_-	DEAD/DEAH box helicase	NA	D2J050	Enterococcus_phage	50.5	1.4e-127
WP_054300664.1|20804_21371_-	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	35.0	1.4e-20
WP_017377658.1|21374_22061_-	Fic family protein	NA	NA	NA	NA	NA
WP_155081739.1|22713_23448_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155085365.1|23444_24071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085366.1|24170_24575_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6C6	Streptococcus_phage	33.7	1.5e-05
WP_155079478.1|24594_25152_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|25135_25522_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085367.1|25518_25863_-|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	38.3	1.4e-12
WP_155081777.1|25820_26138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080470.1|26249_27116_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155085368.1|27412_27670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085369.1|27814_28930_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081779.1|29319_30603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081780.1|30949_31327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081739.1|31331_32066_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155066936.1|32547_32898_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081465.1|32929_33382_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	3.3e-09
WP_016211671.1|34178_34916_+	ParA family protein	NA	E5FFJ3	Burkholderia_phage	25.8	1.7e-10
WP_122942012.1|34908_35274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081783.1|35291_35486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081784.1|35614_36424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|36615_37845_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079478.1|38462_39020_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|39003_39390_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081765.1|40341_41070_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	9.3e-38
WP_155081831.1|41462_42434_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080664873.1|42352_42667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081764.1|43038_44289_-	MFS transporter	NA	NA	NA	NA	NA
WP_155081763.1|44376_44625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081762.1|45972_46638_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	3.6e-36
WP_155081761.1|47064_48801_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.2	2.1e-24
WP_155081760.1|49316_50339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081759.1|50463_50634_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085370.1|50761_50932_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085371.1|51226_51784_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	37.4	9.6e-27
WP_155081758.1|51815_52835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081739.1|53078_53813_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155085372.1|53812_54076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079730.1|54120_54282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079731.1|54546_54795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|54778_55336_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085373.1|55316_55751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081739.1|55805_56540_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155085374.1|56563_56938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664873.1|57357_57672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081756.1|58373_60143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080567.1|61114_62134_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155066610.1|62137_62713_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.2	1.6e-08
WP_155081755.1|62778_62946_+	phosphatase	NA	NA	NA	NA	NA
WP_155080251.1|63732_63879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081830.1|64045_64372_-	mRNA-degrading endonuclease	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.9e-11
WP_122943070.1|64373_64616_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155066936.1|65018_65369_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155068622.1|65400_65853_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
WP_155079476.1|67196_67583_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|67566_68124_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079612.1|68741_69971_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079487.1|70442_71492_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085375.1|71762_72485_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081749.1|72529_73504_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	7.1e-25
WP_155067533.1|73523_73919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081753.1|73991_74654_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	36.1	8.2e-25
WP_155081752.1|75305_77030_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_080664873.1|78729_79044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081751.1|79046_79247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081750.1|79367_79733_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	47.1	7.2e-23
WP_155081749.1|79872_80847_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	7.1e-25
WP_155081748.1|80843_81236_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	5.0e-14
WP_155081747.1|81598_81865_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079478.1|81912_82470_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|82453_82840_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081746.1|82987_83131_+	phosphatase	NA	NA	NA	NA	NA
WP_155085376.1|83634_83961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085377.1|84025_84334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080561.1|84478_84778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|88027_88480_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	3.3e-09
WP_155066936.1|88511_88862_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155068802.1|89356_89737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|89984_90248_-	RNA-binding protein	NA	NA	NA	NA	NA
90532:90591	attL	CGCCCTCCGTCATATGAAGTGCAACACCACTCTACACTAAGCCGCCATTAAATTCTCTAA	NA	NA	NA	NA
WP_155079445.1|90567_91542_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155085378.1|91584_92013_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6C6	Streptococcus_phage	47.2	4.2e-06
WP_155081743.1|92596_92791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|93794_94769_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081701.1|95402_96092_+	hypothetical protein	NA	NA	NA	NA	NA
93759:94810	attR	CGCCCTCCGTCATATGAAGTGCAACACCACTCTACACTAAGCCGCCATTAAATTCTCTAAAAAAACATGATTAGGTGCGCGATAATCTAAACTCGCCCTTCTTCTCGCATTCAATGTATGCTCTATTTTTGCTATTTTAGCATCACTTATTTCATTAAAGTCTGTTCCTTTAGGAAGAAAACGCCTAATCAAACCATTCGTGTGCTCATTTAGGCCTCTGTCGCAAGAGCGATAAGGTCTAGCAAAGTAGAAATCAGCATCAGTAATCTTTGAAATATCCTCATGACCAGCGAATTCTGTCCCGTTATCTGAGGTAATCGTTTTAAAGTCAAAGAAAGTTGAGGCGACTATACTTCTGAAGGTCTCAACAACGGTTTCTGCACATTTGTTAGCCATTTTCCTTATACAACACATCTTATTGGCTTTATCAACAAGGGTTAACAAGTAAGATTTGTGATCTCGACCTACTATGGTATCAATTTCAAAATGTCCAAATTCAGTCTTTTCGTCAGCAATAGCGGGCCTTTGTTCAATACCAACGCGGTTCGGTATTTTAGTTTTATCACCACTTTTCACCTTCTTCTTATAAGGTTTTCCAGAGTGGGGCAGGCTTTTGTAAAGCTCTCCTCCTTTCTCTCGATCCTCATGAATATAACGGTAGATGGTGCTCTCACTCACTTGGATATTATGCTCCTGTATAAGCTCTTTACTAATAACATCGGGTGACGTATGGGTGCTTAACCGCTCATGAATTAATACTTTTGCTTTCTCTGAAATTTTCTGAAAATCCTGCCCTTGCTTAGCATTAGACCGTTTTTCTTGCGCACAACGCGAGGCCAAGCGATGGCAATAAAGACCGTTAAAATCGCTTGGGGTATGCCGTTTAGTCTCACGACTGACTGTGCTAGGAGCAAAGCCAAGTGCTCTAGCAATTGATCTCATGGAGTCCCCTTCTGATAAACGTTGTTCGATATAAAAACGATCTTTTTCATTTAAGTGCCGATAAGCCATTTGTACCCTCTAAGTCAAAAAGGCGAACTAGAGAGTTTATC	NA	NA	NA	NA
WP_036775032.1|96139_96955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664873.1|97176_97491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081742.1|97902_98637_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	1.5e-27
WP_155085379.1|98689_100390_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.0	2.1e-40
WP_155079476.1|100386_100773_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|100756_101314_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081739.1|103838_104573_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155081738.1|104585_104744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085380.1|104861_105713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148037451.1|105705_105906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|107587_108040_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
>prophage 1
NZ_CP039237	Piscirickettsia salmonis strain BI1 plasmid unnamed3, complete sequence	66296	7424	53649	66296	transposase	unidentified_phage(35.0%)	50	NA	NA
WP_155081922.1|7424_8351_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	21.0	4.8e-07
WP_155085395.1|8331_10587_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_155081886.1|10576_11392_-	virulence associated protein	NA	NA	NA	NA	NA
WP_155081887.1|11561_11948_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_155081888.1|11944_12190_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_155079741.1|12474_13449_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	2.4e-25
WP_155081889.1|13654_13921_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085396.1|14216_16124_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155081891.1|16309_18361_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155081892.1|18816_19050_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079741.1|19069_20044_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	2.4e-25
WP_155066936.1|20322_20673_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155068622.1|20704_21157_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
WP_155085404.1|21165_21336_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080383.1|21430_22405_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	4.1e-25
WP_155085397.1|22401_22539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085396.1|22834_24742_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155081891.1|24927_26979_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155081892.1|27434_27668_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085398.1|27687_28662_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	7.1e-25
WP_155081893.1|28706_29195_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155079741.1|29459_30434_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	2.4e-25
WP_155081894.1|30674_31388_-	acid phosphatase	NA	NA	NA	NA	NA
WP_155085399.1|32299_33055_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.5	2.7e-08
WP_122942818.1|33279_33534_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_155081895.1|33523_33811_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	9.6e-15
WP_155079454.1|34134_34326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081896.1|35210_36452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081897.1|36705_38091_+	hypothetical protein	NA	M1I670	Acanthocystis_turfacea_Chlorella_virus	25.3	2.1e-06
WP_155081911.1|38080_38266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085400.1|38293_39106_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.6	2.2e-48
WP_155068889.1|39129_39444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081899.1|39849_40842_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	1.4e-23
WP_155079741.1|41964_42939_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	2.4e-25
WP_155066936.1|43135_43486_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155068622.1|43517_43970_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
WP_155081902.1|43956_44544_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.0	6.8e-07
WP_155080102.1|44559_45012_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_155081903.1|45703_46573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066610.1|47368_47944_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.2	1.6e-08
WP_155081904.1|47889_48195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085401.1|48292_48928_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.0	4.6e-09
WP_155079826.1|48963_49849_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	9.0e-11
WP_155081905.1|50500_50647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081906.1|50713_51046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081907.1|51138_51369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081908.1|51384_52008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081909.1|52107_52740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081910.1|52645_53095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|53091_53649_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039238	Piscirickettsia salmonis strain BI1 plasmid unnamed4, complete sequence	61348	3612	41270	61348	integrase,transposase	unidentified_phage(42.86%)	50	NA	NA
WP_155080408.1|3612_4842_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081838.1|4978_5128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081873.1|5357_6230_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155081839.1|6496_6637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122943008.1|6636_7434_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155085177.1|9115_9754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|9809_10784_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155085406.1|10843_11089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080469.1|11200_11584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|11998_13048_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079445.1|13643_14618_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081161.1|14641_14857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081841.1|15024_15492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081842.1|15670_15985_-	universal stress family protein	NA	NA	NA	NA	NA
WP_155081843.1|17265_17562_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085407.1|17789_18491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085408.1|18474_19371_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085409.1|19313_19523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085410.1|19537_19675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081847.1|19885_20332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081848.1|20477_21497_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081849.1|21702_22662_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	1.7e-23
WP_155066936.1|22729_23080_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081465.1|23111_23564_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	3.3e-09
WP_155081850.1|23652_23862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081851.1|23998_24814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|24984_25959_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_080963620.1|26145_26502_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_027242953.1|26485_26740_-	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_155079478.1|27325_27883_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|27866_28253_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085411.1|28268_28436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085412.1|28432_29113_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.8	1.8e-27
WP_155085413.1|29810_30629_+	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	55.6	5.5e-79
WP_155085414.1|30621_31458_+	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	35.4	5.8e-44
WP_155085415.1|31753_32101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085416.1|32406_33381_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	1.2e-24
WP_155081874.1|33710_34040_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|34132_34690_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|34673_35060_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081854.1|35078_35372_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_155081855.1|35468_35834_-|integrase	tyrosine-type recombinase/integrase	integrase	K4K327	Caulobacter_virus	33.0	4.2e-07
WP_155079476.1|35987_36374_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|36357_36915_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085417.1|36915_37125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|37105_37663_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|37646_38033_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085418.1|38188_38704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|38725_39611_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	9.0e-11
WP_155079445.1|40295_41270_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
>prophage 1
NZ_CP039239	Piscirickettsia salmonis strain BI1 plasmid unnamed5, complete sequence	44011	18294	29873	44011	capsid,head,transposase,portal,protease,tail	Erysipelothrix_phage(18.18%)	20	NA	NA
WP_155081933.1|18294_18618_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	38.8	6.0e-13
WP_155081934.1|18614_18926_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	35.6	1.0e-09
WP_155081935.1|19114_19531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081936.1|19913_20498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085426.1|20652_21846_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	39.7	1.7e-68
WP_155085427.1|21901_22573_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	45.4	3.2e-45
WP_155085428.1|22520_23393_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	40.9	5.9e-55
WP_155085429.1|23346_23508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085436.1|23433_23805_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	50.5	8.6e-24
WP_155081942.1|23891_24869_-	hypothetical protein	NA	A0A1P8DTK0	Proteus_phage	42.4	2.1e-69
WP_155079741.1|24906_25881_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	2.4e-25
WP_155081943.1|25940_26171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081944.1|26391_27177_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	41.8	4.5e-38
WP_016210974.1|27188_27596_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242932.1|27604_27832_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155081945.1|27979_28345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081946.1|28493_28964_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	63.4	5.8e-33
WP_155081947.1|28967_29198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085437.1|29194_29542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081949.1|29534_29873_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	3.5e-24
