The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	57607	82314	3317308	transposase	Leptospira_phage(33.33%)	29	NA	NA
WP_155066276.1|57607_58494_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066277.1|58704_60312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|60328_61378_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066279.1|61424_61583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066280.1|61853_62144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068600.1|62257_62482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420745.1|62498_62951_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066281.1|62982_63333_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066282.1|63398_63638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066283.1|63694_64060_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066284.1|64355_67418_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.4	1.3e-61
WP_155066285.1|67414_68479_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155066286.1|68843_69797_-	glutathione synthase	NA	NA	NA	NA	NA
WP_155066287.1|69828_70992_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_155066288.1|70997_71597_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_155068601.1|71784_72285_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.3e-19
WP_155066289.1|72302_73391_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_155066290.1|73529_74774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066291.1|74770_75613_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_155066292.1|75592_76396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068602.1|76594_76810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066293.1|76810_77779_+	TonB family protein	NA	NA	NA	NA	NA
WP_155068603.1|77834_78386_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_155066294.1|78512_78935_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_155068604.1|78927_79689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066295.1|79731_80430_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_155066296.1|80440_81265_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	2.1e-25
WP_155066297.1|81479_81830_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068605.1|81861_82314_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	149888	330407	3317308	tRNA,tail,protease,transposase	Staphylococcus_phage(22.22%)	176	NA	NA
WP_155066348.1|149888_150557_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155066349.1|151196_154268_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	21.1	3.2e-55
WP_155066350.1|154331_155435_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155066351.1|155458_156013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066352.1|156127_156697_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155066353.1|156816_157569_+	DUF2076 family protein	NA	NA	NA	NA	NA
WP_155066354.1|158325_159183_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_155066355.1|159414_159981_-	DUF1415 family protein	NA	NA	NA	NA	NA
WP_155066356.1|159992_160778_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_155066357.1|161405_162326_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_155066358.1|162386_163382_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_155066359.1|163413_163908_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_017376129.1|163998_164256_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	42.1	1.2e-11
WP_155066360.1|164352_164775_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_155066361.1|165118_165835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066362.1|165878_166130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066363.1|166134_167571_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_155066364.1|167598_169041_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_155066365.1|169114_169453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066366.1|169532_170063_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_155066367.1|170150_172343_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.3	4.8e-106
WP_155066368.1|172385_172865_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_155066369.1|173447_173864_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155066370.1|173881_174163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066371.1|174318_174750_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_155066372.1|174778_175609_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_155066373.1|175635_175767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066374.1|175797_176682_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_155066375.1|176653_176875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|176993_177968_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016210225.1|178154_178433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066376.1|179095_181255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066377.1|181965_182547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066378.1|182850_183018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066379.1|183222_183480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066380.1|184137_184902_+	cadmium carbonic anhydrase	NA	NA	NA	NA	NA
WP_155066381.1|185124_185883_+	ion transporter	NA	NA	NA	NA	NA
WP_155066382.1|185959_186538_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_155066383.1|186635_187511_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155066384.1|187617_187842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066385.1|188777_189569_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	1.7e-13
WP_155066386.1|190420_190933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066387.1|191224_191773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066388.1|191783_192908_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_155066389.1|192914_194156_+	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	26.0	1.8e-17
WP_155066390.1|194185_194923_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155066391.1|195334_196678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066392.1|196968_197562_+	CDP-alcohol phosphatidyltransferase	NA	NA	NA	NA	NA
WP_155066393.1|197530_198184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066394.1|198362_199346_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155066395.1|199368_200265_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_017377592.1|200424_200868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066396.1|200864_201506_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_155066397.1|201616_202195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066398.1|203976_204297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066399.1|204570_205911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066400.1|207553_208537_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	30.5	6.4e-26
WP_155066401.1|208890_209439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066402.1|209407_210560_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	2.6e-58
WP_155066403.1|210587_211187_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066404.1|211309_212195_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066405.1|212355_212799_-	CRS1 / YhbY domain protein	NA	NA	NA	NA	NA
WP_155066406.1|212853_213111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066407.1|213088_213715_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_155068613.1|213792_215775_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|216272_217616_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_017377606.1|217882_220552_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_155066408.1|220575_222495_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_155068614.1|222664_224086_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	1.4e-45
WP_155066409.1|224230_225205_+	phospholipase	NA	NA	NA	NA	NA
WP_155066410.1|225214_225436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|227282_227555_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|227566_228403_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_155068615.1|229149_229371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066411.1|229535_231188_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	65.3	1.1e-182
WP_155066412.1|231261_231552_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_155068616.1|231777_232233_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_155066413.1|232297_232762_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_155066414.1|232853_234200_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_155066415.1|234199_235105_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_155066416.1|235166_236153_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|236145_236388_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_155066417.1|236510_238055_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.2	1.9e-64
WP_155066418.1|238101_239388_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_155066419.1|239430_240834_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_155066404.1|243268_244155_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066420.1|245731_246229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066421.1|246396_247095_-	response regulator	NA	NA	NA	NA	NA
WP_155068617.1|247196_248759_-	amino acid permease	NA	NA	NA	NA	NA
WP_155066422.1|249084_250878_+	M24 family metallopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	40.9	1.0e-117
WP_155066423.1|250964_251237_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_155066424.1|251242_251869_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_155066425.1|251855_253286_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_155066426.1|253607_254663_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.7	5.1e-29
WP_017377631.1|254631_255309_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_155066427.1|255298_256153_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|256301_256595_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_155066428.1|256701_257514_-	trfA family protein	NA	NA	NA	NA	NA
WP_155066429.1|257812_258667_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_155066430.1|258820_259870_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_155066431.1|259875_260571_-	DedA family protein	NA	NA	NA	NA	NA
WP_155066432.1|260588_261869_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_016210096.1|262142_263504_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_155066433.1|263566_264118_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_155066434.1|269549_270821_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_155066435.1|270877_271861_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|271857_272643_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_155066436.1|272956_273403_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_155066437.1|273830_275312_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	27.6	4.8e-49
WP_155066438.1|275367_276477_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.1	1.0e-35
WP_155066439.1|276574_277042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066440.1|277330_278305_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155066441.1|278340_278610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066442.1|278754_279402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066443.1|279546_279849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|279867_280140_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066444.1|280151_280862_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.9	2.1e-34
WP_155066298.1|280858_281230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066445.1|281265_281907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066446.1|281985_282135_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066447.1|282312_282663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066448.1|283289_285308_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_155066449.1|285924_286365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066450.1|286570_287449_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_155066451.1|287432_288446_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066452.1|288469_289531_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068618.1|289857_290220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066453.1|290344_290872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066454.1|291127_291400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066455.1|294100_295216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066456.1|295154_295841_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_155066457.1|295834_296812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066458.1|296846_298010_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|298473_298698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|298851_299217_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066459.1|299162_299738_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210632.1|300053_300341_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_155066460.1|300515_301271_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_155068619.1|301303_301708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066461.1|301683_302160_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_155066462.1|302166_303744_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_155066463.1|303747_304512_+	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
WP_155068620.1|304565_305102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066464.1|305098_305830_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_155066465.1|305912_306815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066440.1|307220_308195_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155066466.1|308171_308336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|308373_308739_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066467.1|308684_309260_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066468.1|309223_310051_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066469.1|311264_311537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211609.1|311638_311947_+	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_155068621.1|311979_314157_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.7	1.7e-140
WP_155066470.1|314274_314508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066471.1|314711_315242_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_155066472.1|315274_315856_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066473.1|316000_316612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066474.1|316921_317173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066475.1|317187_317361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066476.1|317367_317592_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066477.1|317736_318390_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	34.5	8.6e-19
WP_036771330.1|318426_319401_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155066478.1|320067_320259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|320320_320686_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066479.1|320742_320940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066480.1|320936_321986_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066481.1|322082_322355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066482.1|322351_322726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066483.1|322769_323483_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155066484.1|324045_324822_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_155066485.1|324830_326888_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.0e-17
WP_155066486.1|327072_327522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066440.1|327956_328931_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155066487.1|329357_329507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066488.1|329572_329923_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|329954_330407_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	337518	394747	3317308	transposase	Leptospira_phage(16.67%)	51	NA	NA
WP_155066496.1|337518_338355_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	3.2e-42
WP_032126239.1|338366_338639_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066497.1|338812_340417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066498.1|342167_343043_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155066499.1|343055_343736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|343740_345144_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046733.1|346132_346270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066500.1|346206_346980_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066501.1|347312_347678_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210864.1|347805_349104_-	MFS transporter	NA	NA	NA	NA	NA
WP_155066502.1|349368_350334_+	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.1	4.3e-14
WP_155066503.1|350293_350635_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_155066504.1|350660_351440_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_155066505.1|351469_351757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|351851_352097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066506.1|352264_353056_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155066507.1|353215_354040_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066508.1|354090_355206_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155066509.1|356470_357193_+	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_155068623.1|359218_359371_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_155066440.1|359347_360322_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155066510.1|362622_363699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|364569_365388_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_155068624.1|365463_367833_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.2	1.8e-159
WP_155066511.1|368542_369970_+	amino acid permease	NA	NA	NA	NA	NA
WP_155066512.1|370004_370823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066513.1|371183_372407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066514.1|372771_373248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066515.1|374101_374794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068625.1|375419_376394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066516.1|376383_378156_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	25.6	2.1e-14
WP_155066517.1|378156_378504_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155068626.1|378784_380011_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155066518.1|380100_381399_-	MFS transporter	NA	NA	NA	NA	NA
WP_155066519.1|381657_382182_-	hypothetical protein	NA	A0A1W7AG82	Streptococcus_virus	34.7	7.4e-13
WP_155066520.1|382162_382714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066521.1|382933_384232_-	MFS transporter	NA	NA	NA	NA	NA
WP_155066522.1|384348_384639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066523.1|384677_384962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066469.1|385036_385309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|385338_385791_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066524.1|386158_386461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066525.1|386522_386879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066526.1|387023_387578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066527.1|387846_388551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066528.1|388695_390267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066529.1|390990_391245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066530.1|391960_392338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066531.1|392341_393061_+	amino acid permease	NA	NA	NA	NA	NA
WP_155066532.1|393062_393317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066452.1|393685_394747_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	401463	428171	3317308	transposase	Bacillus_phage(50.0%)	23	NA	NA
WP_155066278.1|401463_402513_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066539.1|402884_403718_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.5	2.1e-17
WP_155066540.1|403833_405018_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_155066541.1|405036_405981_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_155066542.1|406572_407358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066543.1|407475_407844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066544.1|408071_409649_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_155066545.1|410377_414862_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_155066546.1|414998_416522_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155066547.1|416610_417090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047317.1|417156_417993_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_032126239.1|418004_418277_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066548.1|418327_418696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066549.1|418840_419182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066550.1|419303_420284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068627.1|420464_420644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066551.1|420821_421217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066552.1|421238_422300_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066553.1|422809_423082_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066554.1|423519_424761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066404.1|425491_426377_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066555.1|426429_427125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|427121_428171_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	512393	542184	3317308	tRNA,transposase	Tupanvirus(16.67%)	30	NA	NA
WP_155066606.1|512393_514325_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.8	1.6e-116
WP_075273353.1|514329_514860_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|514894_515089_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_155066607.1|515131_515491_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_155066608.1|515622_516618_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_155066609.1|516630_519012_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|519017_519305_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_155066553.1|519428_519701_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066610.1|520027_520603_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066611.1|520818_521349_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_155066612.1|521611_521977_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066613.1|522033_522402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|522390_523119_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155066614.1|523322_524096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068634.1|524097_525039_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_155066615.1|525172_526750_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_155066616.1|526893_527943_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066617.1|528108_529005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066404.1|529192_530079_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066618.1|530114_530831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066619.1|531390_532149_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_155068635.1|532357_532930_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_155068636.1|533033_533582_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_155066620.1|534157_534454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066621.1|534688_534844_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066622.1|535478_536365_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066623.1|536649_537513_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_155066624.1|537747_540558_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_155066625.1|540846_541029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066626.1|541233_542184_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	548245	574627	3317308	transposase	Staphylococcus_phage(22.22%)	30	NA	NA
WP_155066278.1|548245_549295_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066633.1|549377_549617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066634.1|549662_550133_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	36.4	1.9e-20
WP_155066635.1|550267_552148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|552894_553869_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155066636.1|554108_555071_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_155066637.1|555070_556309_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_155066638.1|556339_557113_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155066639.1|557093_557954_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_155066640.1|558017_558725_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_155066641.1|558687_559191_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	42.4	1.9e-13
WP_155066642.1|559556_560999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066643.1|561233_561371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066644.1|561373_561763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066645.1|561755_562088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066646.1|562090_562660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066647.1|562691_563069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066648.1|563162_563576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066649.1|564120_565326_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.3	1.4e-35
WP_032126239.1|565533_565806_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047317.1|565817_566654_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_155066650.1|566676_566838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066651.1|566986_568012_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	76.9	5.7e-17
WP_155066652.1|568168_568345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066653.1|568353_569190_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.1	8.4e-43
WP_032126239.1|569201_569474_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066654.1|570294_571269_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.6e-30
WP_155066655.1|571310_572342_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066656.1|572560_573310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066657.1|573544_574627_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.7	8.4e-144
>prophage 7
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	623722	680819	3317308	transposase	Staphylococcus_phage(50.0%)	52	NA	NA
WP_155066696.1|623722_624772_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066440.1|625033_626008_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155066697.1|626340_626544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066698.1|627266_628364_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.1	5.7e-47
WP_155066699.1|628397_629648_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	1.3e-92
WP_155066700.1|629648_630281_-	LysE family translocator	NA	NA	NA	NA	NA
WP_155066701.1|630547_631000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066702.1|631045_631279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|631298_632273_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155066703.1|632316_632994_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_155066704.1|633028_633493_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_155066705.1|633983_635963_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_155068639.1|636227_636629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066706.1|636621_637635_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-15
WP_155066707.1|637621_638410_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_155066708.1|638603_639575_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_155066709.1|639587_640079_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155066710.1|640441_641812_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.2e-110
WP_155066711.1|642115_642586_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	37.3	2.1e-22
WP_155066278.1|642705_643755_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068640.1|644598_645549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068641.1|645823_647989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066712.1|648139_649300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066404.1|649417_650303_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066713.1|650537_653225_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_155066714.1|653329_653755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066715.1|653857_654268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066716.1|655064_655904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066717.1|655906_657100_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_155066718.1|657105_658086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066719.1|658101_659139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066720.1|659153_659576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066721.1|659628_660132_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_155066722.1|660124_660871_+	type IV secretion system protein DotC	NA	NA	NA	NA	NA
WP_155066723.1|660863_661970_+	ATPase	NA	NA	NA	NA	NA
WP_027242627.1|661990_662230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068642.1|662258_664562_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_155066724.1|664570_665032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066725.1|665040_666084_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_027242623.1|666083_666665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068643.1|666699_667122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066726.1|667124_670133_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155066727.1|670101_670956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066728.1|670994_674204_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_155066729.1|674248_674746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066730.1|675065_675716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209685.1|675717_676053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066731.1|676057_676468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068644.1|676458_677412_+	PAP2 family protein	NA	NA	NA	NA	NA
WP_155066732.1|677481_677709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066733.1|677857_679741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066734.1|680003_680819_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	2.7e-14
>prophage 8
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	687778	812087	3317308	tRNA,transposase	Planktothrix_phage(16.0%)	112	NA	NA
WP_155066739.1|687778_688129_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068645.1|688160_688613_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|689000_689453_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_064006185.1|689711_690428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066740.1|691967_692570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066741.1|692627_694448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066742.1|695013_695520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066743.1|695604_697008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068646.1|697122_697377_+	DUF493 family protein	NA	NA	NA	NA	NA
WP_155066744.1|697530_697803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068647.1|699238_699577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066745.1|700311_700554_+	response regulator SirA	NA	NA	NA	NA	NA
WP_155066746.1|700641_701733_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_155066747.1|701713_702667_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	3.8e-31
WP_155066748.1|702889_704374_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	1.4e-45
WP_155066749.1|704413_704917_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	31.1	4.8e-09
WP_155066750.1|705016_705436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066508.1|705716_706832_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155066751.1|706865_707552_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066752.1|707811_708987_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_155068648.1|709134_709539_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155066753.1|709602_709956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066754.1|710177_712424_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.0	1.5e-94
WP_155066755.1|712464_712890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066756.1|713120_714257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066757.1|714243_714534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066758.1|714678_715854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066759.1|715846_716794_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155066760.1|716873_717314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066761.1|717620_718211_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066762.1|718194_718401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066763.1|718521_719055_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_155066764.1|719193_720831_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	4.4e-88
WP_155066765.1|720835_721057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066766.1|721154_722168_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_155066767.1|722332_724561_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.2	1.2e-83
WP_155066768.1|724541_725246_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_155066769.1|725479_725809_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_155066770.1|726059_726572_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155066771.1|726635_727955_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_155066469.1|728192_728465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066772.1|728476_729241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066773.1|729571_731182_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155066774.1|731534_732464_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_155068649.1|732525_733416_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155066775.1|733425_734388_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.5	2.7e-16
WP_155066776.1|734388_735378_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	3.8e-18
WP_016209540.1|735546_735885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066777.1|735881_736457_+	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.0	2.4e-33
WP_155066778.1|736508_736721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066779.1|736907_737747_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	3.7e-46
WP_155066780.1|737779_741205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066781.1|741479_742400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|742436_743486_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066782.1|744160_745171_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	41.6	8.6e-58
WP_155066783.1|745972_747022_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066784.1|747084_747258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066785.1|748272_748929_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066786.1|749622_750582_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|750606_751011_-	RidA family protein	NA	NA	NA	NA	NA
WP_155066787.1|751039_751750_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_155066788.1|751813_753529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209558.1|753525_753888_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_155068650.1|753902_755057_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	32.4	3.9e-38
WP_155066789.1|755060_756068_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.2	1.1e-36
WP_155066790.1|756070_757087_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	26.1	3.2e-12
WP_155066791.1|757301_758378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066792.1|758465_758858_-	RidA family protein	NA	NA	NA	NA	NA
WP_155066793.1|758990_760274_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_155066794.1|760289_761591_+	aspartate kinase	NA	NA	NA	NA	NA
WP_155066795.1|761605_763408_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155068651.1|763418_764405_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155066796.1|764485_765562_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155066797.1|765661_766636_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.8	3.3e-14
WP_155068652.1|766696_767674_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.3	1.7e-15
WP_155066798.1|767858_768128_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_155066799.1|768448_769735_+	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_155066800.1|769799_770486_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066801.1|776150_778220_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	2.2e-07
WP_155066404.1|778495_779382_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066802.1|779486_780236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066803.1|780263_780446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066804.1|780504_781200_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.5	1.6e-10
WP_155066805.1|782076_783216_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	1.9e-61
WP_155066806.1|783424_784771_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_155066807.1|784885_785878_+	AAA family ATPase	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_155066808.1|785880_786378_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_155066809.1|786374_787214_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155066810.1|787246_788797_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_155068653.1|788904_789288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066811.1|789457_790081_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.6	4.5e-33
WP_155066812.1|790225_790363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|790381_790654_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047317.1|790665_791502_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_155066813.1|792390_793212_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_155066814.1|793213_794251_-	asparaginase	NA	NA	NA	NA	NA
WP_155066815.1|794251_796909_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_155066816.1|796986_797796_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376219.1|798204_798972_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_155066817.1|799142_800021_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_064004235.1|800024_800762_+	UMP kinase	NA	NA	NA	NA	NA
WP_017376216.1|800765_801323_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_155066818.1|801330_802077_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.3	2.5e-22
WP_155066819.1|802084_802891_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_155066820.1|802978_803854_+	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_155066821.1|803945_805244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066496.1|805314_806151_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	3.2e-42
WP_032126239.1|806162_806435_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066822.1|806490_806667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066823.1|807144_809076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066440.1|809303_810278_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155066824.1|811013_812087_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	830199	891010	3317308	tRNA,transposase	Leptospira_phage(25.0%)	48	NA	NA
WP_155066837.1|830199_831645_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_155066838.1|831680_833210_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_155047317.1|833538_834375_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_032126239.1|834386_834659_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066839.1|835014_836718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066840.1|837260_838229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066841.1|838584_839436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066842.1|839727_842418_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_155066843.1|842664_843879_+	MFS transporter	NA	NA	NA	NA	NA
WP_155066844.1|844033_845749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066508.1|847362_848478_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155066845.1|848528_849353_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066846.1|849966_850803_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	4.2e-42
WP_032126239.1|850814_851087_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066847.1|852947_853139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066848.1|854185_854725_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	53.8	2.4e-35
WP_155066849.1|854889_856146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066440.1|856560_857535_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155066850.1|857627_857933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066610.1|857878_858454_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066851.1|859330_859531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066852.1|859853_860267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066853.1|860904_861183_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|861218_862193_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155066854.1|862859_863120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066855.1|863747_863948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066856.1|864152_865808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066440.1|865866_866841_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155066857.1|867095_867716_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155066858.1|868034_870002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066859.1|870158_871616_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.3	6.5e-99
WP_155066860.1|871684_873265_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	26.8	6.7e-17
WP_155066861.1|873305_873854_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_155066862.1|873899_877796_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	2.0e-118
WP_016210741.1|877802_878126_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_155066863.1|878196_878652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066864.1|878683_879679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066865.1|879930_881565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068654.1|881924_882872_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.9	7.3e-35
WP_017377238.1|883190_883535_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_155068655.1|883664_884300_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_155068656.1|884340_885168_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_036772199.1|885254_885782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066866.1|886669_887089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066867.1|887198_887780_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_032126239.1|888401_888674_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066508.1|888997_890113_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155066868.1|890146_891010_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.1	8.7e-43
>prophage 10
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	905848	1027933	3317308	protease,transposase	Bacillus_phage(20.0%)	109	NA	NA
WP_155066879.1|905848_906046_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155066881.1|906090_906384_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	38.5	5.8e-07
WP_155066496.1|908294_909131_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	3.2e-42
WP_032126239.1|909142_909415_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066882.1|909481_909736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066884.1|910165_910351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066885.1|910812_911778_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.8	4.7e-45
WP_155066886.1|911822_912398_-	bleomycin resistance protein	NA	NA	NA	NA	NA
WP_155066889.1|912428_913703_-	MFS transporter	NA	NA	NA	NA	NA
WP_155066891.1|914354_915068_+	aldolase	NA	NA	NA	NA	NA
WP_155066892.1|915145_915883_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_155066894.1|916003_917359_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_155066297.1|918019_918370_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068658.1|918401_918854_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066895.1|919239_920115_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.6	1.7e-33
WP_155066896.1|920717_922022_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|922134_922740_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|922821_924123_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_155066897.1|924190_926623_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.6e-219
WP_016209655.1|926726_926999_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_155066898.1|927081_928980_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_155066899.1|929012_929897_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.7	2.2e-41
WP_155066900.1|929905_930301_-	CrcB family protein	NA	NA	NA	NA	NA
WP_155066901.1|930725_932873_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	7.0e-25
WP_155066903.1|932844_934194_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155066905.1|934190_936311_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.0	1.5e-16
WP_155066907.1|936307_938011_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.0	4.4e-22
WP_155066909.1|938144_939287_-	galactokinase	NA	NA	NA	NA	NA
WP_155066910.1|939356_939803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066404.1|939840_940726_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066278.1|940781_941831_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066912.1|941877_942465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066913.1|942602_943631_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_155066914.1|943757_945272_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_155066915.1|945383_945665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047317.1|945825_946662_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_032126239.1|946673_946946_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066916.1|947689_948616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066917.1|948814_949030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066440.1|949026_950001_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155066918.1|950142_950970_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066919.1|952093_952276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066920.1|952882_953689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066921.1|954032_955925_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	33.0	1.6e-81
WP_155066922.1|956217_958566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066923.1|958911_959262_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068659.1|959293_959746_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066924.1|959794_960799_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066925.1|961048_961252_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066926.1|961590_961887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066927.1|961952_963359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|963916_964189_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|964200_965037_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_027243159.1|966992_967175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|967238_967466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066928.1|967678_968443_+	DNA/RNA endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	32.6	1.1e-28
WP_026063577.1|968669_968963_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_155066929.1|969034_969652_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.3	7.6e-17
WP_155066930.1|969812_970790_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_155066931.1|970886_972353_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_155066932.1|972379_973033_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155066933.1|973157_973724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066934.1|973972_975751_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	29.4	3.4e-33
WP_155068660.1|975822_977529_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.6	2.9e-21
WP_155066935.1|977520_978549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|978898_979249_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066937.1|979175_979382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|979432_979705_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066496.1|979716_980553_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	3.2e-42
WP_155066938.1|981296_981746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068661.1|982232_983654_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_155066939.1|984035_985478_+	MFS transporter	NA	NA	NA	NA	NA
WP_155068662.1|985671_985740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066940.1|986604_987168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066941.1|987142_987280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066942.1|987438_987930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|989281_990331_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066943.1|990401_990812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066944.1|991001_992210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066945.1|992343_992490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066946.1|992477_992813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066947.1|993167_994022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066948.1|994359_995535_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_155066949.1|998734_999871_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_155066950.1|1000517_1001207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066951.1|1001396_1002143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066952.1|1002240_1002771_+	cytochrome B	NA	NA	NA	NA	NA
WP_155066953.1|1002841_1004020_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.9	7.7e-50
WP_155066954.1|1004168_1008005_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_155066955.1|1007991_1009494_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_155068663.1|1010045_1010681_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_155066956.1|1011116_1012364_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_155066404.1|1012908_1013795_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066957.1|1013858_1014722_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066958.1|1015761_1016598_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	2.7e-41
WP_032126239.1|1016609_1016882_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066959.1|1016948_1017395_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066960.1|1017610_1019047_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155066961.1|1019134_1019674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066962.1|1020028_1020541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066963.1|1020809_1021376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066964.1|1021473_1022523_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066965.1|1022548_1023253_-	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_155066966.1|1023268_1023661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068664.1|1023805_1024168_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066967.1|1024655_1025027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066968.1|1025333_1025993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066969.1|1026207_1026510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1026958_1027933_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 11
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	1038313	1211812	3317308	tRNA,integrase,protease,transposase	Leptospira_phage(16.67%)	161	1025742:1025801	1100591:1100913
1025742:1025801	attL	TTCATCGCTGTAGGGTTTTTCAGCAATCATATCATCTAAGGCTAAAACTCCATCATCAAG	NA	NA	NA	NA
WP_155066977.1|1038313_1038559_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155068600.1|1039483_1039708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066978.1|1039829_1040804_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	7.3e-30
WP_155066979.1|1040823_1041054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|1041110_1041476_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066980.1|1041971_1043078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066981.1|1043317_1044307_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066982.1|1044405_1045541_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.6	1.3e-57
WP_155066983.1|1045774_1046068_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.5	2.9e-06
WP_155066984.1|1046053_1046233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066985.1|1046532_1048977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066923.1|1050069_1050420_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068665.1|1050451_1050946_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066986.1|1051509_1053381_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	31.1	5.5e-34
WP_155066987.1|1053472_1055218_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_155066988.1|1055297_1055747_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	5.4e-20
WP_016211035.1|1055799_1056015_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_155066989.1|1056261_1057278_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.6	3.5e-99
WP_155066990.1|1057326_1057956_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_155066991.1|1058267_1059479_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155066992.1|1059575_1060577_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155066993.1|1060675_1061884_-	MFS transporter	NA	NA	NA	NA	NA
WP_155066994.1|1061873_1063601_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_155068666.1|1063784_1064756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066995.1|1065427_1065868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066996.1|1066072_1066306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066997.1|1066420_1067755_-	dihydroorotase	NA	NA	NA	NA	NA
WP_155066998.1|1067883_1068525_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210566.1|1068830_1069253_+	universal stress protein	NA	NA	NA	NA	NA
WP_155066999.1|1069596_1070559_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_155068667.1|1070597_1071773_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_155067000.1|1071861_1073562_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_155067001.1|1073561_1075100_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	36.9	1.0e-70
WP_155067002.1|1075128_1076781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|1076854_1077610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067003.1|1077951_1079241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067004.1|1079471_1080659_-	MFS transporter	NA	NA	NA	NA	NA
WP_155067005.1|1080839_1081481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067006.1|1081554_1082904_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	26.9	1.3e-32
WP_155068668.1|1083007_1085188_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_155067007.1|1085432_1085744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066653.1|1086382_1087219_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.1	8.4e-43
WP_155067008.1|1087251_1087779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068669.1|1087758_1088337_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	3.4e-19
WP_155067009.1|1088747_1089410_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1089440_1089809_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_155067010.1|1089819_1091136_-	MFS transporter	NA	NA	NA	NA	NA
WP_155068670.1|1091418_1091994_+	DedA family protein	NA	NA	NA	NA	NA
WP_016211261.1|1092419_1092713_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_122940630.1|1092902_1093256_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_155067011.1|1093310_1095584_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	2.3e-167
WP_155067012.1|1095629_1096220_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1096524_1096797_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047317.1|1096808_1097645_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_155067013.1|1097964_1099117_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	1.4e-59
WP_155068671.1|1099145_1099751_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.6e-09
WP_155067014.1|1100074_1100329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067015.1|1100473_1100842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211259.1|1100954_1101200_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
1100591:1100913	attR	TTCATCGCTGTAGGGTTTTTCAGCAATCATATCATCTAAGGCTAAAACTCCATCATCAAGTCCCTCATACTCACGAACATCAGCCTTAATTTTTAACCAAAGGTCTTTTGATGTTTGTGGGGTTTTATTCAATAAGCGAGTTATCTGATCATGTGACAATTCGTCAGGCATTAAATCTGCTAATCCGGTAGCTGTTGCATGTTTGTTTTGAGCGATTAGATAGTCTGTGTATATGTCAGCAAGGTTTAACATTATTACCAAAAAAATCAAGTTGTTGAACAAAACATTATAGTATCAATTAGCTCTTGCTGCGTAACATGAGT	NA	NA	NA	NA
WP_155068672.1|1101289_1102045_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_155067016.1|1102028_1102985_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.3	3.5e-61
WP_155067017.1|1103247_1105779_+	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	2.2e-86
WP_155067018.1|1105771_1106512_+	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_155066278.1|1106640_1107690_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940639.1|1108135_1108930_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_155067019.1|1109092_1109881_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_155067020.1|1109877_1111089_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7C038	Faustovirus	31.1	6.1e-34
WP_155067021.1|1111078_1111438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067022.1|1111533_1111962_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	4.0e-17
WP_155068673.1|1112113_1113223_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_155067023.1|1113219_1113948_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_155067024.1|1114004_1114886_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376087.1|1114970_1115345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067025.1|1115444_1116722_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	4.8e-21
WP_155067026.1|1116733_1117465_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_155067027.1|1117436_1118693_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_155067028.1|1118802_1120206_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_016209408.1|1120358_1120529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067029.1|1120841_1121663_+	AAA family ATPase	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155067030.1|1121659_1122553_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375750.1|1122598_1123120_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_155067031.1|1123196_1123682_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_155067032.1|1123969_1124758_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_155067033.1|1124747_1125611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209435.1|1125637_1126009_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_155067034.1|1126109_1127066_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_155067035.1|1127549_1130222_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_155067036.1|1130303_1130930_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_155067037.1|1131086_1132685_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_155067038.1|1132774_1134196_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155067039.1|1134226_1134748_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	4.0e-11
WP_155067040.1|1134744_1135350_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_155067041.1|1135426_1136437_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.9e-07
WP_155067042.1|1136549_1137254_+	protein TolQ	NA	NA	NA	NA	NA
WP_155067043.1|1137288_1137720_+	protein TolR	NA	NA	NA	NA	NA
WP_155067044.1|1137722_1138775_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_155067045.1|1138834_1140187_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_155067046.1|1140222_1140864_+	OmpA family protein	NA	NA	NA	NA	NA
WP_155067047.1|1140900_1141827_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_155067048.1|1141829_1142477_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.8	5.3e-37
WP_155067049.1|1142527_1143331_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	1.2e-41
WP_155067050.1|1143511_1143727_+	slyX family protein	NA	NA	NA	NA	NA
WP_155067051.1|1143733_1143964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068674.1|1144025_1145618_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_155067052.1|1145819_1146749_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	31.3	1.6e-13
WP_155067053.1|1146750_1147518_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_155067054.1|1147884_1148652_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_155067055.1|1148689_1149052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067056.1|1149224_1150934_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155067057.1|1151196_1152513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067058.1|1152900_1154373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067059.1|1154657_1155032_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067060.1|1155176_1155782_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	34.4	2.8e-16
WP_032126239.1|1155793_1156066_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067061.1|1156514_1157021_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067062.1|1157673_1158303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067063.1|1158306_1159257_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066404.1|1159253_1160140_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067064.1|1160602_1161892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067065.1|1162318_1163602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067066.1|1163808_1165746_-	histidine kinase	NA	NA	NA	NA	NA
WP_155067067.1|1166756_1167476_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_155067068.1|1167589_1171129_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_155067069.1|1171196_1172027_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_155067070.1|1172013_1174053_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	41.2	7.1e-128
WP_155067071.1|1174068_1175121_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_155067072.1|1175131_1175662_+	exsB family protein	NA	NA	NA	NA	NA
WP_054300641.1|1176821_1177187_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155067073.1|1177132_1177708_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067074.1|1177704_1177848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067075.1|1181428_1181812_+	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_155068675.1|1181887_1182181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067076.1|1182348_1183716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066480.1|1183768_1184818_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066812.1|1185579_1185717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067077.1|1185954_1186089_-	phosphatase	NA	NA	NA	NA	NA
WP_155067078.1|1186035_1186647_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.0	3.7e-32
WP_155067079.1|1186715_1187330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067080.1|1187548_1188403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067081.1|1188679_1188898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067082.1|1189062_1190433_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_155067083.1|1190425_1191379_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_155067084.1|1191359_1194164_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	9.0e-57
WP_155067085.1|1194243_1194840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067086.1|1195229_1195985_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155067087.1|1196188_1196830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067088.1|1197101_1198427_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_155067089.1|1198423_1200481_+	crotonase	NA	NA	NA	NA	NA
WP_155067090.1|1200458_1201031_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155067091.1|1201086_1201446_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_155067092.1|1201525_1202560_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_155067093.1|1202547_1203669_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_122941582.1|1203762_1204746_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_155067094.1|1204902_1206570_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.3	1.2e-19
WP_155067095.1|1206916_1207678_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.1	1.6e-48
WP_155068676.1|1207752_1207941_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067096.1|1208015_1209053_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067097.1|1209159_1209744_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	39.1	1.5e-35
WP_155066404.1|1209747_1210634_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067098.1|1210970_1211291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066610.1|1211236_1211812_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	1231073	1284605	3317308	transposase	Leptospira_phage(33.33%)	50	NA	NA
WP_155067115.1|1231073_1231925_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1231925_1232198_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1232209_1233046_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_155067116.1|1233054_1233357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068678.1|1233466_1233586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067117.1|1233575_1235792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067118.1|1235992_1237585_+	B-type flagellin	NA	NA	NA	NA	NA
WP_155067119.1|1237809_1239387_+	B-type flagellin	NA	NA	NA	NA	NA
WP_155067120.1|1239492_1239924_+	flaG family protein	NA	NA	NA	NA	NA
WP_155067121.1|1240043_1241429_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_155067122.1|1241454_1241892_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_155067123.1|1241896_1242238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067124.1|1242252_1244241_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155067125.1|1244269_1244950_+	glycosyl transferase family 2	NA	NA	NA	NA	NA
WP_155067126.1|1244972_1247147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067127.1|1247395_1248949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067128.1|1249020_1249842_+	DUF1338 family protein	NA	NA	NA	NA	NA
WP_155067129.1|1249973_1250195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067130.1|1250789_1252262_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.8	3.7e-33
WP_155067131.1|1252565_1255259_+	DNA repair protein	NA	NA	NA	NA	NA
WP_155067132.1|1255255_1258657_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	1.0e-09
WP_155067133.1|1258907_1259222_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155067134.1|1259187_1259793_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067135.1|1260839_1261511_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_155067136.1|1262217_1262568_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066404.1|1262817_1263703_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067137.1|1264200_1264956_-	zinc transporter	NA	NA	NA	NA	NA
WP_155067138.1|1265250_1266801_+	dolichyl-phosphate-mannose-protein mannosyltransferase	NA	NA	NA	NA	NA
WP_155067139.1|1267398_1267734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067140.1|1267702_1267873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067141.1|1268293_1268458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067142.1|1268689_1268851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067143.1|1269203_1269389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067144.1|1269487_1269724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067145.1|1269708_1272732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067146.1|1272999_1273596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067147.1|1273705_1273861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067148.1|1274029_1275046_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_155067149.1|1275064_1276093_+	chorismate mutase	NA	NA	NA	NA	NA
WP_155067150.1|1276146_1277451_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_155067151.1|1277441_1278008_+	shikimate kinase	NA	NA	NA	NA	NA
WP_155067152.1|1277997_1279080_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	2.7e-73
WP_155067153.1|1279122_1280226_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_155067154.1|1280266_1280755_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_155067155.1|1281120_1281309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1281285_1282260_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155067156.1|1282449_1283178_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067157.1|1283196_1283577_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067158.1|1283766_1284321_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	34.0	2.1e-18
WP_032126239.1|1284332_1284605_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	1321218	1347293	3317308	transposase	Leptospira_phage(33.33%)	26	NA	NA
WP_155067186.1|1321218_1322322_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	32.1	1.8e-21
WP_155067187.1|1322357_1322513_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155067188.1|1322862_1323666_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067189.1|1323687_1324044_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155067190.1|1324006_1324510_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067191.1|1325002_1326247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243003.1|1327294_1328656_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_155067192.1|1328751_1329411_-	response regulator	NA	NA	NA	NA	NA
WP_155067193.1|1329912_1330197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1330401_1330674_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047317.1|1330685_1331522_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_155067194.1|1331672_1331885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067195.1|1331943_1332918_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	9.5e-30
WP_155067196.1|1333342_1334902_-	amino acid permease	NA	NA	NA	NA	NA
WP_155067197.1|1335263_1337234_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.2	7.2e-77
WP_155067198.1|1337431_1338502_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155067199.1|1338559_1338766_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_155067200.1|1338772_1340248_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_054300641.1|1340756_1341122_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066459.1|1341067_1341643_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1342922_1343195_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047317.1|1343206_1344043_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_155067201.1|1344315_1345218_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067202.1|1345627_1345960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067203.1|1346073_1346226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067204.1|1346318_1347293_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	6.8e-28
>prophage 14
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	1356095	1403234	3317308	tRNA,protease,transposase	Leptospira_phage(20.0%)	41	NA	NA
WP_155066278.1|1356095_1357145_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066508.1|1357515_1358631_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155067213.1|1359084_1360620_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_155067214.1|1360744_1362229_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_155046733.1|1363352_1363490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067215.1|1363426_1364425_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067216.1|1364920_1365118_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067217.1|1365155_1365626_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	48.2	4.0e-34
WP_155067218.1|1365639_1365795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067219.1|1365953_1366415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067220.1|1366469_1369040_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.8	3.5e-31
WP_155067221.1|1369147_1369633_+	nicotinamide-nucleotide amidohydrolase family protein	NA	B5TK85	Pseudomonas_phage	54.9	4.4e-36
WP_122941088.1|1369804_1370845_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_155067222.1|1370822_1371305_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_155067223.1|1371301_1373896_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	1.8e-88
WP_017376461.1|1374202_1374466_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_155067224.1|1374744_1375173_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_155067225.1|1375211_1375526_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067226.1|1376905_1377781_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155067227.1|1378635_1378788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067228.1|1378932_1379238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067229.1|1379718_1381281_-	peptide-binding protein	NA	NA	NA	NA	NA
WP_155067230.1|1382363_1382825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067231.1|1383045_1383990_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067232.1|1384530_1386006_-	amino acid permease	NA	NA	NA	NA	NA
WP_155067233.1|1386241_1386436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067234.1|1386528_1387551_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_155067235.1|1387881_1389249_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_026063533.1|1389474_1389729_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_155067236.1|1389744_1391031_+	GTPase HflX	NA	NA	NA	NA	NA
WP_155067237.1|1391050_1392265_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_155067238.1|1392264_1393158_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_155067239.1|1393355_1394654_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.8	3.2e-65
WP_155067240.1|1396033_1398433_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	8.0e-70
WP_155067241.1|1398429_1399188_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_155067242.1|1399364_1399754_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_155067243.1|1400197_1400461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066370.1|1400515_1400797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067244.1|1400933_1402073_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.0	2.8e-25
WP_032126239.1|1402113_1402386_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047317.1|1402397_1403234_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
>prophage 15
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	1426261	1598583	3317308	tRNA,integrase,transposase	Leptospira_phage(25.64%)	166	1485460:1485519	1557413:1558517
WP_155067261.1|1426261_1427029_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066923.1|1427090_1427441_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067262.1|1427367_1427808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066508.1|1427858_1428974_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155066469.1|1429442_1429715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067263.1|1429769_1431020_-	MFS transporter	NA	NA	NA	NA	NA
WP_155067264.1|1431313_1431649_-	DUF3470 domain-containing protein	NA	NA	NA	NA	NA
WP_016211283.1|1431960_1432209_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377443.1|1432244_1432754_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_155067265.1|1432753_1433533_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_155067266.1|1433550_1433898_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_155067267.1|1434009_1434285_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	51.9	3.0e-13
WP_155067268.1|1434375_1434768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|1434795_1435248_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067269.1|1435279_1435630_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068645.1|1435670_1436123_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067270.1|1436154_1436505_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067271.1|1436559_1437660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067272.1|1437631_1437880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067273.1|1438085_1438232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067274.1|1438803_1439211_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	56.0	2.5e-32
WP_155067275.1|1439263_1439362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067276.1|1439608_1439830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067277.1|1440076_1440883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067278.1|1441138_1441966_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155067279.1|1441995_1442850_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_155067280.1|1444418_1444859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067281.1|1444878_1445769_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155066278.1|1445765_1446815_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067282.1|1447967_1449326_-	AAA family ATPase	NA	G3MBE0	Bacillus_virus	37.4	2.0e-70
WP_155067283.1|1449607_1449967_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210111.1|1450368_1452003_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_155067284.1|1452009_1452846_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	7.6e-52
WP_155067285.1|1452867_1454145_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	61.2	7.3e-139
WP_155067286.1|1454232_1454553_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_155067287.1|1454576_1455668_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_155067288.1|1455851_1457441_+	amino acid permease	NA	NA	NA	NA	NA
WP_155067289.1|1457501_1458275_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	1.5e-65
WP_155067290.1|1458445_1459495_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.1	1.0e-29
WP_155047317.1|1460207_1461044_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_032126239.1|1461055_1461328_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067291.1|1461328_1462129_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.4	3.7e-40
WP_155067292.1|1462180_1462897_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	4.4e-40
WP_155067293.1|1463212_1463353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068686.1|1463636_1463909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067294.1|1463981_1465241_-	phosphoesterase	NA	NA	NA	NA	NA
WP_155067295.1|1465344_1466610_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_155067296.1|1466768_1467251_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_155067297.1|1467329_1468790_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.1e-57
WP_155067298.1|1469743_1470244_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_155067299.1|1477125_1478367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1478911_1479184_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047317.1|1479195_1480032_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_155067300.1|1480195_1481791_+	cytochrome bd-I ubiquinol oxidase subunit CydA	NA	NA	NA	NA	NA
WP_032126239.1|1482495_1482768_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047317.1|1482779_1483616_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_155067301.1|1484171_1484318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066785.1|1484868_1485525_-|transposase	transposase	transposase	NA	NA	NA	NA
1485460:1485519	attL	ACGCTGCGAGCCAAGGAGTGCAAGGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTT	NA	NA	NA	NA
WP_155067302.1|1485631_1485877_-	hypothetical protein	NA	NA	NA	NA	NA
1485460:1485519	attL	ACGCTGCGAGCCAAGGAGTGCAAGGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTT	NA	NA	NA	NA
WP_155067303.1|1486517_1487000_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	47.9	9.2e-34
WP_155068687.1|1487144_1487492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212445.1|1487629_1487896_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155067304.1|1488242_1488656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067305.1|1488703_1489777_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067306.1|1491338_1492208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067307.1|1492247_1494182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067308.1|1494576_1495164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067309.1|1495343_1495808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068688.1|1496212_1496662_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_155068689.1|1496781_1497165_+	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
WP_155067310.1|1497310_1497640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067311.1|1497872_1498376_-	methyltransferase domain-containing protein	NA	R4ZEC6	Mythimna_separata_entomopoxvirus	30.3	2.4e-08
WP_155067312.1|1498779_1499796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067313.1|1500736_1501315_+	nucleoside deaminase	NA	S4VYT2	Pandoravirus	34.1	4.3e-14
WP_155067314.1|1501342_1501738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067315.1|1501843_1503301_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_155067316.1|1503362_1504850_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_155067317.1|1505619_1506222_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1506578_1507049_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_155067318.1|1507202_1507652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067319.1|1507891_1508233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|1508279_1509329_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066496.1|1509504_1510341_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	3.2e-42
WP_032126239.1|1510352_1510625_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067320.1|1510691_1512011_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155066278.1|1512077_1513127_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068690.1|1516819_1518082_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_155067321.1|1518170_1519976_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1520535_1521333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067322.1|1521502_1521964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|1522884_1523934_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066440.1|1524335_1525310_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155067323.1|1525419_1526573_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.3e-59
WP_155067324.1|1526674_1527130_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	33.6	6.4e-13
WP_033923779.1|1527280_1528117_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1528128_1528401_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068691.1|1528568_1528808_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067325.1|1529066_1531022_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_155067326.1|1531412_1531598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067327.1|1531934_1532924_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_155066404.1|1533203_1534090_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067328.1|1534338_1535961_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.2	3.5e-29
WP_017376830.1|1536070_1536385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067329.1|1536752_1537598_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	27.9	1.7e-06
WP_155066469.1|1537581_1537854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067330.1|1538213_1538804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067331.1|1538814_1540410_-	amino acid permease	NA	NA	NA	NA	NA
WP_155067332.1|1540545_1541373_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_155067333.1|1543096_1543708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420684.1|1543890_1544139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066440.1|1544787_1545762_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155066653.1|1546594_1547431_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.1	8.4e-43
WP_032126239.1|1547442_1547715_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067334.1|1548306_1548507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067335.1|1548889_1549696_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1549767_1550742_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155067336.1|1550915_1551887_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155067337.1|1551868_1552840_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155068692.1|1553397_1553676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067338.1|1553728_1553974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068693.1|1554575_1554806_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	53.4	5.3e-16
1553940:1554230	attR	ACGCTGCGAGCCAAGGAGTGCAAGGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGGCCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTA	NA	NA	NA	NA
WP_155067339.1|1554821_1554962_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	63.0	5.9e-10
1553940:1554230	attR	ACGCTGCGAGCCAAGGAGTGCAAGGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGGCCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTA	NA	NA	NA	NA
WP_155067340.1|1554977_1555262_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155067341.1|1555688_1556129_-	universal stress family protein	NA	NA	NA	NA	NA
WP_036771330.1|1556459_1557434_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155067342.1|1557913_1558888_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.3e-28
WP_155067343.1|1559250_1560189_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027242821.1|1560252_1562247_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|1562243_1562846_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_155067344.1|1562842_1563181_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_155067345.1|1563256_1564477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067346.1|1564553_1565615_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211856.1|1566136_1566322_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_017377178.1|1566449_1566917_+	bacterioferritin	NA	NA	NA	NA	NA
WP_017377177.1|1566913_1567792_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_155068694.1|1568043_1569351_+	MFS transporter	NA	NA	NA	NA	NA
WP_155067347.1|1569694_1571221_+	IraAB	NA	NA	NA	NA	NA
WP_155067348.1|1571280_1571430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067349.1|1571735_1572512_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155067350.1|1572657_1573899_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_155067351.1|1574357_1575407_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067352.1|1575403_1575736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066404.1|1575696_1576582_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067353.1|1576572_1576971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067354.1|1577201_1578422_-	amino acid permease	NA	NA	NA	NA	NA
WP_155068695.1|1578783_1580778_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_155067355.1|1580888_1581491_-	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
WP_155067356.1|1581557_1582481_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_155067357.1|1582501_1582966_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_155067358.1|1583028_1584057_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_155067359.1|1584147_1584528_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_155067360.1|1584558_1584888_+	DUF4404 family protein	NA	NA	NA	NA	NA
WP_155067361.1|1585586_1585793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1585887_1586862_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155067362.1|1587066_1587981_-	EamA family transporter	NA	NA	NA	NA	NA
WP_155068696.1|1588027_1588678_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1589898_1590873_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155067363.1|1591772_1592750_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_155067364.1|1592772_1593447_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_155067365.1|1593431_1594685_-	MFS transporter	NA	NA	NA	NA	NA
WP_155046733.1|1595065_1595203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067366.1|1595139_1595508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067367.1|1595652_1596426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068697.1|1596644_1597196_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	26.3	3.7e-07
WP_032126239.1|1597462_1597735_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047317.1|1597746_1598583_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
>prophage 16
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	1620624	1657652	3317308	transposase	Staphylococcus_phage(40.0%)	37	NA	NA
WP_155067379.1|1620624_1621416_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.9	5.2e-42
WP_032126239.1|1621427_1621700_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067380.1|1622509_1623232_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_155067381.1|1623964_1624426_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_017377126.1|1624436_1625885_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_155067382.1|1625925_1626681_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.0	2.0e-11
WP_155067383.1|1626661_1628062_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_155067384.1|1628085_1629303_+	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.3	3.4e-93
WP_016209778.1|1629333_1629708_+	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_017377121.1|1629726_1630278_+	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_155067385.1|1630625_1631063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1631823_1632798_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155067386.1|1632833_1633424_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1633424_1633697_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047317.1|1633708_1634545_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_155067387.1|1634567_1634927_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155067388.1|1635220_1636372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067389.1|1636382_1637570_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.0e-21
WP_017376484.1|1637719_1638346_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_155067390.1|1638391_1639621_+	nucleoside:proton symporter	NA	B2YG43	Musca_hytrovirus	22.1	2.6e-08
WP_155067391.1|1639815_1640379_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155067392.1|1640453_1641812_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_036771330.1|1641967_1642942_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155066440.1|1643171_1644146_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155067393.1|1644539_1644722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067394.1|1645080_1646055_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	6.2e-29
WP_155067395.1|1646078_1646405_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067396.1|1646331_1646631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067397.1|1647469_1648090_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_155067398.1|1648163_1649447_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_155067399.1|1649786_1651085_+	ankryin	NA	NA	NA	NA	NA
WP_155067400.1|1651225_1652602_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_155067401.1|1653242_1653755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067402.1|1653873_1654356_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.3	3.4e-12
WP_155066978.1|1654414_1655389_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	7.3e-30
WP_155068699.1|1656181_1656319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|1656677_1657652_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 17
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	1674087	1716561	3317308	integrase,protease,transposase	Leptospira_phage(37.5%)	45	1674425:1674484	1712302:1712679
WP_155067419.1|1674087_1674873_-|transposase	transposase	transposase	NA	NA	NA	NA
1674425:1674484	attL	ACCTGTACTTTGAAAGCCATACCTTTTAAGTACACAGTCTGAGGAATGCCGTCTTCTAAT	NA	NA	NA	NA
WP_032126239.1|1674873_1675146_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066496.1|1675157_1675994_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	3.2e-42
WP_155067420.1|1676002_1676371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067421.1|1676831_1676987_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1677009_1677846_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1677857_1678130_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066653.1|1678349_1679186_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.1	8.4e-43
WP_155067422.1|1679229_1679820_+	MFS transporter	NA	NA	NA	NA	NA
WP_155066508.1|1679968_1681084_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155068701.1|1681756_1682536_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016210843.1|1683147_1683378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067423.1|1683464_1684592_+	DUF4172 domain-containing protein	NA	D7RWK9	Brochothrix_phage	22.5	6.9e-08
WP_036771330.1|1685309_1686284_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155068702.1|1686385_1687147_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_155067424.1|1687312_1689883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067425.1|1690034_1690808_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155067426.1|1690859_1691003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067427.1|1691348_1691729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1692000_1692975_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155067428.1|1693134_1694463_-	amino acid carrier protein	NA	NA	NA	NA	NA
WP_155067429.1|1694726_1695296_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	38.9	1.2e-29
WP_155067430.1|1695311_1695623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068703.1|1695632_1696601_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1696711_1697065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067431.1|1697068_1698133_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_155067432.1|1698133_1699873_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	9.9e-54
WP_155067433.1|1699879_1700302_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_155067434.1|1700285_1700915_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_155067435.1|1701150_1701249_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155067436.1|1701281_1703159_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_155067437.1|1703304_1703793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067438.1|1703937_1704177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067439.1|1704321_1704738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067440.1|1704882_1705230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067441.1|1706175_1706460_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155068704.1|1706957_1707638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067442.1|1707637_1707940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067443.1|1708036_1709158_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771628.1|1709551_1710673_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_155067444.1|1711648_1712404_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_155067445.1|1712650_1712986_+	hypothetical protein	NA	NA	NA	NA	NA
1712302:1712679	attR	ATTAGAAGACGGCATTCCTCAGACTGTGTACTTAAAAGGTATGGCTTTCAAAGTACAGGTCGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGCCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCCTTGCACTCCTTGGCTCGCAGCGTATGAAAAAAACATTCAAAAACGAAAATGG	NA	NA	NA	NA
WP_155067446.1|1713904_1714288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067447.1|1714303_1715638_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_155066404.1|1715675_1716561_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	1732198	1786614	3317308	tRNA,transposase	Tupanvirus(15.38%)	48	NA	NA
WP_155066278.1|1732198_1733248_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067465.1|1734015_1734901_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067466.1|1735788_1736613_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	8.1e-06
WP_155067467.1|1736738_1737026_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047317.1|1737044_1737881_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_032126239.1|1737892_1738165_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067468.1|1738369_1738516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067469.1|1740327_1741029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067470.1|1741103_1741283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067471.1|1741344_1741701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067472.1|1741778_1742522_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_155067473.1|1742535_1743579_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_155067474.1|1743711_1745484_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	39.5	6.4e-08
WP_155068706.1|1745690_1746824_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	1.6e-15
WP_155067475.1|1747373_1750193_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	5.2e-312
WP_155067476.1|1750566_1751292_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_155067477.1|1751406_1754385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1754435_1755839_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155067478.1|1756134_1756287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|1756625_1756991_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155067479.1|1757047_1757449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068707.1|1757626_1757815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067480.1|1758209_1759595_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	30.0	9.0e-50
WP_155067481.1|1759601_1761140_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155067482.1|1761182_1761908_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_155067483.1|1762117_1763344_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	26.9	4.4e-32
WP_155067484.1|1763547_1764369_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155067485.1|1764418_1765228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066480.1|1765496_1766546_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067486.1|1766542_1767517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068708.1|1767626_1771493_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	6.0e-51
WP_155067487.1|1771658_1772534_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155067488.1|1772567_1772717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067489.1|1772949_1774113_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.0	2.9e-25
WP_155067490.1|1774339_1775215_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155067491.1|1775202_1775781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067492.1|1775784_1776360_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300641.1|1776305_1776671_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155067493.1|1776991_1777972_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_155067494.1|1778593_1779592_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.2e-34
WP_155067495.1|1779727_1780075_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_155067496.1|1780071_1780674_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017375910.1|1781132_1781861_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155067497.1|1782107_1782572_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_155067498.1|1782738_1783248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067499.1|1783527_1784472_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066278.1|1784969_1786019_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067500.1|1786002_1786614_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	6.9e-10
>prophage 19
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	1792804	1869095	3317308	tRNA,transposase	Leptospira_phage(25.0%)	57	NA	NA
WP_155067504.1|1792804_1793809_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_155067505.1|1793931_1794330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067506.1|1794383_1796207_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_155067507.1|1796203_1799506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067508.1|1799536_1800451_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_155067509.1|1800515_1801145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067510.1|1801189_1801624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067511.1|1801604_1802345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067512.1|1802358_1803756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067513.1|1803758_1806707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067514.1|1806706_1808428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209636.1|1808442_1808847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067515.1|1808847_1811721_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_155067516.1|1817130_1818294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067517.1|1818297_1818912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067518.1|1818929_1820429_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155067519.1|1820445_1820952_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_155068709.1|1822109_1822184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067520.1|1823241_1823706_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067521.1|1823814_1824366_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.0	1.1e-17
WP_032126239.1|1824377_1824650_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067522.1|1824705_1824954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067523.1|1824972_1825434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066616.1|1825499_1826549_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067524.1|1826552_1827398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067525.1|1827452_1830425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067526.1|1830437_1830983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067527.1|1832039_1832288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067528.1|1832425_1832848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064005551.1|1835145_1835652_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_155067529.1|1836172_1836313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066440.1|1836566_1837541_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155067530.1|1837681_1837876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067531.1|1838041_1841122_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_155067532.1|1841139_1842192_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_036771330.1|1843302_1844277_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155067533.1|1844296_1844692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067534.1|1845099_1845744_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_155067535.1|1846795_1846942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377969.1|1847033_1847273_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_155067536.1|1847595_1847940_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_155067537.1|1848029_1848614_-	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_155067538.1|1848735_1849422_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.5	1.6e-28
WP_155067539.1|1849545_1850730_-	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
WP_155068710.1|1850945_1852388_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X9I5H2	Streptococcus_phage	24.5	1.6e-20
WP_155067540.1|1852524_1853475_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155067541.1|1854191_1855190_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046733.1|1855126_1855264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377960.1|1855785_1856535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067542.1|1856607_1858077_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_155066480.1|1858631_1859681_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067543.1|1859746_1860706_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	2.0e-27
WP_155066404.1|1863166_1864052_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066496.1|1864670_1865507_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	3.2e-42
WP_032126239.1|1865518_1865791_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068711.1|1866657_1867272_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155067544.1|1867931_1869095_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.0	2.2e-25
>prophage 20
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	1883572	2041956	3317308	tRNA,integrase,transposase	Leptospira_phage(30.0%)	169	1884049:1884108	1931792:1933022
WP_155067554.1|1883572_1883911_+|transposase	transposase	transposase	NA	NA	NA	NA
1884049:1884108	attL	TTGTCAACCTCCCATAAGTGAGACAGTTTAAAACTGGAATTATCCCTCTGTTTTTGTCGA	NA	NA	NA	NA
WP_155047317.1|1884087_1884924_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_032126239.1|1884935_1885208_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067555.1|1885282_1886302_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067556.1|1886505_1886871_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066610.1|1886816_1887392_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067557.1|1887411_1887645_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067558.1|1887689_1887860_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155067559.1|1887897_1888182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211467.1|1888277_1888844_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_155067560.1|1888846_1889971_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_155068712.1|1890055_1890868_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_155067561.1|1890998_1892978_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_155067562.1|1893037_1893691_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_122942470.1|1893997_1894450_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155067563.1|1894854_1896327_-	catalase	NA	A0A2K9L572	Tupanvirus	46.6	3.8e-99
WP_016211840.1|1896466_1896931_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_155067564.1|1897784_1897955_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155067565.1|1898159_1898549_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155067566.1|1898657_1899524_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	28.4	1.2e-07
WP_155067567.1|1899702_1900974_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.1e-14
WP_155067568.1|1901062_1901533_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_155068713.1|1901555_1902149_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	31.4	8.1e-16
WP_155067569.1|1902286_1903336_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_155067570.1|1903359_1904283_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_155067571.1|1904299_1904761_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_155066298.1|1904838_1905210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066404.1|1905268_1906155_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066508.1|1906629_1907745_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155067572.1|1907795_1908335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068714.1|1908463_1909282_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_155067573.1|1909697_1910048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067574.1|1910091_1910232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067575.1|1910376_1911354_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	1.5e-27
WP_155067576.1|1911373_1911955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067577.1|1912025_1912502_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_155066404.1|1912572_1913459_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067578.1|1913864_1914611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|1914607_1915582_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155067579.1|1916535_1916793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067580.1|1918290_1919220_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_155068715.1|1919226_1921149_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.2	1.2e-84
WP_155068716.1|1921213_1922488_-	endonuclease/exonuclease/phosphatase	NA	NA	NA	NA	NA
WP_155067581.1|1922933_1923605_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_155067582.1|1923613_1924465_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_155067583.1|1924642_1925941_+	PAS domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_155067584.1|1926088_1927435_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_155067585.1|1927612_1927945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067586.1|1927965_1929015_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067587.1|1929057_1929198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067588.1|1929402_1929972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067589.1|1930510_1931638_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047317.1|1931830_1932667_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_032126239.1|1932678_1932951_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067590.1|1933057_1933231_-	hypothetical protein	NA	NA	NA	NA	NA
1931792:1933022	attR	TTGTCAACCTCCCATAAGTGAGACAGTTTAAAACTGGAATTATCCCTCTGTTTTTGTCGAAATTTTTTCTAACTGTTTTTCACGTTTCTCAGCAAATGTGTCTGGTGAAAGATTCTTTAAAGATTGATGTGGTCTGATCGTGTTATATTCAACGATCCAGTCATCACTAAGTTTCTGAACTTGCTGCAATGAAGTAAATTGATTGGAATCTAAAATATCACCACGATAAGTGCGGTTAAATCGTTCAATATAACCATTTTGAGCAGGTTTTCCTGGTTGTATCCGACGCAGTTGAATTCCATGCCCTTCAGCCCATTCTTGGAAATGGGAAGAAATGAATTCAGGCCCATTGTCAGTCCGCAGCATTTCAGGGTAGCCATGCACTTTGCACCACTCATCAAGTTTGGACGTGACAAAAACAGCAGGCATTGAAAAATCGATAGCGATGCCTAAAGCCTTACGGTTGTAATCATCAATGAGGTTCATCGTTCTAAATTTCGTACCGCTCAGAAGGGCGTCACTCATAAAATCTAATGACCAACAAACATTTTTGTAGATAGGCTGAAATAAATATTCAGGCTCGTTTTTGACGTAGTGATGCTTTGGTTTACAGCTTATGTTTAAGCCCATTTCAATATAGACTCGACGAATGCGCTTATGGTTCCAAGGCTTACCTTTGTTTTTTAAATATGCGACCATTTTGTCGCAACCCCAGCGTTTGTGTTTGCTCGCTAACGTCTTTAGCTCTGAAATTATTTCAGCATCATCAGATTGATGCTGTTTTTTTCGGTAATAGCTTGCTCTTGGAAGAGTGACTAAATTACAAGCAACCACGAGGCTTAGCTTATGTTCATCTTTGAGGTAAGTAGCGAGCATTCGTTTATCCTCTATATCGGTAGCTTTTTTTCCACAACATCTTTCAAAGCCTCAATTTCTATTTGAGAATCAGCATACATTCTCTTAAGTTGCTGGTTCTCTTTCTCTAATTGTTTTAGCCTTTTTAGCTGAGAGATATCCATTGCCCCATAACGTTCTTTTAAGGTGTAATACGTGCTAGTTGAGATTCCGTAGTCTCTTGCTGTGGTTTCTATATCTGCTCCAGCCTCAACACGCTTAAGCAACTCTACGATTTTTGATTCACTTAATTTGCTCTTTTTCATATGCTCTCCTGTTTGAAAATGTTAACAGAAGATTCCAGTTATGAGTTGTCTCATTTTAAGGGAGGGTTACC	NA	NA	NA	NA
WP_155067591.1|1933622_1933790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067592.1|1933804_1934110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067593.1|1934242_1934383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067594.1|1934746_1936024_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_017378241.1|1936020_1936197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067595.1|1936667_1938269_+	cytochrome bd-I ubiquinol oxidase subunit CydA	NA	NA	NA	NA	NA
WP_155067596.1|1938285_1939428_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016212445.1|1940032_1940299_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155067597.1|1940373_1940580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068717.1|1940588_1940735_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067078.1|1940748_1941360_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.0	3.7e-32
WP_155067077.1|1941306_1941441_+	phosphatase	NA	NA	NA	NA	NA
WP_155067598.1|1941564_1941873_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155067599.1|1941884_1942061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067600.1|1942516_1942825_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	48.8	5.3e-19
WP_155067601.1|1943121_1943892_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_155067602.1|1943916_1945188_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_155067603.1|1945730_1948247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067604.1|1948310_1950032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378250.1|1950899_1951133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068718.1|1951333_1951954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067605.1|1951920_1952886_-	PAP2 family protein	NA	NA	NA	NA	NA
WP_155067606.1|1952876_1953287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067607.1|1953293_1953629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067608.1|1953629_1954250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066440.1|1954514_1955489_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155067609.1|1955591_1956425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067610.1|1956461_1959575_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_155067611.1|1959604_1960399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067612.1|1960403_1963394_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016209975.1|1963399_1963831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067613.1|1963881_1964448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067614.1|1964447_1965491_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_155068719.1|1965496_1966000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067615.1|1966024_1968331_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_016209962.1|1968377_1968617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068720.1|1968618_1969746_-	ATPase	NA	NA	NA	NA	NA
WP_155067616.1|1969745_1970498_-	type IV secretion system protein DotC	NA	NA	NA	NA	NA
WP_155067617.1|1970490_1970997_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_155067618.1|1971021_1971429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067619.1|1971456_1972482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067620.1|1972522_1973428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067621.1|1973434_1974628_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_155068721.1|1974624_1975533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067622.1|1976536_1977250_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	40.0	4.4e-40
WP_017378274.1|1977325_1977604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067623.1|1977633_1978524_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_016211307.1|1978608_1979082_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_155067624.1|1979226_1979748_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155067625.1|1979788_1980583_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_155067626.1|1980585_1980834_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066404.1|1981154_1982040_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067627.1|1982037_1982334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067628.1|1982330_1983116_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.9	6.7e-42
WP_032126239.1|1983127_1983400_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067629.1|1983769_1984516_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155067630.1|1985016_1985805_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047317.1|1985852_1986689_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_032126239.1|1986700_1986973_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067631.1|1987013_1987301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067632.1|1987493_1988399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067633.1|1988528_1989257_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_155067634.1|1989376_1989958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067635.1|1989975_1990932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067636.1|1991637_1992213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1992231_1993068_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1993079_1993352_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067637.1|1993441_1993921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066404.1|1994042_1994928_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067638.1|1994948_1995140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376696.1|1995502_1996453_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_155067639.1|1996535_1997318_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_155067640.1|1997433_1997781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067641.1|1998252_1998888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067642.1|1998921_1999518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067643.1|1999665_2000325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|2000457_2001507_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067644.1|2001609_2002122_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107517381.1|2002189_2002384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068722.1|2002597_2002951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067645.1|2003281_2003560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067646.1|2003602_2004229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067647.1|2004499_2004940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067489.1|2005208_2006372_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.0	2.9e-25
WP_155067648.1|2006455_2007229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067649.1|2007621_2008818_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067650.1|2008855_2012701_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_155067651.1|2012899_2014033_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|2014046_2014235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068723.1|2014433_2015816_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	1.1e-39
WP_155067652.1|2016231_2016459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047317.1|2016500_2017337_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_032126239.1|2017348_2017621_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067653.1|2017687_2018356_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155066278.1|2018506_2019556_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067654.1|2019615_2020533_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_155067655.1|2020584_2021340_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_155067656.1|2021407_2022682_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.5	8.8e-92
WP_155067657.1|2022802_2023480_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_155067658.1|2023687_2025112_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	34.1	1.2e-41
WP_016209938.1|2025086_2025725_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_155068724.1|2025934_2026213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067659.1|2026446_2027391_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	34.8	5.4e-38
WP_155067660.1|2027412_2029281_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_064004815.1|2029301_2029655_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_026063528.1|2029693_2030809_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_155067661.1|2031003_2032044_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_027242800.1|2032046_2033081_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_155067662.1|2033077_2034139_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_155067663.1|2034250_2035723_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	1.8e-43
WP_017376400.1|2035875_2036319_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_155067664.1|2036389_2039161_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.5e-149
WP_155067665.1|2040835_2041108_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067666.1|2041119_2041956_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	7.1e-42
>prophage 21
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	2049686	2179332	3317308	tRNA,transposase	Leptospira_phage(25.0%)	116	NA	NA
WP_155067671.1|2049686_2050091_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068725.1|2051722_2052007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067672.1|2052254_2052875_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	39.1	3.1e-34
WP_155067673.1|2053145_2053379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|2053390_2053663_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067674.1|2053681_2053840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067675.1|2054454_2056215_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_155067676.1|2056308_2056974_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_155067677.1|2056986_2058492_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	5.9e-87
WP_155067678.1|2058513_2059044_-	colicin V production family protein	NA	NA	NA	NA	NA
WP_155067679.1|2059117_2060380_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_155067680.1|2060854_2061727_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_155068726.1|2061828_2062611_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_155067681.1|2062701_2064027_-	fimbrial protein FimV	NA	NA	NA	NA	NA
WP_155067682.1|2064395_2065571_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_155067683.1|2065738_2066392_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_155067684.1|2066529_2068470_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	2.1e-73
WP_155067685.1|2068466_2069090_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155067686.1|2069230_2072692_+	MFS transporter	NA	NA	NA	NA	NA
WP_155067687.1|2072763_2073339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067688.1|2073350_2074787_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_155067689.1|2074880_2075813_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066297.1|2076111_2076462_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068658.1|2076493_2076946_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067690.1|2077069_2077753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|2077921_2078194_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067691.1|2078205_2079042_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.4e-42
WP_155067692.1|2079050_2080715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067693.1|2080990_2083921_-	peptidase M16	NA	NA	NA	NA	NA
WP_155067694.1|2084064_2086005_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.8	6.1e-44
WP_155067695.1|2086196_2086844_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155067696.1|2086866_2088192_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.3e-37
WP_155067697.1|2088221_2089019_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_155066404.1|2089154_2090040_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126239.1|2090148_2090421_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|2090432_2091269_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_155067698.1|2092569_2093013_-	response regulator	NA	NA	NA	NA	NA
WP_155067699.1|2093443_2093932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067700.1|2094038_2095007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067701.1|2095707_2099112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067702.1|2099330_2101244_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	2.4e-117
WP_155067703.1|2101292_2101940_-	methyltransferase	NA	W8CYT3	Bacillus_phage	31.5	3.6e-09
WP_155067704.1|2102075_2103200_-	hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_155067705.1|2103196_2103793_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209821.1|2103823_2104156_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_155067706.1|2104245_2106063_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	1.3e-43
WP_155068727.1|2106517_2107780_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	9.2e-25
WP_155067707.1|2108834_2109374_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_155067708.1|2109719_2110136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067709.1|2110231_2111047_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_155068728.1|2111179_2112673_+	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_155067710.1|2112858_2113281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068729.1|2113280_2115341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067711.1|2115624_2116440_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_155067712.1|2116540_2117359_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_155067713.1|2117355_2117724_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_155067714.1|2118076_2118226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|2118798_2119071_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066496.1|2119082_2119919_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	3.2e-42
WP_155067715.1|2119937_2120654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067716.1|2121123_2121930_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_155067717.1|2121953_2122655_-	cyclase family protein	NA	NA	NA	NA	NA
WP_155067718.1|2122729_2123389_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155067719.1|2123526_2124783_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_155067720.1|2125057_2125720_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_155067721.1|2125709_2126948_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	1.2e-93
WP_155067722.1|2127060_2127381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2127413_2128250_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2128261_2128534_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067723.1|2129837_2130002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067724.1|2130146_2130602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067725.1|2130677_2131877_-	enoyl-[acyl-carrier-protein] reductase FabV	NA	NA	NA	NA	NA
WP_155067726.1|2132130_2132424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067727.1|2132476_2134489_-	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_155067728.1|2134543_2135503_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_155067729.1|2135656_2136439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067730.1|2136595_2137312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067731.1|2137325_2138717_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_155067732.1|2138758_2141746_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_155067733.1|2141815_2142643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067734.1|2142697_2143867_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_155068730.1|2143854_2144559_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_155067735.1|2144627_2145413_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_155067736.1|2145440_2146178_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_016210285.1|2146281_2148477_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242992.1|2148552_2149236_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_027242993.1|2149246_2149678_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_155067737.1|2149723_2150122_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_155067738.1|2150486_2151194_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_155067739.1|2151258_2151561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067740.1|2151616_2152093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242998.1|2152144_2152666_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_155067741.1|2152747_2153842_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_155067742.1|2154027_2154960_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067743.1|2155164_2155365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067744.1|2155784_2156426_+	hypothetical protein	NA	R4ZFK6	Choristoneura_rosaceana_entomopoxvirus	29.1	7.7e-12
WP_155067745.1|2156901_2157618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067746.1|2157754_2159002_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	70.4	2.5e-14
WP_155067747.1|2159382_2159994_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_155067748.1|2160076_2160943_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2160946_2161708_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_155067749.1|2161861_2162767_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_155067750.1|2162989_2163805_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_155067751.1|2163990_2164380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067752.1|2164515_2166093_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.5	2.2e-15
WP_155067753.1|2167715_2169227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067754.1|2169285_2170368_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.7	8.4e-144
WP_155067755.1|2170634_2172524_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_155067756.1|2172558_2173764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067757.1|2173766_2175080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067758.1|2175045_2176269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067759.1|2176318_2177119_-	taurine catabolism dioxygenase TauD	NA	NA	NA	NA	NA
WP_155067760.1|2177115_2177478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122942301.1|2177510_2177819_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_155068731.1|2178209_2178626_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066739.1|2178981_2179332_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	2201018	2294252	3317308	tRNA,protease,transposase,tail,integrase	Leptospira_phage(45.0%)	102	2239885:2239944	2248531:2249185
WP_155066923.1|2201018_2201369_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067776.1|2201456_2201921_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067777.1|2201958_2204712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068732.1|2205194_2205374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067778.1|2205675_2205996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066918.1|2205999_2206827_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067779.1|2207265_2207967_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155067780.1|2208142_2208388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067781.1|2208617_2208923_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_155067782.1|2209101_2211099_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2211082_2212129_-	glutathione synthase	NA	NA	NA	NA	NA
WP_155067672.1|2212441_2213062_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	39.1	3.1e-34
WP_155067673.1|2213332_2213566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|2213577_2213850_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067783.1|2214095_2214947_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.1e-12
WP_155067784.1|2214947_2215868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067785.1|2216116_2217016_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067786.1|2217160_2217454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067787.1|2217470_2217869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067788.1|2218197_2218440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067789.1|2220238_2220769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066524.1|2220875_2221178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068733.1|2221545_2221986_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067790.1|2222492_2223422_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	4.8e-31
WP_144420711.1|2223578_2224004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067791.1|2224087_2224231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067792.1|2225295_2225844_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067793.1|2227836_2228112_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155067794.1|2228601_2229213_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_051929560.1|2229233_2230433_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_017377024.1|2230527_2230668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067795.1|2230680_2231085_-	SufE family protein	NA	NA	NA	NA	NA
WP_155068734.1|2231993_2232563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067796.1|2233255_2233399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066298.1|2233962_2234334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047317.1|2234452_2235289_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_032126239.1|2235300_2235573_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067797.1|2235628_2236246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067798.1|2236288_2236627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066507.1|2236692_2237517_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066508.1|2237567_2238683_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_032126239.1|2239380_2239653_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|2239664_2240501_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
2239885:2239944	attL	AGCGCATTCGTCGAGTCTATATTGAAATGGGCTTAAACATAAGCTGTAAACCAAAGCATC	NA	NA	NA	NA
WP_155067799.1|2240509_2241625_-	hypothetical protein	NA	F1C571	Cronobacter_phage	28.8	1.7e-35
WP_155067800.1|2241756_2242662_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155067801.1|2243754_2244237_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	33.8	1.2e-14
WP_036771330.1|2244256_2245231_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155067802.1|2245274_2245562_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155067803.1|2245823_2245976_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067804.1|2246101_2247340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067805.1|2247406_2248285_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155067806.1|2248517_2249147_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	39.4	2.8e-35
WP_155067807.1|2249225_2249789_+|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	30.5	7.4e-19
2248531:2249185	attR	AGCGCATTCGTCGAGTCTATATTGAAATGGGCTTAAACATAAGCTGTAAACCAAAGCATCACTACGTCAAAAACGAGCCTGAATATTTATTTCAGCCTATCTACAAAAATGTTTGTTGGTCATTAGATTTTATGAGTGACGCCCTTCTGAGCGGTACGAAATTTAGAACGATGAACCTCATTGATGATTACAACCGTAAGGCTTTAGGCATCGCTATCGATTTTTCAATGCCTGCTGTTTTTGTCACATCCAAACTTGATGAGTGGTGCAAAGTGCATGGCTACCCTGAAATGCTGCGGACTGACAATGGGCCTGAATTCATTTCTTCCCATTTCCAAGAATGGGCTGAAGGGCATGGAATTCAACTGCGTCGGATACAACCAGGAAAACCTGCTCAAAATGGTTATATTGAACGATTTAACCGCACTTATCGTGGTGATATTTTAGATTGCAATCAATTTACTTCATTGCAGCAAGTTCAGAAACTTAGCGATGACTGGATCGTTGAATATAATACGATCAGACCACATCAATCTTTAAAGAATCTTTCACCAGACACATTTGCTGAGAAACGTGAAAAACAGTTAGAAAAAATTTCGACAAAAACAGAGGGATAATTCCAGTTTTAAACTGTCTCACTTATGGGGGGTTGACA	NA	NA	NA	NA
WP_155067808.1|2249867_2250410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067806.1|2250428_2251058_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	39.4	2.8e-35
WP_155067809.1|2251328_2251553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|2251564_2251837_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067810.1|2251958_2252642_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	36.2	2.3e-22
WP_155067811.1|2252677_2253373_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	2.7e-39
WP_155067812.1|2253412_2253949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068735.1|2254233_2255208_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|2255636_2256350_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_155067813.1|2256518_2257010_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_155067814.1|2257149_2257641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067815.1|2257843_2258734_+	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_155068736.1|2258893_2259478_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_155067816.1|2259558_2260497_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_155046571.1|2260579_2260735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068737.1|2261742_2262837_-	FUSC family protein	NA	NA	NA	NA	NA
WP_155067817.1|2262961_2264278_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.6	9.4e-65
WP_155067818.1|2264332_2269219_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_155068738.1|2269311_2269614_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_155067819.1|2269724_2271647_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_155067820.1|2271668_2272964_+	DUF444 family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_155067821.1|2272960_2274583_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_155067822.1|2274689_2275583_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_155067823.1|2275692_2276316_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_155067824.1|2277887_2278088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|2278283_2278556_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067691.1|2278567_2279404_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.4e-42
WP_155067825.1|2279412_2280087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067826.1|2280231_2280930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067827.1|2280945_2281089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067828.1|2281212_2281653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068739.1|2281855_2282554_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_155067829.1|2282720_2283290_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_155067830.1|2283862_2284489_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_155068740.1|2285073_2285220_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067468.1|2285530_2285677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067831.1|2287038_2287788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067832.1|2287877_2288690_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067833.1|2289180_2289324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|2289390_2289663_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066653.1|2289674_2290511_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.1	8.4e-43
WP_155067834.1|2290918_2291206_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066610.1|2291439_2292015_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067835.1|2291960_2292128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067836.1|2292140_2292335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066621.1|2292458_2292614_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126239.1|2292843_2293116_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067837.1|2293112_2293391_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155067838.1|2293661_2294252_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.6	4.3e-33
>prophage 23
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	2313487	2359030	3317308	transposase	Staphylococcus_phage(30.77%)	46	NA	NA
WP_155066480.1|2313487_2314537_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068743.1|2314808_2316305_+	nuclease	NA	NA	NA	NA	NA
WP_155067853.1|2316367_2317705_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_155067854.1|2317847_2319314_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_155067855.1|2319310_2320360_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_155067856.1|2320483_2322592_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|2322754_2323159_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2323219_2323945_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_155067857.1|2324030_2324924_+	YicC family protein	NA	NA	NA	NA	NA
WP_155067858.1|2324964_2325585_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	35.1	4.8e-19
WP_016210310.1|2325645_2325852_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_155067859.1|2325873_2328018_+	RelA/SpoT family protein	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_155067860.1|2328035_2328173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067861.1|2328316_2328739_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126239.1|2329222_2329495_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047317.1|2329506_2330343_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_155067862.1|2330365_2330665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067863.1|2332101_2333025_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.9	2.2e-23
WP_155067864.1|2333091_2334375_+	MFS transporter	NA	NA	NA	NA	NA
WP_155067865.1|2334800_2335001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066297.1|2335055_2335406_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068744.1|2335437_2335890_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300641.1|2336449_2336815_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066936.1|2337057_2337408_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2337439_2337892_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067866.1|2337886_2338900_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	32.1	1.3e-21
WP_155066496.1|2338896_2339733_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	3.2e-42
WP_032126239.1|2339744_2340017_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067867.1|2340565_2341159_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067868.1|2341155_2341434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067869.1|2341703_2342723_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_017376520.1|2342709_2343132_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_155067870.1|2343133_2343607_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	8.1e-27
WP_155067871.1|2343714_2344338_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	45.1	7.7e-41
WP_155067872.1|2344368_2345043_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	1.7e-30
WP_155067873.1|2345048_2346197_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	6.8e-43
WP_155067874.1|2346193_2346655_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_155067875.1|2346752_2348003_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A219Y950	Aeromonas_phage	54.5	4.5e-101
WP_155067876.1|2348129_2349809_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.2	9.6e-38
WP_036771330.1|2350264_2351239_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155067877.1|2351314_2352196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067878.1|2352388_2352709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067879.1|2353499_2354549_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067880.1|2354789_2355629_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155067881.1|2357661_2358033_-	VOC family protein	NA	NA	NA	NA	NA
WP_155066404.1|2358144_2359030_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	2370756	2525946	3317308	tRNA,integrase,transposase	Leptospira_phage(20.0%)	163	2416236:2416295	2519709:2520852
WP_155067893.1|2370756_2371332_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067894.1|2371430_2372360_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067013.1|2372387_2373541_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	1.4e-59
WP_155066936.1|2373935_2374286_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2374317_2374770_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067895.1|2374819_2375164_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_155068745.1|2375216_2376260_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_155067896.1|2376452_2377427_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155067897.1|2377446_2378505_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067898.1|2378853_2379885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067899.1|2380097_2380463_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155067900.1|2380519_2380660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067901.1|2380804_2381272_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067902.1|2381332_2381599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067903.1|2381655_2382003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067904.1|2382037_2382700_-	PAS fold family protein	NA	NA	NA	NA	NA
WP_155068746.1|2382743_2383346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067905.1|2383575_2384631_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.4	3.4e-49
WP_155067906.1|2384634_2387820_+	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_155067907.1|2387897_2388854_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_155067908.1|2388902_2389439_+	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.1	4.9e-20
WP_155067909.1|2389435_2390197_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_155067910.1|2390271_2391321_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067911.1|2391447_2394036_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.2	8.8e-123
WP_155067912.1|2394322_2394544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067913.1|2394832_2395660_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067914.1|2395900_2396551_-	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_155067915.1|2396770_2397646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067916.1|2397874_2398276_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_155067917.1|2398292_2398841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067918.1|2399152_2399554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067919.1|2399507_2399666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067920.1|2400099_2402310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067921.1|2403272_2403683_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067922.1|2404011_2404545_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067923.1|2404642_2405839_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_155067924.1|2405859_2406516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067925.1|2406663_2407359_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.9	5.5e-40
WP_155067926.1|2407494_2408787_-	MFS transporter	NA	NA	NA	NA	NA
WP_155067927.1|2409113_2411177_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	4.2e-35
WP_155067928.1|2411179_2411827_+	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_017376743.1|2411842_2412475_+	endonuclease III	NA	NA	NA	NA	NA
WP_155067929.1|2412543_2412981_+	DUF1841 family protein	NA	NA	NA	NA	NA
WP_155067930.1|2413461_2413620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|2414060_2415110_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067931.1|2415706_2415973_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067932.1|2416047_2416251_+	hypothetical protein	NA	NA	NA	NA	NA
2416236:2416295	attL	TGTCAACCCCCCATAAGTGAGACAGTTTAAAACTGGAATTATCCCTCTGTTTTTGTCGAA	NA	NA	NA	NA
WP_033923779.1|2416273_2417110_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
2416236:2416295	attL	TGTCAACCCCCCATAAGTGAGACAGTTTAAAACTGGAATTATCCCTCTGTTTTTGTCGAA	NA	NA	NA	NA
WP_032126239.1|2417121_2417394_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067933.1|2417434_2418058_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.8e-37
WP_155067932.1|2418080_2418284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067934.1|2418889_2419528_-	DUF4937 domain-containing protein	NA	NA	NA	NA	NA
WP_155068747.1|2420291_2420966_+	BAX inhibitor (BI)-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.9	1.5e-34
WP_155067935.1|2421111_2421474_+	sulfurtransferase complex subunit TusD	NA	NA	NA	NA	NA
WP_155067936.1|2421470_2421827_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_155067937.1|2421828_2422131_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_155067938.1|2422138_2422471_+	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_155067939.1|2422860_2423472_-	NAAT family transporter	NA	NA	NA	NA	NA
WP_155067940.1|2423740_2425177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067941.1|2425468_2426224_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_017376759.1|2426326_2426545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068748.1|2426614_2427535_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_155068749.1|2427541_2427952_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155067942.1|2428153_2428951_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155067944.1|2428953_2429322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067946.1|2429365_2430220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067948.1|2430323_2431103_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_155067949.1|2436826_2437684_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_155067950.1|2437670_2438600_-	ATPase	NA	NA	NA	NA	NA
WP_155067952.1|2438796_2440188_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_155067953.1|2440234_2441278_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	27.6	2.4e-18
WP_155067954.1|2441320_2441761_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_155067956.1|2441892_2443083_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_155067957.1|2443112_2443490_-	response regulator	NA	NA	NA	NA	NA
WP_155066370.1|2444230_2444512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067959.1|2444529_2444709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2444767_2445742_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155068750.1|2446775_2447072_-	EamA family transporter	NA	NA	NA	NA	NA
WP_155067556.1|2447518_2447884_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066610.1|2447829_2448405_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067960.1|2448961_2449135_+	phosphatase	NA	NA	NA	NA	NA
WP_155066469.1|2449320_2449593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066469.1|2449635_2449908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|2449993_2451043_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067961.1|2451026_2451833_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067962.1|2452052_2452334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068751.1|2452829_2453027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066404.1|2453130_2454017_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067963.1|2454612_2455116_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	49.6	3.0e-35
WP_032126239.1|2455156_2455429_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|2455440_2456277_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_155067964.1|2456299_2456572_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155067965.1|2456646_2456943_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067966.1|2457347_2458190_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
2456256:2457454	attR	TTCGACAAAAACAGAGGGATAATTCCAGTTTTAAACTGTCTCACTTATGGGGGGTTGACAGGCTGAACCAGCATTTTGGCCTCCCGTGGTGAAACTCTTTTTCTAGGCTTGATCCGTAAATTAAGCTTGAGCTCACAATAGACACGGTAAACACGCTTATGGTTCCAAGCGTAGTTTTGCTTGATTTTAGCCATCATTTTGTCAAAACCCCACCGATGATGTACCTTAGCTAAATCTGTCAGCACCTTTTTAATTTTAGTATCAGCAACCTGCTTTTTAGGTTGATACCGATAAACTGATCGGCCAATACGGCACATCTTGCATGCTTTATTCCCGCTCAATGCATGAGCTTTGACAGCATAATCAACTAAGTGACGCCGACTCGCTGCGGTTATAGCTTTTTTTCAACAATATCCTTGAGCACTTTGTGCTCTAGGCTAATGTCTGCGTACATCTGTTTCAAACGGCGGTTTTCGTCTTCAAGCTCTTTTAAACGCTGTAGATCTGAAACGCCCATGCCTTGATATTTGGACCTGAGTTTGTAGTAGCTGCTTTTAGCAATACCATACTGGCGACAAATATCTTCAACTTTAACACCTGCTTGGCCTTCATTAAGCATGGCTACAACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGCCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCCTTGCACTCCTTGGCTCGCAGCGATTGATGCAACTCCTTGCCCACGGAAAGGGCCTCATATTGTAATTAGATAAATAGTACGTCCAGTGTAACCCTTTAAATCAGCATTTAAACGTCAAAAACATCCCAAGCCTCTCGCCAAAGCTCTTCAGTAATTAAACCCCTTATGAACTTAAATAAGTCACAAGGGTAAAAATTAACTATTTAACGCCCAACTCTTTTAGACGCTCATTCAAATAGCTTTTTGCCGTATGGCGCTCTGATAGCACAACGTCTGAGCGAGGATGTAAAAATAACGGTGCTGTTA	NA	NA	NA	NA
WP_155067967.1|2458277_2458928_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.7	1.1e-21
2456256:2457454	attR	TTCGACAAAAACAGAGGGATAATTCCAGTTTTAAACTGTCTCACTTATGGGGGGTTGACAGGCTGAACCAGCATTTTGGCCTCCCGTGGTGAAACTCTTTTTCTAGGCTTGATCCGTAAATTAAGCTTGAGCTCACAATAGACACGGTAAACACGCTTATGGTTCCAAGCGTAGTTTTGCTTGATTTTAGCCATCATTTTGTCAAAACCCCACCGATGATGTACCTTAGCTAAATCTGTCAGCACCTTTTTAATTTTAGTATCAGCAACCTGCTTTTTAGGTTGATACCGATAAACTGATCGGCCAATACGGCACATCTTGCATGCTTTATTCCCGCTCAATGCATGAGCTTTGACAGCATAATCAACTAAGTGACGCCGACTCGCTGCGGTTATAGCTTTTTTTCAACAATATCCTTGAGCACTTTGTGCTCTAGGCTAATGTCTGCGTACATCTGTTTCAAACGGCGGTTTTCGTCTTCAAGCTCTTTTAAACGCTGTAGATCTGAAACGCCCATGCCTTGATATTTGGACCTGAGTTTGTAGTAGCTGCTTTTAGCAATACCATACTGGCGACAAATATCTTCAACTTTAACACCTGCTTGGCCTTCATTAAGCATGGCTACAACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGCCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCCTTGCACTCCTTGGCTCGCAGCGATTGATGCAACTCCTTGCCCACGGAAAGGGCCTCATATTGTAATTAGATAAATAGTACGTCCAGTGTAACCCTTTAAATCAGCATTTAAACGTCAAAAACATCCCAAGCCTCTCGCCAAAGCTCTTCAGTAATTAAACCCCTTATGAACTTAAATAAGTCACAAGGGTAAAAATTAACTATTTAACGCCCAACTCTTTTAGACGCTCATTCAAATAGCTTTTTGCCGTATGGCGCTCTGATAGCACAACGTCTGAGCGAGGATGTAAAAATAACGGTGCTGTTA	NA	NA	NA	NA
WP_155067968.1|2458942_2459983_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	7.7e-70
WP_155067969.1|2460105_2461191_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_155067970.1|2461217_2462327_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_155067972.1|2462391_2462709_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_155067973.1|2462705_2463065_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_155067975.1|2463167_2465621_-	kinase	NA	NA	NA	NA	NA
WP_155067977.1|2466100_2467099_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_155067978.1|2467299_2467452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067979.1|2468084_2468642_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_155067980.1|2469372_2469735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|2469773_2470823_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067981.1|2471305_2472211_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_017376171.1|2472511_2473486_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155067982.1|2473521_2474103_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067098.1|2474048_2474369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066440.1|2474974_2475949_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155068752.1|2476008_2477265_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_155067983.1|2477253_2478135_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_017377906.1|2478127_2479213_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_155067984.1|2479209_2480469_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_155067985.1|2480637_2481285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068753.1|2481436_2482099_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_155067986.1|2482445_2483393_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	2.6e-40
WP_155067987.1|2483490_2484117_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_155067988.1|2484122_2484704_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_155067989.1|2484775_2485867_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_155067990.1|2485956_2486670_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_155067991.1|2486942_2487359_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066404.1|2487565_2488452_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067992.1|2488569_2488836_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067993.1|2488910_2489171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067994.1|2489315_2489834_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	47.4	2.6e-34
WP_155047317.1|2489852_2490689_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_032126239.1|2490700_2490973_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068754.1|2491077_2491194_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067995.1|2491207_2491468_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2491499_2491952_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067996.1|2492017_2493181_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.0	3.8e-25
WP_155067997.1|2493429_2494899_-	aminotransferase class V-fold PLP-dependent enzyme	NA	M4QFZ1	Prochlorococcus_phage	41.7	3.5e-84
WP_155067998.1|2494892_2496269_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.4	3.5e-46
WP_155067999.1|2496281_2496674_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_017377931.1|2496670_2497774_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_155068000.1|2497952_2499248_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377933.1|2499255_2500203_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_155068001.1|2500214_2501033_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155068002.1|2501035_2501815_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155068003.1|2501829_2502888_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_155068004.1|2502884_2503895_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|2503901_2504099_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_155068005.1|2504159_2507072_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_155068006.1|2507113_2507965_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_155068007.1|2508047_2508608_-	chorismate lyase	NA	NA	NA	NA	NA
WP_155068008.1|2508849_2508996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068009.1|2509924_2510347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068010.1|2510424_2510931_+	chagasin	NA	NA	NA	NA	NA
WP_155068011.1|2510976_2513928_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_155068012.1|2513956_2514289_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	35.4	2.8e-05
WP_155067195.1|2514445_2515420_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	9.5e-30
WP_155066440.1|2515691_2516666_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155068013.1|2516703_2516937_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047317.1|2516948_2517785_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_155068014.1|2519266_2519497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|2519729_2520779_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068015.1|2520878_2522031_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	3.4e-58
WP_155068016.1|2522119_2522578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068017.1|2523041_2523752_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	1.3e-31
WP_155068018.1|2523748_2524783_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.8	2.4e-31
WP_155068019.1|2524971_2525946_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.8	3.6e-29
>prophage 25
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	2562697	2765829	3317308	plate,integrase,tRNA,transposase	Escherichia_phage(34.04%)	209	2581252:2581311	2759176:2760590
WP_155068054.1|2562697_2563096_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_144420812.1|2563095_2564523_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155068055.1|2564573_2565062_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_155068056.1|2565054_2566527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068057.1|2566528_2567221_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_155068058.1|2567198_2568227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068059.1|2568220_2569447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068060.1|2569452_2570964_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_155068061.1|2571225_2571663_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_155068062.1|2571738_2573046_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_155068063.1|2573050_2573761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068064.1|2573773_2576944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068065.1|2578210_2578435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2578507_2579911_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155066480.1|2579977_2581027_-|transposase	transposase	transposase	NA	NA	NA	NA
2581252:2581311	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_155068066.1|2581979_2582477_+	hypothetical protein	NA	NA	NA	NA	NA
2581252:2581311	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_155068067.1|2582621_2583143_+	hypothetical protein	NA	NA	NA	NA	NA
2581252:2581311	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_155068068.1|2583284_2584085_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_155068069.1|2584183_2584759_-	anthranilate/aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	1.9e-57
WP_155068070.1|2584752_2584926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068071.1|2585119_2585815_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_155068072.1|2585860_2586760_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_017376331.1|2586794_2587178_-	response regulator	NA	NA	NA	NA	NA
WP_155068073.1|2587326_2588157_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_155068074.1|2588787_2589813_-	phosphotransferase	NA	NA	NA	NA	NA
WP_155068075.1|2589943_2592448_+	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_155068076.1|2592454_2593726_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_155068077.1|2593727_2594711_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_155068078.1|2594723_2595542_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_016210431.1|2595582_2595975_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_155068079.1|2596034_2596841_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_155067226.1|2596922_2597798_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155068080.1|2597882_2598320_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6H9S3	Enterobacteria_phage	28.8	3.2e-09
WP_155068081.1|2598383_2599268_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068082.1|2600496_2601948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068083.1|2602980_2603361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068756.1|2603287_2603527_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068084.1|2603748_2604198_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	50.7	2.2e-34
WP_155068085.1|2604790_2605582_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	3.3e-41
WP_032126239.1|2605593_2605866_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068086.1|2606038_2606341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068087.1|2607150_2607831_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
2606306:2606594	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGCCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCCTTGCACTCCTTGGCTCGCAGCGA	NA	NA	NA	NA
WP_155068088.1|2607827_2608640_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
2606306:2606594	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGCCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCCTTGCACTCCTTGGCTCGCAGCGA	NA	NA	NA	NA
WP_155068089.1|2608713_2612394_-	hypothetical protein	NA	NA	NA	NA	NA
2606306:2606594	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGCCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCCTTGCACTCCTTGGCTCGCAGCGA	NA	NA	NA	NA
WP_155068090.1|2612403_2613891_-	ribonuclease G	NA	NA	NA	NA	NA
WP_155068091.1|2613900_2614518_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_155068092.1|2614587_2615106_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_155068093.1|2615102_2616002_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2616017_2617061_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_155068094.1|2617250_2617538_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_155068095.1|2617658_2619119_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_155068096.1|2619195_2620632_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_155068097.1|2621323_2621674_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068757.1|2621705_2622158_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068098.1|2623604_2623973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068758.1|2625241_2625310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068099.1|2626469_2626673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|2627587_2627860_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066653.1|2627871_2628708_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.1	8.4e-43
WP_155068759.1|2628986_2629757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068100.1|2629886_2630198_+	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_155068101.1|2630310_2630865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068102.1|2630889_2631345_-	arginine repressor	NA	NA	NA	NA	NA
WP_155068103.1|2631334_2632387_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	4.1e-10
WP_155068104.1|2632389_2633853_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_155068105.1|2634125_2634422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068106.1|2634720_2635185_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_155068107.1|2635468_2636284_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155068760.1|2636416_2638729_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155068108.1|2638836_2639364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068761.1|2640050_2641328_+	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_016210914.1|2641332_2641584_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_155068762.1|2641644_2642139_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.7e-27
WP_155068109.1|2642333_2643320_-	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.8e-13
WP_155068110.1|2643411_2644227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068111.1|2646011_2647148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068112.1|2647187_2647805_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155068113.1|2649769_2650726_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	2.4e-33
WP_155068114.1|2650785_2651451_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_155047317.1|2651632_2652469_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_032126239.1|2652480_2652753_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068115.1|2653347_2654790_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155066440.1|2654864_2655839_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155068116.1|2656135_2656756_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	39.1	8.2e-35
WP_155068117.1|2657033_2657624_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_155068118.1|2657750_2659136_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_155068119.1|2659229_2659427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068120.1|2659519_2660356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068121.1|2660865_2661243_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_155068122.1|2661255_2661492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068123.1|2661491_2661698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068124.1|2661856_2662576_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_155068763.1|2662664_2664449_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377842.1|2664549_2664804_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_155068125.1|2665239_2665968_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.5e-43
WP_155068126.1|2665936_2666800_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155068127.1|2667963_2668149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068128.1|2668314_2668698_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_069314058.1|2668681_2668927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064005730.1|2669334_2669598_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_155068129.1|2669662_2672362_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_064005732.1|2672744_2673302_+	recombinase family protein	NA	A0A222YWP5	Escherichia_phage	57.9	1.2e-53
WP_054300654.1|2673363_2673624_+	hypothetical protein	NA	A0A1S5NR91	Burkholderia_phage	46.4	2.8e-13
WP_081007087.1|2673673_2673982_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	42.5	7.9e-07
WP_155068130.1|2674065_2674488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068131.1|2674494_2674929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068132.1|2674949_2675180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068133.1|2675184_2675628_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_155068134.1|2675658_2675823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047317.1|2676575_2677412_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_032126239.1|2677423_2677696_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774259.1|2678676_2679651_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155068135.1|2679878_2680307_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_155068136.1|2680284_2680779_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155068137.1|2680823_2680970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068138.1|2681081_2681570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068139.1|2681570_2681681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068140.1|2681741_2682287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068125.1|2682354_2683083_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.5e-43
WP_155068141.1|2683125_2683767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068142.1|2684003_2684207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068143.1|2684310_2684460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068144.1|2684578_2685499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066440.1|2685675_2686650_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_032126737.1|2686951_2687680_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_155068145.1|2687709_2688147_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068146.1|2688155_2688524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068147.1|2690203_2690797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|2691073_2691337_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_032126737.1|2692597_2693326_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_155068148.1|2693467_2693857_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	51.0	2.2e-25
WP_032126737.1|2693859_2694588_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_155068149.1|2694638_2695370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068150.1|2695479_2695767_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	37.2	6.9e-05
WP_155068151.1|2695978_2696788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068152.1|2698767_2700789_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155068153.1|2701150_2701297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|2701339_2702068_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_155068154.1|2702118_2702535_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6H9S3	Enterobacteria_phage	32.4	4.5e-13
WP_032126239.1|2702590_2702863_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066653.1|2702874_2703711_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.1	8.4e-43
WP_155068764.1|2703936_2704437_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_155068155.1|2704523_2704970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066404.1|2705714_2706600_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068156.1|2706597_2707407_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068157.1|2707426_2708134_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.6	1.3e-47
WP_155068158.1|2708147_2708357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068159.1|2709144_2710014_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	1.2e-68
WP_155068160.1|2710010_2711360_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	37.0	1.8e-74
WP_155068161.1|2711472_2713113_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_032126737.1|2713777_2714506_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_155068162.1|2714508_2714691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068163.1|2715102_2715693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068164.1|2715825_2716593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068165.1|2716584_2716875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068166.1|2716980_2718144_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.0	2.9e-25
WP_155068167.1|2718636_2719155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068168.1|2719574_2720153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068169.1|2720629_2720872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068170.1|2721003_2721657_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.4	3.1e-32
WP_155068171.1|2721712_2722474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067589.1|2722963_2724091_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155068172.1|2724365_2725859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068173.1|2725941_2726670_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_155068174.1|2727643_2728072_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_155068175.1|2728068_2728368_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155068176.1|2728458_2729088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068177.1|2729101_2730142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068178.1|2730208_2730409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068179.1|2730591_2731320_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	3.0e-44
WP_155068180.1|2731331_2732015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068181.1|2732011_2732794_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_155068182.1|2732859_2733576_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033923779.1|2733584_2734421_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2734432_2734705_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068183.1|2734723_2735143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068184.1|2735627_2736014_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_155068185.1|2736010_2736256_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_036771330.1|2736598_2737573_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155068186.1|2737609_2738152_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0V4T7	Roseobacter_phage	33.3	6.3e-15
WP_048876031.1|2738288_2739692_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155068187.1|2740197_2741637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068188.1|2741785_2741959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|2742031_2742304_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066653.1|2742315_2743152_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.1	8.4e-43
WP_155068189.1|2743428_2743890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122942947.1|2744204_2744483_+	peptidase	NA	A0A2L1IV28	Escherichia_phage	52.2	4.9e-24
WP_122942945.1|2744493_2744799_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_155068179.1|2745019_2745748_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	3.0e-44
WP_155068190.1|2746077_2747043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068191.1|2747035_2747530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068192.1|2747522_2747840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2747883_2748612_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155068193.1|2748634_2750722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068194.1|2750711_2751598_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068195.1|2751675_2753796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068196.1|2754127_2754742_+	repressor LexA	NA	NA	NA	NA	NA
WP_155068197.1|2754985_2755189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068765.1|2755394_2756075_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	39.6	1.1e-35
WP_155068198.1|2756145_2756577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|2756579_2757308_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_155068199.1|2757354_2757498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067589.1|2757979_2759107_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_148037451.1|2759468_2759669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068200.1|2759661_2760426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067444.1|2760606_2761362_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_032126737.1|2761591_2762320_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_155068201.1|2763881_2764949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068202.1|2765064_2765829_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	2770814	2828625	3317308	tRNA,protease,transposase	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_155066278.1|2770814_2771864_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068766.1|2771923_2772742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068206.1|2772998_2774300_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2774447_2775116_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_155067981.1|2775976_2776882_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155068207.1|2777026_2777623_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_155068208.1|2777643_2778840_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1V0SHQ2	Klosneuvirus	24.8	1.6e-10
WP_155068209.1|2778964_2780329_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_155068210.1|2780325_2781417_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_155068211.1|2781668_2782343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068212.1|2782459_2782969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068213.1|2782977_2783811_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376581.1|2783814_2784465_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_155068214.1|2784454_2785294_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	22.9	2.3e-08
WP_016210074.1|2785299_2785926_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_155068215.1|2786087_2786630_+	septation protein A	NA	NA	NA	NA	NA
WP_155068216.1|2786713_2787016_+	YciI family protein	NA	NA	NA	NA	NA
WP_155068217.1|2787012_2787276_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_155068218.1|2787380_2787653_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_155068219.1|2787691_2788330_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_155068220.1|2788363_2789455_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155068221.1|2789629_2791177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|2791884_2792934_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068222.1|2793004_2795329_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.1	1.7e-21
WP_155068223.1|2795500_2796217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068767.1|2796295_2796913_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_155068224.1|2796905_2798288_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_155068225.1|2798296_2798770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068226.1|2798902_2800162_+	diphosphate--fructose-6-phosphate 1-phosphotransferase	NA	NA	NA	NA	NA
WP_155068227.1|2800611_2803056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068228.1|2803621_2804050_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068229.1|2804046_2804193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066978.1|2804316_2805291_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	7.3e-30
WP_155066278.1|2805517_2806567_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066278.1|2806706_2807756_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068230.1|2807821_2807986_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155068768.1|2808702_2808999_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_155068231.1|2809969_2810695_-	D-Ala-D-Ala dipeptidase	NA	NA	NA	NA	NA
WP_155068232.1|2812482_2813025_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_155068233.1|2813021_2813708_-	acireductone synthase	NA	NA	NA	NA	NA
WP_155068234.1|2813711_2814323_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_155068769.1|2814369_2815389_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_155068235.1|2815487_2816282_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	3.1e-103
WP_155068236.1|2816303_2817110_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_155068237.1|2817188_2818238_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_155068238.1|2818222_2818420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068770.1|2818723_2819986_+	phosphate permease	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.5e-24
WP_027242634.1|2820031_2820709_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2820794_2821076_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_155068239.1|2821167_2822355_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.6	2.2e-20
WP_155068240.1|2822668_2823610_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155068241.1|2823578_2824034_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155068242.1|2824113_2824338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068243.1|2824631_2824871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068244.1|2824854_2825904_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068245.1|2826638_2826851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068246.1|2827114_2827759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068247.1|2827776_2827917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068248.1|2828094_2828625_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
>prophage 27
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	2832031	2873100	3317308	tRNA,transposase	Staphylococcus_phage(33.33%)	45	NA	NA
WP_155068251.1|2832031_2832256_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068771.1|2832257_2832467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068252.1|2833063_2833438_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155068253.1|2833383_2833947_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068254.1|2834905_2835103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068255.1|2835924_2836197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420745.1|2836191_2836644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068256.1|2836675_2837026_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066978.1|2837397_2838372_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	7.3e-30
WP_155068257.1|2838579_2839158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068258.1|2839262_2839907_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_155068259.1|2840142_2840640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068260.1|2841141_2841732_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068261.1|2841774_2842191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068262.1|2842354_2843872_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.1	1.7e-86
WP_155068263.1|2843983_2845082_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	2.8e-06
WP_155068264.1|2845319_2846519_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_155068265.1|2846548_2847187_+	ribonuclease T	NA	NA	NA	NA	NA
WP_155068266.1|2847202_2849458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068267.1|2849694_2850039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068772.1|2851166_2851625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068268.1|2852296_2853271_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	6.2e-29
WP_155068269.1|2853500_2853755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068270.1|2853771_2854059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068271.1|2854248_2854575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068272.1|2854816_2855254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068273.1|2855596_2855839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068274.1|2856526_2857504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068275.1|2858058_2858721_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155068773.1|2858812_2859094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068276.1|2860121_2860781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068277.1|2860881_2861532_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_155068774.1|2862435_2862657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068278.1|2863684_2864269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068279.1|2864645_2865734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066653.1|2865766_2866603_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.1	8.4e-43
WP_032126239.1|2866614_2866887_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068280.1|2867322_2868237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068281.1|2868426_2868549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068282.1|2868578_2868827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068283.1|2869251_2869476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068284.1|2869680_2870277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068285.1|2870400_2871411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068286.1|2871467_2871620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066440.1|2872125_2873100_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
>prophage 28
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	2897986	2939487	3317308	tRNA,transposase	Klosneuvirus(28.57%)	39	NA	NA
WP_155068307.1|2897986_2900800_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.7	3.9e-76
WP_155068776.1|2900939_2901866_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	33.6	7.2e-11
WP_155068308.1|2902044_2903583_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2903756_2904017_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_036771330.1|2904191_2905166_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155068309.1|2905439_2906687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068310.1|2906791_2907520_+	DUF541 domain-containing protein	NA	NA	NA	NA	NA
WP_155068311.1|2907623_2908361_+	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_155066923.1|2908434_2908785_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068659.1|2908816_2909269_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068312.1|2909366_2910416_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068313.1|2912438_2913224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068314.1|2913285_2913834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068315.1|2913920_2915087_-	acetylornithine/succinylornithine family transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	3.4e-26
WP_155068316.1|2915392_2918191_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.0	7.1e-179
WP_155068317.1|2918249_2919470_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.9	8.5e-36
WP_155068318.1|2919527_2920148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068319.1|2920582_2920870_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376930.1|2921026_2921356_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_155068320.1|2921390_2923028_-	response regulator	NA	NA	NA	NA	NA
WP_155068321.1|2923129_2924179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068322.1|2924251_2924896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068323.1|2924892_2926146_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155068324.1|2926163_2927435_-	ubiquinone biosynthesis protein	NA	NA	NA	NA	NA
WP_155068325.1|2927459_2928050_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376937.1|2928194_2928419_+	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_016209991.1|2928399_2928729_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_155068326.1|2928955_2929519_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_155068327.1|2929555_2930017_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_155068328.1|2931828_2932656_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_122940173.1|2932655_2933204_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_155068329.1|2933333_2933726_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_155068330.1|2933757_2934225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068331.1|2934221_2935127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|2935413_2935686_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|2935697_2936534_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_155068332.1|2936683_2937163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068333.1|2938256_2938421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|2938437_2939487_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	3052251	3168046	3317308	tRNA,protease,transposase	Leptospira_phage(12.5%)	107	NA	NA
WP_155066440.1|3052251_3053226_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155068420.1|3053245_3054319_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155068782.1|3054312_3054855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068421.1|3054930_3057102_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_016209298.1|3057169_3057436_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_155068422.1|3057498_3058443_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_155068423.1|3058442_3058796_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_155068424.1|3058844_3061520_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.0	4.6e-26
WP_155068425.1|3061536_3063054_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_016209273.1|3063130_3063583_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_155068783.1|3063801_3065241_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_155068784.1|3065240_3066779_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_155068426.1|3066793_3068764_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_016209309.1|3068767_3069073_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_155068427.1|3069096_3069720_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_017378114.1|3069739_3070228_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_064004451.1|3070241_3071267_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_155068428.1|3071271_3073665_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_016209307.1|3073714_3075004_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_017378118.1|3075010_3075511_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_155068429.1|3075510_3076764_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_155068430.1|3076765_3077443_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_016209262.1|3077460_3077946_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_016209283.1|3077936_3078305_-	NADH-ubiquinone/plastoquinone oxidoreductase chain 3	NA	NA	NA	NA	NA
WP_155068431.1|3078953_3079118_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067095.1|3079870_3080632_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.1	1.6e-48
WP_155068432.1|3080689_3081658_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068433.1|3081914_3082277_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_155068434.1|3082290_3083052_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_155068435.1|3083355_3084705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068436.1|3085490_3086324_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_155068437.1|3086345_3086939_+	thymidine kinase	NA	A0A023W530	Serratia_phage	53.2	2.6e-54
WP_155068438.1|3086910_3087312_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_155068439.1|3087335_3088346_-	lipase	NA	NA	NA	NA	NA
WP_155068440.1|3088412_3089261_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_155068441.1|3089370_3090348_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_155068442.1|3091010_3091733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068443.1|3092236_3093502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068444.1|3093546_3094005_-	NfeD family protein	NA	NA	NA	NA	NA
WP_155068445.1|3094028_3094949_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_155068446.1|3095076_3095859_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	5.3e-31
WP_155068447.1|3095948_3097448_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_155068448.1|3097761_3099645_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_155068449.1|3099926_3100439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068450.1|3100986_3102096_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	5.6e-18
WP_155068451.1|3102107_3102752_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_155068452.1|3102770_3103757_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_155068453.1|3103842_3104919_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_155068454.1|3105121_3105946_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_155068455.1|3106253_3106988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|3107556_3108606_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068456.1|3108702_3108864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|3108858_3109311_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066653.1|3109839_3110676_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.1	8.4e-43
WP_032126239.1|3110687_3110960_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068457.1|3110978_3111893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068458.1|3111995_3112967_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068459.1|3113284_3113659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068460.1|3113896_3114379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|3114434_3115685_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_017378137.1|3115786_3116005_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_155068461.1|3116479_3117334_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_155068462.1|3117493_3117964_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_155068463.1|3118216_3119596_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.9	2.7e-54
WP_155068464.1|3119623_3120082_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.9	9.2e-52
WP_155068465.1|3120059_3121310_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.7	5.8e-40
WP_017375944.1|3121468_3121705_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|3121718_3121874_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_155068466.1|3121954_3122917_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155068467.1|3123076_3124393_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|3124402_3125071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068468.1|3125286_3125601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068469.1|3125805_3127620_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_155068470.1|3128036_3128825_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_155068471.1|3129411_3131163_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155068472.1|3131173_3131974_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	39.1	2.0e-33
WP_155068473.1|3132078_3132567_-	diacylglycerol kinase	NA	A0A1B2IDT7	Erwinia_phage	44.3	1.1e-29
WP_017375799.1|3134086_3134431_+	DMT family protein	NA	NA	NA	NA	NA
WP_155068474.1|3140123_3141086_-	glycerate dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	26.3	2.8e-18
WP_016210039.1|3141274_3142534_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|3142756_3143083_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_155068475.1|3143277_3144219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068785.1|3144277_3146344_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_155068476.1|3146349_3147345_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_155068477.1|3147920_3149501_+	amino acid permease	NA	NA	NA	NA	NA
WP_155068478.1|3149647_3151057_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_155068479.1|3151116_3152250_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_155068480.1|3152375_3153200_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_155068481.1|3153434_3154064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068482.1|3154321_3154693_-	isochorismatase	NA	NA	NA	NA	NA
WP_155068483.1|3155003_3155291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068484.1|3155702_3156560_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068485.1|3157087_3157936_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_155068486.1|3158050_3159091_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_155068487.1|3160038_3160188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068786.1|3160226_3160679_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066488.1|3160710_3161061_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068488.1|3161471_3161705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068489.1|3161849_3161996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068490.1|3162077_3163106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068491.1|3163554_3163857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068787.1|3164064_3164613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068492.1|3164757_3165180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067136.1|3165334_3165685_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068493.1|3165611_3165824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068788.1|3166711_3167128_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|3167593_3168046_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	3172241	3241540	3317308	tRNA,transposase	Acinetobacter_phage(37.5%)	57	NA	NA
WP_155066508.1|3172241_3173357_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155068498.1|3173912_3174809_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155068499.1|3174896_3175898_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_155068500.1|3176005_3176530_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_155068501.1|3176811_3177786_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155068789.1|3177885_3179145_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.1e-13
WP_155068502.1|3179518_3179941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068503.1|3179937_3180471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068790.1|3180467_3180863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068791.1|3180979_3181825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068504.1|3182273_3184604_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_155068505.1|3184733_3186740_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155068506.1|3187447_3193042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377408.1|3193054_3193363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068507.1|3193486_3193966_-	DUF1669 domain-containing protein	NA	A0A1B2LRT6	Wolbachia_phage	51.4	2.7e-30
WP_155068508.1|3194122_3195520_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.0	1.8e-77
WP_155068509.1|3195640_3196588_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_155068510.1|3196584_3197100_-	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_155068511.1|3197086_3198286_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
WP_155068512.1|3198282_3198612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068792.1|3198613_3199843_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_155068513.1|3199842_3200886_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_155068514.1|3200885_3201581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068515.1|3201565_3204055_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377396.1|3204071_3204326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3204326_3204683_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_155068516.1|3205469_3206627_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155068517.1|3206646_3209754_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_155068518.1|3209755_3210232_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_155068519.1|3211576_3211858_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3212006_3212348_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_155068520.1|3212468_3214349_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_155068521.1|3214432_3215950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068522.1|3216048_3217164_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155068523.1|3217131_3217311_+	phosphatase	NA	NA	NA	NA	NA
WP_155068524.1|3217573_3218572_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_155068525.1|3218575_3219343_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_155068526.1|3219335_3220535_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_155068527.1|3220518_3221190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068528.1|3221211_3221988_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	30.7	5.8e-22
WP_155068529.1|3221991_3222990_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.4	2.3e-39
WP_155068530.1|3222991_3223570_-	anthranilate/aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	8.1e-45
WP_155068531.1|3223566_3225036_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3225079_3225367_-	trp operon repressor	NA	NA	NA	NA	NA
WP_155068532.1|3225567_3226488_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155068533.1|3226601_3227156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068534.1|3227271_3228030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047025.1|3228799_3229686_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068535.1|3230094_3230544_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_155066278.1|3230547_3231597_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068536.1|3232433_3232736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068537.1|3233184_3233754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066404.1|3234185_3235071_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067195.1|3235203_3236178_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	9.5e-30
WP_017378398.1|3237247_3237646_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_017378399.1|3238511_3239462_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_155068538.1|3239461_3241540_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 31
NZ_CP039219	Piscirickettsia salmonis strain NVI 5692 chromosome, complete genome	3317308	3251653	3289337	3317308	tRNA,transposase	Prochlorococcus_phage(20.0%)	39	NA	NA
WP_155068548.1|3251653_3252628_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3252721_3253225_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_155068549.1|3253359_3254511_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3254507_3254987_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_155068550.1|3255133_3257455_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.5	6.7e-98
WP_155068551.1|3257399_3258026_+|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
WP_155068552.1|3258030_3258930_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_155068793.1|3259026_3259581_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_155068553.1|3259863_3260988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068554.1|3261344_3261698_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155068555.1|3262381_3263611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068556.1|3263903_3264224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243067.1|3264651_3264834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068557.1|3265554_3266334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|3266610_3267246_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068558.1|3268420_3268711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066404.1|3269001_3269888_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068559.1|3269848_3270106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068560.1|3270852_3271680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068561.1|3271861_3271996_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068562.1|3272205_3273180_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	9.5e-30
WP_155068563.1|3273379_3273604_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155068564.1|3273748_3274411_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	47.3	3.4e-47
WP_032126718.1|3275124_3275505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068565.1|3275668_3276364_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_155068566.1|3276360_3277788_+	dihydrolipoamide dehydrogenase	NA	NA	NA	NA	NA
WP_155068567.1|3277811_3278348_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155068568.1|3278344_3279181_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_155068569.1|3279181_3279523_-	cytochrome C oxidase subunit IV	NA	NA	NA	NA	NA
WP_027242562.1|3279524_3280130_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_155068570.1|3280126_3282121_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_155068571.1|3282140_3283082_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_155068572.1|3283308_3284727_+	MFS transporter	NA	NA	NA	NA	NA
WP_155068573.1|3285124_3285277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068574.1|3285271_3285583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068575.1|3285691_3285865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068576.1|3287322_3287619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068577.1|3287999_3288500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068578.1|3288680_3289337_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039220	Piscirickettsia salmonis strain NVI 5692 plasmid unnamed1, complete sequence	137059	1697	105447	137059	transposase,integrase,tail	Streptococcus_phage(52.5%)	118	NA	NA
WP_036771330.1|1697_2672_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_155068800.1|2849_3560_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036776715.1|4025_4754_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155068801.1|5284_6013_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	9.3e-38
WP_155068802.1|6093_6474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|6721_6985_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_155068147.1|7261_7855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068885.1|7697_9146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|9484_10213_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155068803.1|10571_11624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068886.1|11846_11978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068804.1|13182_13911_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	4.2e-38
WP_155068805.1|14110_15970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066496.1|15978_16815_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	3.2e-42
WP_032126239.1|16826_17099_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068806.1|17099_17618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|17638_17911_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_122943164.1|17914_18175_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_155068807.1|18665_18851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068808.1|19023_19182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068809.1|19151_20090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|20677_21406_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155068125.1|21998_22727_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_064005732.1|22955_23513_-	recombinase family protein	NA	A0A222YWP5	Escherichia_phage	57.9	1.2e-53
WP_155068129.1|23895_26595_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_064005730.1|26659_26923_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_069314058.1|27330_27576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068810.1|27559_27808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068125.1|27837_28566_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155068142.1|29043_29247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068143.1|29350_29500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068811.1|29618_30281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068812.1|30644_31220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068813.1|31622_31943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068814.1|32147_32492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068815.1|32413_32788_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_155047317.1|33786_34623_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_032126239.1|34634_34907_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068816.1|35304_36705_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_155068817.1|37178_38153_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	29.7	6.4e-26
WP_155068818.1|38914_39889_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.3	8.3e-26
WP_155068887.1|40120_40432_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	38.7	8.0e-15
WP_155068819.1|40428_40830_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.9	2.1e-23
WP_032126239.1|40944_41217_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068820.1|41228_41579_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126737.1|41625_42354_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155068821.1|42471_42846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068822.1|43137_43887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068823.1|43990_44911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|45047_45776_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155068824.1|45870_46068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068825.1|46516_46846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068826.1|46869_47832_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155068827.1|48187_48916_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	2.1e-37
WP_155068828.1|49218_49689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068889.1|50262_50577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068888.1|50495_51467_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155068829.1|51598_51742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066440.1|51891_52866_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	4.9e-26
WP_155068830.1|52909_53773_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155068831.1|53776_54544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066508.1|55484_56600_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155068832.1|56640_57060_-	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	40.9	1.1e-19
WP_155068833.1|57148_57763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068834.1|58195_58399_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155068125.1|58428_59157_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155068835.1|59240_60089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|60163_60892_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126714.1|61264_61804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068836.1|61880_62132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068837.1|62293_62443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068838.1|62728_63025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047317.1|63047_63884_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_032126239.1|63895_64168_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211918.1|65658_66627_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_155068839.1|66626_67907_-	AAA family ATPase	NA	A0A240F4U1	Ochrobactrum_phage	33.0	1.5e-43
WP_155068890.1|68523_69522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068840.1|69630_69861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068841.1|70075_70945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068842.1|71013_71742_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	4.2e-38
WP_155068843.1|71785_72157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068844.1|72178_73228_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068845.1|73417_74386_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.7	1.6e-29
WP_155068846.1|74532_74694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068847.1|74703_76158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068848.1|76329_77304_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	2.2e-26
WP_155068849.1|77955_78690_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	2.7e-37
WP_155068850.1|79436_80417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066508.1|81606_82722_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_087910667.1|83654_84338_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_027243197.1|84342_84912_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_017375910.1|85787_86516_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155068851.1|86759_87557_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_155068852.1|87674_88556_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155068853.1|88729_89437_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.8	4.2e-27
WP_155068854.1|89537_89864_-	mRNA-degrading endonuclease	NA	NA	NA	NA	NA
WP_155068855.1|89865_90051_-	toxin-antitoxin system, antitoxin component, AbrB family protein	NA	NA	NA	NA	NA
WP_155047317.1|90546_91383_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_032126239.1|91394_91667_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068842.1|92065_92794_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	4.2e-38
WP_155068856.1|92840_93359_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155068857.1|93470_93797_-	mRNA-degrading endonuclease	NA	A9D9Y1	Lactobacillus_prophage	35.6	7.3e-11
WP_155068858.1|93798_94041_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155068842.1|94588_95317_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	4.2e-38
WP_155068859.1|95410_96010_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|96438_97167_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155068860.1|97298_97472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066440.1|97491_98466_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	4.9e-26
WP_155068861.1|98694_99090_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_155068862.1|99089_99800_+	RES domain-containing protein	NA	NA	NA	NA	NA
WP_155068863.1|99844_99994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068864.1|100138_100315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068865.1|100317_100515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068866.1|100716_101310_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.9	2.3e-10
WP_032126737.1|101339_102068_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155066480.1|102173_103223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068867.1|103355_104375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068179.1|104718_105447_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
>prophage 1
NZ_CP039221	Piscirickettsia salmonis strain NVI 5692 plasmid unnamed2, complete sequence	79048	1665	50181	79048	transposase,integrase	unidentified_phage(22.22%)	57	NA	NA
WP_032126737.1|1665_2394_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155066469.1|2525_2798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|2949_3222_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068893.1|3233_3872_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	36.8	3.3e-31
WP_032126239.1|3938_4211_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|4222_5059_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_155068894.1|5077_5677_-	hypothetical protein	NA	K7PKX4	Enterobacterial_phage	34.3	1.2e-22
WP_155068895.1|5917_6244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068896.1|6447_6684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068897.1|6989_7853_-	hypothetical protein	NA	A0A1B0XTI7	Freshwater_phage	27.4	7.9e-12
WP_155068898.1|7842_8592_-	hypothetical protein	NA	A0A1B0XTI8	Freshwater_phage	40.9	2.4e-49
WP_155068899.1|9246_9744_-	hypothetical protein	NA	A0A291AYC8	Shigella_phage	38.4	5.6e-18
WP_036774259.1|10174_11149_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_155068900.1|11226_11472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068901.1|11627_12443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068902.1|12550_12922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066508.1|13454_14570_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155068948.1|14603_14822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068903.1|15958_16156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068904.1|16366_16879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068905.1|16907_17657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068906.1|18373_18571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068907.1|18918_19143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068908.1|19162_19669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068909.1|19658_20189_-	hypothetical protein	NA	A0A0H4TJ49	Erysipelothrix_phage	40.0	1.8e-06
WP_155068910.1|20169_20541_-	hypothetical protein	NA	A0A2I7QR23	Vibrio_phage	32.2	4.0e-05
WP_155068911.1|20570_21377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067589.1|21986_23114_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155068912.1|23433_23937_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155068913.1|23930_24572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126347.1|24620_25361_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	6.0e-08
WP_016212315.1|25769_26204_-	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	39.7	9.1e-25
WP_122942527.1|26609_26909_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_155068914.1|26905_27151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067589.1|27504_28632_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_122942721.1|29701_30784_+	replication initiation protein	NA	NA	NA	NA	NA
WP_148037459.1|30789_31011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|31276_32251_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_155068915.1|32440_32632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420837.1|32821_33754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377509.1|33895_34624_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_155068916.1|34653_36726_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_036771639.1|37055_38030_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_155068917.1|38315_40079_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155068918.1|40811_41120_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155068919.1|41389_42127_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	27.3	5.4e-09
WP_155068920.1|42346_42700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068921.1|42845_43130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068922.1|43686_44661_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.3	1.9e-25
WP_155068923.1|44758_45076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068924.1|45065_45296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068925.1|45768_46584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068926.1|46631_47321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068927.1|47751_48105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068928.1|48184_48553_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155068929.1|48605_49385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068173.1|49452_50181_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 2
NZ_CP039221	Piscirickettsia salmonis strain NVI 5692 plasmid unnamed2, complete sequence	79048	71598	78932	79048	transposase	Streptococcus_phage(14.29%)	10	NA	NA
WP_155068173.1|71598_72327_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155068941.1|72765_73221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068942.1|73629_74364_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.2	1.3e-26
WP_155066610.1|74728_75304_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.2	1.6e-08
WP_155068943.1|75249_75591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068944.1|75737_75905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|75947_76922_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_155068945.1|77153_78119_+	hypothetical protein	NA	B5AX98	Iodobacteriophage	26.5	3.7e-10
WP_155068946.1|78119_78743_+	hypothetical protein	NA	A0A2H4J1F0	uncultured_Caudovirales_phage	47.2	1.4e-39
WP_155068947.1|78755_78932_+	carbon storage regulator	NA	H2BD56	Pseudomonas_phage	51.1	4.2e-05
>prophage 1
NZ_CP039222	Piscirickettsia salmonis strain NVI 5692 plasmid unnamed3, complete sequence	75380	3678	49814	75380	head,capsid,terminase,protease,portal,tail,transposase	Streptococcus_phage(34.48%)	54	NA	NA
WP_032126737.1|3678_4407_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_017375910.1|4564_5293_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155068953.1|5339_5681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068954.1|5768_6152_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	43.9	2.8e-25
WP_155068955.1|6427_7876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|8397_9126_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155068956.1|10029_10596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|11296_12271_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_032126239.1|12588_12861_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066496.1|12872_13709_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	3.2e-42
WP_155068957.1|13727_13931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068958.1|14166_14601_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_155068959.1|14767_15232_-	hypothetical protein	NA	H6WFS7	Cyanophage	36.2	6.5e-21
WP_155068960.1|15324_15792_+	tryptophan-rich sensory protein	NA	A0A1V0S976	Catovirus	34.0	1.9e-07
WP_017375910.1|15882_16611_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155068961.1|16613_17786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068962.1|17930_18332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|18400_19129_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155068963.1|19151_21083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068964.1|21293_21587_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155068965.1|21583_21907_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	55.0	2.1e-18
WP_017375910.1|22080_22809_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155069006.1|22787_23348_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.6	2.5e-43
WP_155068966.1|23932_25306_-	DEAD/DEAH box helicase	NA	D2J050	Enterococcus_phage	50.7	3.4e-126
WP_054300664.1|25374_25941_-	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	35.0	1.4e-20
WP_017377658.1|25944_26631_-	Fic family protein	NA	NA	NA	NA	NA
WP_036771330.1|26999_27974_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_032126737.1|28506_29235_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155068967.1|29325_29766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068968.1|29812_30055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047317.1|31562_32399_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_032126239.1|32410_32683_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068969.1|32769_33063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068970.1|33065_34748_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	45.3	8.2e-138
WP_155068971.1|34838_35975_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	46.9	7.1e-85
WP_155068972.1|35922_36594_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	45.4	7.2e-45
WP_155068973.1|36651_37635_+|capsid	phage major capsid protein	capsid	Q6DMU0	Streptococcus_phage	33.1	1.6e-45
WP_032126239.1|37690_37963_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047317.1|37974_38811_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_155068974.1|39154_39379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068975.1|39594_39906_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	29.8	8.0e-07
WP_155068976.1|39902_40226_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	43.5	1.7e-15
WP_155068977.1|40218_40614_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	35.5	6.0e-07
WP_155068978.1|40610_40964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|41325_41598_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047317.1|41609_42446_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_155068979.1|42723_44493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068980.1|45184_45595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068146.1|45603_45972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068981.1|46113_46842_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155068982.1|47111_48236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068983.1|48641_48845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068984.1|48792_49056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068985.1|49085_49814_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	7.1e-38
>prophage 1
NZ_CP039224	Piscirickettsia salmonis strain NVI 5692 plasmid unnamed5, complete sequence	42705	20297	28055	42705		Freshwater_phage(33.33%)	12	NA	NA
WP_155069073.1|20297_21161_+	hypothetical protein	NA	A0A1B0XTI7	Freshwater_phage	26.9	8.8e-11
WP_155069074.1|21163_21682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069075.1|21732_22839_+	hypothetical protein	NA	K7PKX4	Enterobacterial_phage	32.7	8.9e-24
WP_155069077.1|22897_23635_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_155069079.1|23688_24699_+	hypothetical protein	NA	A0A1B0XTJ8	Freshwater_phage	29.0	4.7e-32
WP_155069081.1|24710_24902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069082.1|24898_25321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069084.1|25298_25766_+	hypothetical protein	NA	A0A2K9V3I1	Faecalibacterium_phage	35.0	7.6e-09
WP_155069085.1|25765_26131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069086.1|26087_26615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069087.1|26598_27627_+	DUF3383 family protein	NA	E5DV56	Deep-sea_thermophilic_phage	30.7	2.2e-32
WP_155069088.1|27635_28055_+	hypothetical protein	NA	A0A142IE16	Pseudomonas_phage	32.8	2.3e-12
>prophage 1
NZ_CP039225	Piscirickettsia salmonis strain NVI 5692 plasmid unnamed6, complete sequence	40120	18994	35006	40120	transposase	unidentified_phage(36.36%)	17	NA	NA
WP_155068562.1|18994_19969_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	3.7e-26
WP_155066440.1|20458_21433_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	4.9e-26
WP_155069129.1|21532_21790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069130.1|21809_22277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069131.1|22294_24175_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	33.7	4.3e-55
WP_155069132.1|24271_24541_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_155068019.1|25109_26084_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.9e-26
WP_155069133.1|26080_26806_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.8	1.6e-10
WP_155069139.1|26845_27178_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	44.2	2.5e-14
WP_027242582.1|27174_27576_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.9	6.0e-23
WP_155069134.1|27585_29772_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.0	5.4e-73
WP_155067195.1|29985_30960_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	2.2e-26
WP_155069135.1|31058_31250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067666.1|32149_32986_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	7.1e-42
WP_032126239.1|32997_33270_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155069136.1|33346_33799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069020.1|33923_35006_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	73.0	5.8e-145
