The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	45566	89679	3160732	transposase	Moraxella_phage(16.67%)	46	NA	NA
WP_129556427.1|45566_46142_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46087_46453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46651_47413_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_016211195.1|47714_49241_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49612_50452_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50491_51799_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51773_52943_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|52997_53723_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54001_54391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54550_55456_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55531_55675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274979.1|55722_56562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|56554_56890_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_155046698.1|57068_57230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|57346_57640_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_016210704.1|58534_60481_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61135_64198_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64194_65259_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65614_66568_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66599_67763_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67768_68368_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68555_69056_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69073_70162_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70588_71833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71829_72672_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016211096.1|72651_73461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73639_73867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73867_74818_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74873_75425_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75551_75974_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75966_76713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76755_77454_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77464_78289_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78618_78987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274980.1|78981_80043_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|80092_80323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80452_81667_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81967_83029_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_016211249.1|83042_84770_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_016211245.1|84803_85535_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85534_86323_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86427_87051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87370_87583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273383.1|87738_88311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046699.1|88515_89088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274981.1|89082_89679_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	136473	178470	3160732	transposase	Staphylococcus_phage(50.0%)	46	NA	NA
WP_054300271.1|136473_137448_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|137949_139362_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|139854_140862_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|140881_142402_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_129556430.1|142458_142665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211018.1|143640_144957_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145060_145444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145578_148644_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|148712_149816_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|149839_150394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150508_151078_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151197_151953_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_054300545.1|152119_153181_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|153575_153971_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|153992_154358_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154414_154579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|154568_154868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|155120_155486_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|155431_156007_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212607.1|156007_156364_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|156452_157028_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|156973_157339_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|157818_158385_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|158396_159182_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|159813_160737_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|160788_161784_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|161815_162310_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|162401_162659_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|162748_163171_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|163489_164206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|164249_164501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556431.1|164514_165942_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|165969_167412_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|167499_167838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|167922_168453_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|168513_170706_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|170748_171234_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|171503_171935_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_016210245.1|171952_172783_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|172797_172941_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|172971_173856_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|173827_174049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|174222_174501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|175471_176377_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016212383.1|176779_177898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|177894_178470_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	182276	239530	3160732	protease,transposase,tRNA,tail	Escherichia_phage(12.5%)	56	NA	NA
WP_075273327.1|182276_182852_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|182797_183163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|183226_183499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212441.1|183766_183991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372761.1|185006_185456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|185519_186248_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210779.1|186290_187220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|187512_188106_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|188074_188728_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|188905_189877_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|189899_190796_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|190954_191401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210787.1|191397_192039_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|192148_192727_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|193202_193640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|193964_195305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|195568_196963_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075274986.1|198411_199479_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|199531_199954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|200194_200638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|200692_200950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|200927_201554_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|201631_203614_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|203823_205167_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|205433_208103_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|208126_210046_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|210215_211637_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|211782_212757_+	phospholipase A	NA	NA	NA	NA	NA
WP_016209855.1|212788_213184_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209859.1|213186_213408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|213571_215233_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|215305_215596_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_016209861.1|215821_216277_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|216341_216806_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216898_218245_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|218244_219150_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|219211_220198_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|220190_220433_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|220554_222099_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|222145_223432_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|223474_224869_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224892_225072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|225068_225644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|225589_225955_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274988.1|226016_228251_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016210079.1|228672_229170_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|229340_230036_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|230138_231701_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|232016_233810_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233895_234168_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|234173_234800_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234786_236217_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236549_237605_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237573_238251_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|238240_239077_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|239236_239530_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	256927	301858	3160732	transposase,tRNA	Acinetobacter_phage(40.0%)	48	NA	NA
WP_075274991.1|256927_257503_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377888.1|257506_258067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556436.1|258122_259009_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046701.1|259035_259185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|259329_259530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|259577_260039_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|260462_261944_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|262006_263116_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|263213_265175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|265704_266109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|266161_267223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046702.1|267348_267504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270449_271602_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556437.1|271644_272067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049804.1|272336_273779_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_032126861.1|273982_274297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046703.1|274490_274628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|274631_275518_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212538.1|275689_276130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210630.1|276659_277775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664846.1|277713_278400_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032126366.1|278393_279371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210638.1|279409_280573_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210640.1|281037_281262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|281647_281935_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210633.1|282109_282865_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|282870_283326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210637.1|283301_283778_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210636.1|283784_285362_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_032126367.1|285365_286130_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210629.1|286183_286720_+	tim44-like domain protein	NA	NA	NA	NA	NA
WP_016210634.1|286716_287448_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_032126368.1|287556_288711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275120.1|288855_289167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664872.1|289490_290471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211898.1|290712_291336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211899.1|291663_291957_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_105962625.1|292053_292940_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212296.1|293719_294448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126374.1|294556_295528_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664866.1|295559_295976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211609.1|296590_296899_+	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_032126373.1|296931_299118_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	2.7e-141
WP_016211605.1|299221_299455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|299671_300202_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211607.1|300230_300455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|300637_301453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300526.1|301561_301858_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	329433	374988	3160732	transposase	Hokovirus(33.33%)	45	NA	NA
WP_075273298.1|329433_330009_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210127.1|330061_331087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|331180_331444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|331810_332629_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|332701_335074_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_016210125.1|335786_337214_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|337248_338271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|338287_338665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210122.1|339506_340199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|340825_341800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|341789_343562_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|343562_343910_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_032126493.1|344159_345386_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|345475_346774_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664834.1|346807_347167_-	VUT family protein	NA	NA	NA	NA	NA
WP_080664833.1|347212_347557_-	VUT family protein	NA	NA	NA	NA	NA
WP_016210137.1|347537_348089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664832.1|348315_349614_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|349730_350021_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_155049101.1|350332_351574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|351986_352562_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|352507_352873_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212359.1|353608_353827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|354194_355169_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212044.1|355707_355962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|356684_357671_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|357808_358003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664870.1|358685_359333_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_129556444.1|359325_359748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211797.1|359909_361313_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|361363_361939_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|361884_362199_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556445.1|362239_363126_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126227.1|363764_364055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212008.1|364092_364791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212010.1|364807_365104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556446.1|365221_366373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273619.1|366645_367221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211273.1|367278_368112_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.0	3.5e-17
WP_016211268.1|368227_369412_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211271.1|369430_370375_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016211269.1|370679_371465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211272.1|371582_371951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211270.1|372178_373756_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_054300173.1|373926_374988_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	447601	555242	3160732	transposase,integrase,tRNA	Escherichia_phage(45.95%)	103	512755:512814	545878:546258
WP_075275004.1|447601_448465_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|448681_450241_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|450262_451297_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|451345_451915_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|452050_453022_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|453033_454611_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|454676_455663_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016210646.1|455994_457104_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|457209_458394_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|458471_460460_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|460668_460824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|461081_461381_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_075275005.1|461539_461875_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|462791_464198_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|464215_465202_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|465204_466359_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|466355_467051_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|467185_468676_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|468696_469746_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|469812_471207_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|472085_474017_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|474021_474552_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|474586_474781_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|474823_475183_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|475602_476598_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_032126132.1|476610_478992_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|478997_479285_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|479556_480033_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|480177_480375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|480499_481474_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|482374_482473_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210477.1|482957_484247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126626.1|484483_485176_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|485217_485991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|485992_486934_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|487066_488644_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|488853_490611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|491159_491918_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|492125_492698_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|492801_493350_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|493651_493897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|493925_494222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|494489_495413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556451.1|495891_496149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275008.1|496212_496941_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	3.3e-43
WP_098082828.1|497255_497513_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275009.1|497644_498352_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.8	1.3e-44
WP_075275011.1|498395_499124_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.2e-42
WP_032126799.1|499315_500128_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_129556452.1|501248_501596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|501598_503338_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300501.1|503842_504571_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_016212066.1|504931_505708_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016212069.1|505919_506087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212070.1|506061_506661_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_054300500.1|507070_507799_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_054300501.1|508147_508876_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|508887_509280_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|509276_509522_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300307.1|510625_511354_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300307.1|511960_512689_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
512755:512814	attL	GATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCG	NA	NA	NA	NA
WP_016212268.1|513333_513918_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|513921_514605_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|514887_515616_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_052104629.1|515952_516978_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212159.1|517121_517319_-	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_016212158.1|517586_518501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275019.1|518610_519315_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	9.2e-43
WP_105962625.1|519278_520165_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211714.1|520539_523884_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_016211713.1|523916_524606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|524628_525357_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_075275021.1|525424_526366_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556625.1|526580_527138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126478.1|527130_527469_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.7e-24
WP_032126479.1|527455_527809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212114.1|527805_528036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212110.1|528039_528510_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	62.5	7.6e-33
WP_054300201.1|529156_529885_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_016212024.1|530280_530529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212021.1|530525_531125_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|531124_531343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|531829_532822_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|532818_533553_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_129556453.1|533972_534404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047116.1|534548_534728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|535429_536158_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_051307368.1|536815_538096_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|538095_539064_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_032126737.1|541575_542304_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_032126738.1|542504_542777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|542769_543048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212425.1|543251_543842_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.4	1.1e-20
WP_032126150.1|543990_544224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|544322_545297_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_075275025.1|546812_548828_-	DUF1561 family protein	NA	NA	NA	NA	NA
545878:546258	attR	GATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTTTTTCAAAAAGGCAATCGCCCAACCTTATGTGAAATCACCGCGTGTTGTGAATGTCGACAAGCACGCTTCATTTCCACCCGCTCACCAAAAAGCCAAAGATGAAGGTCTCTTTTCTAGTCAGTGTAAACTCAGGCGAGTGAAGTATTTAAACAACTGCATTGAAAATGATCACAAAGCGGTAAAGCGCAAATCCCGTTTCCGCCAATGGTACCAATCACTTTCTACAGCACGGCCTACCATTGACATAATGGAAGCGATGCGCATGGTTCAAAAAGGTCAATTACGTTATATTAAAAAACAGAATATCTGTGCC	NA	NA	NA	NA
WP_016211807.1|549077_549299_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728351.1|549186_549345_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556454.1|549608_551621_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_075275029.1|551789_552518_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	9.6e-43
WP_075275032.1|553261_554071_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	1.1e-15
WP_032126239.1|554121_554394_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|554405_555242_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
>prophage 7
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	560170	604137	3160732	transposase,tRNA	Escherichia_phage(22.22%)	47	NA	NA
WP_054300202.1|560170_560899_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211235.1|561393_561831_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|562260_563649_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211238.1|564091_565585_+	amino acid permease	NA	NA	NA	NA	NA
WP_129556456.1|565786_566536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556457.1|566579_567518_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016211244.1|567501_568197_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_036776715.1|568598_569327_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|569420_570086_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|570150_571107_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|571365_572064_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|572106_573219_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|573823_574399_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|574344_574710_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|574797_575148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|575883_576945_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556458.1|577320_577554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210908.1|578445_579261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|579351_580335_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|580505_581027_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_016210914.1|581060_581312_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210909.1|581317_582595_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|583287_583815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|583934_586247_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|586375_587191_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|587388_587853_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275036.1|587982_589044_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|589304_589601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|589883_591347_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|591349_592402_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211494.1|592391_592847_+	arginine repressor	NA	NA	NA	NA	NA
WP_016211487.1|592871_593195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|593542_593854_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_032126201.1|593983_594730_+	lipoprotein	NA	NA	NA	NA	NA
WP_054300148.1|594751_595813_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|595923_596898_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126197.1|597038_597992_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|598105_598303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|598548_598749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212072.1|598778_598976_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212074.1|599062_599284_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|599310_599676_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275038.1|599621_600212_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046713.1|600349_600514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|600808_602245_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|602286_603738_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|603849_604137_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	640386	741015	3160732	protease,transposase,tRNA,plate	Prochlorococcus_phage(17.65%)	104	NA	NA
WP_016209523.1|640386_641736_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|641786_642224_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|642485_643997_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_032126188.1|644002_645229_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|645222_646251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|646228_646921_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_016209516.1|646925_648395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556464.1|648384_648876_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|648881_650354_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|650353_650752_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|650748_652437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|652418_653375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|653417_653933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|654037_654970_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|655189_655576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|655592_656237_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|656417_657257_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|657332_657935_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|657935_658790_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|659146_659458_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|659482_660874_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|661029_661761_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_129556465.1|661757_662330_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|662316_662874_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|662879_663860_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|663999_664800_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_129556466.1|664803_665571_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|665567_666032_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|666054_666708_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|666711_667059_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|667092_667344_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|667418_668687_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|668689_669448_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|669509_670400_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|670450_671134_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|671219_671477_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_075275046.1|671749_673963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|673954_674827_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|674994_676824_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|676987_677629_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|677870_678401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|678418_678592_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|678650_679700_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|679706_680657_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|680710_681655_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|681682_682420_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|682508_682751_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|682825_684049_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|684080_684929_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|684925_685978_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|686098_686719_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_016210407.1|686734_687721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080743011.1|687831_688287_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556469.1|688246_688555_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|689348_690254_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275050.1|690329_691025_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275052.1|691169_691679_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|691728_691938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|693172_693619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|693622_694198_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275054.1|694143_694509_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|694629_694815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|694918_695953_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|695949_696660_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|697134_697653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|697770_698103_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209920.1|698132_701087_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209912.1|701132_701630_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|701689_702106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|702197_703058_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|703140_703707_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|703739_704594_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_016209914.1|704635_707542_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|707602_707800_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|707806_708817_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|708813_709872_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|709865_710666_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|710668_711487_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|711498_712446_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|712453_713755_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|713933_715037_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|715033_715426_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|715437_716814_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|716807_718277_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209916.1|718468_719440_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	3.7e-34
WP_129556470.1|719676_720563_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|720862_721108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|721656_722391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|722515_723577_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|723899_724604_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|724697_725411_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|725493_726585_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|726656_727238_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|727243_727870_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|727966_728902_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|729261_729933_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210598.1|730074_730734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|730902_732162_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|732158_733244_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|733236_734118_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|734106_735357_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_075275125.1|736948_737992_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|740128_740494_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|740439_741015_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	776445	823131	3160732	transposase,tRNA	Staphylococcus_phage(28.57%)	39	NA	NA
WP_016209374.1|776445_777897_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|777932_779462_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_016209380.1|780037_780460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556473.1|780592_781681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126585.1|782222_783143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|783493_784309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|784600_787291_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_080664814.1|787539_788760_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|788927_790634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|791232_792459_+	MFS transporter	NA	NA	NA	NA	NA
WP_075274832.1|793041_794016_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_075273456.1|794138_794438_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|794397_794853_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212416.1|794854_795385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212417.1|795508_795754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|795804_796170_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|796115_796691_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052047106.1|796764_797241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|797956_798322_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|798267_798843_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300173.1|798869_799931_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556627.1|799983_800589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211819.1|800807_801038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|801334_801835_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|802037_803294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211822.1|803650_804064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|804373_805435_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275065.1|805734_806409_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.9e-10
WP_016212172.1|807299_808772_+	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|808791_809766_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556474.1|809970_810192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|810357_810978_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_016210737.1|811296_813273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|813428_814886_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|814954_816535_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210744.1|816575_817061_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|817157_821054_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|821060_821384_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300173.1|822069_823131_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	839818	894271	3160732	protease,transposase	Staphylococcus_phage(15.38%)	45	NA	NA
WP_033923708.1|839818_840694_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|840949_841594_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|841624_843430_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|843453_844029_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556476.1|844573_845584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|845679_846654_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016209640.1|847072_848092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|848550_849516_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|849560_850136_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|850166_851441_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|852067_852781_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|852860_853598_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|853718_855074_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|855250_855922_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|856037_856913_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|857516_858821_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|858933_859539_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|859620_860922_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|860989_863422_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|863525_863798_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_032126162.1|863901_865779_+	SurA domain-containing protein	NA	NA	NA	NA	NA
WP_016209643.1|865810_866695_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|866703_867099_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|867526_869674_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|869645_870995_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|870991_873112_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|873108_874812_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209654.1|874930_876073_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|876137_877166_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_129556477.1|877325_878807_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|878896_879382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275067.1|879714_880782_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273512.1|881537_881882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|882018_882993_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126362.1|883164_883530_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051307360.1|884369_885299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211512.1|886390_887197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|887539_889432_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|889718_890123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923634.1|890327_890876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|890865_891752_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|892090_892501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556479.1|892714_892897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274918.1|893384_893750_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|893695_894271_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	900521	963358	3160732	transposase,integrase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(14.29%)	59	892881:892940	910165:910604
892881:892940	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_032126152.1|900521_901112_-|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016212424.1|901314_901593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|901585_901858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|902002_903085_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211300.1|903135_904176_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_129556480.1|904687_910177_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|910200_911175_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
910165:910604	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTA	NA	NA	NA	NA
WP_016212302.1|911488_911788_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_129556481.1|911972_912404_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_054300162.1|912661_913744_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211579.1|913967_914453_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|914520_915429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211581.1|915705_916476_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.9	8.9e-31
WP_016211585.1|916594_917152_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016211582.1|917213_917993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|918090_918444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|918510_918705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|918720_919065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|919422_919998_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|919943_920309_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377898.1|920426_920984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047108.1|921085_921484_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212107.1|922295_923432_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046716.1|923836_923983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|924680_925235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|925671_925854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210541.1|925918_926146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|926376_927123_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|927349_927643_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|927714_928320_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|928468_929446_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_032126547.1|929542_930985_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|931011_931665_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_016210552.1|931789_932356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|932710_934489_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_016210542.1|934560_936267_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.9	2.5e-25
WP_054300262.1|936258_936549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066183.1|936605_936803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|937011_937377_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|937322_937898_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|937901_938276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275071.1|938651_939626_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_054300264.1|939728_940067_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300265.1|940211_940472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556469.1|940431_940740_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556484.1|941241_942702_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_016211426.1|943045_944488_+	MFS transporter	NA	NA	NA	NA	NA
WP_075273490.1|945470_946763_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_054300148.1|947003_948065_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556485.1|948217_950776_+	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.6	6.3e-73
WP_032126554.1|950795_951881_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_016210417.1|952322_952760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210423.1|952756_953641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210416.1|953730_954261_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_016210420.1|954331_955510_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.1	2.0e-50
WP_016210425.1|955658_959507_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_016210422.1|959493_960996_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_016210418.1|961546_962182_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_081377899.1|962494_963358_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	967430	1070611	3160732	transposase,tRNA	uncultured_Mediterranean_phage(11.11%)	110	NA	NA
WP_075275075.1|967430_968492_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|968486_968657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|968646_968811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|968867_969233_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|969254_969623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210898.1|970534_970885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|970973_971264_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|971738_972041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210897.1|972381_973362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|973440_974778_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|974896_975268_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|975488_976139_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|976181_977264_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|977317_979201_+	APC family permease	NA	NA	NA	NA	NA
WP_032126790.1|979700_980606_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275077.1|980690_981527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212218.1|981671_982022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|983472_984534_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|984659_985742_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_032126801.1|986412_986922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275079.1|986969_988031_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556488.1|988179_989029_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126540.1|990178_991042_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|991922_992288_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|992233_992809_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|993039_993405_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|993350_993926_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126869.1|994446_994686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|994663_995725_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212290.1|995841_997167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|997170_998057_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212326.1|998282_998480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122941816.1|998566_998875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212323.1|998951_999224_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_075274676.1|999298_999496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046717.1|999654_999804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|1002060_1004097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664853.1|1004820_1006563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211090.1|1006522_1008157_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|1008169_1009213_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|1009191_1009653_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_016211081.1|1009693_1010629_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211087.1|1010656_1011652_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211088.1|1011871_1012834_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126778.1|1013012_1013207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075285940.1|1013421_1014243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377357.1|1014327_1014729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212611.1|1015212_1015533_+	histidine kinase	NA	NA	NA	NA	NA
WP_075275084.1|1015580_1016642_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212519.1|1016716_1017097_+	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_052047081.1|1017367_1017805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212356.1|1017855_1018701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275086.1|1018678_1019677_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1019637_1020003_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1019948_1020524_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1020893_1021868_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016212585.1|1021979_1022300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212621.1|1022594_1022999_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_075273327.1|1022995_1023571_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1023516_1023882_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126498.1|1023943_1024504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211126.1|1024636_1025026_-	lipoprotein	NA	NA	NA	NA	NA
WP_016211125.1|1025195_1026026_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211128.1|1026248_1027154_-	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211119.1|1027317_1028079_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211122.1|1028082_1028949_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126499.1|1029045_1029657_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211118.1|1030035_1031283_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126500.1|1031419_1032136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275089.1|1032269_1032602_-	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	37.3	8.0e-05
WP_129556631.1|1032746_1032914_-	phosphatase	NA	NA	NA	NA	NA
WP_075275091.1|1033922_1034408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|1034678_1035089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300412.1|1035233_1035548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210280.1|1035784_1036879_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_016210284.1|1036960_1037482_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210276.1|1037536_1038013_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210275.1|1038068_1038371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210273.1|1038435_1039143_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210274.1|1039515_1039914_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_032126334.1|1039953_1040385_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210271.1|1040395_1041079_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1041163_1043359_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_129556492.1|1043456_1044200_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210283.1|1044227_1045013_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_016210272.1|1045052_1045763_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210279.1|1045750_1046917_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210277.1|1046970_1047804_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210270.1|1047873_1050861_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210281.1|1050902_1052294_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210269.1|1052307_1052658_-	L,D-transpeptidase catalytic domain protein	NA	NA	NA	NA	NA
WP_032126362.1|1052695_1053061_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1053006_1053582_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664860.1|1053545_1053983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211367.1|1054138_1054921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126330.1|1055068_1056028_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_032126331.1|1056082_1058092_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_016211366.1|1058147_1058435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126332.1|1058687_1059887_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_075273327.1|1060533_1061109_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1061054_1061420_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|1061553_1062417_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1062647_1062941_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556495.1|1063921_1064179_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211589.1|1064301_1065534_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_016211592.1|1065523_1066186_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_129556496.1|1066460_1067699_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_032126329.1|1067884_1068514_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211588.1|1068589_1069291_+	cyclase family protein	NA	NA	NA	NA	NA
WP_105962623.1|1069458_1070611_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 13
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	1100068	1143128	3160732	transposase,tRNA	Tupanvirus(28.57%)	41	NA	NA
WP_075275097.1|1100068_1100644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1100589_1100955_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300408.1|1101005_1101662_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_080664854.1|1101998_1102580_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_032126179.1|1102537_1102789_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_016211113.1|1102818_1104144_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_016211112.1|1104199_1104847_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211115.1|1105039_1106992_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211114.1|1107124_1110055_+	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_075274672.1|1110420_1111014_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1111185_1111551_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1111496_1112072_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1112085_1112376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1112321_1112897_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212254.1|1112886_1114329_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016212252.1|1114366_1114525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|1114839_1115565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|1115769_1116141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211395.1|1116497_1116833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779999.1|1116748_1117180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211393.1|1117199_1118756_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_016211391.1|1118767_1119343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728317.1|1119409_1122775_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275098.1|1122965_1123895_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-24
WP_129556498.1|1124407_1125016_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210596.1|1125012_1126953_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.1e-72
WP_016210594.1|1127088_1127742_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210595.1|1127918_1129097_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210588.1|1129464_1130790_+	fimV domain protein	NA	NA	NA	NA	NA
WP_032126176.1|1130880_1131663_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210587.1|1131764_1132625_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_016210590.1|1132799_1134062_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210593.1|1134141_1134672_+	colicin V production protein	NA	NA	NA	NA	NA
WP_016210586.1|1134693_1136199_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210592.1|1136211_1136868_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016212005.1|1137257_1139018_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_155049815.1|1139583_1139736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1139918_1141071_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_032126856.1|1141376_1141718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377901.1|1141778_1142489_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275102.1|1142669_1143128_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	1197113	1249794	3160732	protease,tRNA,transposase	Klosneuvirus(28.57%)	48	NA	NA
WP_016209838.1|1197113_1198007_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|1198006_1199221_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|1199240_1200527_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|1200542_1200797_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016209830.1|1201032_1202400_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|1202730_1203753_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_032126640.1|1204275_1205751_+	APC family permease	NA	NA	NA	NA	NA
WP_129556633.1|1205967_1206864_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209827.1|1207182_1208742_+	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_016209841.1|1208817_1209012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209831.1|1209231_1209930_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|1210208_1210472_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209848.1|1210778_1213373_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209835.1|1213369_1213852_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209844.1|1213829_1214870_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209840.1|1215042_1215528_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_032126641.1|1215635_1218206_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_032126642.1|1218241_1218703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|1218772_1218979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|1220182_1220722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|1221381_1222866_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|1222990_1224526_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|1224759_1225125_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556501.1|1225070_1225646_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_059372539.1|1225678_1226542_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080728346.1|1226559_1226892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300375.1|1227698_1227899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|1228113_1228419_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_016210929.1|1228453_1228810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046724.1|1228806_1228974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210921.1|1229198_1229783_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_016210925.1|1229874_1230561_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.5	9.7e-29
WP_032126561.1|1230684_1231869_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210917.1|1232082_1233525_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	5.4e-21
WP_016210927.1|1233649_1234600_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210930.1|1234660_1235434_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210918.1|1235437_1236187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210926.1|1236271_1237741_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_129556502.1|1238000_1238564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273571.1|1238672_1239350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211012.1|1239499_1240072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211008.1|1240180_1241683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211010.1|1241775_1244205_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_016211011.1|1244483_1245680_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_016211013.1|1245740_1248107_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_032126565.1|1248424_1248697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1248907_1249273_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1249218_1249794_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	1254330	1431565	3160732	transposase,tRNA	Bacillus_phage(11.76%)	168	NA	NA
WP_081007040.1|1254330_1254987_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210510.1|1255017_1255746_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_016210506.1|1255738_1256977_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210512.1|1257112_1258150_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210515.1|1258203_1259106_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210514.1|1259214_1260468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1260525_1264023_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075273576.1|1264082_1264811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|1264938_1265487_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016210508.1|1265807_1267505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556503.1|1267513_1268380_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	5.6e-58
WP_032126637.1|1269441_1269735_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032127044.1|1270636_1270837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1271040_1272102_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047029.1|1272174_1272516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1272683_1273049_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|1272994_1273570_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211467.1|1273644_1274211_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_032126344.1|1274213_1275302_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032126343.1|1275422_1276235_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_016211471.1|1276365_1278351_+	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
WP_016211470.1|1278410_1279064_-	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_129556505.1|1279830_1280796_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1280836_1281811_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212421.1|1282561_1282744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1283235_1283601_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1283546_1284122_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556507.1|1284111_1284798_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.3	5.5e-48
WP_032126637.1|1284914_1285208_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556508.1|1285269_1285713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300380.1|1285983_1286640_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1286741_1287107_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1287052_1287628_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212483.1|1287624_1288422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1288432_1289515_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300173.1|1289817_1290879_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211841.1|1291738_1292191_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211839.1|1292308_1293781_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|1293939_1294404_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|1294874_1295048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274832.1|1295359_1296334_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_032126143.1|1296433_1297705_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_016211422.1|1297793_1298264_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_051307357.1|1298286_1298880_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211417.1|1299016_1300066_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_016211415.1|1300089_1301013_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1301029_1301491_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211414.1|1301598_1302417_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_129556449.1|1302632_1303139_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1303153_1303519_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377858.1|1303722_1304433_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300382.1|1304651_1305074_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046725.1|1305290_1305431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1305474_1306449_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075274829.1|1306472_1306745_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1306756_1307593_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126139.1|1310261_1311191_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_016210804.1|1311197_1313117_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126141.1|1313181_1314456_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210805.1|1314865_1315537_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_016210808.1|1315545_1316397_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210803.1|1316574_1317873_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_054300162.1|1317947_1319030_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212040.1|1319233_1320583_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_016212039.1|1320759_1321317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133287.1|1321505_1321904_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075274828.1|1322005_1323328_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.2e-11
WP_054300384.1|1323736_1324552_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212251.1|1324713_1325250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212250.1|1325411_1326062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126600.1|1326184_1326706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|1326977_1327160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1327509_1328787_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_080664858.1|1328783_1328921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211223.1|1329432_1331034_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211221.1|1331050_1332193_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211218.1|1332445_1333183_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|1333207_1334479_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_075274826.1|1334735_1335641_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211680.1|1335871_1338271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211682.1|1338318_1340001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209976.1|1340870_1341104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126209.1|1341304_1341925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209969.1|1341891_1342857_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016209951.1|1342847_1343258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209957.1|1343264_1343600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556634.1|1343600_1344143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209950.1|1344447_1345239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209973.1|1345275_1348380_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_016209965.1|1348409_1349207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209956.1|1349211_1352202_-	ATPase AAA	NA	NA	NA	NA	NA
WP_016209975.1|1352207_1352639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209972.1|1352689_1353256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126210.1|1353255_1354299_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_016209954.1|1354304_1354829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209953.1|1354850_1357157_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_016209962.1|1357208_1357448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209958.1|1357449_1358577_-	type II/IV secretion system family protein	NA	NA	NA	NA	NA
WP_016209964.1|1358576_1359329_-	dotC-like type IV secretion system protein	NA	NA	NA	NA	NA
WP_051307320.1|1359321_1359828_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_016209959.1|1359852_1360260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556635.1|1360287_1361295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209971.1|1361353_1362259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209955.1|1362265_1363459_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_032126212.1|1363455_1364364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211310.1|1365610_1366324_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SEW9	Cyanophage	39.1	2.2e-39
WP_016211308.1|1366399_1366678_-	lipoprotein	NA	NA	NA	NA	NA
WP_032126213.1|1366707_1367598_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_016211307.1|1367682_1368156_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_016211313.1|1368291_1368813_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016211309.1|1368853_1369648_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016211305.1|1369650_1369932_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211306.1|1369928_1370882_-	pentapeptide repeats family protein	NA	NA	NA	NA	NA
WP_016211312.1|1371587_1372334_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075274825.1|1372455_1373517_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1373794_1374067_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1374078_1374915_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_016211999.1|1375294_1375648_+	ras family protein	NA	NA	NA	NA	NA
WP_016211998.1|1375637_1376201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|1376331_1377060_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|1377179_1377458_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_129556636.1|1378411_1378720_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016210889.1|1378737_1381584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210887.1|1382093_1383044_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210886.1|1383126_1383906_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210883.1|1383974_1384682_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210888.1|1384642_1384894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1384916_1385213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1385746_1386520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1386552_1387149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210885.1|1387206_1388088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1388429_1388696_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300400.1|1388840_1389083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1389139_1389667_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|1390332_1390527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1390740_1391094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1391425_1392046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274823.1|1392309_1396320_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211770.1|1396519_1397653_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|1397666_1397855_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_075274822.1|1398147_1399122_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016209929.1|1400580_1401474_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|1401582_1402500_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209943.1|1402551_1403307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|1403374_1404649_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209927.1|1404783_1405461_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209944.1|1405661_1407089_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|1407063_1407702_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|1407911_1408190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|1408423_1409368_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_032126634.1|1409389_1411258_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|1411278_1411632_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_016209936.1|1411670_1412786_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.6	1.4e-93
WP_016209932.1|1412968_1414009_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|1414011_1415046_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|1415042_1416104_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|1416215_1417688_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209937.1|1417840_1418284_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209940.1|1418359_1421131_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_016209946.1|1421287_1422517_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1422543_1423206_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|1423727_1424228_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556510.1|1424329_1425433_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	7.3e-10
WP_033923779.1|1425956_1426793_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1426804_1427077_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211806.1|1427866_1428592_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_016211805.1|1428634_1430173_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211804.1|1430179_1431565_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
>prophage 16
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	1458415	1494935	3160732	protease,transposase,integrase	Leptospira_phage(33.33%)	41	1450953:1451012	1505263:1505520
1450953:1451012	attL	TCGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGC	NA	NA	NA	NA
WP_098082828.1|1458415_1458673_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774189.1|1458672_1459680_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_051307372.1|1459727_1460117_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016212275.1|1460232_1461216_+	MFS transporter	NA	NA	NA	NA	NA
WP_129556512.1|1461205_1461781_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300363.1|1461726_1462074_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212589.1|1462497_1462935_+	MFS transporter	NA	NA	NA	NA	NA
WP_129556637.1|1463409_1464189_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016210843.1|1464803_1465034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210844.1|1465120_1466248_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_122941824.1|1466432_1468169_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_032126340.1|1468249_1469011_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556514.1|1469290_1471747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1471898_1472672_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016210841.1|1472730_1473102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1473315_1474290_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126239.1|1474374_1474647_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1474658_1475495_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_081377864.1|1475508_1475748_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211148.1|1475829_1477158_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1477421_1477991_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211151.1|1478006_1478318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1478327_1479284_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1479396_1479750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211153.1|1479753_1480818_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211145.1|1480818_1482558_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211152.1|1482564_1482987_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211144.1|1482970_1483600_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075273474.1|1484156_1485131_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_075274844.1|1485311_1485563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1485571_1486408_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1486419_1486692_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556515.1|1486710_1487070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046727.1|1487895_1488240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1488483_1489458_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075275108.1|1489434_1490040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556516.1|1490398_1490902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1490996_1491269_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1491280_1492117_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_080664876.1|1492429_1494292_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_081377865.1|1494650_1494935_+|transposase	transposase	transposase	NA	NA	NA	NA
1505263:1505520	attR	TCGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTACGTGCCTTGAATCGGCACACTCCACTACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGCCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCA	NA	NA	NA	NA
>prophage 17
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	1498765	1558311	3160732	transposase,tRNA	Staphylococcus_phage(18.75%)	51	NA	NA
WP_075274847.1|1498765_1499641_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212011.1|1499874_1500996_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_016212013.1|1501217_1501601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|1501616_1502294_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300271.1|1502530_1503505_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300271.1|1504152_1505127_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556517.1|1505524_1505812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1505830_1506667_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1506678_1506951_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274849.1|1507076_1507820_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212348.1|1507814_1509044_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_016211994.1|1510462_1510999_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_032126537.1|1511035_1511221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211991.1|1511461_1512367_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126538.1|1513275_1514694_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_081007034.1|1514958_1515243_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_080728343.1|1515224_1515365_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_016211561.1|1515446_1519313_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_016211564.1|1519478_1520354_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211563.1|1520386_1520548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274852.1|1520758_1521202_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1521330_1522305_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_052047138.1|1522567_1522801_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126690.1|1528848_1529331_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_016210112.1|1530024_1531452_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_122943012.1|1531568_1532024_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210108.1|1532209_1533475_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_016210114.1|1533567_1534827_+	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210107.1|1534898_1535171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210101.1|1535460_1536957_-	flagellin domain protein	NA	NA	NA	NA	NA
WP_016210113.1|1537379_1538429_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210110.1|1538616_1539372_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_016210102.1|1539432_1541022_-	APC family permease	NA	NA	NA	NA	NA
WP_016210106.1|1541204_1542296_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210105.1|1542315_1542636_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210099.1|1542719_1543997_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_017377579.1|1544018_1544855_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210111.1|1544861_1546496_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_016210117.1|1546916_1547276_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210103.1|1547557_1548916_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_081377868.1|1548991_1549648_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211632.1|1550343_1551198_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211634.1|1551233_1552055_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211631.1|1552310_1553117_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_129556519.1|1553375_1554554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|1554639_1554933_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_075273327.1|1555008_1555584_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1555529_1555895_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556520.1|1555855_1556752_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.8e-54
WP_129556521.1|1556702_1556891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1557424_1558311_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	1568576	1624713	3160732	transposase,tRNA	Staphylococcus_phage(13.33%)	48	NA	NA
WP_075273804.1|1568576_1568915_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1568874_1569330_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212267.1|1569496_1569856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1570136_1570784_+	LysE family translocator	NA	NA	NA	NA	NA
WP_155046730.1|1571051_1571192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274856.1|1571410_1572436_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211733.1|1574191_1575016_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_016211731.1|1575071_1576178_-	protein kinase	NA	NA	NA	NA	NA
WP_016211734.1|1576193_1576463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1576884_1577583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047160.1|1578187_1578487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211399.1|1578621_1579365_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211403.1|1579378_1580422_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211405.1|1580557_1582330_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_129556522.1|1582536_1583769_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211669.1|1586877_1587228_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211666.1|1587382_1590202_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211664.1|1590574_1591303_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211555.1|1591839_1593198_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_032126677.1|1593272_1593836_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211557.1|1594030_1595260_-	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_016211554.1|1595305_1595932_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_032126678.1|1596258_1597269_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_075274857.1|1597279_1598155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274858.1|1599734_1600820_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1600956_1601322_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1601267_1601843_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1602533_1603508_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1604062_1605124_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1605221_1606196_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_129556523.1|1606531_1607417_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209772.1|1608436_1608988_-	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_016209778.1|1609006_1609381_-	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209796.1|1609411_1610629_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_080664823.1|1610652_1612053_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209795.1|1612033_1612789_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_016209793.1|1612829_1614278_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_032126436.1|1614293_1614749_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209771.1|1615455_1616178_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016209791.1|1616342_1617065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307317.1|1617201_1617495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209798.1|1617556_1619581_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_016209769.1|1619593_1620337_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_017377132.1|1620378_1620762_-	response regulator	NA	NA	NA	NA	NA
WP_016209784.1|1620848_1621571_-	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_129556524.1|1621567_1622455_-	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_032126239.1|1623592_1623865_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1623876_1624713_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
>prophage 19
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	1636678	1692472	3160732	transposase	Staphylococcus_phage(42.86%)	57	NA	NA
WP_081377870.1|1636678_1637197_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	31.0	1.6e-07
WP_081007030.1|1637232_1638204_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307341.1|1638897_1640496_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_016210848.1|1640662_1641847_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1642142_1642697_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210850.1|1642945_1644199_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210851.1|1644183_1644855_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210847.1|1644877_1645882_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210849.1|1645910_1647359_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210855.1|1647476_1648454_+	DMT family transporter	NA	NA	NA	NA	NA
WP_129556525.1|1648607_1649427_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1649503_1650478_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212475.1|1650675_1650882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211182.1|1651866_1652196_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_032126448.1|1652227_1652608_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211178.1|1652698_1653727_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016211180.1|1653789_1654254_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_032126449.1|1654274_1655198_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016211185.1|1655264_1655873_+	smr domain protein	NA	NA	NA	NA	NA
WP_032126450.1|1655985_1657980_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211177.1|1658347_1659568_+	amino acid permease	NA	NA	NA	NA	NA
WP_016212445.1|1659782_1660049_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_129556526.1|1660045_1660831_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	1.3e-45
WP_075274822.1|1660889_1661864_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016211736.1|1661887_1662088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211739.1|1662204_1662711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126783.1|1662821_1664063_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211741.1|1664208_1664985_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211738.1|1665461_1666106_-	membrane protein	NA	NA	NA	NA	NA
WP_032126790.1|1666176_1667082_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1668043_1668382_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1668341_1668797_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126602.1|1668949_1670257_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211857.1|1670507_1671386_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016211855.1|1671382_1671850_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|1671976_1672162_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_054300271.1|1672377_1673352_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556640.1|1673618_1674845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211351.1|1674920_1675259_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_032127067.1|1675255_1675858_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211349.1|1675854_1677849_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211350.1|1677912_1678851_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211352.1|1679529_1679970_+	universal stress protein	NA	NA	NA	NA	NA
WP_075273313.1|1680143_1680482_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1680441_1680897_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210793.1|1680898_1681579_+	OmpW family protein	NA	NA	NA	NA	NA
WP_016210801.1|1681901_1682873_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210795.1|1682854_1683826_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_051307339.1|1683931_1684738_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210791.1|1685112_1685313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210799.1|1685739_1686693_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_129556527.1|1687154_1687415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273540.1|1687599_1688211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210800.1|1688577_1689405_+	DsbA family protein	NA	NA	NA	NA	NA
WP_080750117.1|1689540_1691181_+	APC family permease	NA	NA	NA	NA	NA
WP_052047040.1|1691206_1692145_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1692214_1692472_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	1698640	1753898	3160732	transposase,tRNA	Pseudomonas_phage(25.0%)	45	NA	NA
WP_075273327.1|1698640_1699216_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212185.1|1699309_1700299_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1700632_1700818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1701497_1703453_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016210749.1|1703751_1704213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210752.1|1704382_1705180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556641.1|1707556_1708819_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_032126362.1|1712693_1713059_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1713004_1713580_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211454.1|1713720_1714191_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_016211452.1|1714941_1716429_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211455.1|1716490_1717948_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_122942091.1|1718053_1718449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1718476_1719055_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_054300325.1|1719676_1719949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046732.1|1720142_1720313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274862.1|1720427_1721024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1721195_1721789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211728.1|1722176_1724111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1724149_1725064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1726634_1726901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1726977_1727634_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1727808_1728264_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1728223_1728562_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556531.1|1728524_1728722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211752.1|1728926_1730072_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211748.1|1730087_1731692_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211749.1|1731771_1732965_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_032126540.1|1733173_1734037_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075274864.1|1737257_1738283_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047087.1|1738454_1738673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211462.1|1738833_1739814_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211465.1|1740441_1741425_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211464.1|1741575_1741923_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_032126752.1|1741919_1742522_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211466.1|1742609_1744130_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126753.1|1744199_1744664_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_032126362.1|1744756_1745122_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1745067_1745643_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212485.1|1746395_1746929_+	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_129556532.1|1747225_1747408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664820.1|1747716_1747887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209620.1|1747869_1750926_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209619.1|1751012_1752461_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209621.1|1752893_1753898_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	1783520	1832968	3160732	transposase,integrase	Acinetobacter_phage(16.67%)	51	1782464:1782523	1812236:1812526
1782464:1782523	attL	AAACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGA	NA	NA	NA	NA
WP_081377829.1|1783520_1784255_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_129556535.1|1784699_1785585_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1785775_1786033_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377871.1|1786237_1786930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556536.1|1786932_1788086_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274872.1|1788045_1788585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274873.1|1789059_1789557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1789578_1789944_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1789889_1790465_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274874.1|1790465_1790834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126786.1|1791132_1794213_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016211319.1|1794230_1795283_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211316.1|1795815_1796466_+	porin family protein	NA	NA	NA	NA	NA
WP_016211315.1|1796800_1797445_+	porin family protein	NA	NA	NA	NA	NA
WP_054300314.1|1797632_1797968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273532.1|1797928_1798516_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126997.1|1798733_1798973_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_032126998.1|1799294_1799642_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_036774554.1|1799740_1800019_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1800071_1800359_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1800362_1801249_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211346.1|1802398_1803040_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_016211340.1|1803067_1803289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211347.1|1803281_1804265_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211344.1|1804478_1805297_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211342.1|1805457_1807140_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.1e-32
WP_016211343.1|1807147_1808170_-	YHYH protein	NA	NA	NA	NA	NA
WP_016211341.1|1808368_1808539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1808683_1809658_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211940.1|1809771_1810104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1810224_1811484_-	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211214.1|1813246_1813810_+	hypothetical protein	NA	NA	NA	NA	NA
1812236:1812526	attR	AAACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_016211210.1|1813912_1815394_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211213.1|1815400_1815607_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211211.1|1815655_1816735_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211215.1|1816926_1818897_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211212.1|1819257_1820817_+	APC family permease	NA	NA	NA	NA	NA
WP_075274875.1|1821099_1821402_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300307.1|1821448_1822177_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_129556539.1|1822245_1822590_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211983.1|1822837_1823497_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556643.1|1823592_1824957_+	histidine kinase	NA	NA	NA	NA	NA
WP_016212551.1|1825414_1825909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|1826250_1826826_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1826771_1827062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1827075_1827651_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1827596_1827962_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211946.1|1829182_1829938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556540.1|1830156_1830552_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211947.1|1830544_1831690_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_075274878.1|1832092_1832968_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	1875658	1892025	3160732	transposase	Leptospira_phage(40.0%)	15	NA	NA
WP_032126239.1|1875658_1875931_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377873.1|1875942_1876779_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.6e-41
WP_016212058.1|1877421_1878972_-	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_075274880.1|1879127_1880093_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1881088_1881361_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1881372_1882209_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_098082828.1|1882706_1882964_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1882963_1883971_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212247.1|1884337_1885093_+	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1885720_1886695_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300162.1|1887034_1888117_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212246.1|1888220_1888877_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_075274882.1|1889812_1890409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556544.1|1890523_1890880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1890942_1892025_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 23
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	1936820	1951630	3160732	transposase,integrase	Acinetobacter_phage(50.0%)	22	1941876:1941935	1945578:1945816
WP_075274886.1|1936820_1937882_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274888.1|1938153_1938489_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081007004.1|1938493_1938949_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1938908_1939247_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|1939404_1939569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1939558_1939858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212209.1|1940313_1941315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556545.1|1941569_1941911_-	hypothetical protein	NA	NA	NA	NA	NA
1941876:1941935	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_075274890.1|1942115_1942796_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_098082828.1|1942865_1943123_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377874.1|1943291_1943759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556546.1|1944219_1945405_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	5.9e-58
WP_155049882.1|1945414_1945564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556547.1|1945831_1946392_-	reverse transcriptase	NA	NA	NA	NA	NA
1945578:1945816	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTACGTGCCTTGAATCGGCACACTCCACTACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGCCTTTCGCAACTCCGCTCTGCTAAAAACCCGAA	NA	NA	NA	NA
WP_054300287.1|1946800_1947130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1947151_1947517_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1947462_1948038_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274733.1|1948056_1948374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1948424_1949261_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1949272_1949545_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211421.1|1950403_1950628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1950724_1951630_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	2031352	2083230	3160732	protease,transposase,tRNA	Orpheovirus(20.0%)	51	NA	NA
WP_016209424.1|2031352_2032630_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209433.1|2032729_2033104_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209412.1|2033188_2034076_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209436.1|2034133_2034862_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_129556555.1|2034858_2035989_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209444.1|2036119_2036548_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_032126508.1|2036642_2037002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209447.1|2036991_2038203_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016209421.1|2038199_2038988_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209411.1|2039150_2039945_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_054300271.1|2040150_2041125_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155049809.1|2041299_2042595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2042598_2042898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2042887_2043052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2043108_2043474_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211553.1|2043813_2044554_-	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_016211549.1|2044557_2047062_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211548.1|2047324_2048281_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211550.1|2048264_2049026_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_075274903.1|2049103_2049979_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2050103_2050349_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016211262.1|2050408_2052682_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_075273504.1|2052736_2053090_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|2053279_2053573_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_032126515.1|2053745_2053925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307354.1|2054000_2054576_-	DedA family protein	NA	NA	NA	NA	NA
WP_032126514.1|2054858_2056175_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2056185_2056554_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016211265.1|2056584_2057247_-	adenylate kinase	NA	NA	NA	NA	NA
WP_032126362.1|2057421_2057787_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556556.1|2057732_2058308_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126519.1|2058475_2059195_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_016211478.1|2059174_2059990_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126518.1|2060006_2062208_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211474.1|2062290_2063640_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_016211473.1|2063714_2064314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211476.1|2064297_2064507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211931.1|2064824_2066012_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211932.1|2066207_2067497_+	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_054300152.1|2067907_2068273_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210558.1|2069909_2070665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210562.1|2070738_2072391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210560.1|2073958_2075659_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_016210557.1|2075747_2076500_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016210564.1|2076502_2076964_-	amidohydrolase	NA	NA	NA	NA	NA
WP_016210559.1|2076960_2077923_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_016210566.1|2078283_2078706_-	universal stress protein	NA	NA	NA	NA	NA
WP_016210568.1|2079011_2079653_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210561.1|2079780_2081115_+	dihydroorotase	NA	NA	NA	NA	NA
WP_032126397.1|2081229_2081820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2082168_2083230_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	2091074	2135780	3160732	transposase,tRNA	Staphylococcus_phage(22.22%)	47	NA	NA
WP_129556558.1|2091074_2091968_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126170.1|2092131_2092404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211040.1|2092631_2093843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211037.1|2094193_2094823_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211042.1|2094871_2095888_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211035.1|2096134_2096350_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211043.1|2096402_2096852_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211039.1|2096931_2098677_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211036.1|2098768_2100640_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_054300271.1|2100987_2101962_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211094.1|2101981_2102305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|2103369_2105850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211092.1|2105893_2107186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307348.1|2107421_2110178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211519.1|2111333_2111753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|2111753_2112455_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|2112715_2112922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|2113151_2113457_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|2113635_2115633_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2115616_2116663_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|2117370_2118222_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|2118222_2119143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|2119553_2119838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377876.1|2119829_2120285_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2120244_2120583_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2120795_2121725_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2121881_2122310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556560.1|2122390_2122927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2122896_2123802_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2123992_2124601_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_081007013.1|2124641_2124941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2124930_2125095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274909.1|2125478_2125805_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2125903_2126479_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2126424_2126790_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556561.1|2126960_2128113_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	2.6e-58
WP_016211971.1|2128319_2128931_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2128951_2130148_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2130244_2130385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2130397_2130802_-	SufE family protein	NA	NA	NA	NA	NA
WP_075273313.1|2130927_2131266_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556562.1|2131225_2131528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|2131672_2131858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|2132427_2133009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556649.1|2133036_2133894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|2134433_2134961_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_075273327.1|2135204_2135780_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	2156979	2206727	3160732	protease,tRNA,transposase	Staphylococcus_phage(33.33%)	48	NA	NA
WP_016209884.1|2156979_2157603_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2157679_2157880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2158021_2158720_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2158866_2159436_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2159750_2160374_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2160582_2161185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|2161256_2161622_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046744.1|2161678_2161852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556564.1|2163021_2163351_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273603.1|2164507_2164684_+	phosphatase	NA	NA	NA	NA	NA
WP_129556565.1|2164807_2165203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126686.1|2166672_2167257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274914.1|2167807_2168683_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_059372565.1|2168731_2169103_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556566.1|2169011_2169215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210465.1|2169722_2170565_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2170615_2170963_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2171153_2172041_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2172155_2172758_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2172754_2173474_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_075275113.1|2173542_2175252_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_016210464.1|2175402_2177340_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2177448_2178501_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2178500_2178776_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2178856_2179405_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_155049143.1|2179721_2182316_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_016210459.1|2182480_2182999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212492.1|2183203_2184058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2184107_2185082_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_033923740.1|2185140_2185428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211720.1|2185675_2186599_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211716.1|2186612_2187536_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126595.1|2187483_2188140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|2188442_2189270_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_052133280.1|2189710_2190082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126590.1|2190274_2191807_+	nuclease	NA	NA	NA	NA	NA
WP_032126591.1|2191869_2193207_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_016210313.1|2193349_2194816_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210314.1|2194812_2195862_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_016210306.1|2195985_2198094_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|2198258_2198663_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2198723_2199449_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210307.1|2199534_2200425_+	YicC family protein	NA	NA	NA	NA	NA
WP_032126592.1|2200465_2201086_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.3	2.5e-20
WP_016210310.1|2201146_2201353_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_016210316.1|2201374_2203528_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.1e-12
WP_016210317.1|2203534_2205517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2205752_2206727_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 27
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	2212919	2258420	3160732	transposase	Staphylococcus_phage(50.0%)	52	NA	NA
WP_054300443.1|2212919_2213198_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|2213250_2213499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|2213456_2214518_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212177.1|2215513_2215687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2215763_2216021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2217095_2217671_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274918.1|2217616_2217982_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212205.1|2218665_2218845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|2218984_2220430_+	MFS transporter	NA	NA	NA	NA	NA
WP_016212319.1|2220988_2221216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2221202_2221529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2221530_2221962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|2222490_2223552_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210831.1|2223646_2224192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2224461_2225481_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2225467_2225890_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2225891_2226365_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|2226480_2227104_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|2227133_2227808_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2227813_2228962_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2228958_2229420_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2229495_2230746_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2230872_2232552_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2232661_2233528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274920.1|2234958_2235693_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	4.8e-10
WP_016211000.1|2235788_2236574_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2236717_2237404_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2237437_2237836_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2237999_2238305_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|2238382_2238637_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2238790_2240452_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2240511_2241195_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2241194_2242283_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2242331_2244968_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300237.1|2245380_2246442_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556568.1|2246631_2248113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2248149_2248725_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|2248670_2248961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2248974_2249550_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2249495_2249861_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212450.1|2250016_2250919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2250962_2251937_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211507.1|2252250_2253570_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|2253573_2254290_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|2254286_2254928_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_075274921.1|2254920_2255019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274922.1|2254996_2255293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211503.1|2255303_2255759_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|2255813_2256158_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2256187_2257231_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|2257645_2257855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2257844_2258420_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	2327623	2387235	3160732	transposase,tRNA	Planktothrix_phage(16.67%)	58	NA	NA
WP_129556571.1|2327623_2328334_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2328362_2328767_+	RidA family protein	NA	NA	NA	NA	NA
WP_016209567.1|2329882_2330500_-	MFS transporter	NA	NA	NA	NA	NA
WP_155046949.1|2330570_2330741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126712.1|2330934_2331393_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2332137_2333148_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2333632_2334544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2334869_2338364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2338401_2339241_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_016209564.1|2339427_2339643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2339691_2340267_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2340263_2340602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2340770_2341760_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2341760_2342723_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_016209559.1|2342732_2343635_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300271.1|2343678_2344653_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2344790_2345024_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2345117_2345483_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2345539_2345704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2345693_2345993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212572.1|2346050_2346443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2346572_2346938_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2346994_2347303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2347394_2347970_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2347915_2348281_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|2348433_2348706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212514.1|2349116_2349254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2349272_2350109_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2350120_2350393_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126774.1|2350548_2350884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2351043_2352576_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2352608_2353448_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2353444_2353942_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211412.1|2353945_2354938_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211408.1|2355052_2356399_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2356622_2357684_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2357762_2358908_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|2365007_2365865_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2365851_2366775_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211368.1|2366971_2368363_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2368409_2369453_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2369495_2369939_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2370071_2371262_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2371316_2371463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|2372014_2372932_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2373199_2373493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2373569_2373764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212197.1|2374782_2375700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2376165_2377008_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2377075_2377726_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|2377740_2378781_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|2378903_2379989_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2380015_2381125_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2381141_2381459_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2381455_2381815_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210878.1|2381917_2384647_-	kinase	NA	NA	NA	NA	NA
WP_080664847.1|2385147_2386101_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_075274927.1|2386173_2387235_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	2425220	2599254	3160732	protease,transposase,integrase,tRNA	Escherichia_phage(32.65%)	165	2572878:2572937	2581119:2581406
WP_036771330.1|2425220_2426195_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_129556574.1|2426491_2426845_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211760.1|2426897_2428277_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211761.1|2428383_2430375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274928.1|2430790_2431765_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	5.2e-28
WP_016209674.1|2431994_2432828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126406.1|2433011_2434490_-	nuclease	NA	NA	NA	NA	NA
WP_155049159.1|2434930_2436727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209671.1|2436809_2437037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556575.1|2437104_2438073_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_032126407.1|2438048_2438459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209685.1|2438463_2438799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556656.1|2438800_2439328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556657.1|2439813_2440254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209678.1|2440355_2443574_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_129556576.1|2443613_2444468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209670.1|2444436_2447445_-	ATPase AAA	NA	NA	NA	NA	NA
WP_032126408.1|2447447_2447873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209688.1|2447904_2448486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209684.1|2448485_2449529_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_016209692.1|2449531_2450011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047060.1|2450019_2452323_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_032126410.1|2452351_2452591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209677.1|2452611_2453718_-	type II/IV secretion system family protein	NA	NA	NA	NA	NA
WP_016209693.1|2453710_2454457_-	type IV secretion system protein DotC	NA	NA	NA	NA	NA
WP_016209695.1|2454449_2454953_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_032126411.1|2455016_2455451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209680.1|2455465_2456503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209681.1|2456518_2457499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556659.1|2457504_2458650_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209676.1|2458706_2459546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209672.1|2460059_2460485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209690.1|2460587_2463275_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_016211689.1|2463861_2465001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211690.1|2465076_2467233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556660.1|2467518_2468271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211688.1|2468456_2468675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211600.1|2468823_2469342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211601.1|2469677_2470100_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	37.3	1.1e-22
WP_016211597.1|2470405_2471776_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.8	2.6e-110
WP_016211595.1|2472133_2472601_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211599.1|2472613_2473624_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_080664865.1|2473819_2474296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2474292_2475129_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2475140_2475413_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144019247.1|2475479_2475836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556577.1|2475828_2476857_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	4.8e-16
WP_016211744.1|2476834_2477239_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_016211742.1|2477469_2479449_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054300202.1|2479728_2480457_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300202.1|2480932_2481661_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210955.1|2482384_2482639_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2482737_2484522_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_016210956.1|2484610_2485330_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|2485512_2485719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210948.1|2485718_2485955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2485967_2486345_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2486851_2487670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210947.1|2487763_2487961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|2488055_2489441_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|2489567_2490158_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_075274930.1|2490968_2491388_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274931.1|2491417_2492146_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_032126570.1|2492902_2493202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211816.1|2493214_2493568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2493609_2495223_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2495444_2495666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274933.1|2495974_2496703_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2497319_2498417_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2498450_2499701_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_075274934.1|2500188_2500857_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.0	2.8e-41
WP_016212193.1|2500979_2501318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2501385_2501772_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2501768_2502014_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300202.1|2502422_2503151_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211625.1|2503634_2504504_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_016211621.1|2504500_2505850_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	4.6e-75
WP_016211623.1|2505962_2507603_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_016211987.1|2509424_2511161_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_144019359.1|2511322_2511520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556671.1|2511664_2512393_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_098082825.1|2512456_2512765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2512757_2513090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2513093_2513663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211655.1|2513791_2514205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211652.1|2514464_2515670_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211653.1|2515777_2516803_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_054300202.1|2516894_2517623_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212214.1|2517781_2518282_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036780855.1|2518256_2518754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|2519519_2520248_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211053.1|2520290_2520857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211047.1|2520944_2522579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2522940_2523444_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2523406_2524114_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2524182_2525043_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_016211045.1|2525023_2525797_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2525827_2527081_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2527080_2528043_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2528086_2528839_+	ComF family protein	NA	NA	NA	NA	NA
WP_016210615.1|2531214_2531685_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2531730_2531970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274938.1|2531988_2532495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2532658_2534083_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|2534147_2535197_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2535463_2536243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2536286_2537189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210625.1|2537247_2537994_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_016210616.1|2538242_2541053_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_129556661.1|2541353_2541917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2541905_2542634_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2542723_2542930_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212263.1|2543092_2543686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212264.1|2543731_2544325_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	5.4e-28
WP_016212238.1|2544840_2546130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274939.1|2546159_2546888_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.8e-42
WP_087910645.1|2547000_2548153_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274940.1|2548181_2548862_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	2.0e-42
WP_016211997.1|2549217_2550327_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.5	4.4e-07
WP_016211996.1|2550328_2551276_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_075274941.1|2551659_2552388_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.2e-42
WP_075275114.1|2552417_2552780_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212339.1|2552932_2553679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274942.1|2553697_2554426_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	2.7e-45
WP_032127022.1|2555102_2557289_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2557350_2558504_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2558789_2559314_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|2559504_2559672_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|2559616_2560333_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
WP_032126817.1|2560689_2561511_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211722.1|2561520_2564823_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_016211321.1|2565203_2566364_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211323.1|2566537_2567635_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211325.1|2567624_2569145_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211322.1|2569207_2569798_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211324.1|2570333_2570888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066186.1|2571645_2572125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274945.1|2572269_2572620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|2572844_2572994_+	hypothetical protein	NA	NA	NA	NA	NA
2572878:2572937	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_016212659.1|2573138_2573384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046748.1|2573471_2573777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212294.1|2574128_2574473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274946.1|2574486_2574930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|2575151_2575376_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_016212230.1|2575431_2576880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2578413_2578602_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556589.1|2580003_2580279_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2580281_2580884_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_155046749.1|2580947_2581235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|2581779_2582859_+	hypothetical protein	NA	NA	NA	NA	NA
2581119:2581406	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_016211874.1|2583177_2584896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2584939_2585845_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_081377873.1|2587007_2587844_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.6e-41
WP_032126239.1|2587855_2588128_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046750.1|2588324_2588462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2589648_2590224_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_016210050.1|2590299_2591175_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210054.1|2591239_2591761_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210069.1|2591745_2592828_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.6e-20
WP_016210051.1|2593068_2593473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2593897_2594629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2594885_2596187_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2596328_2596997_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2597440_2598037_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2598057_2599254_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
>prophage 30
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	2627894	2662334	3160732	transposase,tRNA	Microbacterium_phage(20.0%)	38	NA	NA
WP_054300282.1|2627894_2628359_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377880.1|2628415_2628895_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2629752_2630148_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|2630144_2630939_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211756.1|2631117_2631843_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2632088_2633276_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_081377344.1|2633630_2634758_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210935.1|2635088_2635631_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2635627_2636314_-	acireductone synthase	NA	NA	NA	NA	NA
WP_016210942.1|2636317_2636929_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2636975_2637995_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2638096_2638891_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2638928_2639735_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2639813_2640863_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2641060_2642320_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2642366_2643044_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2643129_2643411_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|2643502_2644690_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_129556549.1|2644797_2645684_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210820.1|2645885_2646827_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2647330_2647555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2647846_2648551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|2649000_2649639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2649973_2650504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210821.1|2650500_2652033_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2652029_2652980_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2653399_2654032_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2654274_2654472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2654821_2655250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307340.1|2655327_2656026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274949.1|2656003_2657065_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2657289_2657586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2657690_2658335_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2658570_2659068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377881.1|2659984_2660152_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377882.1|2660158_2660440_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2660399_2660738_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210986.1|2660795_2662334_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	1.3e-86
>prophage 31
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	2670420	2721566	3160732	transposase,tRNA	Staphylococcus_phage(37.5%)	51	NA	NA
WP_105962625.1|2670420_2671307_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212032.1|2671563_2672691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2672814_2673477_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2673568_2673814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211962.1|2674111_2674627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2675175_2675835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2675936_2676587_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|2676699_2677020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2677078_2678053_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2678303_2678525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212027.1|2678547_2679771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212028.1|2680265_2680514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2680601_2681487_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210162.1|2682172_2683210_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_032126295.1|2683240_2684695_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_016210181.1|2684704_2685889_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_016210176.1|2685962_2686970_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210183.1|2687038_2689042_-	transketolase	NA	NA	NA	NA	NA
WP_016210174.1|2689492_2690653_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	8.2e-121
WP_016210170.1|2690889_2692005_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210172.1|2692167_2692692_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.6	6.9e-51
WP_016210163.1|2692691_2693222_+	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_016210178.1|2693311_2693779_-	DoxX family protein	NA	NA	NA	NA	NA
WP_016210161.1|2694280_2694535_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210179.1|2694735_2695239_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_129556592.1|2695529_2696060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2696220_2696904_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|2696979_2697759_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_032126297.1|2697745_2698606_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210177.1|2698730_2699096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210175.1|2699481_2699811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210171.1|2700124_2701684_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	5.8e-37
WP_036771330.1|2702241_2703216_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_075274951.1|2703212_2704097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211784.1|2704650_2705373_+	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_016211783.1|2705364_2705730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|2706010_2707288_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211782.1|2707887_2708070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2708131_2708497_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2708442_2709018_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556593.1|2709014_2709656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210766.1|2709744_2710188_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_032126291.1|2710191_2710701_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210756.1|2710693_2713507_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
WP_051307336.1|2713645_2714572_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	9.4e-11
WP_016210758.1|2714729_2716268_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2716441_2716702_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_016210763.1|2717010_2718255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210755.1|2718358_2719087_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_016210761.1|2719190_2719928_+	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_075273298.1|2720990_2721566_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	2744532	2804309	3160732	protease,transposase,tRNA	unidentified_phage(33.33%)	57	NA	NA
WP_054300173.1|2744532_2745594_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2745684_2746431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274953.1|2746555_2747419_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2747662_2748025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377902.1|2748211_2748739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2748883_2749300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2751071_2751983_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2752034_2752883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2753327_2754038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2754129_2755098_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2755085_2755733_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_016210370.1|2755761_2756613_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2756627_2757905_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2757945_2758461_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210372.1|2758539_2759601_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2759622_2760711_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_016210378.1|2760755_2762591_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2762633_2763104_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2763140_2763476_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2763488_2764205_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2764141_2765158_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2765154_2765634_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2765717_2768198_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2768260_2768626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273456.1|2769003_2769303_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2769262_2769718_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2769732_2770023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210570.1|2770088_2771687_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2771817_2772153_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_016210578.1|2772180_2773845_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	7.1e-33
WP_016210581.1|2773841_2774486_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2774485_2775229_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2775287_2775527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2775677_2777045_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2777055_2777607_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2777687_2778671_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2778792_2780550_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2780772_2781363_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2781450_2781870_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_016210580.1|2782010_2782271_+	methyltransferase	NA	NA	NA	NA	NA
WP_075274955.1|2782346_2783321_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_075274956.1|2783363_2783732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2783792_2784578_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075274955.1|2785963_2786938_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212084.1|2787219_2788236_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2788235_2788751_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2788792_2789266_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_075274955.1|2789423_2790398_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212306.1|2790433_2790964_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2790993_2791449_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_129556598.1|2793998_2796512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211935.1|2797446_2800095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274958.1|2800543_2801605_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2801631_2802207_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2802152_2802518_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046755.1|2802589_2802766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556599.1|2803156_2804309_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 33
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	2918106	2961504	3160732	protease,transposase	Acanthamoeba_polyphaga_lentillevirus(14.29%)	41	NA	NA
WP_016209259.1|2918106_2918955_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_016209274.1|2919071_2919983_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_075274963.1|2920701_2921763_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212454.1|2921982_2922663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211192.1|2923451_2924810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211189.1|2924854_2925313_-	NfeD family protein	NA	NA	NA	NA	NA
WP_016211187.1|2925337_2926258_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_016211186.1|2926384_2927167_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.3	8.2e-32
WP_016211190.1|2927256_2928756_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_016211188.1|2929077_2930961_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_075273298.1|2931034_2931610_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2931555_2931921_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211157.1|2932485_2933142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211161.1|2933249_2934359_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2934370_2935015_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2935033_2936020_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2936099_2937176_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2937378_2938203_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2938519_2939524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2939732_2940698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274965.1|2940836_2941712_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2942008_2943061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046999.1|2943349_2943757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2943970_2944462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2944517_2945768_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2945870_2946089_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_052104629.1|2946531_2947557_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080728341.1|2948006_2948177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212561.1|2948148_2948289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210728.1|2949203_2949674_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2949962_2951342_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2951369_2951828_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2951805_2953023_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2953214_2953451_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2953464_2953620_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2953700_2954663_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2954822_2956139_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2956148_2956817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2957179_2958994_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_129556601.1|2959111_2959888_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_052104629.1|2960478_2961504_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP039214	Piscirickettsia salmonis strain Psal-104a chromosome, complete genome	3160732	2993189	3109901	3160732	transposase,tRNA	Staphylococcus_phage(33.33%)	110	NA	NA
WP_054300271.1|2993189_2994164_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2994239_2995259_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556602.1|2995657_2995867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274966.1|2997858_2998920_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|2999000_2999309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|2999423_3000740_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664857.1|3001201_3002488_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|3002560_3003457_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|3003543_3004542_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|3004650_3005175_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|3005422_3006661_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|3007208_3007682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|3007678_3008074_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3009003_3009579_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3009524_3009890_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211610.1|3010154_3012485_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_129556603.1|3012605_3014621_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075274967.1|3014804_3018197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3018261_3018567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274968.1|3018736_3019837_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|3020231_3021341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209721.1|3022279_3023677_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.3e-77
WP_051307313.1|3023796_3024744_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3024740_3025256_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3025242_3026442_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3026438_3026762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3026763_3027993_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3027992_3029036_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3029035_3029719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3029715_3032205_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3032221_3032476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3032476_3032833_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3033612_3034776_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3034795_3037903_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3037904_3039410_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3039437_3039719_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3039867_3040209_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3040328_3042209_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3042293_3043892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3043909_3045025_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3045152_3046151_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|3046154_3046913_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3046914_3048114_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3048097_3048769_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3048790_3049567_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3049570_3050569_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3050570_3051149_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3051145_3052615_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3052658_3052946_-	trp operon repressor	NA	NA	NA	NA	NA
WP_016209699.1|3053146_3053743_+	DMT family transporter	NA	NA	NA	NA	NA
WP_075274970.1|3053952_3054423_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3054479_3054635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274971.1|3054779_3055232_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3055417_3055639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|3055754_3056387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274972.1|3056364_3057426_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211865.1|3057865_3058405_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3058489_3059026_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3059677_3059980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3060429_3060738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274973.1|3061328_3061796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3062078_3062789_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3063015_3063414_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|3064281_3065232_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3065231_3067310_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3067457_3067973_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3067981_3068545_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3068525_3069272_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3069411_3069864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3070287_3071124_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3071120_3072017_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3072049_3073117_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3073135_3073504_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3073529_3074978_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3074987_3076367_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3076407_3077739_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3077710_3078670_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3078762_3079266_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3079400_3080552_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3080548_3081028_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3081174_3083496_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3083440_3084067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3084071_3084971_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3085043_3085622_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3085922_3086180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556611.1|3086188_3087342_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046758.1|3088478_3088610_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3088754_3088910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212051.1|3089237_3090011_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126148.1|3090552_3090735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3091338_3092313_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3093407_3093746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212337.1|3093762_3094473_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_051307375.1|3094460_3094652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|3094813_3095113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3095102_3095267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3095323_3095689_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3096993_3097689_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3097685_3099113_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3099138_3099402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3099762_3100737_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556612.1|3100795_3101646_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3101683_3102028_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3102024_3102861_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3102861_3103203_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3103204_3103810_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3103806_3105801_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3105820_3106762_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211292.1|3106989_3108414_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3108926_3109901_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 1
NZ_CP039215	Piscirickettsia salmonis strain Psal-104a plasmid unnamed1, complete sequence	153780	2323	101075	153780	tail,transposase,head,capsid,integrase,protease	Streptococcus_phage(19.57%)	115	91314:91373	104648:105510
WP_129556705.1|2323_2824_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	28.0	9.9e-07
WP_036771330.1|2882_3857_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_054300162.1|4369_5452_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212151.1|5816_6779_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|6802_7117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923686.1|7173_8223_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|8331_9372_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|9385_10015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|10105_10405_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211886.1|10401_10830_-	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_032126832.1|12590_13499_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_054300202.1|13609_14338_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155066188.1|14405_14591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|15477_16206_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|16409_18986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046766.1|19210_19348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|19391_20366_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075274931.1|20566_21295_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.4e-38
WP_016212137.1|21738_22800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212139.1|22875_23121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307371.1|23092_23707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|24524_25499_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556707.1|25858_26878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|27506_28660_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126239.1|28804_29077_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|29088_29925_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075275144.1|29957_30689_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|30786_31200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212017.1|31494_31893_+	hypothetical protein	NA	W8VUR5	Pseudomonas_phage	38.8	2.3e-06
WP_047927838.1|31922_32168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|32164_32464_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016212019.1|32620_33316_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_081377351.1|34129_34909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|34992_35145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|35097_35430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|35594_35972_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|36278_36662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|37131_37860_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_129556708.1|37975_38311_-	mRNA-degrading endonuclease	NA	A9D9Y1	Lactobacillus_prophage	35.6	2.6e-11
WP_016212365.1|38303_38546_-	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_054300271.1|38754_39729_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075275142.1|40364_41093_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_075275141.1|41375_43061_+	protein kinase	NA	NA	NA	NA	NA
WP_129556709.1|43272_43362_+	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_129556710.1|43442_43913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275140.1|44066_44801_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.1e-38
WP_075275139.1|45427_45658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212404.1|46272_46506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126756.1|46626_47070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275138.1|47214_47523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047124.1|47727_49389_+	AAA family ATPase	NA	A0A0K2FLP8	Brevibacillus_phage	31.5	9.1e-65
WP_016212457.1|49398_49800_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_016212456.1|49796_50084_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_075275137.1|50127_50541_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126239.1|50596_50869_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|50880_51717_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_016212579.1|52647_52845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|54350_54551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|54561_55137_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|55082_55448_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|56279_58322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|59226_59592_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|59537_60113_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075274752.1|60109_60409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|60444_61598_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_052047048.1|61778_62279_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|62278_62440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211937.1|62709_63099_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211936.1|63588_64611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211938.1|65105_65666_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275133.1|66237_66546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|67078_68232_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273327.1|68480_69056_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075275128.1|69001_69367_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556696.1|69466_70483_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.0	3.0e-18
WP_052133287.1|70584_70983_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556716.1|71116_71407_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_016210655.1|71420_72017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210663.1|72335_72647_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210667.1|72643_72967_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210658.1|72959_73355_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210651.1|73351_73702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210664.1|73701_74124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210669.1|74125_74449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|74505_74772_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075273774.1|76973_78131_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275128.1|78272_78638_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|78583_79159_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126790.1|79629_80535_+|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_129556697.1|80919_81312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211776.1|81794_83132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|83299_83668_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211773.1|83769_84444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|84896_85262_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|85207_85783_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126360.1|85989_86724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|86846_87905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|88413_89160_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|89160_89565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|89958_90774_-	hypothetical protein	NA	NA	NA	NA	NA
91314:91373	attL	GGCACTGTTGCGAAAAATTATAGTGAACTTCAGAAAGGTTATTTTCTTGTGCTCTCTGCT	NA	NA	NA	NA
WP_054300202.1|91378_92107_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212298.1|92548_92875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|93115_93592_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_075275158.1|93706_94000_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377916.1|94116_94641_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.4	2.5e-29
WP_098082791.1|94845_95148_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.6	8.6e-14
WP_129556698.1|95156_95858_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_016211912.1|95947_96538_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_032126795.1|96810_97071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|97074_97347_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_016211913.1|97672_98794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273786.1|99226_99625_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377915.1|99633_100191_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	2.9e-47
WP_081377914.1|100335_100665_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|100781_101075_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
104648:105510	attR	GGCACTGTTGCGAAAAATTATAGTGAACTTCAGAAAGGTTATTTTCTTGTGCTCTCTGCTTAGAATTAAGCAGCTAATCCAAATAATTTATCAATGAGCTGATTTTGGGCACAGATATTCTGTTTTTTAATATAACGTAATTGACCTTTTTGAACCATGCGCATCGCTTCCATTATGTCAATGGTAGGCCGTGCTGTAGAAAGTGATTGGTACCATTGGCGGAAACGGGATTTGCGCTTTACCGCTTTGTGATCATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACACTGACTAGAAAAGACACCTTCATCTTTGGCTTTTTGGTGAGCGGGTGGAAATGAAGCGTGCTTGTCGACATTCACAACACGCGGTGATTTCACATAAGGTTGGGCGATTGCCTTTTTGAAAAAGCGCATCGCCGCTTTGGCATTTTGCTGTCGGCTGAGCATCCAGTCCAAAGTATGGCCATATTTATCAATGGCTCGATAAAGGTAATACCAACGACCTTTGATTTTCACCAACGTTTCATCTAACCGCCAAGAGGCACACGTTTGACGAAAGTGGGGCCTCAGCCGTTTGGCGATCTGCGAGCCATACTCGTGCACCCAGCGACAAATGGTTGAACGCTCAATCTCAAGACCTCTTTCAGCTGCTATTTCTTTGAGATCACGGTAAGATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATGATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTCTACCCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCCG	NA	NA	NA	NA
>prophage 1
NZ_CP039216	Piscirickettsia salmonis strain Psal-104a plasmid unnamed2, complete sequence	79943	3311	43500	79943	transposase	Streptococcus_phage(17.65%)	51	NA	NA
WP_054300162.1|3311_4394_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212427.1|4579_4981_-	GTP cyclohydrolase I family protein	NA	NA	NA	NA	NA
WP_129556722.1|4982_5261_-	VUT family protein	NA	NA	NA	NA	NA
WP_081377862.1|5293_6130_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|6141_6414_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664877.1|6480_6822_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	31.4	4.4e-06
WP_054300202.1|8234_8963_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212288.1|9252_10503_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300173.1|11166_12228_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275207.1|12275_12725_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126388.1|12851_13877_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211377.1|14637_15660_+	AAA family ATPase	NA	A0A1V0DZZ0	Clostridioides_phage	27.5	3.2e-12
WP_016211383.1|15683_16553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|16858_17122_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211378.1|17369_17798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211376.1|17797_18235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211382.1|18234_18888_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_016211381.1|18899_19391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|19461_20037_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|19982_20348_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212400.1|20398_20998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046771.1|20997_21231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|21387_22540_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212392.1|22568_23576_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	26.4	1.2e-06
WP_075273802.1|23639_24368_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_016212131.1|24551_24899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212135.1|25337_26522_+	3-methylitaconate isomerase	NA	NA	NA	NA	NA
WP_075275202.1|26765_27467_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	6.0e-10
WP_075275201.1|27469_28198_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_016212164.1|28326_29355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211443.1|30378_31065_+	Fic family protein	NA	NA	NA	NA	NA
WP_016211439.1|31068_31623_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	40.6	1.0e-20
WP_016211436.1|31667_32606_+	fic/DOC family protein	NA	S4TP71	Salmonella_phage	37.2	5.2e-25
WP_016211434.1|32578_32770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211445.1|32947_33298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211437.1|33314_33941_-	zinc-ribbon domain-containing protein	NA	A0A1S5XYQ1	Kurlavirus	28.2	4.4e-12
WP_032126541.1|33947_34340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211440.1|34350_35265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211444.1|35534_36041_+	antirestriction protein ArdA	NA	A0A222YZE5	Mycobacterium_phage	33.7	2.8e-17
WP_051307358.1|36189_36573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556729.1|36856_37087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212541.1|37073_37298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212539.1|37357_37507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|37503_38478_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212090.1|38521_38701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212087.1|38700_39129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126714.1|39296_39836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212089.1|40072_40303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126713.1|40401_41439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|41908_42934_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275198.1|42960_43500_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	40.2	8.4e-12
>prophage 2
NZ_CP039216	Piscirickettsia salmonis strain Psal-104a plasmid unnamed2, complete sequence	79943	51843	72524	79943	terminase,tail,protease,capsid,portal,head	Pseudomonas_phage(11.76%)	29	NA	NA
WP_129556725.1|51843_52524_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	39.3	3.3e-37
WP_016210977.1|52702_52996_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_129556724.1|53213_53396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046773.1|53540_53720_-	phosphatase	NA	NA	NA	NA	NA
WP_016212235.1|53766_54132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126134.1|54432_54816_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	5.6e-26
WP_016212234.1|54903_55383_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_016212231.1|55386_55596_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	43.1	1.3e-08
WP_080743047.1|55611_55968_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	61.3	5.4e-23
WP_081377926.1|55986_57069_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	1.2e-89
WP_016211136.1|57065_58307_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	46.0	3.1e-86
WP_080664855.1|58254_58926_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_016211140.1|58983_60177_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_016211133.1|60297_61632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|61822_62134_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211132.1|62130_62454_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211139.1|62446_62842_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211129.1|62838_63189_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|63188_63611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126913.1|63612_63936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|63992_64259_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_032126912.1|64262_66341_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.0	2.5e-56
WP_016210657.1|66333_66675_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|66671_67343_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|67311_68058_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_016210665.1|68047_68605_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_016210662.1|68611_68899_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	2.5e-15
WP_016210670.1|68888_69143_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_016210653.1|69236_72524_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	33.5	5.2e-112
>prophage 1
NZ_CP039217	Piscirickettsia salmonis strain Psal-104a plasmid unnamed3, complete sequence	33655	10622	20331	33655	integrase,transposase	unidentified_phage(28.57%)	13	5164:5223	19653:19844
5164:5223	attL	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTA	NA	NA	NA	NA
WP_155066192.1|10622_11111_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	42.3	5.5e-18
WP_155066193.1|10981_11281_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066191.1|11289_12201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556741.1|12790_13462_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.4	3.4e-10
WP_052133268.1|13483_13765_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	38.7	8.3e-11
WP_016212274.1|13837_14302_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032126154.1|14312_14507_-	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_032126152.1|14722_15313_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
WP_129556740.1|15376_15745_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155046774.1|15956_16133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300579.1|16351_17353_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	1.3e-26
WP_016211990.1|17500_19573_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_129556739.1|19602_20331_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
19653:19844	attR	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTACCGTGATCTCAAAGAAATAGCAGCTGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGTTGGGTGCACGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTC	NA	NA	NA	NA
