The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	31805	91889	3186162	transposase,tRNA	Staphylococcus_phage(28.57%)	51	NA	NA
WP_036772169.1|31805_32681_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33039_34395_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34486_34993_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34989_35358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36760_38545_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39025_40153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40225_40981_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|41017_43711_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43742_44294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44401_45415_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45535_45760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46115_46877_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47019_47814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|47958_48711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49022_50549_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50687_51761_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|51800_53108_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53082_54252_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54306_55032_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55497_57603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|57817_58282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58301_58811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59195_60137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60418_61870_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773655.1|62336_62741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63301_64276_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|65010_65388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|65977_66952_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773242.1|66991_67546_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|67733_68633_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|68637_69264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|69208_71530_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|71676_72156_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|72152_73304_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|73438_73942_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|74035_75010_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|74999_76313_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|76353_77733_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|77739_79191_+	potassium transporter	NA	NA	NA	NA	NA
WP_017378407.1|79891_80959_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|80991_81888_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|81884_82721_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|82856_83309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|83447_84194_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|84174_84738_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|84746_85262_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|85403_87482_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|87481_88432_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|89299_89698_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|89923_90253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|90869_91889_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	124019	241945	3186162	protease,transposase,tRNA	Staphylococcus_phage(12.5%)	103	NA	NA
WP_053093682.1|124019_124763_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|125203_125497_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|125497_125752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|125768_128261_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|128253_128937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|128936_129980_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|129979_131209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|131210_131540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|131536_132736_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|132848_133238_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|133237_134182_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|134301_135699_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|136024_136546_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|136669_136978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|136992_142215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|142605_144612_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|144742_147073_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|147248_148079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|148195_148591_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|148587_149121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|149117_149519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|149913_150234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|150243_151200_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|151709_152234_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|152334_153333_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|153421_154318_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|154391_155678_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|156137_157454_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|157567_157738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|157757_158732_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|158858_159119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|159386_159677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|162215_163256_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|163358_164330_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|164452_165301_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|165452_165740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|166050_166422_+	isochorismatase	NA	NA	NA	NA	NA
WP_155046561.1|167844_167982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|167995_168208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|168731_169556_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210041.1|170886_172296_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|172443_174024_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|174772_175768_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|175773_177840_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|177897_178848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|179042_179369_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|179591_180851_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|181110_181986_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|182024_182987_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|188681_189026_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|189122_190046_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|190545_191034_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|191136_191937_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|191947_193699_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|194588_194831_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|194834_195233_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|195464_196340_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|197058_197517_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|197698_197884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|198599_200414_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|200824_201493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|201502_202819_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|202978_203941_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|204021_204177_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|204190_204427_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|204619_205837_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|205814_206273_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|206300_207680_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|207716_207935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|208254_209550_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|209754_209946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|210144_211020_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|211207_212473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|212506_213382_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|213503_213962_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|213985_214906_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|215033_215816_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|215906_217406_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|217719_219603_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|219862_220525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|220591_221701_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|221712_222357_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|222375_223362_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|223446_224523_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|224724_225549_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|225851_226817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|227135_228188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|228246_229221_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|229556_229985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|230221_230704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|230759_232010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|232112_232331_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|232802_233657_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|233711_234182_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|234478_234715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|234861_235242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|235300_236176_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|236942_237854_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|237970_238819_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|238885_239896_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|239919_240243_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375571.1|240253_240655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|240925_241945_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	315748	358107	3186162	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|315748_316624_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|316704_317337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|317290_318736_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|318770_319190_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|319963_320332_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|320341_320881_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|321041_321473_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|321476_322175_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|322422_322929_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|322971_323340_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|323610_327687_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|327750_331959_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|332120_332495_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|332599_333073_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|333088_335200_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|335227_336418_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|336424_336736_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|336858_337497_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|337512_338130_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|338126_338423_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|338437_339262_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|339278_339554_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|339559_339892_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|339904_340639_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|340652_341066_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|341065_341266_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|341265_341523_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|341644_342013_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|342030_342342_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|342357_342900_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|342912_343218_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|343246_343639_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|343651_344185_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|344194_344548_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|344558_345059_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|345064_345247_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|345249_345684_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|345684_347007_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|347063_347177_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|347320_347677_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|347702_348092_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|348101_348722_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|348743_349721_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|349769_350168_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|350280_351528_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|351514_352171_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|352255_352534_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|352776_353004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|353136_353931_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|354239_355454_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|355851_356031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|355999_356653_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|357028_357277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|357366_358107_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	376125	425808	3186162	transposase,tRNA	Staphylococcus_phage(25.0%)	54	NA	NA
WP_017376964.1|376125_378606_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|378692_379172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|379144_380185_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|380121_380838_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|380850_381186_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|381222_381693_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|381735_383571_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|383615_384704_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|384725_385787_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|385864_386380_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|386420_387698_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|387712_388564_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|388592_389240_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|389236_390196_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_036774534.1|390287_390713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875861.1|390717_391587_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|391731_391986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|392130_392697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|392802_393243_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_051929598.1|393200_393458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242664.1|393754_394957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|395240_396215_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046563.1|396684_396822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|396838_397054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|397258_397870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|397866_398124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|398374_398767_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|398896_399445_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|399444_400272_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|400321_402007_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|402084_402546_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|402582_403146_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|403372_403702_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|403682_403907_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|404051_404642_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|404666_405938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|405955_407209_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|407205_407850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|407922_408972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|409073_410711_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|410745_411075_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|411231_411519_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376927.1|411945_412083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|412588_413809_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|413867_416666_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|416971_418138_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|418236_418773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|418834_419167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|419424_420327_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|420396_420894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|421039_422443_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|422643_423372_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963630.1|423541_424399_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_048875864.1|424782_425808_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	496734	543702	3186162	transposase	Streptococcus_phage(33.33%)	44	NA	NA
WP_048875872.1|496734_498018_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|498190_498328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|498324_499728_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|499841_500279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|500399_500828_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|501075_501513_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|501944_503333_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|503779_505273_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|505467_506223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|506722_506953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|508057_509068_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|509064_509286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|510004_510946_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|511473_511872_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|511811_512666_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|512757_513039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|513124_513802_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|513847_515128_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|515303_516353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|516431_517232_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|517245_518040_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|518142_519162_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|519208_519820_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|519823_520510_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|520506_521049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|521341_522529_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|522773_523499_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|523684_524473_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|524469_524865_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|525257_526298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|526294_527698_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|530113_530371_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|530410_531796_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242633.1|532125_533223_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_017377120.1|533256_534507_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|534507_535140_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|535429_535882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|535927_536770_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|536804_537296_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|537491_539459_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|539686_540091_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|540068_541097_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|541083_541872_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|542298_543702_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	583208	716593	3186162	transposase,plate,tRNA	Staphylococcus_phage(13.64%)	110	NA	NA
WP_036772726.1|583208_583757_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|584509_585889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|586248_587712_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|587895_588708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|589172_591167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|591561_592941_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|592978_593416_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|593458_594175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|595721_596252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|596318_598139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|598703_599210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|599294_600698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|600812_601067_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|601219_601492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|602366_602942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377063.1|602938_603109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|604009_604252_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|604554_605646_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|605626_606580_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|606803_608288_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|608327_608831_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|609090_610266_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|610413_610818_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|610974_611850_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|611884_612238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|615567_615993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|616223_617360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|617346_618669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|618661_619780_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|619900_620434_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|620572_622210_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|622214_622436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|622544_623558_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|623820_626049_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_026063593.1|626029_626734_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|626968_627298_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|628698_628917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|628975_629851_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|629843_630710_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|630777_632097_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|632566_633127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|633445_634372_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|635267_636176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|639872_640712_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|640898_641114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|641162_641738_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|641734_642073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|642241_643231_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|644220_645123_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875883.1|645382_645919_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|646063_646981_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|647415_648426_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|649233_649770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|650982_651330_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|651474_652434_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|652535_653318_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|653450_654410_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|654434_654839_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|654867_655542_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|655641_657357_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|657353_657716_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|657730_658885_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|658888_659896_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|659898_660915_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|661130_662216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|662322_662715_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|662847_664131_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|664146_665448_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|665465_667268_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|667272_668265_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|668345_669422_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|669519_670494_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|670561_671533_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|671716_671986_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|672587_673874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|673938_674619_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155052676.1|680274_680562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816881.1|680600_680819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275355.1|680842_681817_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_027242570.1|682030_683170_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|683378_684749_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|685127_686120_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|686123_686639_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|686635_687475_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|687507_689058_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|689165_689537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|690757_690919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|691499_692903_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|692937_693375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|693398_694373_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|694431_694860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|695047_695854_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|695928_696321_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|696365_697187_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|697199_698183_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|698184_699453_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|699459_701964_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|702094_703120_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|703116_703827_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|703751_704582_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|704731_705115_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|705149_706049_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|706094_706766_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|706848_707424_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|707522_708323_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|708464_709322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|710184_711321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|711387_714558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|714570_715281_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|715285_716593_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 7
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	725235	771552	3186162	transposase,plate	Staphylococcus_phage(21.43%)	51	NA	NA
WP_017376356.1|725235_725634_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|725630_727319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|727300_728257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|728299_728815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|728919_729852_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|730071_730458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|730475_731120_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|731270_732110_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|732185_732788_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|732788_733643_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|734000_734312_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|734336_735725_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|735880_736612_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|736608_737136_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|737167_737725_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|737730_738711_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|738850_739651_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|739654_740422_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|740418_740883_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|740905_741559_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|741562_741910_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|741943_742195_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|742272_743541_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|743543_744302_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|744363_745254_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|745304_745988_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|745997_746345_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155062809.1|746614_748738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|748729_749602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|749769_751599_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|751766_752408_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|752732_753179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|753196_753370_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|753428_754478_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|754484_755435_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|755489_756434_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|756461_757199_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|757287_757530_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|757604_758828_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|758859_759708_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|759704_760757_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|760893_761514_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|761739_762892_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|763912_764887_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|764883_765054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|766022_766619_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|766587_767748_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|768258_768600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|768703_769738_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|769734_770445_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|770577_771552_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 8
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	779712	834023	3186162	protease,transposase,tRNA	Prochlorococcus_phage(33.33%)	49	NA	NA
WP_017377942.1|779712_780219_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243058.1|780300_780717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|780808_781669_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|781766_782312_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|782394_783246_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|783287_786194_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|786254_786452_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|786458_787469_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|787465_788524_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|788538_789318_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|789320_790133_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|790144_791092_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|791102_792395_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|792573_793677_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|793673_794066_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|794078_795455_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|795448_796918_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|797111_797546_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|797841_798018_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|799052_800078_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_155046573.1|800540_800972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|802364_803015_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|803713_804508_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|804687_805332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|805506_806481_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|806881_807139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|808816_809494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|809727_810552_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|810645_811359_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|811448_812540_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|812611_813193_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|813198_813825_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|813921_814869_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|815215_815878_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|816048_816708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|816876_818136_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|818132_819218_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|819210_820092_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|820080_821331_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|822716_823037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|823295_823562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|824052_824271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|825256_825478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|825474_826557_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|826567_826939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|826935_827115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|829818_830094_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|830929_832387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|832814_834023_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	877703	940237	3186162	transposase,tRNA	Staphylococcus_phage(28.57%)	53	NA	NA
WP_048875904.1|877703_878579_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|878835_879273_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|879333_879966_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|879981_880629_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|880631_882695_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|883021_884314_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|884702_886913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|886929_887586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|889971_890847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|891105_891717_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|892144_894733_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|894835_895597_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|895593_896130_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|896178_897135_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|897212_900398_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|900401_901457_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|901686_902289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|902332_902995_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|903029_903377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375702.1|903845_904877_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|905339_906743_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|907861_908206_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|908297_908753_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|909001_909136_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|909128_909770_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|909766_910483_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|910486_911806_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155051395.1|912487_912631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773644.1|913610_916247_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_036773645.1|916288_917374_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|917373_918057_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_017377748.1|918117_919779_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377747.1|919931_920186_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|920264_920582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|920734_921133_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|921214_921853_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|922009_922984_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|923356_923632_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|924181_924466_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|926282_926876_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|927977_928859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|928970_930650_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|930776_932027_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|932102_932564_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|932560_933709_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|933714_934389_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|934385_935042_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|935167_935641_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|935642_936065_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|936051_937071_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|937230_937410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|937628_937910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|939361_940237_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	944139	1011102	3186162	protease,transposase,tRNA	Bacillus_phage(20.0%)	57	NA	NA
WP_048876012.1|944139_945543_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|945901_946669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|946782_948186_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|948182_948344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|948659_949634_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|949874_951158_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|951224_952148_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|954343_956488_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|956509_956716_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|956776_957397_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|957437_958331_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|958416_959142_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|959203_959608_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|959770_961879_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|962002_963052_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|963048_964515_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|964657_965995_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|966062_967553_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|967781_968153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|968303_969131_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|969433_970090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|970037_970961_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|970974_971898_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376987.1|972145_972829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|974528_974756_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_016210338.1|974823_974961_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376989.1|975080_975629_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|975709_975985_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|975984_977034_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|977146_979084_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|979231_980944_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|981012_981732_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|981728_982331_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|982445_983333_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|983523_983871_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|983921_984761_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|984856_985603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|985799_986426_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|986741_987311_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|987454_988153_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|988859_989483_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|989592_990486_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|990592_992203_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|992199_993495_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|993516_995439_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|995549_995852_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|995946_1000833_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1000880_1002203_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1002327_1003422_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1003473_1004412_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1004492_1005077_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1005461_1006352_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1006554_1007046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1007185_1007677_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1007845_1008559_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065653747.1|1008621_1009962_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1010226_1011102_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	1016715	1079262	3186162	transposase	Staphylococcus_phage(33.33%)	57	NA	NA
WP_017377787.1|1016715_1016943_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1016969_1018010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1018076_1018646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1018876_1019281_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1019293_1019434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1019528_1020728_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1020748_1021360_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1021561_1022323_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1022618_1023545_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1023705_1024662_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1024806_1025076_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1025342_1026317_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1026470_1026698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1026814_1027240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1027396_1028326_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1028772_1029303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|1029624_1029930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1030407_1030719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1031058_1032225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1034412_1035384_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1035986_1036160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1036555_1037473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1037473_1038325_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1038765_1039812_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1039801_1041793_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1041902_1042277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1042530_1042713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1042974_1043676_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027242868.1|1043676_1044144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376293.1|1045782_1048533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1048768_1050061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1050547_1051453_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376296.1|1052230_1052947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1053232_1053994_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1054026_1055430_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1055426_1055591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1055650_1055938_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1056682_1057411_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1057379_1058126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046685.1|1058176_1058596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1058592_1059567_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1059723_1060041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772457.1|1062516_1062825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1062900_1063173_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1065706_1066144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1066745_1067933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1068203_1069838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1069888_1070617_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1072044_1073007_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1073250_1074246_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1074273_1075209_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1075252_1075714_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1075692_1076310_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1076339_1077314_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1077368_1077836_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1077848_1078493_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1078533_1079262_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 12
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	1087962	1137530	3186162	transposase	Acinetobacter_phage(22.22%)	39	NA	NA
WP_082300708.1|1087962_1088523_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1089847_1090243_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1090251_1090608_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1090600_1091476_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1091561_1092140_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1092097_1092391_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1093351_1094863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1095110_1096514_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1096719_1097154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1097236_1097941_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1098199_1098688_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1098716_1099391_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1099631_1100507_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275340.1|1101037_1101646_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1101916_1102375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1102653_1103043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1103228_1104044_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1104266_1105172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1105335_1106097_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1106100_1106967_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1107052_1107664_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1108042_1109290_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1109441_1110143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1110440_1110614_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1111103_1111604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1112682_1112910_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774233.1|1112962_1113196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1113224_1113905_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1113927_1116102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1116347_1117418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1117414_1118818_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378190.1|1118960_1119452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1119523_1120345_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1121011_1122511_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1122814_1125508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1125504_1128906_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_048875961.1|1130493_1131897_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1132975_1133647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1136555_1137530_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 13
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	1162253	1218647	3186162	transposase,tRNA	Staphylococcus_phage(37.5%)	52	NA	NA
WP_053093677.1|1162253_1162973_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1163200_1163377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1163625_1163949_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1164037_1166056_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1166078_1167032_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1167197_1168385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1169098_1169737_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1170034_1171030_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_027242772.1|1171170_1172217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1172209_1173235_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1173301_1175332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1176638_1176866_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1178209_1178353_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876034.1|1178349_1179042_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242771.1|1179308_1179626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|1179768_1180179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1180335_1180662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1180808_1181846_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1181887_1182133_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_129556541.1|1182257_1182572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1182579_1184154_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1184308_1184878_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1185187_1186990_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1186986_1187928_+	signal peptidase I	NA	NA	NA	NA	NA
WP_036771308.1|1187955_1188177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242761.1|1188339_1189014_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1189019_1189919_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1189932_1190676_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1190678_1191410_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1191406_1191790_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1191927_1193175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1193585_1194731_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1194723_1195077_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1195357_1195900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1196544_1196733_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1196752_1197727_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1197770_1198646_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1198999_1199827_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1199926_1200088_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1200738_1202079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1203130_1203358_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|1203499_1204861_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1204956_1205616_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144420701.1|1206456_1206813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1207409_1208969_-	APC family permease	NA	NA	NA	NA	NA
WP_027243001.1|1209329_1211300_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375893.1|1211497_1212568_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1212625_1212832_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1212838_1214314_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1214449_1215013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1215182_1216586_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1217552_1218647_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 14
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	1234889	1282614	3186162	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_036772169.1|1234889_1235765_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1235834_1236938_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1237005_1237329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1237485_1238268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1238403_1239381_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1239454_1241446_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1241501_1241783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1242036_1243236_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_051929862.1|1245667_1246180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1246366_1247242_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1247278_1247443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1248651_1249065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1249075_1249411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1249555_1250674_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1250903_1251170_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1252452_1252680_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1252690_1253197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1253274_1253892_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1254023_1255256_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1255245_1255908_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1256182_1257439_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1257576_1258236_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1258310_1259012_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1259759_1260734_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1261942_1262296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1262509_1262704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1262771_1263284_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1263421_1264276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1264324_1264969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1265002_1265647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243125.1|1266169_1266463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1266561_1267344_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1267426_1268377_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1270419_1273260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1273282_1273864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1273983_1274712_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1274857_1275832_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1275947_1276853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1277451_1278198_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1278450_1278843_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1278880_1279528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1281243_1282614_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	1306433	1347643	3186162	transposase	Enterobacteria_phage(16.67%)	37	NA	NA
WP_048876023.1|1306433_1307537_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1307627_1308780_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1309193_1310045_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|1310182_1310332_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1310956_1313323_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1313370_1314567_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1315135_1317568_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1317889_1319389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1319497_1320070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1320384_1321854_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1321926_1322676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1322679_1323453_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1323551_1324502_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1324641_1326084_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1326299_1327484_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1327607_1328294_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1328429_1329014_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1329103_1329433_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1329768_1330008_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_017377970.1|1330056_1330248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1331022_1331316_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1331464_1331626_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1332140_1332680_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1333018_1333663_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1333996_1334647_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1335170_1336223_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1336240_1339321_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1339486_1339735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1339800_1340676_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1341598_1342105_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1342122_1342320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1342338_1342482_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1342549_1342723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1342927_1344241_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1344250_1344514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1344572_1345547_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1347415_1347643_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 16
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	1378860	1432594	3186162	transposase,tRNA	Bacillus_thuringiensis_phage(25.0%)	45	NA	NA
WP_036772026.1|1378860_1379736_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1379840_1383143_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1383139_1384963_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1385002_1385401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1385509_1386526_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1386960_1388415_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1388496_1391553_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081329473.1|1392943_1393363_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376676.1|1393735_1394200_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1394272_1395274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1398166_1398499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1398860_1399004_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1398991_1399936_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420692.1|1399939_1400329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1400147_1400486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1400860_1401460_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1401459_1401807_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1401957_1402941_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1403850_1404165_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1404313_1404472_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1404443_1405373_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1406287_1406704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1407832_1408549_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1409297_1409456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1409504_1410080_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1410224_1410503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1410567_1411443_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1411608_1415475_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1415630_1416440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1416489_1417311_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1417510_1418743_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1418913_1419639_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1419681_1421220_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1421226_1422612_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1422925_1423975_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1424534_1424912_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|1425103_1425979_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1426960_1427188_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1427240_1427759_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_146619432.1|1428014_1428206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420793.1|1428614_1429388_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243181.1|1429501_1430473_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376772.1|1430454_1431426_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420687.1|1431861_1432047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1432057_1432594_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	1451529	1500948	3186162	transposase	Staphylococcus_phage(23.08%)	45	NA	NA
WP_051929845.1|1451529_1452354_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1452757_1453732_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1453917_1454511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1454691_1455156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1455550_1455832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1455828_1457232_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1457883_1458264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1458503_1459160_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1459304_1459601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1459660_1459948_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036772296.1|1461137_1461515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1461714_1462764_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1462740_1464558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1464828_1465407_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1465434_1465899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1465935_1467393_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1467454_1468942_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1469711_1470314_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1470875_1471346_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1472993_1473737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1473888_1474320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1476957_1478304_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1478391_1480197_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1480662_1481460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1481844_1482306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1482528_1483503_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1483545_1483668_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1483739_1485695_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1486084_1486270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1486591_1487581_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1487993_1489619_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1489727_1490042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1490337_1491723_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1491887_1492115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1492255_1492714_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1492914_1493100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1493168_1493996_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1494450_1494975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420684.1|1495157_1495406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1495575_1496529_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1496723_1497698_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1497825_1498851_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1499503_1499791_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1499850_1500183_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1500387_1500948_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
>prophage 18
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	1509669	1569240	3186162	protease,transposase,integrase,tRNA	Staphylococcus_phage(25.0%)	58	1498520:1498579	1568945:1569555
1498520:1498579	attL	CCACCACGTGTCACTGATAAGTGGACGTGCGTATTCCAATTTAAACTCTGGCCGAAAGTA	NA	NA	NA	NA
WP_017376809.1|1509669_1511439_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_017376808.1|1511577_1512621_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376807.1|1512634_1513378_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_027243093.1|1513490_1513808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1513869_1514049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243094.1|1514111_1514819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420791.1|1515602_1516814_+	protein kinase	NA	NA	NA	NA	NA
WP_017376801.1|1516869_1517694_-	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_017376798.1|1518881_1519517_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017376797.1|1519798_1520158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1520431_1522717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420683.1|1522705_1523362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|1523538_1524171_+	MarC family protein	NA	NA	NA	NA	NA
WP_027243097.1|1524206_1524392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243098.1|1524457_1525603_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243099.1|1525838_1527152_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_155046588.1|1528267_1528477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420682.1|1529011_1529173_-	phosphatase	NA	NA	NA	NA	NA
WP_017376785.1|1530579_1531485_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376784.1|1531725_1531911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242578.1|1531947_1532484_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_027242577.1|1532501_1533803_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_048876008.1|1533799_1534774_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_144420681.1|1534817_1535003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1535182_1535347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1535348_1536224_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1536539_1537460_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1537475_1537859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1538185_1539142_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_144420678.1|1539409_1539688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243017.1|1540186_1541530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378522.1|1541703_1541883_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1541926_1542901_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1543048_1544920_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1544952_1545051_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1545286_1545916_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1545899_1546322_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1546328_1548068_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1548068_1549133_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1549136_1549490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1549602_1550571_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1550580_1550892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1550907_1551477_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1551740_1553069_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1553109_1554084_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1554670_1555072_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146619459.1|1555591_1558048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1558250_1559102_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1559147_1560854_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1562325_1563300_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1563662_1563908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1564271_1565300_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1565430_1565634_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420676.1|1565918_1566875_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_047927838.1|1567167_1567413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1567409_1567709_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1567931_1568402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1569012_1569240_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
1568945:1569555	attR	TACTTTCGGCCAGAGTTTAAATTGGAATACGCACGTCCACTTATCAGTGACACGTGGTGGTGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGATAGGTTAGCATTGGCTGTATGCAACCGATCATGATTGTAATATCGAATATAGGCCTCAACATCCTCCTTCATAGTATCACGGGTTAAGTGAATCACATTCAACAGCCATTCGTGCTTTAGGCTGCCAAAAAAACGCTCGACAACCGCATTGTCAACGCAAGCACCGACACTGCTCATAGAAGCGGTGATTTTATGCTTCTTCAACAGTTTTCGATATTTTTTACTGGTATACTGCGAACCACGATCACTGTGAAATAACAAGTGTTCTGTCGGCTGCCGCAAGTGAATCGCCATATCCATTGCACGACAAACTAGATTTTCGCTCATTCTCTTATTCATCGCCCAGCCAATCACTTTTCGAGAGTATAAATCAATAACGACCGCAAGATACAACCAGCCTTCAGCAGTTCTAAGGTAGGTAATGTCACCTGCCCATGAGTGATTTGCAATGACTGGATTAAACTGCTGATTCAATACGTTATCTGCAACAGC	NA	NA	NA	NA
>prophage 19
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	1574692	1617623	3186162	transposase	Staphylococcus_phage(20.0%)	41	NA	NA
WP_053856766.1|1574692_1576096_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1576283_1577141_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1577265_1577901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1577949_1578201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1578456_1579356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1579492_1580566_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1580666_1581080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1581100_1581814_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1582001_1583414_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1583623_1584592_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1585325_1585694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1585697_1586015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1586090_1587065_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1587584_1588085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1588155_1589484_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1589619_1591008_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1591155_1592466_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1592806_1594090_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1594163_1594784_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1594982_1595243_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1595445_1595592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1595567_1596161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1598024_1598243_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1599495_1600266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1600352_1600568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1600664_1601786_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1602052_1603027_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1603289_1604411_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1604703_1604991_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1604963_1605467_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1605547_1606207_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1606548_1607466_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1607595_1607769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1608434_1609793_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_017376486.1|1609867_1610431_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376485.1|1610625_1611855_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1611900_1612527_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1612676_1613864_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1613872_1614565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1614686_1615839_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1616639_1617623_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 20
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	1675958	1824280	3186162	protease,transposase,tRNA	Staphylococcus_phage(12.12%)	134	NA	NA
WP_036774017.1|1675958_1676834_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1677223_1677562_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1677558_1678155_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1678157_1680152_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1680215_1681154_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1681502_1682477_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1682680_1682878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1683039_1683444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1685027_1685468_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1685794_1686670_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155074368.1|1686682_1686877_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1687331_1687586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1688797_1689763_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1689855_1690167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1690367_1691144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1691973_1692165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1692893_1693943_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1694113_1694887_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1694947_1696537_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1696727_1697819_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1697841_1698159_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1698245_1699523_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1699544_1700381_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1700387_1702022_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1702453_1702813_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1703094_1704453_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1704478_1704721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1705214_1705394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1705649_1706906_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1707019_1707277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1707421_1708432_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1708808_1709663_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1709692_1710526_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036773204.1|1711102_1711876_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1711957_1712278_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1712496_1713402_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1713487_1713886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1714030_1714528_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047927093.1|1716188_1717292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1717390_1717768_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1717847_1718822_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1720366_1721086_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1721169_1721457_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1721741_1722614_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1722570_1723347_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1723551_1723887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1724285_1724642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1724803_1725079_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1725188_1725536_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1725553_1726333_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1726332_1726842_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1726877_1727126_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1727437_1727773_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1728072_1729323_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1729404_1731432_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1731977_1732196_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1732367_1732730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1732878_1734282_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1734563_1735739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1735756_1737754_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1737734_1738715_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1738770_1739613_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_036772544.1|1739612_1740029_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1740009_1740429_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1740451_1741081_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1741649_1743839_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1743850_1745056_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1745040_1746888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1746872_1748111_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1748097_1749966_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1749999_1751253_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1751258_1752116_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1752134_1752863_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017376477.1|1754391_1754781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1754957_1755716_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1755712_1758112_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1758125_1759403_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1759492_1760791_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1760988_1761882_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1761881_1763096_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_048876132.1|1763115_1764369_-	GTPase HflX	NA	NA	NA	NA	NA
WP_026063533.1|1764417_1764672_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_017376470.1|1764947_1766315_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_017376469.1|1766671_1767694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376467.1|1768213_1769689_+	APC family permease	NA	NA	NA	NA	NA
WP_036772167.1|1769908_1770856_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_017376465.1|1771397_1772960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046597.1|1773504_1773681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971651.1|1773795_1774671_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1775043_1775307_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1775613_1778208_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1778204_1778687_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1778664_1779705_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1779879_1780365_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1780472_1783043_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1783076_1783538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1783874_1784750_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1785027_1786788_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1786881_1787547_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1787559_1789065_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1789086_1789617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1789690_1790953_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1791139_1792012_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1792113_1792902_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1792994_1794320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1794673_1795849_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1796017_1796671_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1796826_1798767_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1798763_1799387_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1799551_1800526_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1800797_1801418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1801414_1802818_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1802885_1803302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1803709_1804207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1804203_1805178_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875985.1|1805221_1805827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1805971_1806508_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1806512_1806809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1806817_1807423_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1807608_1808007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1808197_1808401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1808545_1808701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1808825_1809278_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1809394_1810867_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1811305_1811770_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1812458_1813709_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1813818_1814289_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1814311_1814905_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1815042_1816092_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1816115_1817039_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1817055_1817517_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1817624_1818443_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1819052_1819196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1823359_1824280_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	1886543	1903438	3186162	transposase	Staphylococcus_phage(50.0%)	16	NA	NA
WP_017378288.1|1886543_1886765_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1886823_1887798_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1887996_1888161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1888157_1888793_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420659.1|1889069_1889849_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420658.1|1889881_1890643_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1890619_1891609_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1891744_1892620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1892638_1893298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1893831_1894089_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774189.1|1894088_1895096_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876031.1|1895561_1896965_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1897078_1897924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1898068_1899718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1899808_1900594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|1902034_1903438_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	1932111	1980983	3186162	transposase,tRNA	uncultured_Mediterranean_phage(33.33%)	43	NA	NA
WP_144420657.1|1932111_1933173_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1933884_1934046_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1934962_1935502_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1935884_1936301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1936396_1937212_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1937344_1938838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1939023_1939449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1939445_1941506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1941789_1942605_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1942705_1943524_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1943520_1943889_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1944070_1944898_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1944961_1945690_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1946092_1946821_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1947210_1947936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1947970_1951843_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1952043_1953177_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1953190_1953379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1953602_1954961_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_036773947.1|1956567_1957443_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1957954_1958590_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999981.1|1958602_1959076_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_155046603.1|1959003_1959156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929627.1|1959349_1959700_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1959759_1960047_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1960099_1960879_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376415.1|1961303_1962221_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1962272_1963028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1963095_1964370_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376412.1|1964490_1965168_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376411.1|1965368_1966793_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_016209938.1|1966767_1967406_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376410.1|1967768_1968047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376409.1|1968280_1969225_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376408.1|1969246_1971115_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376407.1|1971135_1971489_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_026063528.1|1971527_1972643_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1972827_1973868_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_027242800.1|1973870_1974905_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376402.1|1974901_1975963_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_017376401.1|1976074_1977547_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376400.1|1977699_1978143_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376399.1|1978211_1980983_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
>prophage 23
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	1985414	2034569	3186162	transposase	Staphylococcus_phage(25.0%)	45	NA	NA
WP_036773116.1|1985414_1986389_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|1986912_1989639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|1990526_1991501_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|1991751_1992456_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875970.1|1994028_1994502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|1995469_1996954_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|1997078_1998614_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|1998636_1998966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|1998862_1999078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2001061_2002261_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2002470_2003331_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2003446_2004025_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2004181_2004823_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2004861_2005083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2005075_2006059_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2006452_2006950_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2007094_2007370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2007521_2009204_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2009211_2010234_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2010402_2011404_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2011517_2011856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2012331_2013591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2013799_2014027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2014055_2014274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2014411_2014777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2014844_2015087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2015101_2015437_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2015441_2015879_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_036772812.1|2015904_2017290_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2017400_2017832_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2017937_2019449_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2019739_2021332_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2021532_2023728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772819.1|2023821_2025255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2025297_2025813_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2025812_2026760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2026743_2027409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2027405_2028134_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2028123_2028870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2028853_2029918_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2030122_2031310_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2031366_2032485_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2032932_2033190_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2033469_2034147_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2034365_2034569_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	2054269	2119795	3186162	protease,transposase,tRNA	Burkholderia_virus(10.0%)	59	NA	NA
WP_017377787.1|2054269_2054497_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2054586_2055342_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2055755_2056352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2056431_2059236_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2059216_2060170_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2060162_2061533_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2061703_2063107_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2063878_2064205_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155074370.1|2064409_2065084_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	6.0e-15
WP_017376600.1|2065382_2065562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2065817_2067074_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2067312_2067459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2067541_2067898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2068393_2068753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2068762_2069146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2070034_2070175_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2070319_2071240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2073397_2073928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2073938_2074994_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2075009_2077049_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2077035_2077866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2077932_2081472_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2081585_2082305_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2082543_2083173_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2083292_2084696_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2084841_2086785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2087302_2088163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2088598_2090344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771696.1|2090758_2092219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2092401_2093001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2093138_2093336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2093536_2093677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2093744_2094524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2095088_2095490_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2095634_2096012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2096471_2097779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155074371.1|2098527_2098737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2098836_2100240_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2100480_2102190_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2102359_2102722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|2102829_2103804_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_047927659.1|2103862_2104633_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_017377874.1|2104998_2105766_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377875.1|2105767_2106697_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.9	7.0e-14
WP_017377877.1|2106899_2108492_+	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_017377878.1|2108553_2108787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377879.1|2108790_2109006_-	SlyX family protein	NA	NA	NA	NA	NA
WP_027242835.1|2109187_2109991_+	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	6.8e-42
WP_027242836.1|2110041_2110689_-	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.6	1.6e-36
WP_144420778.1|2110691_2111591_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_017377882.1|2111663_2112305_-	OmpA family protein	NA	NA	NA	NA	NA
WP_048875959.1|2112340_2113693_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_036771700.1|2113752_2114847_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_017377887.1|2114849_2115281_-	protein TolR	NA	NA	NA	NA	NA
WP_017377888.1|2115315_2116020_-	protein TolQ	NA	NA	NA	NA	NA
WP_017377889.1|2116132_2117143_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.9e-07
WP_017377890.1|2117219_2117825_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_017377891.1|2117821_2118343_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_017377892.1|2118373_2119795_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 25
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	2128905	2177926	3186162	protease,transposase,tRNA	unidentified_phage(15.38%)	52	NA	NA
WP_036771957.1|2128905_2129877_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2130225_2130534_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2130530_2131187_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2131320_2131806_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2131883_2132405_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2132450_2133344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2133340_2134162_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2134356_2134506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2134733_2135564_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155074372.1|2136819_2137140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2137292_2138696_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_144420645.1|2138805_2140062_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2140033_2140765_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2140776_2142054_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2142153_2142528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2142612_2143500_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2143557_2144286_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2144282_2145392_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2145543_2145972_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2146066_2146423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2146415_2147627_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2147623_2148412_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2148574_2149369_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2149818_2150559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2150562_2153061_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2153323_2154280_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2154263_2155025_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2155232_2156207_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2156315_2157071_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2157195_2157441_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2157500_2159774_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2159828_2160131_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2160371_2160665_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2160835_2161015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2161090_2161702_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2161948_2163265_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2163275_2163644_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2163674_2164337_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2164759_2165338_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2165317_2165725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2165848_2166145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2166191_2167067_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876123.1|2167136_2169317_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_017376060.1|2169420_2170770_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_036772012.1|2170843_2171533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2171665_2172853_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376055.1|2173371_2174016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2174012_2175326_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2175530_2175704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2175973_2176447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2176591_2176786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2177050_2177926_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	2196988	2245211	3186162	transposase,tRNA	Staphylococcus_phage(16.67%)	41	NA	NA
WP_036771639.1|2196988_2197963_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875951.1|2198006_2198843_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2198988_2199408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2199684_2200365_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2200330_2200681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2200713_2201925_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2202265_2202895_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2202943_2203960_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2204206_2204422_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2204474_2204924_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2205003_2206749_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2206840_2208712_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2209156_2209873_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2211310_2212180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2212136_2212364_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2213332_2214247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2214292_2215315_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2215383_2216433_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155052687.1|2217061_2217232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243219.1|2217516_2217825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2217991_2219395_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046608.1|2219487_2219652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2219973_2220198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2220208_2221420_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036774710.1|2221814_2222714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375569.1|2222887_2223283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2223535_2224579_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2224698_2224935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2225723_2227277_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2229457_2229685_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2230555_2231530_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017375736.1|2232256_2233339_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_017375735.1|2233381_2234032_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375734.1|2234254_2234626_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_027243178.1|2234736_2236098_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155046609.1|2237818_2238025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2238335_2239418_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2239414_2239726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2240771_2241746_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2242752_2243532_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2243993_2245211_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	2258081	2319049	3186162	transposase,integrase	Staphylococcus_phage(30.0%)	47	2265934:2265993	2316355:2317115
WP_144420638.1|2258081_2259164_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2259160_2259472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2260969_2261905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2262497_2263643_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2265885_2267049_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2265934:2265993	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|2267077_2267302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2268649_2269825_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2270170_2272681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2272739_2273552_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275283.1|2273992_2274604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2274746_2275721_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2275825_2277157_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2277355_2277424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2277555_2278998_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2279389_2280802_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2281491_2281938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2282532_2283381_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2283634_2284693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2284684_2286391_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2286462_2288196_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2288492_2289059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2289183_2289837_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2289863_2291324_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2291420_2292398_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2292867_2294271_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2294796_2295090_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2295316_2296081_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2296288_2296516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2296579_2296762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2297324_2297504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376902.1|2297567_2297879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2298733_2299438_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2299635_2299776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2300180_2300705_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|2300851_2302108_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2302175_2302655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2303095_2304499_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420632.1|2304913_2307229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2307801_2309694_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2309865_2310840_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2311143_2311950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2312018_2312630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2314111_2314408_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2314404_2315247_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2315637_2316423_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2316427_2317831_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2316355:2317115	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2318104_2319049_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	2339891	2367544	3186162	protease,transposase	Staphylococcus_phage(25.0%)	28	NA	NA
WP_017377305.1|2339891_2341193_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2341274_2341880_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2341992_2343297_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2343897_2344773_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2344888_2345560_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2345739_2347095_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2347215_2347953_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2348031_2348748_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2349396_2350671_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2350701_2351277_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2351321_2352287_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2352750_2353659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|2354046_2354298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2354442_2354871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2354856_2355801_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2356005_2356158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2356186_2356921_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2357015_2357276_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2357494_2358460_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|2358436_2358733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2358923_2359373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2359632_2360061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2360156_2360657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2360593_2360755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2361635_2361857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2363355_2364033_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2365347_2365686_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2366569_2367544_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 29
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	2406789	2478729	3186162	transposase,tRNA	Staphylococcus_phage(37.5%)	54	NA	NA
WP_080999971.1|2406789_2408193_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2408306_2408882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2410127_2410355_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2410644_2411184_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2411493_2412981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2413032_2413458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2413676_2415080_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2415076_2415454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2415413_2415959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2416354_2417581_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2418181_2419834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2419770_2419965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963645.1|2420297_2421488_-	MFS transporter	NA	NA	NA	NA	NA
WP_027243147.1|2421736_2424409_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2424697_2425534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2426194_2427085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2427553_2428528_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876031.1|2429012_2430416_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2430561_2431965_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|2432049_2433864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2435775_2437179_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2437212_2438742_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2438777_2440238_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_027242908.1|2440212_2441172_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376200.1|2441249_2444756_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_017376201.1|2444779_2445349_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_027242907.1|2445562_2446717_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376204.1|2446735_2447509_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|2447508_2447955_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376206.1|2447972_2449022_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_017376207.1|2449132_2449666_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_036771893.1|2449746_2452164_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_027242906.1|2452448_2453516_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_017376209.1|2455718_2456783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376210.1|2456772_2457801_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376211.1|2457797_2458337_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376212.1|2458873_2460784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242905.1|2460831_2461020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420622.1|2461228_2462806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|2462902_2463778_-	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_080963646.1|2463866_2464766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063514.1|2464680_2465427_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_017376216.1|2465434_2465992_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_017376217.1|2465995_2466733_-	UMP kinase	NA	NA	NA	NA	NA
WP_017376218.1|2466736_2467615_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376219.1|2467779_2468547_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376220.1|2468953_2469763_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376221.1|2469840_2472498_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|2472501_2473539_+	asparaginase	NA	NA	NA	NA	NA
WP_017376223.1|2473540_2474362_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376224.1|2474492_2475377_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_036773116.1|2475689_2476664_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2476716_2477712_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2477754_2478729_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 30
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	2489461	2545090	3186162	transposase,tRNA	Burkholderia_virus(28.57%)	53	NA	NA
WP_017376309.1|2489461_2489749_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2489869_2491330_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2491409_2492846_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2492970_2493945_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2496135_2496897_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2498054_2498282_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2499235_2499448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2499465_2499783_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2499809_2500499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2500839_2501043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2501174_2502110_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2502122_2502905_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2503034_2503346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2503689_2504016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2504040_2504496_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2504485_2505538_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2505540_2507004_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2507138_2507366_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2508782_2509247_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2509503_2510319_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2510447_2512760_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2512876_2513404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2514095_2515373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2515383_2515635_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2515668_2516190_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2516359_2517346_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2517436_2518252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2518680_2519076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2519048_2519276_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_047927746.1|2520244_2520832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2521434_2522106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875918.1|2522250_2522832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420767.1|2522874_2523552_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243185.1|2523830_2524787_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_017377736.1|2524846_2525512_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017377737.1|2525545_2526091_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_155046615.1|2526370_2526532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774946.1|2527228_2527843_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_144420620.1|2527769_2528972_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875923.1|2528957_2529953_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2529956_2530361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2531328_2531556_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2532524_2533121_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875914.1|2533089_2534250_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_017375625.1|2534954_2535182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875913.1|2535178_2535949_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017377194.1|2535945_2537259_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_027243130.1|2538183_2539053_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377197.1|2539049_2540399_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_017377198.1|2540511_2542152_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_027243131.1|2542537_2542804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377200.1|2542933_2543122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2543686_2545090_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	2549085	2595100	3186162	transposase,tRNA	Bacillus_phage(20.0%)	50	NA	NA
WP_017377840.1|2549085_2549805_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2549966_2550173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2550172_2550409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2550421_2550775_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2551312_2552146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2552238_2552436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2552533_2553919_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2554045_2554636_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2555667_2555955_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2556014_2556179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2556175_2557546_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2557912_2559325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2559394_2560165_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2560657_2560945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2562421_2562715_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2562672_2563494_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2563638_2563863_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155046618.1|2564117_2564645_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|2564821_2565082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2565000_2565156_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2565254_2566229_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2567557_2567707_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2567823_2568117_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2568925_2569501_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2569578_2570454_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2570518_2571139_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2571123_2572206_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2572439_2572844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2574334_2575636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2575782_2576451_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2577383_2577947_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2578003_2579200_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_017376587.1|2579324_2580689_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376586.1|2580685_2581777_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376585.1|2582031_2582682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2582874_2583069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2583176_2583329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376583.1|2583595_2584723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063543.1|2584812_2585646_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376581.1|2585649_2586300_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_017376580.1|2586289_2587129_-	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_016210074.1|2587134_2587761_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376579.1|2587921_2588464_+	septation protein A	NA	NA	NA	NA	NA
WP_017376578.1|2588547_2588850_+	YciI family protein	NA	NA	NA	NA	NA
WP_144420763.1|2588867_2589110_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376576.1|2589208_2589481_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376575.1|2589519_2590158_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376574.1|2590190_2591282_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144420616.1|2591453_2592962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2594125_2595100_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 32
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	2604394	2668484	3186162	transposase,tRNA	Staphylococcus_phage(38.46%)	56	NA	NA
WP_080999966.1|2604394_2605744_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2606041_2606599_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2606692_2607199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2607703_2608399_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|2608529_2609318_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2609351_2610755_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2611178_2612153_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2612409_2612637_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2613724_2614255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2614251_2615784_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2615780_2616731_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2617151_2617784_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2618026_2618224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999965.1|2619274_2620363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2620507_2620759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2620863_2621508_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2621743_2622241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2622752_2623727_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2624097_2624391_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2625203_2625539_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2625859_2627398_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2627550_2628649_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2628887_2630087_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2630117_2630744_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2630772_2631657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2631790_2632021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2632158_2633400_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_144420613.1|2633679_2634051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2636182_2636344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2636719_2637847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2637963_2638626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2638711_2638972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2639390_2640152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2642213_2642873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2642973_2643624_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2643771_2644461_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377795.1|2644483_2645647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2645851_2646103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619442.1|2646626_2647289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2647422_2648397_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376009.1|2649751_2650042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376008.1|2650364_2651402_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376007.1|2651432_2652887_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376006.1|2652896_2654081_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376005.1|2654154_2655162_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376004.1|2655230_2657234_-	transketolase	NA	NA	NA	NA	NA
WP_017376003.1|2657685_2658846_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376001.1|2659082_2660198_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376000.1|2660360_2660885_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017375999.1|2660884_2661415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2663074_2663950_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2664070_2664571_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2664567_2664834_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2664999_2665974_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2666153_2666774_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2667080_2668484_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	2677986	2723143	3186162	transposase,tRNA	Staphylococcus_phage(21.43%)	40	NA	NA
WP_048875901.1|2677986_2678961_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_144420611.1|2679495_2679696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155052690.1|2679728_2681060_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	2.4e-36
WP_017377275.1|2682142_2682865_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2682856_2683225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2683487_2684789_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2684884_2685328_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2685331_2685841_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2685833_2688647_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2689143_2690076_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2690180_2691107_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2691285_2692824_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2692997_2693258_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2694532_2695141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2695187_2695916_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2696162_2696300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377696.1|2697462_2698002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2698236_2699148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2699407_2699704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2700048_2701202_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2701798_2702347_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2702450_2703014_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2703231_2703990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2705265_2705493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2705715_2705895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2706150_2707407_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2707474_2708119_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_017378393.1|2708923_2709130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816949.1|2710130_2710529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378390.1|2710722_2712300_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378389.1|2712433_2713375_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378388.1|2713376_2714150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963621.1|2715758_2715965_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2716231_2716519_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378384.1|2716524_2718906_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|2718918_2719914_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_016210495.1|2720045_2720405_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378382.1|2720447_2720642_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|2720676_2721207_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378381.1|2721211_2723143_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
>prophage 34
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	2760921	2813950	3186162	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2760921_2761896_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2762052_2763627_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2763851_2764130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2764199_2765075_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2765084_2766245_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2766359_2767508_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2767518_2770320_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2770426_2771125_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2771137_2772901_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2772904_2773252_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2773245_2773620_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2774567_2775851_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2776260_2777556_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2777911_2778457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242732.1|2779044_2779566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2779577_2780957_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2781192_2781627_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2781623_2782976_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2782975_2784091_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2784091_2785108_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2785097_2786768_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2786787_2787123_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2787150_2788590_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2788586_2789633_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2789775_2791272_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2791567_2792569_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2792674_2793286_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2793406_2793784_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2793834_2795241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2795234_2796302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2796408_2798010_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2798258_2799176_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2799244_2800939_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2801173_2802103_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2802133_2803537_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2803767_2804472_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2804538_2805195_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2805205_2806087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2806257_2808927_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2809287_2810262_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2810341_2811313_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2811366_2812341_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2812460_2812682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2812745_2813054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2812978_2813950_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	2828516	2882777	3186162	transposase	Staphylococcus_phage(37.5%)	51	NA	NA
WP_026063658.1|2828516_2829245_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2829554_2829809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2830522_2833177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2833215_2833506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2833622_2834921_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2835491_2835980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2835960_2836263_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2836509_2836998_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2837031_2837670_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2837791_2838331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2838420_2839647_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2840259_2840517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2840603_2841503_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2841647_2841914_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2841905_2842055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2842282_2843158_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2843287_2843515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2843581_2843776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2843834_2844809_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2844846_2845035_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2845035_2846808_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2846797_2847790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2848397_2849090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2849576_2850146_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2850142_2851117_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2851156_2851660_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2851750_2853154_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2853852_2854038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2854143_2855547_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420599.1|2855551_2856124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2856157_2857585_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|2858870_2861240_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2861315_2862134_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2862485_2863031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2863513_2864752_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2864728_2865703_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017375625.1|2865795_2866023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|2866027_2866519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243039.1|2867191_2868079_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_027243038.1|2868168_2869659_-	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_017376549.1|2869682_2870564_-	ROK family protein	NA	NA	NA	NA	NA
WP_017376548.1|2870560_2871283_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376547.1|2871982_2872774_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|2872960_2873206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420598.1|2873357_2873588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376543.1|2873617_2874397_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_047927468.1|2874422_2874728_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_144420752.1|2874724_2875618_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_027243035.1|2875973_2877272_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376538.1|2879874_2881056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2881349_2882777_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	2890363	2939872	3186162	transposase,tRNA	Bodo_saltans_virus(14.29%)	44	NA	NA
WP_062312049.1|2890363_2891731_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2892223_2892703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2892882_2894946_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2894954_2895680_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2896307_2897021_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2897025_2897556_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2897790_2898024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2898136_2898385_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2899192_2901385_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2901402_2901711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2902364_2904074_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2904267_2904423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2905825_2906701_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2907026_2907788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2908012_2908744_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2908740_2909277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2909330_2910095_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2910097_2911675_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2911681_2912158_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2912133_2912565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2912597_2913353_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2913527_2913815_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2914197_2914422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2914761_2915925_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2915959_2916937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2916930_2917617_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2917555_2918671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2918950_2919556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2919793_2920273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2922095_2922749_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2922861_2923413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2923512_2924487_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2924772_2925297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2925994_2926819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2927074_2927431_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2927427_2928831_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2928950_2929511_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2929668_2930235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155074373.1|2930437_2932600_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_027243087.1|2932863_2933559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2933599_2933812_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2935384_2936494_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2936549_2938031_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2938468_2939872_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP039050	Piscirickettsia salmonis strain Psal-081 chromosome, complete genome	3186162	3067266	3132515	3186162	protease,transposase	Hokovirus(14.29%)	55	NA	NA
WP_017376170.1|3067266_3068367_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3068724_3069699_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3069835_3070714_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3070721_3070952_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3071005_3072010_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3072228_3073056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3073137_3074526_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3074813_3076214_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3076308_3077235_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3077231_3078368_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3078364_3079372_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3079368_3080532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3080541_3081393_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3081424_3082597_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3082593_3083982_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3084010_3084418_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3084437_3085445_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3085441_3086314_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3086310_3087171_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3087172_3089443_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3089444_3090590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3090636_3091122_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3091161_3091785_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3097464_3098217_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243062.1|3099548_3100172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3100276_3101065_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3101064_3101796_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3101829_3103557_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3103570_3104632_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3104946_3106161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3106293_3106818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3107435_3108284_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3108270_3108969_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3109023_3109785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3109777_3110200_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3110329_3110881_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3110936_3111899_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3111899_3112115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3112301_3113111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3113090_3113933_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3113929_3115174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3115312_3116401_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3116418_3116919_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3117106_3117706_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3117711_3118875_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3118907_3119861_+	glutathione synthase	NA	NA	NA	NA	NA
WP_017376261.1|3120224_3121289_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3121285_3124348_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3124500_3124953_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3124984_3125341_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3125759_3126533_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376269.1|3129156_3129447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3129671_3130547_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3130543_3131101_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3131111_3132515_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039051	Piscirickettsia salmonis strain Psal-081 plasmid unnamed1, complete sequence	179546	0	50413	179546	transposase,integrase	Streptococcus_phage(45.0%)	52	3197:3256	36813:37514
WP_027243191.1|0_708_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|661_1540_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_144420840.1|1570_2002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|2384_3089_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|3100_3829_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
3197:3256	attL	CATTGCTTCCATCACATCAATGGTAGATCGTGCTGTAGAAAGTGATTGGTACCATTGGCG	NA	NA	NA	NA
WP_051929563.1|3858_4248_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|4270_4999_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|5001_5610_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_144420841.1|5981_6206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|6198_6537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|6550_6955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375840.1|6999_7218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275474.1|8186_9299_+	replication initiation protein	NA	A0A218MNI2	uncultured_virus	29.8	2.1e-25
WP_017377655.1|9640_9886_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|9882_10269_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|10356_11085_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|11063_11684_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|12029_12716_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|13665_14028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|14030_15770_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|16171_16324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|16351_17035_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|17116_18094_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|18169_18340_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|18380_19109_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_036771293.1|19654_19921_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772437.1|20216_22115_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|22536_23265_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_080963669.1|23338_23485_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|23901_24066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|24086_25373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|25555_26284_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|26411_27389_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_144420843.1|28470_30354_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|31094_32072_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375911.1|32838_33090_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	53.3	6.5e-07
WP_017375910.1|33092_33821_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017375909.1|34109_34799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036775032.1|34846_35662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046632.1|37671_37821_-	hypothetical protein	NA	NA	NA	NA	NA
36813:37514	attR	CGCCAATGGTACCAATCACTTTCTACAGCACGATCTACCATTGATGTGATGGAAGCAATGGGCACTGTTGCGAAAAGTTATCGTGAGCTTCAGAAAGGTTATTTTCTTGTGCTCTCTGCTTAGAATTAAGCAGCTAATCCAAATAATTTATCAATGAGCTGATTTTGGGCACAGATATTCTGTTTTTTAATATAACGTAATTGACCTTTTTGAACCATGCGCATCGCTTCCATTATGTCAATGGTAGGCCGTGCTGTAGAAAGTGATTGGTACCATTGGCGGAAACGGGATTTGCGCTTTATCGCTTTGTGATCATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACATCGCCTAGAAAAGACACCTTCATCTTTGGCTTTTTGATGAGCGGGTGGAAATGAAGCGTGTTTATCGACATTCACAACACGCGGTGATTTCACATAAGGTTGGGCTATTGCCTTTTTGAAAAAGCGCAAGGCCGCTTTAGCATTTTGCTGACGACTGAGCATCCAATCCAAAGTATGGCCATATTTATCAATCGCTCGATAAAGGTAATACCAGCGCCCTTTAATTTTAACCAGCGTTTCATCCAGCCGCCAAGAGGCACACGTTTGGCGAAAGTGGGGCCGTAACCGTTTAGCGATTTCAGGTCCATATTCATGAACCCAACGACAGACGCTGCGAGCCATG	NA	NA	NA	NA
WP_032126795.1|38293_38554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|38557_38830_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|38905_39634_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|40203_41175_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|42039_42867_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|43720_44191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|45084_45228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|46434_47034_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|47387_48164_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|48524_49253_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_080963638.1|49328_49523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|49441_50413_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039051	Piscirickettsia salmonis strain Psal-081 plasmid unnamed1, complete sequence	179546	62301	124806	179546	portal,terminase,transposase,integrase	Streptococcus_phage(41.18%)	61	89500:89559	129142:130062
WP_027242929.1|62301_62685_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|62771_63254_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|63256_64588_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|64792_65227_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|65313_65700_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|65737_66472_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|66518_67232_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_144420848.1|68610_68796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243190.1|68799_72144_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017377509.1|72324_73053_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|73146_74121_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|74434_74797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|74836_75346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|75577_76558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|77023_78001_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|78481_79459_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|79473_79635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|79852_80107_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_048876199.1|80096_80387_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	52.6	1.3e-11
WP_036771347.1|80373_81351_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|82351_82564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|82721_83699_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_144420843.1|83817_85701_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_047927782.1|86496_86886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|86801_87779_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_048876196.1|87808_88957_-	hypothetical protein	NA	NA	NA	NA	NA
89500:89559	attL	TTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTA	NA	NA	NA	NA
WP_027243215.1|90770_91793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|92275_93004_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_048876194.1|94243_94777_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|94957_95299_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|95479_95746_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|95818_97684_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|97851_98136_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|98479_99208_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|99289_99781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|100513_100741_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|102292_102721_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|102656_103043_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|103072_103801_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|103812_103962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|104208_104937_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|106314_107277_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|107300_107630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|107696_108737_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|108750_108942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|109146_109716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|109758_110058_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155046638.1|110054_110519_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|110792_111521_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|111694_112468_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|113181_114117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|114391_115120_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243201.1|115285_115525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|115588_118930_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|119087_119816_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|120109_120505_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|120557_121286_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|121769_122498_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|122668_123238_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|123242_123926_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|124077_124806_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
129142:130062	attR	TTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGCGCACAAGAAAAACGAGCTAACGCTAAGCAAGGACAAGCTTTTCAACAAATTTCAGAAGAGGAAAAAATGTTGATTCATCAGCGGTTAAGCACTCATACATCCCCCGATGTTATCAGTCAAGAACTTATACGTGAGCATAATATTCAGGTGAGTGAGAGCACGATTTACCGTTATATTTATGATGATAGAGAGCGGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCAGGAAAACCTTATAAGAAGAAGGTGAGTCGTGGTGATCAAACAAAAATACCTAATCGCGTTGGTATTGAACAACGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGTGACCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACTTCTGACAACGGAACAGAGTTTGCCGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAACACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACGGATTTTAATGAAGTTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATCGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGT	NA	NA	NA	NA
>prophage 1
NZ_CP039053	Piscirickettsia salmonis strain Psal-081 plasmid unnamed3, complete sequence	51496	5715	19511	51496	transposase,capsid,tail,head	Moraxella_phage(18.18%)	18	NA	NA
WP_036771639.1|5715_6690_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|6739_7279_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|7292_7877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|8261_8573_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|8569_8995_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|9173_9569_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|9565_9916_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|9915_10338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|10339_10663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|10719_10986_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|10989_13068_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|13060_13402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|13398_14070_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|13999_14785_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|14774_15332_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|15328_18019_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|18077_18506_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|18533_19511_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 1
NZ_CP039054	Piscirickettsia salmonis strain Psal-081 plasmid unnamed4, complete sequence	33497	3344	19366	33497	integrase,capsid,transposase,tail,terminase,head	unidentified_phage(35.71%)	21	NA	NA
WP_036771330.1|3344_4319_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4854_5445_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5675_5936_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5928_6282_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6458_7433_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|7965_8331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|8475_8730_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8713_9070_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|9167_10142_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|10767_11634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|11846_12230_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|12316_12799_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|12801_12987_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|13006_13981_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|14077_14470_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|14505_15087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|15467_16442_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|16515_16731_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|17534_18050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|18395_18953_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|18949_19366_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
