The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	45582	58682	3062326	transposase	Moraxella_phage(25.0%)	17	NA	NA
WP_075273371.1|45582_46158_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46103_46469_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46667_47429_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_036779326.1|47730_49257_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49628_50468_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50507_51815_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51789_52959_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|53013_53739_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54017_54407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54594_55500_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55547_55691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273385.1|55738_56542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007063.1|56569_57055_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	52.0	1.3e-40
WP_032126362.1|57092_57458_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|57403_57979_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007062.1|57942_58272_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.0	7.7e-08
WP_017377700.1|58388_58682_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
>prophage 2
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	152596	201593	3062326	transposase,protease	Bacillus_phage(50.0%)	57	NA	NA
WP_054300545.1|152596_153658_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|154052_154448_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|154469_154835_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154891_155056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|155045_155345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300544.1|155435_155882_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|156377_156944_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|156955_157741_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|158372_159296_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|159347_160343_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|160374_160869_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|160960_161218_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|161307_161730_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|162048_162765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|162808_163060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300543.1|163064_164501_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|164528_165971_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|166058_166397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|166481_167012_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|167072_169265_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|169307_169793_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|170062_170494_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036778324.1|170511_171342_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|171356_171500_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|171530_172415_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|172386_172608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|172781_173060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300542.1|173740_173977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|174002_174908_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556686.1|175338_176220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|176453_177029_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|176974_177340_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300541.1|177667_178447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126848.1|178980_179781_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016211858.1|179999_180758_+	ion transporter	NA	NA	NA	NA	NA
WP_016211859.1|180834_181122_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_075273327.1|181125_181701_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|181646_182012_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|182075_182348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300540.1|182615_182840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300539.1|183855_185199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|185491_186085_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|186053_186707_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|186884_187856_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|187878_188775_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|188933_189380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779493.1|189376_190018_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|190127_190706_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|191181_191619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|191943_193284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|193547_194942_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_054300538.1|196390_197458_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|197510_197933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|198173_198617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|198671_198929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|198906_199533_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|199610_201593_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
>prophage 3
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	217478	271377	3062326	tail,transposase,tRNA	Acinetobacter_phage(50.0%)	44	NA	NA
WP_016209854.1|217478_218465_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|218457_218700_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|218821_220366_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|220412_221699_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|221741_223136_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|223159_223339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|223335_223911_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|223856_224222_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210079.1|227227_227725_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|227895_228591_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|228693_230256_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|230571_232365_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|232450_232723_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|232728_233355_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|233341_234772_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|235104_236160_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|236128_236806_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|236795_237632_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|237791_238085_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|238191_238998_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|239302_240157_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_016210082.1|240311_241361_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_054300536.1|241411_242068_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|242085_243366_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|243639_245001_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_032126863.1|245400_245952_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016211802.1|251384_252656_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036778206.1|252712_253696_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|253692_254478_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_032126362.1|255174_255540_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|255485_256061_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300535.1|256064_256784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|256928_257129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|257176_257638_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|258061_259543_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|259605_260715_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|260812_262774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|263303_263708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|263760_264822_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046934.1|265185_265356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|265729_266812_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_105962623.1|268314_269467_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046935.1|269509_269932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270224_271377_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 4
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	434911	547163	3062326	protease,transposase,tRNA	Escherichia_phage(32.14%)	105	NA	NA
WP_054300513.1|434911_435775_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|435991_437551_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|437572_438607_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|438655_439225_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|439360_440332_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|440343_441921_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|441986_442973_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054300512.1|443304_444414_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|444519_445704_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|445781_447770_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|447978_448134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|448391_448691_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300510.1|448961_449144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|449200_449566_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|450482_451889_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|451906_452893_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|452895_454050_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|454046_454742_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|454876_456367_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|456387_457437_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|457503_458898_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|459776_461708_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|461712_462243_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|462277_462472_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|462514_462874_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|463293_464289_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_036777440.1|464301_466683_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|466688_466976_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|467247_467724_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|467868_468066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|468190_469165_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|470065_470164_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300507.1|470648_471938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|472174_472867_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|472908_473682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|473683_474625_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|474757_476335_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|476544_478302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|478850_479609_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|479816_480389_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|480492_481041_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|481342_481588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|481616_481913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|482180_483104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300506.1|483582_483990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|484061_484790_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126799.1|484870_485683_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_129556452.1|486803_487151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|487153_488893_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046941.1|489294_489558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300500.1|490229_490958_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_054300502.1|490987_491665_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.8	2.9e-09
WP_016212477.1|491837_492083_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_032126794.1|492079_492472_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_054300501.1|492483_493212_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_016212066.1|493572_494349_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016212069.1|494560_494728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212070.1|494702_495302_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_054300500.1|495711_496440_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_017375910.1|496968_497697_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|498595_499324_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211714.1|499398_502743_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|503359_504088_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155046942.1|505020_505907_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|506292_507021_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016212268.1|507177_507762_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|507765_508449_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|508930_509659_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211759.1|509990_511178_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016211756.1|511423_512149_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_032126312.1|512327_513122_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_129556590.1|513118_513514_-	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_129556490.1|514197_515083_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046943.1|516853_516994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275117.1|517026_517449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211905.1|517692_518103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|518433_519009_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|518954_519320_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300493.1|519381_519594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300492.1|519752_520763_-	protein kinase	NA	NA	NA	NA	NA
WP_016210676.1|521066_523148_-	kinase domain protein	NA	NA	NA	NA	NA
WP_016210671.1|523603_524863_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_036778297.1|524995_525469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210672.1|525477_526860_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_016210677.1|526852_527467_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_016210675.1|527546_528263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210679.1|528430_530755_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.9	2.0e-17
WP_054300491.1|531430_533191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126421.1|533394_534486_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210055.1|534753_535392_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016210070.1|535430_535703_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_032126423.1|535796_536060_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210060.1|536056_536359_-	YciI family protein	NA	NA	NA	NA	NA
WP_016210053.1|536442_536985_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|537146_537773_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_036778098.1|537778_538618_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.3	1.4e-08
WP_016210061.1|538607_539252_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.8e-19
WP_032126424.1|539264_540089_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_016210057.1|540097_540607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210065.1|540747_541407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210075.1|541660_542752_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_016210064.1|542748_544113_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_016210052.1|544237_545434_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
WP_032126425.1|545454_546051_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210066.1|546494_547163_-|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
>prophage 5
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	555637	602527	3062326	transposase,integrase	Escherichia_phage(27.27%)	43	560077:560136	572065:572352
WP_032126790.1|555637_556543_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211874.1|556586_558305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046945.1|558623_559697_-	hypothetical protein	NA	NA	NA	NA	NA
560077:560136	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_016212522.1|560247_560502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300489.1|560598_561201_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_155046946.1|561203_561479_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032126389.1|562880_563069_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212230.1|564602_566051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|566106_567260_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_081007057.1|567317_567734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007056.1|569058_569268_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375841.1|569569_569779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|570085_570304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776735.1|570300_570753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212294.1|570766_571111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046947.1|571540_571708_+	phosphatase	NA	NA	NA	NA	NA
WP_016212659.1|571845_572091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|572235_572385_-	hypothetical protein	NA	NA	NA	NA	NA
572065:572352	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACG	NA	NA	NA	NA
WP_054300484.1|572609_573557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300483.1|574053_574608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211322.1|575143_575734_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211325.1|575796_577317_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211323.1|577306_578404_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211722.1|579831_583134_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_036780093.1|583143_583965_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_054300201.1|584068_584797_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_054300482.1|584826_586116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007054.1|586631_587864_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_080664881.1|588026_588233_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300481.1|588322_589051_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_081007053.1|589152_590013_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_016210616.1|590247_593058_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_016210625.1|593306_594053_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_129556587.1|594111_595014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|595113_595479_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|595424_596000_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_051307334.1|596016_596796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210618.1|597062_598112_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_016210617.1|598176_599601_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_036777984.1|599821_600271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210624.1|600289_600529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|600574_601045_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_075273327.1|601951_602527_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	618621	651808	3062326	transposase,tRNA	Escherichia_phage(57.14%)	34	NA	NA
WP_054300202.1|618621_619350_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_036780855.1|619961_620459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212214.1|620433_620934_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054300202.1|621092_621821_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019359.1|621965_622163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300478.1|622324_624061_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_054300477.1|624340_625069_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211623.1|625791_627432_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_036779883.1|627544_628894_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211625.1|628890_629760_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_054300475.1|630243_630972_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016212196.1|631380_631626_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016212195.1|631622_632009_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212193.1|632076_632415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|632537_633266_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211949.1|633405_634656_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_016211951.1|634689_635787_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_054300202.1|635963_636692_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_032126570.1|636908_637208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211816.1|637220_637574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|637615_639229_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_054300202.1|639434_640163_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|640650_641262_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_036779399.1|641618_641873_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|641971_643756_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779389.1|643844_644564_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|644746_644953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210948.1|644952_645189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|645201_645579_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|646085_646904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210947.1|646997_647195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|647289_648675_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|648801_649392_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_054300202.1|651079_651808_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 7
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	730205	784886	3062326	transposase,tRNA	Agrobacterium_phage(14.29%)	50	NA	NA
WP_081007050.1|730205_730733_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|730789_731155_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211061.1|731216_731570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211058.1|731690_732224_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_032126660.1|732362_734000_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.2	5.8e-88
WP_016211065.1|734004_734226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211066.1|734323_735337_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_016211063.1|735499_737728_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
WP_032126658.1|737708_738413_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|738647_738977_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_054300464.1|740057_741119_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126663.1|741145_741388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126664.1|742106_742790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212048.1|742983_743541_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_054300173.1|744304_745366_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664847.1|745438_746392_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300463.1|746892_749622_+	kinase	NA	NA	NA	NA	NA
WP_016210879.1|749724_750084_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210871.1|750080_750398_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210872.1|750414_751524_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210882.1|751550_752636_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210874.1|752758_753799_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210873.1|753813_754464_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210876.1|754531_755374_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_054300462.1|755839_756757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|757775_757970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036794860.1|758046_758340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|758607_759525_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_016211373.1|760075_760222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211374.1|760276_761467_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211370.1|761599_762043_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211369.1|762085_763129_-	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211368.1|763175_764567_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211371.1|764763_765687_+	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211372.1|765673_766531_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016212287.1|772342_773488_-|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_054300173.1|773566_774628_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211408.1|774851_776198_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_016211412.1|776312_777305_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211411.1|777308_777806_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211407.1|777802_778642_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_051307356.1|778674_780207_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_032126774.1|780366_780702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080728364.1|781598_781871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|782023_782389_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|782334_782910_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300461.1|783001_783310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075278609.1|783374_783731_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212572.1|783860_784253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|784310_784886_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	841859	873622	3062326	transposase,tRNA	Catovirus(20.0%)	32	NA	NA
WP_016211428.1|841859_843923_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
WP_054300173.1|844193_845255_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300457.1|845415_846705_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300148.1|846892_847954_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273329.1|848001_849303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300455.1|849263_849629_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|849643_850150_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300454.1|850139_850490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|850591_850957_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|850902_851478_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046950.1|851467_851722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300452.1|851771_852833_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210196.1|852790_853144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779341.1|853497_855708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|855708_856395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210198.1|856706_857258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|857274_857676_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210190.1|857866_858742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126472.1|858961_859612_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_036778866.1|860074_862663_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.9	3.3e-122
WP_016210199.1|862768_863530_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_016210206.1|863526_864063_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210205.1|864111_865068_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210187.1|865148_868334_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210201.1|868337_869393_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_036778872.1|869622_870228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778869.1|870271_870934_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_016210194.1|870968_871316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|871372_871534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126473.1|871514_871697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210192.1|871905_872424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|872736_873622_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	879542	925349	3062326	transposase	Staphylococcus_phage(41.67%)	43	NA	NA
WP_081007004.1|879542_879998_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|879957_880296_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300449.1|880425_881205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|881224_882199_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_054300448.1|882242_884612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|884801_885863_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300447.1|886275_888912_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_080664849.1|888960_890049_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016210997.1|890048_890732_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_032126469.1|890791_892453_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210998.1|892606_892861_+	LapA family protein	NA	NA	NA	NA	NA
WP_016211001.1|892938_893244_+	competence protein ComEA	NA	NA	NA	NA	NA
WP_016211002.1|893407_893806_+	VOC family protein	NA	NA	NA	NA	NA
WP_155046951.1|893887_894151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781250.1|894957_895743_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300446.1|895838_896573_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	1.1e-09
WP_016210826.1|898003_898870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210824.1|898979_900659_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210830.1|900785_902036_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_032126465.1|902111_902573_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210835.1|902569_903718_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_016210836.1|903723_904398_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_052133275.1|904427_905051_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210828.1|905166_905640_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_016210832.1|905641_906064_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210829.1|906050_907070_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_054300445.1|907339_907891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|907985_909047_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212318.1|909575_910007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|910008_910335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781320.1|910321_910549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|911395_912841_-	MFS transporter	NA	NA	NA	NA	NA
WP_016212205.1|912980_913160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046952.1|914845_915007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|915179_915353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|916348_917410_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|917367_917616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300443.1|917668_917947_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211538.1|918185_919109_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_155083637.1|919818_921900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300441.1|922181_922544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300440.1|922688_923900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|924196_925349_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 10
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	960748	997846	3062326	protease,transposase,tRNA	Bacillus_phage(33.33%)	35	NA	NA
WP_026063519.1|960748_961165_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300357.1|961213_962089_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|962639_963224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212526.1|964555_965089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273603.1|965212_965389_-	phosphatase	NA	NA	NA	NA	NA
WP_105962625.1|965468_966354_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126745.1|967535_968138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122940402.1|968346_968970_+	porin family protein	NA	NA	NA	NA	NA
WP_016209896.1|969284_969854_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016209891.1|970000_970699_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_036777115.1|970840_971041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209884.1|971117_971741_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052104600.1|971850_972744_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209898.1|972850_974461_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_016209888.1|974457_975753_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209876.1|975774_977697_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209881.1|977807_978110_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209893.1|978202_983092_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_052104599.1|983146_984463_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.1	3.2e-65
WP_036777110.1|984587_985682_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_016209878.1|985733_986672_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_080664826.1|986752_987352_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209877.1|987518_988409_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_016209887.1|988611_989103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209894.1|989246_989738_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|989906_990620_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556650.1|991048_992023_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_054300433.1|992352_992583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007045.1|992882_993512_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211960.1|993833_994361_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_054300573.1|994624_995758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|995785_996367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|996936_997122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300431.1|997266_997569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007044.1|997528_997846_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	1000968	1044893	3062326	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_129556499.1|1000968_1002122_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_155046705.1|1002227_1002395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|1002340_1002916_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|1002956_1003565_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032126790.1|1003733_1004639_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556560.1|1004608_1005145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556559.1|1005225_1005654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212093.1|1005810_1006740_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_075273313.1|1006952_1007291_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1007250_1007706_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212654.1|1007697_1007982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212100.1|1008392_1009313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212098.1|1009313_1010165_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1010885_1011932_+	glutathione synthase	NA	NA	NA	NA	NA
WP_032126840.1|1011915_1013913_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_122941967.1|1014091_1014397_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|1014626_1014833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|1015093_1015795_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046955.1|1016036_1016216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046956.1|1016737_1016902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300430.1|1017371_1020128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|1020363_1021656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300429.1|1021709_1021970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300428.1|1022270_1022834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211709.1|1022978_1023125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|1025384_1027421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007043.1|1028144_1029887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300426.1|1029846_1031481_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|1031493_1032537_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|1032515_1032977_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_016211081.1|1033017_1033953_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211087.1|1033980_1034976_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_054300425.1|1035183_1036146_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126778.1|1036324_1036519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046957.1|1036733_1037585_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_052047048.1|1037640_1038141_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212611.1|1038237_1038558_+	histidine kinase	NA	NA	NA	NA	NA
WP_054300423.1|1038605_1039667_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212519.1|1039741_1040122_+	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300422.1|1040392_1040830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300421.1|1040880_1041726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274673.1|1041703_1042702_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1042662_1043028_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046958.1|1042973_1043534_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300417.1|1043918_1044893_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 12
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	1057562	1122451	3062326	transposase,tRNA	Bacillus_phage(30.0%)	58	NA	NA
WP_016210280.1|1057562_1058657_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_016210284.1|1058738_1059260_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210276.1|1059314_1059791_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210275.1|1059846_1060149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210273.1|1060213_1060921_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210274.1|1061293_1061692_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_032126334.1|1061731_1062163_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210271.1|1062173_1062857_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1062923_1065119_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_129556492.1|1065216_1065960_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210283.1|1065987_1066773_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_016210272.1|1066812_1067523_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210279.1|1067510_1068677_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210277.1|1068730_1069564_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210270.1|1069633_1072621_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210281.1|1072662_1074054_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_075273303.1|1074067_1074784_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016211367.1|1074939_1075722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126330.1|1075869_1076829_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_036779263.1|1076883_1078893_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_016211366.1|1078948_1079236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126332.1|1079488_1080688_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_155083639.1|1081334_1082220_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126540.1|1082353_1083217_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1083447_1083741_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556495.1|1084721_1084979_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211589.1|1085101_1086334_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_016211592.1|1086323_1086986_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_129556496.1|1087260_1088499_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_032126329.1|1088684_1089314_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211588.1|1089389_1090091_+	cyclase family protein	NA	NA	NA	NA	NA
WP_129556499.1|1090258_1091411_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016212343.1|1091650_1092457_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_016209806.1|1093269_1093419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209808.1|1093761_1094130_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016209824.1|1094126_1094945_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209813.1|1095045_1095861_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_016209801.1|1096145_1098200_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_032126324.1|1098199_1098622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209805.1|1098800_1100294_-	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_016209818.1|1100426_1101242_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209799.1|1101337_1101754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209815.1|1102140_1102680_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_054300409.1|1102997_1104710_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	4.3e-25
WP_016209812.1|1105156_1106980_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_016209821.1|1107069_1107402_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209800.1|1107432_1108029_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_036777933.1|1108025_1109150_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_016209822.1|1109285_1109933_+	methyltransferase domain protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_016209810.1|1109989_1111903_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209803.1|1112107_1113145_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209820.1|1113203_1116503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|1117204_1118173_-	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209809.1|1118279_1118768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209823.1|1119192_1119636_+	response regulator	NA	NA	NA	NA	NA
WP_075273327.1|1120857_1121433_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1121378_1121744_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300408.1|1121794_1122451_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
>prophage 13
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	1130989	1196801	3062326	transposase,tRNA	uncultured_Mediterranean_phage(28.57%)	52	NA	NA
WP_155046942.1|1130989_1131875_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273597.1|1131865_1133710_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|1133981_1134956_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556498.1|1135135_1135744_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036778626.1|1135740_1137681_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_016210594.1|1137816_1138470_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210595.1|1138646_1139825_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210588.1|1140192_1141518_+	fimV domain protein	NA	NA	NA	NA	NA
WP_032126176.1|1141608_1142391_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210587.1|1142492_1143353_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_016210590.1|1143527_1144790_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210593.1|1144869_1145400_+	colicin V production protein	NA	NA	NA	NA	NA
WP_016210586.1|1145421_1146927_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210592.1|1146939_1147596_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016212005.1|1147985_1149746_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_105962623.1|1150646_1151799_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126856.1|1152104_1152446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1152506_1153568_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300406.1|1153868_1156604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|1158903_1159719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273595.1|1160127_1161498_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.6e-12
WP_054300405.1|1161553_1162054_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209947.1|1162575_1163238_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_036777555.1|1163264_1164494_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209940.1|1164650_1167422_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_052104625.1|1167497_1167941_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209931.1|1168093_1169566_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209926.1|1169677_1170739_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209945.1|1170735_1171770_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209932.1|1171772_1172813_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_036777579.1|1172995_1174111_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209930.1|1174149_1174503_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777561.1|1174523_1176392_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209935.1|1176413_1177358_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_016209925.1|1177591_1177870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1178079_1178718_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209944.1|1178692_1180120_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209927.1|1180320_1180998_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209939.1|1181132_1182407_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209943.1|1182474_1183230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209948.1|1183281_1184199_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_054300404.1|1184307_1185201_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075273594.1|1185273_1186644_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300403.1|1186683_1187658_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.0e-27
WP_016211771.1|1187950_1188139_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_016211770.1|1188152_1189286_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_054300402.1|1189485_1193631_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211823.1|1193665_1193854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300401.1|1194233_1194515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1194846_1195200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1195413_1195608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1196273_1196801_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	1250223	1297256	3062326	transposase	Bacillus_phage(50.0%)	33	NA	NA
WP_032126790.1|1250223_1251129_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_054300386.1|1252652_1253390_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_032126789.1|1258666_1258849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273583.1|1259393_1259675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155083641.1|1266662_1266818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|1268415_1268598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273583.1|1269141_1269423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1269754_1270660_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1270888_1272160_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_054300386.1|1272184_1272922_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1273174_1274317_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1274333_1275935_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1276446_1276584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1276580_1277858_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1278207_1278390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273583.1|1278936_1279218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1279549_1280455_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1280683_1281955_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_054300386.1|1281979_1282717_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1282969_1284112_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1284128_1285730_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1286241_1286379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1286375_1287653_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1288002_1288185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273583.1|1288731_1289013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126846.1|1289187_1289793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212251.1|1289954_1290491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300384.1|1290652_1291468_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273581.1|1291876_1293244_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.6e-11
WP_052133287.1|1293299_1293698_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212039.1|1293886_1294444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212040.1|1294620_1295970_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_054300162.1|1296173_1297256_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 15
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	1304012	1359603	3062326	transposase,tRNA	Vibrio_phage(18.18%)	51	NA	NA
WP_032126139.1|1304012_1304942_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_054300383.1|1305037_1307518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300382.1|1307788_1308211_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300380.1|1308481_1309138_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1309341_1309707_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|1309721_1310228_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211414.1|1310443_1311262_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|1311369_1311831_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211415.1|1311847_1312771_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211417.1|1312794_1313844_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_051307357.1|1313980_1314574_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211422.1|1314596_1315067_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032126143.1|1315155_1316427_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_054300250.1|1316526_1317186_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_075273327.1|1317175_1317751_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1317696_1318062_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211838.1|1318771_1318945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211840.1|1319415_1319880_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211839.1|1320038_1321511_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211841.1|1321628_1322081_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|1322940_1324002_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1324304_1325387_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300381.1|1325397_1326045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300380.1|1326508_1327165_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962623.1|1327493_1328646_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016211470.1|1329248_1329902_+	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|1329961_1331947_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_032126343.1|1332077_1332890_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_032126344.1|1333010_1334099_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_016211467.1|1334101_1334668_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_081007013.1|1334742_1335042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1336460_1336826_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046961.1|1336993_1337398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032127044.1|1337517_1337718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212482.1|1337932_1338076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1338619_1339772_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_054300378.1|1339781_1341479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|1343334_1343883_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_075273576.1|1344010_1344739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1344798_1348296_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_016210514.1|1348353_1349607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210515.1|1349715_1350618_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210512.1|1350671_1351709_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210506.1|1351844_1353083_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210510.1|1353075_1353804_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_081007040.1|1353834_1354491_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211831.1|1354628_1356356_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|1356656_1357010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1357425_1357926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104776.1|1358556_1359024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1359027_1359603_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	1380389	1420847	3062326	protease,transposase,tRNA	Klosneuvirus(25.0%)	34	NA	NA
WP_016210928.1|1380389_1380695_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_054300375.1|1380909_1381110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728346.1|1381916_1382249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1382266_1383130_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556556.1|1383162_1383738_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1383683_1384049_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211651.1|1384282_1385818_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016211650.1|1385942_1387427_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211648.1|1388086_1388626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|1389829_1390036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126642.1|1390105_1390567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300374.1|1390602_1393173_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	5.1e-30
WP_016209840.1|1393280_1393766_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_016209844.1|1393938_1394979_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209835.1|1394956_1395439_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209848.1|1395435_1398030_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209832.1|1398336_1398600_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209831.1|1398878_1399577_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|1399796_1399991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209827.1|1400066_1401626_-	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_129556633.1|1401944_1402841_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|1403057_1404533_-	APC family permease	NA	NA	NA	NA	NA
WP_016209826.1|1405055_1406078_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209830.1|1406408_1407776_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209846.1|1408011_1408266_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126639.1|1408281_1409568_+	GTPase HflX	NA	NA	NA	NA	NA
WP_016209836.1|1409587_1410802_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_016209838.1|1410801_1411695_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209839.1|1411892_1413191_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209829.1|1414570_1416970_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209834.1|1416966_1417725_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209842.1|1417901_1418291_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_054300373.1|1419018_1419876_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|1419872_1420847_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 17
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	1448768	1574515	3062326	protease,transposase,tRNA,integrase	Staphylococcus_phage(16.0%)	114	1490075:1490134	1570531:1571496
WP_016211285.1|1448768_1449548_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211286.1|1449565_1449913_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211289.1|1450024_1450297_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211767.1|1451913_1452723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211764.1|1453273_1454095_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126803.1|1454295_1455528_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_032126804.1|1455650_1456526_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211806.1|1456690_1457416_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_081007037.1|1457458_1458997_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211804.1|1459003_1460389_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_036780332.1|1461083_1462427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1463066_1463750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273555.1|1464027_1464561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210332.1|1464691_1465435_-	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_016210330.1|1465532_1465916_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210333.1|1466119_1466749_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_032126607.1|1466822_1468106_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_054300368.1|1468445_1469744_+	ankryin	NA	NA	NA	NA	NA
WP_016210325.1|1469897_1471274_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210327.1|1471409_1472741_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_054300367.1|1472801_1473320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210321.1|1473368_1474337_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_129556511.1|1474533_1475970_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300568.1|1476152_1476863_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.3	4.1e-38
WP_054300366.1|1476883_1477297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210320.1|1477446_1478520_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_016210322.1|1478656_1479553_-	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016211334.1|1479882_1480071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211336.1|1480119_1480734_+	chorismate mutase	NA	NA	NA	NA	NA
WP_032126265.1|1480799_1481717_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_052104656.1|1482040_1482544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082827.1|1482620_1483922_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_016211330.1|1484096_1485197_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_032126267.1|1485832_1486075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300365.1|1486068_1486386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300364.1|1486495_1487374_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075273553.1|1487547_1488474_+	MFS transporter	NA	NA	NA	NA	NA
WP_155046964.1|1488463_1489039_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300363.1|1488984_1489332_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212589.1|1489755_1490193_+	MFS transporter	NA	NA	NA	NA	NA
1490075:1490134	attL	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAG	NA	NA	NA	NA
WP_129556637.1|1490667_1491447_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1490075:1490134	attL	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAG	NA	NA	NA	NA
WP_016210843.1|1492061_1492292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210844.1|1492378_1493506_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_129556513.1|1493681_1495427_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_032126340.1|1495507_1496269_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_155046965.1|1496548_1499005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1499156_1499930_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016210841.1|1499988_1500360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1500573_1501548_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211148.1|1501752_1503081_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1503344_1503914_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211151.1|1503929_1504241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1504250_1505207_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1505319_1505673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211153.1|1505676_1506741_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211145.1|1506741_1508481_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_036779218.1|1508487_1508910_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211144.1|1508893_1509523_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_054300271.1|1510079_1511054_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007035.1|1511093_1511759_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300361.1|1511736_1512033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273651.1|1512584_1513622_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300359.1|1513980_1514553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664876.1|1514776_1516639_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_081377865.1|1516997_1517282_+|transposase	transposase	transposase	NA	NA	NA	NA
1516735:1517024	attR	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_032126362.1|1518641_1519007_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1516735:1517024	attR	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_129556638.1|1519585_1520266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273551.1|1520265_1520568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211974.1|1520667_1521789_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_054300357.1|1522071_1522947_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212011.1|1523180_1524302_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_016212013.1|1524523_1524907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|1524922_1525600_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300276.1|1525643_1526618_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016211994.1|1528095_1528632_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_032126537.1|1528668_1528854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211991.1|1529094_1530000_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126538.1|1530908_1532327_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_081007034.1|1532591_1532876_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_080728343.1|1532857_1532998_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_052104693.1|1533079_1536946_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_016211564.1|1537111_1537987_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211563.1|1538019_1538181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300355.1|1538391_1538577_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|1538566_1539142_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1539087_1539453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046966.1|1539413_1539794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1539866_1540841_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046967.1|1540979_1541594_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	40.1	1.5e-33
WP_054300353.1|1541644_1541872_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300565.1|1547898_1548399_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_016210112.1|1549092_1550520_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_122943012.1|1550636_1551092_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210108.1|1551277_1552543_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_016210114.1|1552635_1553895_+	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210107.1|1553966_1554239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210101.1|1554528_1556025_-	flagellin domain protein	NA	NA	NA	NA	NA
WP_016210113.1|1557655_1558705_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210110.1|1558892_1559648_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_036777611.1|1559708_1561298_-	APC family permease	NA	NA	NA	NA	NA
WP_016210106.1|1561480_1562572_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210105.1|1562591_1562912_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210099.1|1562995_1564273_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_017377579.1|1564294_1565131_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210111.1|1565137_1566772_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_054300275.1|1567076_1567952_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210117.1|1568187_1568547_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210103.1|1568828_1570187_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_075273327.1|1570539_1571115_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1571060_1571426_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046968.1|1571934_1573087_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.4	2.2e-57
WP_155066176.1|1573096_1573366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1573628_1573994_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1573939_1574515_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	1579364	1627721	3062326	transposase,tRNA	Staphylococcus_phage(20.0%)	40	NA	NA
WP_105962623.1|1579364_1580517_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046942.1|1580902_1581789_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300349.1|1582940_1584665_-	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_032126825.1|1585216_1586530_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_016211481.1|1586762_1587905_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_098082850.1|1587979_1588156_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_052104609.1|1588191_1588824_-	MarC family protein	NA	NA	NA	NA	NA
WP_032126823.1|1588934_1589657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211482.1|1589645_1591919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1592054_1592393_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1592352_1592808_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212267.1|1592974_1593334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1593614_1594262_+	LysE family translocator	NA	NA	NA	NA	NA
WP_155046730.1|1594529_1594670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300161.1|1594888_1595950_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211733.1|1596564_1597389_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_054300347.1|1597444_1598836_-	protein kinase	NA	NA	NA	NA	NA
WP_016211732.1|1599257_1599956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126682.1|1600272_1600599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211399.1|1600706_1601450_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211403.1|1601463_1602507_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211405.1|1602642_1604415_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_129556522.1|1604621_1605854_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_054300271.1|1607164_1608139_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211669.1|1608963_1609314_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211666.1|1609468_1612288_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211664.1|1612660_1613389_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211555.1|1613639_1614998_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_032126677.1|1615072_1615636_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211557.1|1615830_1617060_-	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_016211554.1|1617105_1617732_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_032126678.1|1618058_1619069_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_054300346.1|1619079_1619955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1620101_1621184_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300345.1|1621265_1622345_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1622481_1622847_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1622792_1623368_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1624058_1625033_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1625587_1626649_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1626746_1627721_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 19
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	1656266	1700656	3062326	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_105962625.1|1656266_1657152_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300343.1|1657156_1657384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007030.1|1657419_1658391_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307341.1|1659084_1660683_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_016210848.1|1660849_1662034_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1662617_1663172_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210850.1|1663420_1664674_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210851.1|1664658_1665330_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210847.1|1665352_1666357_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210849.1|1666385_1667834_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210855.1|1667951_1668929_+	DMT family transporter	NA	NA	NA	NA	NA
WP_155046969.1|1669082_1669899_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1669919_1670894_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273543.1|1670933_1671176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776661.1|1672160_1672490_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_032126448.1|1672521_1672902_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211178.1|1672992_1674021_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016211180.1|1674083_1674548_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_032126449.1|1674568_1675492_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_081007029.1|1675558_1676167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776658.1|1676279_1678274_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211177.1|1678665_1679886_+	amino acid permease	NA	NA	NA	NA	NA
WP_155046970.1|1681310_1681559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046971.1|1681636_1682182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126783.1|1682292_1683534_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211741.1|1683679_1684456_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126790.1|1685619_1686525_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1687514_1687853_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1687812_1688268_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126602.1|1688420_1689728_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211857.1|1689978_1690857_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016211855.1|1690853_1691321_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|1691447_1691633_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_054300339.1|1691848_1692820_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.2e-25
WP_129556640.1|1693377_1694604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211351.1|1694679_1695018_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_032127067.1|1695014_1695617_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211349.1|1695613_1697608_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211350.1|1697671_1698610_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211352.1|1699288_1699729_+	universal stress protein	NA	NA	NA	NA	NA
WP_075273313.1|1699902_1700241_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007028.1|1700200_1700656_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	1710956	1765665	3062326	transposase	Cedratvirus(16.67%)	48	NA	NA
WP_036779544.1|1710956_1711964_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1711963_1712221_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046972.1|1712480_1713071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300334.1|1714594_1715083_-	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_051307365.1|1715102_1715363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211834.1|1715620_1715935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|1719308_1720298_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1720631_1720817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046973.1|1721173_1721332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1721498_1723454_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016210749.1|1723752_1724214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210752.1|1724383_1725181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556641.1|1727557_1728820_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016211454.1|1732774_1733245_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_016211452.1|1733995_1735483_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211455.1|1735544_1737002_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_122942091.1|1737107_1737503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1737530_1738109_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_054300330.1|1738730_1739792_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274658.1|1739841_1741047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046974.1|1741198_1741360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300328.1|1741470_1742247_+	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_016212459.1|1742384_1742765_-	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_155046975.1|1742884_1743334_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_054300326.1|1743747_1744212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1744313_1744586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273534.1|1744779_1745661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|1746023_1747049_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300323.1|1747292_1747886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300322.1|1748273_1750208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1750246_1751161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1752731_1752998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1753074_1753731_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212446.1|1753765_1754527_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.1	1.2e-48
WP_016212445.1|1754889_1755156_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1755401_1755857_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1755816_1756155_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556531.1|1756117_1756315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211752.1|1756519_1757665_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211748.1|1757680_1759285_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211749.1|1759364_1760558_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_032126540.1|1760766_1761630_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212346.1|1761863_1762010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049135.1|1762234_1762381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300321.1|1762804_1763176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300320.1|1763393_1763993_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047087.1|1763970_1764189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|1764639_1765665_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	1778806	1843658	3062326	transposase,tRNA	Escherichia_phage(33.33%)	52	NA	NA
WP_016209621.1|1778806_1779811_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209617.1|1779931_1780330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209627.1|1780369_1782193_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_033923701.1|1782189_1785492_+	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209616.1|1785522_1786437_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016209618.1|1786507_1787137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|1787181_1787616_-	lipoprotein	NA	NA	NA	NA	NA
WP_016209630.1|1787596_1788337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|1788350_1789748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|1789750_1792699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|1792698_1794420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209636.1|1794434_1794839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209631.1|1794839_1797713_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075273639.1|1797715_1798432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|1798799_1800692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777073.1|1800723_1803261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209622.1|1803292_1804456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209624.1|1804461_1805073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209623.1|1805094_1806594_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209615.1|1806610_1807117_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_054300202.1|1808384_1809113_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_081007021.1|1809105_1809672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126786.1|1809970_1813051_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016211319.1|1813068_1814121_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211316.1|1814653_1815304_+	porin family protein	NA	NA	NA	NA	NA
WP_016211315.1|1815638_1816283_+	porin family protein	NA	NA	NA	NA	NA
WP_054300314.1|1816470_1816806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273532.1|1816766_1817354_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126997.1|1817571_1817811_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_032126998.1|1818132_1818480_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_036774554.1|1818578_1818857_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1818909_1819197_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1819200_1820087_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923708.1|1822549_1823425_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211346.1|1823956_1824598_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_016211340.1|1824625_1824847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211347.1|1824839_1825823_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211344.1|1826036_1826855_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_054300313.1|1827015_1828698_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	1.6e-32
WP_054300312.1|1828705_1829728_-	YHYH protein	NA	NA	NA	NA	NA
WP_016211341.1|1829926_1830097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1830241_1831216_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211940.1|1831329_1831662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1831782_1833042_-	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_054300310.1|1834843_1835368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211210.1|1835470_1836952_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_052104715.1|1836958_1837165_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211211.1|1837213_1838293_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211215.1|1838484_1840455_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_054300309.1|1840815_1842375_+	APC family permease	NA	NA	NA	NA	NA
WP_054300308.1|1842669_1842900_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300307.1|1842929_1843658_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
>prophage 22
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	1851281	1970202	3062326	transposase	Staphylococcus_phage(14.29%)	108	NA	NA
WP_033923708.1|1851281_1852157_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212202.1|1852568_1853816_+	glutaminase	NA	NA	NA	NA	NA
WP_016209473.1|1854777_1855161_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_016209489.1|1855157_1855889_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_016209497.1|1855891_1856635_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_016209492.1|1856648_1857548_-	GTPase Era	NA	NA	NA	NA	NA
WP_016209466.1|1857553_1858228_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	34.5	8.9e-27
WP_129556644.1|1858633_1859521_-	signal peptidase I	NA	NA	NA	NA	NA
WP_016209482.1|1859571_1861374_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	39.2	5.1e-21
WP_016209457.1|1861673_1862255_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_016209458.1|1862398_1863973_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_155046977.1|1863980_1864301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209486.1|1864419_1864671_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_080664819.1|1864712_1865750_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_016209471.1|1865896_1866223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209462.1|1866232_1866376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209474.1|1866385_1866796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664818.1|1866937_1867273_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_054300303.1|1867954_1869979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209467.1|1870048_1871074_-	FUSC family protein	NA	NA	NA	NA	NA
WP_016209455.1|1871066_1872113_-	membrane protein	NA	NA	NA	NA	NA
WP_075273528.1|1872293_1873259_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_016209459.1|1873518_1874685_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016209478.1|1874848_1875802_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036776213.1|1875824_1877843_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_016209490.1|1877933_1878257_-	YqcC family protein	NA	NA	NA	NA	NA
WP_016209463.1|1878683_1879067_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032126730.1|1879421_1879910_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_016209472.1|1880012_1881383_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_016209456.1|1881496_1882228_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	M1IDP9	Pelagibacter_phage	35.8	5.3e-09
WP_016209491.1|1882252_1883350_-	alanine racemase	NA	NA	NA	NA	NA
WP_016209475.1|1883382_1884804_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	1.7e-152
WP_016209484.1|1885013_1885466_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|1885477_1885705_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_016209481.1|1885754_1886081_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_052104552.1|1886283_1886973_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016209488.1|1887122_1887611_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_155046978.1|1887651_1888755_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_016209460.1|1888798_1889881_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.1	1.0e-72
WP_075274651.1|1889870_1890437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007071.1|1890427_1891783_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209485.1|1891784_1892807_-	chorismate mutase	NA	NA	NA	NA	NA
WP_080664817.1|1892831_1893605_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209496.1|1893634_1893847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046979.1|1894252_1896532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1896561_1897425_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300189.1|1897558_1897924_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1897980_1898145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046980.1|1898134_1898434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046981.1|1898423_1898600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300299.1|1898689_1899772_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|1901973_1903524_-	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_075273524.1|1903679_1904645_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1904685_1905660_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_098082828.1|1906024_1906282_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1906281_1907289_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212247.1|1907655_1908411_+	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1909038_1910013_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300162.1|1910352_1911435_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212246.1|1911538_1912195_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300297.1|1913130_1914198_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1914260_1915343_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210771.1|1915434_1918836_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_016210773.1|1918832_1921526_-	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210769.1|1921829_1923332_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_033923762.1|1923632_1923866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1923993_1924803_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_016210772.1|1924886_1926440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210397.1|1927648_1929823_+	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210388.1|1929819_1930494_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210399.1|1930519_1932511_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210390.1|1932525_1932867_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_032126670.1|1932871_1933309_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210394.1|1933334_1934720_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_122940572.1|1934830_1935256_-	flaG family protein	NA	NA	NA	NA	NA
WP_032126669.1|1935367_1936945_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210398.1|1937169_1938762_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210393.1|1939250_1941452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778065.1|1941545_1942979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1943021_1943537_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211169.1|1943536_1944484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211168.1|1944467_1945127_-	wbqC-like family protein	NA	NA	NA	NA	NA
WP_036778066.1|1945123_1945852_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307350.1|1945841_1946588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664856.1|1946571_1947636_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_016211172.1|1947824_1949021_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_036778145.1|1949070_1950192_-	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	8.7e-11
WP_036781047.1|1950804_1951662_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_054300295.1|1951942_1952167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556646.1|1952977_1954363_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_016211278.1|1954414_1955674_-	threonine synthase	NA	NA	NA	NA	NA
WP_016211277.1|1955660_1956629_-	homoserine kinase	NA	NA	NA	NA	NA
WP_016211279.1|1956642_1959111_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_054300294.1|1959854_1960916_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300293.1|1961187_1961553_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1961609_1961774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|1961763_1961937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|1961909_1962062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300292.1|1962517_1963519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779544.1|1963773_1964781_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1964780_1965038_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007015.1|1965249_1965675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1966167_1967320_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_054300288.1|1967329_1968019_-	hypothetical protein	NA	A0A0N7AE80	Bacillus_phage	28.2	3.2e-08
WP_054300287.1|1968427_1968757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1968778_1969144_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1969089_1969665_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300285.1|1969665_1970202_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	2036237	2091152	3062326	protease,transposase,tRNA	Orpheovirus(16.67%)	56	NA	NA
WP_016209434.1|2036237_2037659_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_129556553.1|2037748_2039341_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_016209439.1|2039504_2040131_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_054300277.1|2040211_2042893_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_016209445.1|2043375_2044332_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_016209435.1|2044432_2044804_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_016209404.1|2044830_2045694_+	chemotaxis phosphatase CheX family protein	NA	NA	NA	NA	NA
WP_016209416.1|2045683_2046469_-	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209413.1|2046757_2047243_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_016209443.1|2047317_2047839_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016209405.1|2047884_2048778_-	cheW-like domain protein	NA	NA	NA	NA	NA
WP_016209406.1|2048774_2049596_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.2	5.0e-16
WP_016209408.1|2049910_2050081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209427.1|2050234_2051638_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_052047073.1|2051731_2052982_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080664816.1|2052968_2053700_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_016209424.1|2053711_2054989_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209433.1|2055088_2055463_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209412.1|2055547_2056435_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209436.1|2056492_2057221_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_129556555.1|2057217_2058348_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209444.1|2058478_2058907_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_032126508.1|2059001_2059361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209447.1|2059350_2060562_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016209421.1|2060558_2061347_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209411.1|2061509_2062304_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_054300276.1|2062509_2063484_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_155049809.1|2063658_2064954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2064957_2065257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2065246_2065411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2065467_2065833_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211553.1|2066172_2066913_-	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_016211549.1|2066916_2069421_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211548.1|2069683_2070640_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211550.1|2070623_2071385_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_054300275.1|2071462_2072338_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2072462_2072708_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016211262.1|2072767_2075041_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_075273504.1|2075095_2075449_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|2075638_2075932_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_032126515.1|2076104_2076284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307354.1|2076359_2076935_-	DedA family protein	NA	NA	NA	NA	NA
WP_032126514.1|2077217_2078534_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2078544_2078913_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016211265.1|2078943_2079606_-	adenylate kinase	NA	NA	NA	NA	NA
WP_054300274.1|2079780_2080146_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2080091_2080667_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126519.1|2080834_2081554_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_016211478.1|2081533_2082349_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126518.1|2082365_2084567_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211474.1|2084649_2085999_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_016211473.1|2086073_2086673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211476.1|2086656_2086866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777061.1|2087183_2088371_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211932.1|2088566_2089856_+	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_129556478.1|2090266_2091152_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	2103688	2145502	3062326	transposase,tRNA	Moraxella_phage(16.67%)	39	NA	NA
WP_054300173.1|2103688_2104750_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776407.1|2104998_2106135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211446.1|2106318_2108046_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_016211448.1|2108035_2109244_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211450.1|2109342_2110365_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155047009.1|2111140_2111314_+	phosphatase	NA	NA	NA	NA	NA
WP_052104774.1|2111458_2112091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2112138_2113200_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126170.1|2113363_2113636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211040.1|2113863_2115075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211037.1|2115425_2116055_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211042.1|2116103_2117120_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211035.1|2117366_2117582_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211043.1|2117634_2118084_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211039.1|2118163_2119909_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211036.1|2120000_2121872_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_054300271.1|2122219_2123194_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273494.1|2123213_2123774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|2124838_2127319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2127393_2128299_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016210899.1|2128798_2130682_-	APC family permease	NA	NA	NA	NA	NA
WP_016210896.1|2130735_2131818_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210904.1|2131860_2132511_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210903.1|2132731_2133103_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_129556487.1|2133221_2134559_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_054300270.1|2134637_2135615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210894.1|2135955_2136258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210902.1|2136768_2137023_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210898.1|2137111_2137462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300269.1|2138373_2138742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2138763_2139129_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2139185_2139350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007012.1|2139339_2139510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|2139504_2140566_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273492.1|2140674_2140794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556486.1|2140884_2141232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556630.1|2141317_2142667_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211781.1|2142976_2144224_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_054300173.1|2144440_2145502_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	2166360	2293922	3062326	transposase,tRNA,protease,integrase	Staphylococcus_phage(12.5%)	118	2194553:2194612	2223781:2224370
WP_075273313.1|2166360_2166699_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|2166658_2166919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300264.1|2167063_2167402_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300263.1|2167389_2167830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2167901_2168876_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212461.1|2169251_2169626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2169629_2170205_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2170150_2170516_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051307332.1|2170724_2170931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300262.1|2170978_2171269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104721.1|2171260_2172967_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_051307331.1|2173038_2174817_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_016210552.1|2175171_2175738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210553.1|2175862_2176516_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_054300261.1|2176542_2177985_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210545.1|2178081_2179059_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_129556482.1|2179207_2179813_+	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_026063577.1|2179884_2180178_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556629.1|2180404_2181151_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_017376905.1|2181381_2181609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|2181673_2181856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|2182292_2182847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046716.1|2183544_2183691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046984.1|2184112_2185231_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047108.1|2186042_2186441_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273488.1|2186496_2187132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2187216_2187582_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2187527_2188103_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211578.1|2188172_2188517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|2188532_2188727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|2188793_2189147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300258.1|2189244_2190024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211585.1|2190085_2190643_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_075273486.1|2190877_2191852_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.2e-29
WP_054300257.1|2191828_2192638_-	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.6	1.8e-29
WP_016211583.1|2192914_2193823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211579.1|2193890_2194376_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
2194553:2194612	attL	TGTAAAACTCCAGATATGATCTGACAAGCTTAAATCATCTGACAACATTTGTCTGATTGA	NA	NA	NA	NA
WP_054300162.1|2194586_2195669_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781361.1|2195939_2196329_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_054300237.1|2196348_2197410_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046986.1|2197598_2198485_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212302.1|2198669_2198969_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_081007067.1|2199189_2204664_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_036780532.1|2205175_2206216_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_054300162.1|2206318_2207401_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781387.1|2207493_2207766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|2207758_2208037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126152.1|2208239_2208830_+|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016211531.1|2208893_2209574_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300254.1|2209927_2210824_+	Abi family protein	NA	A3QSC6	Clostridium_virus	31.6	6.9e-35
WP_016211534.1|2210829_2211339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300253.1|2211325_2212276_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	34.7	6.9e-09
WP_016211528.1|2214130_2214436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664862.1|2214416_2215115_-	P-loop NTPase	NA	NA	NA	NA	NA
WP_032126157.1|2215978_2216383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|2216669_2218562_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_036780074.1|2218904_2219711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307360.1|2220802_2221732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2221820_2222726_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046987.1|2223816_2224500_-|transposase	transposase	transposase	NA	NA	NA	NA
2223781:2224370	attR	TCAATCAGACAAATGTTGTCAGATGATTTAAGCTTGTCAGATCATATCTGGAGTTTTACACCTAAGCTCTTCAAAAGCTATTTGATTTGACCGCACAAGTAATTTATATTTGAGTGCAAAGTGGTTAAGTTGTGCTTTTACACTCAATGTTTCTAGTTTACAAAATGCCACGATTGATGCAAAAATATGATTGCATTGTGACCGAACAGTTTTAGTCGGTGATTTTGCTAAACTTGCATTTTGTTTAATCGACTTATGATATTCTTCAATTTTCCATCGTTTTTGATAGATTTTGTAAAGCCCATCACCATCCGTCTCTAAATCATTTGTTATTAAATAGAGGTGACCTGTTGACCCGTCTTCGTTTGTGAAGATCTTTTTCATTAATCGCACTGGGAAATTAATTCCCTGAAGATATACATCTATGGCCTCACTATCTTTTAAATCAAGAGATTTGACTGGCTGGTAATTTCTATTGATTTTATCATCTAAACTGCAAGCAACTGTTCGATTAGATTTTATTCCTAAAATAAACAACTTATTTAACTTGGCATGAATATAATTCATGTTTTCTTTTGAACTGAACCAGT	NA	NA	NA	NA
WP_155046988.1|2224515_2224884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372266.1|2225216_2225702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300251.1|2225791_2227306_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209659.1|2227432_2228461_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_016209654.1|2228525_2229668_+	galactokinase	NA	NA	NA	NA	NA
WP_016209656.1|2229786_2231490_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209642.1|2231486_2233607_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209652.1|2233603_2234953_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209662.1|2234924_2237072_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209657.1|2237499_2237895_+	CrcB family protein	NA	NA	NA	NA	NA
WP_016209643.1|2237903_2238788_-	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_075273480.1|2238819_2240718_-	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209655.1|2240800_2241073_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_032126161.1|2241176_2243609_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209663.1|2243676_2244978_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_016209647.1|2245059_2245665_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209645.1|2245777_2247082_-	trigger factor	NA	NA	NA	NA	NA
WP_016209661.1|2247685_2248561_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_075273478.1|2248676_2249348_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209658.1|2249524_2250880_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_016209641.1|2251000_2251738_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032126159.1|2251817_2252531_-	aldolase	NA	NA	NA	NA	NA
WP_016209651.1|2253176_2254451_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2254481_2255057_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209649.1|2255101_2256067_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209640.1|2256525_2257545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300250.1|2257963_2258623_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_129556449.1|2258612_2259119_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|2259133_2259499_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155083645.1|2259988_2260276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155083646.1|2260623_2260854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300248.1|2261283_2262258_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	3.1e-28
WP_155046989.1|2262350_2263415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|2263647_2264622_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_129556476.1|2264919_2265930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211684.1|2266474_2267050_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016211685.1|2267073_2268879_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211687.1|2268909_2269554_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_054300245.1|2269809_2270685_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556628.1|2270889_2271705_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.5e-32
WP_016210297.1|2271790_2273170_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_032126463.1|2273226_2274483_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_032126458.1|2274563_2276090_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_054300244.1|2276095_2277094_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_016210290.1|2277334_2278129_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210287.1|2278217_2279081_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_036777321.1|2279201_2280482_-	membrane protein	NA	NA	NA	NA	NA
WP_032126457.1|2281526_2281946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126460.1|2282853_2283291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210301.1|2283467_2284295_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_075273633.1|2284344_2284971_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_016210294.1|2285108_2285453_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_051307327.1|2285770_2286802_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.7e-35
WP_016210303.1|2287077_2287317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2287366_2288428_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210741.1|2289113_2289437_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_016210746.1|2289443_2293340_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_054300242.1|2293385_2293922_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 26
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	2300731	2423267	3062326	protease,transposase,tRNA	Staphylococcus_phage(23.53%)	109	NA	NA
WP_054300271.1|2300731_2301706_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212172.1|2301725_2303198_-	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|2303500_2304475_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300240.1|2304774_2304978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|2305234_2306119_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036777316.1|2306428_2306842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211818.1|2307198_2308455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|2308657_2309158_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_054300238.1|2309454_2309733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273458.1|2310005_2310221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|2310273_2311335_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2311361_2311937_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2311882_2312248_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300559.1|2312963_2313512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2314392_2314848_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273456.1|2314807_2315107_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300276.1|2315229_2316204_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016209398.1|2316786_2318013_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|2318611_2320318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007011.1|2320485_2321706_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209395.1|2321954_2324645_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_016209384.1|2324936_2325752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300234.1|2326102_2327044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300233.1|2327585_2329229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209368.1|2329804_2331334_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_054300232.1|2331369_2332821_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209366.1|2332795_2333755_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_016209365.1|2333832_2337339_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.5	4.9e-193
WP_032126583.1|2337362_2337932_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	42.9	5.7e-27
WP_054300231.1|2338144_2339299_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_016209377.1|2339317_2340091_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_016209390.1|2340090_2340528_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_016209391.1|2340554_2341604_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_016209381.1|2341655_2342189_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_129556472.1|2342269_2344663_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_051307309.1|2345001_2346042_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_016209394.1|2348244_2349309_+	GHMP kinase	NA	NA	NA	NA	NA
WP_016209364.1|2349298_2350327_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_016209393.1|2350323_2350863_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_016209400.1|2351407_2353369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300230.1|2353806_2355438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209397.1|2355558_2356434_-	bacterial lipid A biosynthesis acyltransferase family protein	NA	NA	NA	NA	NA
WP_016209379.1|2356521_2357328_-	cytidylyltransferase	NA	NA	NA	NA	NA
WP_032126580.1|2357335_2358073_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.5	7.2e-22
WP_016209396.1|2358089_2358647_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_016209399.1|2358650_2359388_-	UMP kinase	NA	NA	NA	NA	NA
WP_016209372.1|2359391_2360270_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_032126579.1|2360444_2361212_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_016209375.1|2361634_2362444_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_054300229.1|2362521_2365179_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_016209389.1|2365179_2366217_+	asparaginase	NA	NA	NA	NA	NA
WP_016209373.1|2366218_2367040_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_016209387.1|2367169_2368054_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2368191_2368767_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2368712_2369078_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300228.1|2369983_2371237_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_155046990.1|2371214_2371892_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046988.1|2371907_2372276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210612.1|2373561_2374812_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016210605.1|2374800_2375682_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210611.1|2375674_2376760_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210607.1|2376756_2378016_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210598.1|2378184_2378844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556471.1|2378985_2379657_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210609.1|2380016_2380952_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_016210606.1|2381048_2381675_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_054300226.1|2381680_2382262_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210601.1|2382333_2383425_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210599.1|2383507_2384221_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_122940948.1|2384314_2385019_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300148.1|2385341_2386403_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126800.1|2386527_2387262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046954.1|2387488_2387662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|2387768_2388188_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|2389150_2389396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|2389695_2390581_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300223.1|2390818_2391790_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_016209900.1|2391981_2393451_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209924.1|2393444_2394821_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209906.1|2394832_2395225_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209919.1|2395221_2396325_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_032126654.1|2396503_2397805_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209907.1|2397812_2398760_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_016209913.1|2398771_2399590_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_032126655.1|2399592_2400393_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209910.1|2400386_2401445_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_016209903.1|2401441_2402452_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|2402458_2402656_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_054300222.1|2402716_2405623_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209918.1|2405664_2406519_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_032126652.1|2406551_2407118_-	chorismate lyase	NA	NA	NA	NA	NA
WP_016209915.1|2407200_2408061_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016209922.1|2408152_2408569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300221.1|2408628_2409126_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_054300220.1|2409171_2412126_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209901.1|2412155_2412488_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209923.1|2412605_2413124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209908.1|2413598_2414309_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209899.1|2414305_2415340_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_032126651.1|2415443_2415629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2415749_2416115_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2416060_2416636_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212369.1|2416639_2417086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212599.1|2418320_2418530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2418579_2419641_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2419687_2420593_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2421385_2421724_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2421683_2422139_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2422292_2423267_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 27
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	2492100	2534542	3062326	transposase,tRNA	Synechococcus_phage(50.0%)	47	NA	NA
WP_081007066.1|2492100_2492439_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300215.1|2492433_2492928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|2493731_2494022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007010.1|2494071_2494692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210530.1|2495532_2496213_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_016210535.1|2496209_2497022_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_054300212.1|2497095_2500776_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_036776217.1|2500785_2502273_-	ribonuclease G	NA	NA	NA	NA	NA
WP_054300211.1|2502282_2502900_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016210528.1|2502969_2503488_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210536.1|2503484_2504384_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2504399_2505443_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210537.1|2505632_2505920_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210532.1|2506031_2507483_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_032126195.1|2507524_2508961_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_155046713.1|2509255_2509420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300210.1|2509557_2509746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007009.1|2509702_2509873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2509862_2510027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2510083_2510449_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212074.1|2510475_2510697_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_142396463.1|2510783_2510900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|2511010_2511211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212075.1|2511456_2511654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779278.1|2511767_2512721_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300148.1|2512840_2513902_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300208.1|2513879_2514671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|2514800_2515112_+	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_155046991.1|2515459_2515783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779281.1|2515807_2516263_-	arginine repressor	NA	NA	NA	NA	NA
WP_016211489.1|2516252_2517305_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211493.1|2517307_2518771_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211491.1|2519053_2519350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2519610_2520672_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210915.1|2520801_2521266_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_032126715.1|2521463_2522279_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210906.1|2522407_2524720_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_051307343.1|2524839_2525367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210909.1|2526059_2527337_+	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_016210914.1|2527342_2527594_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210913.1|2527627_2528149_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_032126716.1|2528319_2529303_-	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210908.1|2529393_2530209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2531420_2532482_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212580.1|2533217_2533568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2533655_2534021_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273438.1|2533966_2534542_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	2539038	2586591	3062326	transposase,integrase	Escherichia_phage(47.06%)	53	2548919:2548978	2561654:2561914
WP_054300202.1|2539038_2539767_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211244.1|2540168_2540864_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_016211242.1|2540817_2541786_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_129556456.1|2541829_2542579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211238.1|2542780_2544274_-	amino acid permease	NA	NA	NA	NA	NA
WP_129556626.1|2544716_2546105_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211235.1|2546534_2546972_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300202.1|2547466_2548195_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300206.1|2548480_2548717_+	hypothetical protein	NA	NA	NA	NA	NA
2548919:2548978	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_155046992.1|2549183_2549723_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	30.5	8.7e-09
WP_032126362.1|2549683_2550049_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2549994_2550570_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300203.1|2551052_2551511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|2551515_2552118_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211642.1|2552418_2552772_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_016211646.1|2552764_2553004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211918.1|2553375_2554344_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_051307368.1|2554343_2555624_-	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_054300202.1|2556330_2557059_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_075273432.1|2557369_2558104_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_016212023.1|2558100_2559093_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_054300201.1|2559488_2560217_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_054300200.1|2560518_2561097_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	3.9e-47
WP_155046993.1|2561089_2561452_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	37.6	1.3e-13
WP_016212024.1|2561596_2561845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|2561841_2562441_-	AAA family ATPase	NA	NA	NA	NA	NA
2561654:2561914	attR	TGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGAGCTTGGTCACGTATTGGATAACGTCCTTTTTTGGAGCCTTCTAACAGTTGTTGAATTTCAGGAGTAGTTAGAAAATCCCGATCTCGCTCATGACCATCACATGCCAGAGAATGTTCTACTTCAACACTCATCGCTGCAAACCTTTTTTCAGCTCAAACCCTAAGTTAACTCCTTTTAGCCATTGAGGGAGTGATTTACTC	NA	NA	NA	NA
WP_016212022.1|2562440_2562659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|2562888_2563617_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300198.1|2564028_2564358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2564508_2565237_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016210935.1|2565623_2566166_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2566162_2566849_-	acireductone synthase	NA	NA	NA	NA	NA
WP_036778484.1|2566852_2567464_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2567510_2568530_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2568631_2569426_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2569447_2570254_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2570332_2571382_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2571579_2572839_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2572885_2573563_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2573648_2573930_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_155046994.1|2574021_2575176_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.6	2.1e-20
WP_016210820.1|2575445_2576387_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2576890_2577115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2577406_2578111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300196.1|2578525_2579164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2579498_2580029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300195.1|2580025_2581558_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2581554_2582505_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2582925_2583558_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2583800_2583998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2584347_2584776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155074366.1|2584814_2585552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2585529_2586591_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	2589803	2642013	3062326	transposase,tRNA	Staphylococcus_phage(22.22%)	52	NA	NA
WP_081007004.1|2589803_2590259_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2590218_2590557_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036778253.1|2590614_2592153_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_098082804.1|2592264_2593363_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2593600_2594800_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2594829_2595468_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|2595483_2597667_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|2597904_2598249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|2599294_2599501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|2599665_2600124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|2600711_2601839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2601962_2602625_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2602716_2602962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2604035_2604695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2604796_2605447_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|2605559_2605880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2605938_2606913_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2607163_2607385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300192.1|2607407_2607629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300191.1|2607673_2608630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300190.1|2609124_2610087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046995.1|2610213_2611099_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210162.1|2611784_2612822_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_032126295.1|2612852_2614307_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_016210181.1|2614316_2615501_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_016210176.1|2615574_2616582_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210183.1|2616650_2618654_-	transketolase	NA	NA	NA	NA	NA
WP_016210174.1|2619104_2620265_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	8.2e-121
WP_036776947.1|2620501_2621617_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210172.1|2621779_2622304_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.6	6.9e-51
WP_016210163.1|2622303_2622834_+	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_016210178.1|2622923_2623391_-	DoxX family protein	NA	NA	NA	NA	NA
WP_016210161.1|2623892_2624147_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210179.1|2624347_2624851_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_129556592.1|2625141_2625672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2625832_2626516_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|2626591_2627371_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_032126297.1|2627357_2628218_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210177.1|2628342_2628708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210175.1|2629093_2629423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300188.1|2629736_2631296_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	9.9e-37
WP_054300148.1|2631541_2632603_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211784.1|2633156_2633879_+	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_016211783.1|2633870_2634236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|2634516_2635794_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211782.1|2636393_2636576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2636637_2637003_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273426.1|2636948_2637524_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273424.1|2637538_2638162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210766.1|2638250_2638694_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_032126291.1|2638697_2639207_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210756.1|2639199_2642013_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
>prophage 30
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	2672079	2708408	3062326	protease,transposase,tRNA	Stx2-converting_phage(20.0%)	37	NA	NA
WP_054300173.1|2672079_2673141_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2673231_2673978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300186.1|2674246_2674966_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2675209_2675572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273422.1|2675758_2676286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2676430_2676847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2678929_2679841_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2679892_2680741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2681185_2681896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2681987_2682956_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2682943_2683591_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036779767.1|2683619_2684471_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2684485_2685763_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2685803_2686319_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_054300183.1|2686397_2687459_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2687480_2688569_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_036777788.1|2688613_2690449_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2690491_2690962_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2690998_2691334_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2691346_2692063_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2691999_2693016_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2693012_2693492_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2693575_2696056_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2696118_2696484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273418.1|2696822_2697161_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2697120_2697576_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2697590_2697881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777784.1|2697946_2699545_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2699675_2700011_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777781.1|2700038_2701703_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210581.1|2701699_2702344_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2702343_2703087_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2703145_2703385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2703535_2704903_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2704913_2705465_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2705545_2706529_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2706650_2708408_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 31
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	2858644	2924216	3062326	transposase	Erwinia_phage(18.18%)	55	NA	NA
WP_054300168.1|2858644_2859508_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2859804_2860857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046999.1|2861145_2861553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2861766_2862258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2862313_2863564_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2863666_2863885_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_036777591.1|2864342_2865197_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016210728.1|2865251_2865722_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2866046_2867426_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2867453_2867912_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2867889_2869107_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2869298_2869535_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2869548_2869704_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2869784_2870747_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2870906_2872223_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2872232_2872901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2873263_2875078_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_054300166.1|2875195_2875984_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211543.1|2876564_2878316_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|2878326_2879127_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|2879229_2879718_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_017375799.1|2881226_2881571_+	DMT family protein	NA	NA	NA	NA	NA
WP_016210038.1|2887264_2888227_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|2888413_2889673_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|2889896_2890223_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|2890417_2891368_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|2891425_2893492_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|2893497_2894493_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|2895078_2896659_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|2896815_2898225_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|2898284_2899418_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|2899557_2900382_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|2900609_2901239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|2901575_2901947_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|2902250_2902538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|2902689_2903538_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|2903665_2904706_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_129556667.1|2904778_2906356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|2906999_2907659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2907813_2908788_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2908863_2909883_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047000.1|2909930_2910077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047001.1|2910281_2910467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2911365_2912448_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300161.1|2912495_2913557_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|2913637_2913946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|2914060_2915377_-	MFS transporter	NA	NA	NA	NA	NA
WP_081007001.1|2915838_2917125_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|2917197_2918094_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|2918180_2919179_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|2919287_2919812_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|2920059_2921298_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|2921845_2922319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|2922315_2922711_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2923640_2924216_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP039201	Piscirickettsia salmonis strain Psal-163 chromosome, complete genome	3062326	2934343	3042680	3062326	transposase,tRNA	Staphylococcus_phage(28.57%)	111	NA	NA
WP_081007000.1|2934343_2935432_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300157.1|2935655_2936936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2937768_2938134_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2938079_2938655_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2938937_2939303_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047002.1|2939317_2939923_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036776867.1|2940293_2941691_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_051307313.1|2941810_2942758_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|2942754_2943270_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|2943256_2944456_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|2944452_2944776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|2944777_2946007_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|2946006_2947050_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|2947049_2947733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|2947729_2950219_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|2950235_2950490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|2950490_2950847_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|2951626_2952790_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|2952809_2955917_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|2955918_2957424_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|2957451_2957733_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|2957881_2958223_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|2958342_2960223_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_075274705.1|2960307_2961906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|2961923_2963039_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|2963166_2964165_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|2964168_2964927_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|2964928_2966128_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|2966111_2966783_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|2966804_2967581_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|2967584_2968583_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|2968584_2969163_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|2969159_2970629_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|2970672_2970960_-	trp operon repressor	NA	NA	NA	NA	NA
WP_054300271.1|2971091_2972066_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209699.1|2972266_2972863_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300152.1|2972889_2973255_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|2973311_2973467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273401.1|2973611_2974064_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300151.1|2974101_2974434_+	DMT family transporter	NA	NA	NA	NA	NA
WP_155047003.1|2975922_2976808_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|2976994_2977216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|2977331_2977964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2977941_2979003_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776841.1|2979442_2979982_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|2980066_2980603_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|2981254_2981557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|2982006_2982315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126349.1|2982590_2983085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|2983367_2984078_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|2984304_2984703_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|2985570_2986521_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|2986520_2988599_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|2988746_2989262_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|2989270_2989834_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|2989814_2990561_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|2990700_2991153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|2991288_2992125_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|2992121_2993018_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|2993050_2994118_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|2994136_2994505_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|2994530_2995979_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|2995988_2997368_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|2997408_2998740_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|2998711_2999671_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|2999763_3000267_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3000401_3001553_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3001549_3002029_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3002175_3004497_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3004441_3005068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3005072_3005972_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3006044_3006623_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3006923_3007181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081006999.1|3007189_3007561_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.2	3.4e-20
WP_081006998.1|3007765_3008221_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	1.3e-21
WP_032126637.1|3008337_3008631_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155046758.1|3009479_3009611_+	phosphatase	NA	NA	NA	NA	NA
WP_016212051.1|3010238_3011012_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054300271.1|3012339_3013314_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3014408_3014747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007065.1|3014763_3015603_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_155047004.1|3015815_3016322_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300144.1|3016336_3016702_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3018006_3018702_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3018698_3020126_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3020151_3020415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047005.1|3021519_3022370_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|3022568_3023543_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007064.1|3023582_3023858_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3023854_3024691_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3024691_3025033_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3025034_3025640_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3025636_3027631_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3027650_3028592_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052104719.1|3028819_3030244_+	MFS transporter	NA	NA	NA	NA	NA
WP_155047006.1|3030650_3030791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3031044_3032019_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3032077_3032734_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126480.1|3032780_3033464_-	methyltransferase	NA	NA	NA	NA	NA
WP_080664873.1|3034009_3034324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144019150.1|3034233_3035214_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016211924.1|3035369_3035528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122942409.1|3035887_3036319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556614.1|3036456_3036609_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211852.1|3037194_3037908_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	1.7e-28
WP_075273625.1|3037966_3038719_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211851.1|3038915_3039572_+	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_075273397.1|3040260_3040656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273395.1|3040975_3041158_+	phosphatase	NA	NA	NA	NA	NA
WP_075273393.1|3041302_3042010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047007.1|3042074_3042680_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039202	Piscirickettsia salmonis strain Psal-163 plasmid unnamed1, complete sequence	158203	2231	115199	158203	head,transposase,integrase,tail,protease,capsid	Streptococcus_phage(25.0%)	116	49318:49377	119958:120596
WP_054300202.1|2231_2960_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|3163_5740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047021.1|6034_6190_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300202.1|6213_6942_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273830.1|6971_7304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047014.1|7374_7716_-	hypothetical protein	NA	A0A1B1IQX9	uncultured_Mediterranean_phage	60.3	1.7e-21
WP_054300202.1|7871_8600_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273834.1|8806_9373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273836.1|9715_10777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|10806_11889_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300202.1|12008_12737_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046765.1|13623_13818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047015.1|14198_14522_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212122.1|15398_16100_+	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_016212121.1|16053_16977_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_155046753.1|17410_18295_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.8	5.8e-10
WP_054300271.1|18939_19914_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212151.1|20004_20967_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|20990_21305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|21368_22343_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_033923686.1|22467_23517_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|23625_24666_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_155083657.1|24679_25345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|25399_25699_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211886.1|25695_26124_-	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_052104769.1|27121_28045_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_129556707.1|28359_29379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|29760_30914_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300202.1|30980_31709_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|31806_32220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047016.1|32623_32851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927838.1|32880_33126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|33122_33422_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016212019.1|33578_34274_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_081377351.1|35087_35867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|35950_36103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|36055_36388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|36552_36930_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|37236_37620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273842.1|38089_38818_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	5.4e-38
WP_036781349.1|38933_39260_-	potassium ABC transporter ATPase	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.1e-11
WP_016212365.1|39261_39504_-	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_155047017.1|40857_41037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273844.1|41515_43150_+	protein kinase	NA	NA	NA	NA	NA
WP_129556709.1|43361_43451_+	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_129556710.1|43531_44002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273857.1|44155_44890_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	8.4e-39
WP_016212404.1|45666_45900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273881.1|46020_48207_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.2	9.2e-73
WP_036779532.1|48216_48618_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_016212456.1|48614_48902_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_054300271.1|48945_49920_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
49318:49377	attL	AGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAA	NA	NA	NA	NA
WP_016212579.1|50519_50717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|52222_52423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212061.1|53192_55235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|56427_56793_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274751.1|56738_57314_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.1e-08
WP_075274752.1|57310_57610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047018.1|57645_58449_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.9e-55
WP_129556718.1|58482_59668_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_075273741.1|59877_60612_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046767.1|60942_61104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|61103_61604_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273747.1|61865_62456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273741.1|62585_63320_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273749.1|63541_64267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047019.1|64756_64909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273751.1|64921_66652_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300477.1|66811_67540_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	7.1e-38
WP_155047020.1|67696_68620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273755.1|68860_69517_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.2	2.9e-30
WP_016211955.1|69653_70634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211956.1|71090_71819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556703.1|71876_72365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377344.1|73478_74606_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273757.1|74845_75295_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273760.1|75638_78041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210338.1|78143_78281_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273592.1|78379_79354_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_081377345.1|79350_79875_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.5	1.4e-27
WP_032126637.1|79991_80285_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_075273762.1|80350_81622_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.3	1.1e-22
WP_052047108.1|81677_82076_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273764.1|82131_82500_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_016210655.1|82513_83110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273766.1|83560_84622_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273768.1|84625_84895_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.3	2.2e-05
WP_016210667.1|84891_85215_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210658.1|85207_85603_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210651.1|85599_85950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210664.1|85949_86372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210669.1|86373_86697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273770.1|88194_88479_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075273774.1|90680_91838_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_087910645.1|92000_93154_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_032126362.1|93226_93592_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273438.1|93537_94113_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.0	1.3e-07
WP_032126790.1|94583_95489_+|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_129556697.1|95873_96266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211776.1|96748_98086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|99711_100080_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211773.1|100181_100856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126360.1|101442_102177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|102299_103358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|103866_104613_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|104613_105018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377346.1|105411_106128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047010.1|106272_106515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|107047_108073_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_052104629.1|108894_109920_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212298.1|110199_110526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|110766_111243_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_155047011.1|111357_112510_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	9.8e-58
WP_075273780.1|112519_113227_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_052104629.1|113365_114391_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273782.1|114770_115199_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.0	3.0e-12
119958:120596	attR	AGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
