The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	45582	58682	3062282	transposase	Moraxella_phage(25.0%)	17	NA	NA
WP_075273371.1|45582_46158_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46103_46469_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46667_47429_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_036779326.1|47730_49257_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49628_50468_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50507_51815_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51789_52959_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|53013_53739_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54017_54407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54594_55500_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55547_55691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273385.1|55738_56542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007063.1|56569_57055_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	52.0	1.3e-40
WP_032126362.1|57092_57458_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|57403_57979_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007062.1|57942_58272_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.0	7.7e-08
WP_017377700.1|58388_58682_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
>prophage 2
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	152595	201592	3062282	transposase,protease	Bacillus_phage(50.0%)	57	NA	NA
WP_054300545.1|152595_153657_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|154051_154447_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|154468_154834_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154890_155055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|155044_155344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300544.1|155434_155881_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|156376_156943_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|156954_157740_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|158371_159295_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|159346_160342_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|160373_160868_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|160959_161217_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|161306_161729_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|162047_162764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|162807_163059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300543.1|163063_164500_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|164527_165970_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|166057_166396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|166480_167011_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|167071_169264_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|169306_169792_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|170061_170493_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036778324.1|170510_171341_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|171355_171499_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|171529_172414_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|172385_172607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|172780_173059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300542.1|173739_173976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|174001_174907_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556686.1|175337_176219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|176452_177028_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|176973_177339_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300541.1|177666_178446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126848.1|178979_179780_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016211858.1|179998_180757_+	ion transporter	NA	NA	NA	NA	NA
WP_016211859.1|180833_181121_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_075273327.1|181124_181700_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|181645_182011_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|182074_182347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300540.1|182614_182839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300539.1|183854_185198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|185490_186084_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|186052_186706_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|186883_187855_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|187877_188774_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|188932_189379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779493.1|189375_190017_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|190126_190705_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|191180_191618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|191942_193283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|193546_194941_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_054300538.1|196389_197457_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|197509_197932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|198172_198616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|198670_198928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|198905_199532_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|199609_201592_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
>prophage 3
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	217477	271376	3062282	tRNA,tail,transposase	Acinetobacter_phage(50.0%)	44	NA	NA
WP_016209854.1|217477_218464_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|218456_218699_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|218820_220365_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|220411_221698_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|221740_223135_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|223158_223338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|223334_223910_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|223855_224221_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210079.1|227226_227724_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|227894_228590_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|228692_230255_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|230570_232364_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|232449_232722_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|232727_233354_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|233340_234771_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|235103_236159_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|236127_236805_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|236794_237631_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|237790_238084_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|238190_238997_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|239301_240156_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_016210082.1|240310_241360_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_054300536.1|241410_242067_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|242084_243365_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|243638_245000_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_155046933.1|245273_245951_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016211802.1|251383_252655_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036778206.1|252711_253695_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|253691_254477_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_032126362.1|255173_255539_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|255484_256060_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300535.1|256063_256783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|256927_257128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|257175_257637_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|258060_259542_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|259604_260714_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|260811_262773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|263302_263707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|263759_264821_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046934.1|265184_265355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|265728_266811_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_105962623.1|268313_269466_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046935.1|269508_269931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270223_271376_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 4
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	434887	547139	3062282	transposase,tRNA,protease	Escherichia_phage(32.14%)	106	NA	NA
WP_054300513.1|434887_435751_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|435967_437527_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|437548_438583_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|438631_439201_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|439336_440308_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|440319_441897_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|441962_442949_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054300512.1|443280_444390_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|444495_445680_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|445757_447746_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|447954_448110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|448367_448667_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300510.1|448937_449120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|449176_449542_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|450458_451865_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|451882_452869_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|452871_454026_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|454022_454718_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|454852_456343_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|456363_457413_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|457479_458874_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|459752_461684_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|461688_462219_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|462253_462448_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|462490_462850_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|463269_464265_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_036777440.1|464277_466659_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|466664_466952_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|467223_467700_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|467844_468042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|468166_469141_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|470041_470140_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300507.1|470624_471914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|472150_472843_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|472884_473658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|473659_474601_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|474733_476311_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|476520_478278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|478826_479585_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|479792_480365_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|480468_481017_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|481318_481564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|481592_481889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|482156_483080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300506.1|483558_483966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|484037_484766_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126799.1|484846_485659_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_129556452.1|486779_487127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|487129_488869_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046941.1|489270_489534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300500.1|490205_490934_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_054300502.1|490963_491641_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.8	2.9e-09
WP_016212477.1|491813_492059_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_032126794.1|492055_492448_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_054300501.1|492459_493188_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_016212066.1|493548_494325_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016212069.1|494536_494704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212070.1|494678_495278_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_054300500.1|495687_496416_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_017375910.1|496944_497673_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|498571_499300_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211714.1|499374_502719_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|503335_504064_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155046942.1|504996_505883_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|506268_506997_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016212268.1|507153_507738_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|507741_508425_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|508906_509635_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211759.1|509966_511154_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016211756.1|511399_512125_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_032126312.1|512303_513098_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_129556590.1|513094_513490_-	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_051307363.1|513766_513949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|514173_515059_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046943.1|516829_516970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275117.1|517002_517425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211905.1|517668_518079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|518409_518985_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|518930_519296_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300493.1|519357_519570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300492.1|519728_520739_-	protein kinase	NA	NA	NA	NA	NA
WP_016210676.1|521042_523124_-	kinase domain protein	NA	NA	NA	NA	NA
WP_016210671.1|523579_524839_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_036778297.1|524971_525445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210672.1|525453_526836_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_016210677.1|526828_527443_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_016210675.1|527522_528239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210679.1|528406_530731_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.9	2.0e-17
WP_054300491.1|531406_533167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126421.1|533370_534462_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210055.1|534729_535368_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016210070.1|535406_535679_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_032126423.1|535772_536036_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210060.1|536032_536335_-	YciI family protein	NA	NA	NA	NA	NA
WP_016210053.1|536418_536961_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|537122_537749_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_036778098.1|537754_538594_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.3	1.4e-08
WP_016210061.1|538583_539228_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.8e-19
WP_032126424.1|539240_540065_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_016210057.1|540073_540583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210065.1|540723_541383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210075.1|541636_542728_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_016210064.1|542724_544089_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_016210052.1|544213_545410_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
WP_032126425.1|545430_546027_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210066.1|546470_547139_-|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
>prophage 5
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	555613	602503	3062282	transposase,integrase	Escherichia_phage(27.27%)	43	560053:560112	572041:572328
WP_032126790.1|555613_556519_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211874.1|556562_558281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046945.1|558599_559673_-	hypothetical protein	NA	NA	NA	NA	NA
560053:560112	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_016212522.1|560223_560478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300489.1|560574_561177_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_155046946.1|561179_561455_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032126389.1|562856_563045_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212230.1|564578_566027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|566082_567236_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_081007057.1|567293_567710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007056.1|569034_569244_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375841.1|569545_569755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|570061_570280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776735.1|570276_570729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212294.1|570742_571087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046947.1|571516_571684_+	phosphatase	NA	NA	NA	NA	NA
WP_016212659.1|571821_572067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|572211_572361_-	hypothetical protein	NA	NA	NA	NA	NA
572041:572328	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACG	NA	NA	NA	NA
WP_054300484.1|572585_573533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300483.1|574029_574584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211322.1|575119_575710_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211325.1|575772_577293_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211323.1|577282_578380_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211722.1|579807_583110_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_036780093.1|583119_583941_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_054300201.1|584044_584773_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_054300482.1|584802_586092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007054.1|586607_587840_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_080664881.1|588002_588209_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300481.1|588298_589027_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_081007053.1|589128_589989_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_016210616.1|590223_593034_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_016210625.1|593282_594029_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_129556587.1|594087_594990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|595089_595455_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|595400_595976_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_051307334.1|595992_596772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210618.1|597038_598088_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_016210617.1|598152_599577_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_036777984.1|599797_600247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210624.1|600265_600505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|600550_601021_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_075273327.1|601927_602503_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	618597	651784	3062282	transposase,tRNA	Escherichia_phage(57.14%)	34	NA	NA
WP_054300202.1|618597_619326_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_036780855.1|619937_620435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212214.1|620409_620910_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054300202.1|621068_621797_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019359.1|621941_622139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300478.1|622300_624037_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_054300477.1|624316_625045_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211623.1|625767_627408_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_036779883.1|627520_628870_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211625.1|628866_629736_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_054300475.1|630219_630948_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016212196.1|631356_631602_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016212195.1|631598_631985_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212193.1|632052_632391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|632513_633242_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211949.1|633381_634632_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_016211951.1|634665_635763_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_054300202.1|635939_636668_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_032126570.1|636884_637184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211816.1|637196_637550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|637591_639205_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_054300202.1|639410_640139_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|640626_641238_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_036779399.1|641594_641849_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|641947_643732_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779389.1|643820_644540_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|644722_644929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210948.1|644928_645165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|645177_645555_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|646061_646880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210947.1|646973_647171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|647265_648651_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|648777_649368_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_054300202.1|651055_651784_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 7
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	699551	774604	3062282	transposase,tRNA	Staphylococcus_phage(18.18%)	60	NA	NA
WP_054300468.1|699551_700208_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.4	3.1e-08
WP_016211761.1|700623_702615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211760.1|702721_704101_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300467.1|704138_704519_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|704515_705490_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016211615.1|705724_706441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211620.1|707984_708509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211619.1|708576_710397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210267.1|711251_711758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210259.1|711821_713240_+	asmA-like family protein	NA	NA	NA	NA	NA
WP_016210248.1|713360_713615_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_016210257.1|713761_714034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777860.1|714605_715181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210251.1|716251_716494_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_036777864.1|716580_717672_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210258.1|717652_718606_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	4.9e-31
WP_016210253.1|718829_720314_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	3.8e-46
WP_032126416.1|720354_720858_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.6	2.8e-09
WP_016210254.1|721117_722293_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_016210252.1|723201_723573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210260.1|726087_726516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556655.1|726743_727748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300466.1|727851_729189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300465.1|729181_729961_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_081007050.1|730182_730710_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|730766_731132_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211061.1|731193_731547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211058.1|731667_732201_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_032126660.1|732339_733977_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.2	5.8e-88
WP_016211065.1|733981_734203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211066.1|734300_735314_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_016211063.1|735476_737705_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
WP_032126658.1|737685_738390_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|738624_738954_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_054300464.1|740034_741096_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126663.1|741122_741365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126664.1|742083_742767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212048.1|742960_743518_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_054300173.1|744281_745343_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664847.1|745415_746369_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_016210879.1|749700_750060_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210871.1|750056_750374_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210872.1|750390_751500_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210882.1|751526_752612_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210874.1|752734_753775_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210873.1|753789_754440_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210876.1|754507_755350_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_054300462.1|755815_756733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|757751_757946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036794860.1|758022_758316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|758583_759501_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_016211373.1|760051_760198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211374.1|760252_761443_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211370.1|761575_762019_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211369.1|762061_763105_-	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211368.1|763151_764543_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211371.1|764739_765663_+	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211372.1|765649_766507_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016212287.1|772318_773464_-|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_054300173.1|773542_774604_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	841837	873600	3062282	tRNA,transposase	Catovirus(20.0%)	32	NA	NA
WP_016211428.1|841837_843901_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
WP_054300173.1|844171_845233_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300457.1|845393_846683_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300148.1|846870_847932_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273329.1|847979_849281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300455.1|849241_849607_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|849621_850128_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300454.1|850117_850468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|850569_850935_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|850880_851456_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046950.1|851445_851700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300452.1|851749_852811_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210196.1|852768_853122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779341.1|853475_855686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|855686_856373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210198.1|856684_857236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|857252_857654_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210190.1|857844_858720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126472.1|858939_859590_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_036778866.1|860052_862641_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.9	3.3e-122
WP_016210199.1|862746_863508_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_016210206.1|863504_864041_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210205.1|864089_865046_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210187.1|865126_868312_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210201.1|868315_869371_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_036778872.1|869600_870206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778869.1|870249_870912_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_016210194.1|870946_871294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|871350_871512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126473.1|871492_871675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210192.1|871883_872402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|872714_873600_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	879520	925327	3062282	transposase	Staphylococcus_phage(41.67%)	44	NA	NA
WP_081007004.1|879520_879976_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|879935_880274_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300449.1|880403_881183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|881202_882177_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_054300448.1|882220_884590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|884779_885841_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300447.1|886253_888890_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_080664849.1|888938_890027_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016210997.1|890026_890710_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_032126469.1|890769_892431_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210998.1|892584_892839_+	LapA family protein	NA	NA	NA	NA	NA
WP_016211001.1|892916_893222_+	competence protein ComEA	NA	NA	NA	NA	NA
WP_016211002.1|893385_893784_+	VOC family protein	NA	NA	NA	NA	NA
WP_155046951.1|893865_894129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781250.1|894935_895721_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300446.1|895816_896551_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	1.1e-09
WP_016210826.1|897981_898848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210824.1|898957_900637_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210830.1|900763_902014_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_032126465.1|902089_902551_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210835.1|902547_903696_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_016210836.1|903701_904376_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_052133275.1|904405_905029_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210828.1|905144_905618_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_016210832.1|905619_906042_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210829.1|906028_907048_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_054300445.1|907317_907869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|907963_909025_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212318.1|909553_909985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|909986_910313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781320.1|910299_910527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|911373_912819_-	MFS transporter	NA	NA	NA	NA	NA
WP_016212205.1|912958_913138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046952.1|914823_914985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|915157_915331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212179.1|915753_915906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|916326_917388_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|917345_917594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300443.1|917646_917925_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211538.1|918163_919087_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_054300442.1|919781_921878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300441.1|922159_922522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300440.1|922666_923878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|924174_925327_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 10
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	960725	997823	3062282	transposase,tRNA,protease	Bacillus_phage(33.33%)	35	NA	NA
WP_026063519.1|960725_961142_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300357.1|961190_962066_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|962616_963201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556565.1|964670_965066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273603.1|965189_965366_-	phosphatase	NA	NA	NA	NA	NA
WP_105962625.1|965445_966331_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126745.1|967512_968115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122940402.1|968323_968947_+	porin family protein	NA	NA	NA	NA	NA
WP_016209896.1|969261_969831_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016209891.1|969977_970676_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_036777115.1|970817_971018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209884.1|971094_971718_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052104600.1|971827_972721_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209898.1|972827_974438_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_016209888.1|974434_975730_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209876.1|975751_977674_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209881.1|977784_978087_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209893.1|978179_983069_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_052104599.1|983123_984440_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.1	3.2e-65
WP_036777110.1|984564_985659_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_016209878.1|985710_986649_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_080664826.1|986729_987329_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209877.1|987495_988386_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_016209887.1|988588_989080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209894.1|989223_989715_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|989883_990597_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556650.1|991025_992000_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_054300433.1|992329_992560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007045.1|992859_993489_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211960.1|993810_994338_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_054300573.1|994601_995735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|995762_996344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|996913_997099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300431.1|997243_997546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007044.1|997505_997823_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	1000945	1044870	3062282	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_129556499.1|1000945_1002099_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_155046705.1|1002204_1002372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|1002317_1002893_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|1002933_1003542_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032126790.1|1003710_1004616_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556560.1|1004585_1005122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556559.1|1005202_1005631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212093.1|1005787_1006717_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_075273313.1|1006929_1007268_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1007227_1007683_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212654.1|1007674_1007959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212100.1|1008369_1009290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212098.1|1009290_1010142_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1010862_1011909_+	glutathione synthase	NA	NA	NA	NA	NA
WP_032126840.1|1011892_1013890_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_122941967.1|1014068_1014374_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|1014603_1014810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|1015070_1015772_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046955.1|1016013_1016193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046956.1|1016714_1016879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300430.1|1017348_1020105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|1020340_1021633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300429.1|1021686_1021947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300428.1|1022247_1022811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211709.1|1022955_1023102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|1025361_1027398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007043.1|1028121_1029864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300426.1|1029823_1031458_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|1031470_1032514_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|1032492_1032954_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_016211081.1|1032994_1033930_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211087.1|1033957_1034953_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_054300425.1|1035160_1036123_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126778.1|1036301_1036496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046957.1|1036710_1037562_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_052047048.1|1037617_1038118_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212611.1|1038214_1038535_+	histidine kinase	NA	NA	NA	NA	NA
WP_054300423.1|1038582_1039644_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212519.1|1039718_1040099_+	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300422.1|1040369_1040807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300421.1|1040857_1041703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274673.1|1041680_1042679_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1042639_1043005_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046958.1|1042950_1043511_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300417.1|1043895_1044870_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 12
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	1057539	1122429	3062282	tRNA,transposase	Bacillus_phage(30.0%)	60	NA	NA
WP_016210280.1|1057539_1058634_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_016210284.1|1058715_1059237_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210276.1|1059291_1059768_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210275.1|1059823_1060126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210273.1|1060190_1060898_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210274.1|1061270_1061669_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_032126334.1|1061708_1062140_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210271.1|1062150_1062834_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1062900_1065096_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_129556492.1|1065193_1065937_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210283.1|1065964_1066750_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_016210272.1|1066789_1067500_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210279.1|1067487_1068654_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210277.1|1068707_1069541_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210270.1|1069610_1072598_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210281.1|1072639_1074031_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_075273303.1|1074044_1074761_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016211367.1|1074916_1075699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126330.1|1075846_1076806_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_036779263.1|1076860_1078870_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_016211366.1|1078925_1079213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126332.1|1079465_1080665_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_075273298.1|1081311_1081887_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300410.1|1081832_1082198_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|1082331_1083195_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1083425_1083719_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_144019383.1|1084126_1084345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046959.1|1084377_1084551_+	phosphatase	NA	NA	NA	NA	NA
WP_032126328.1|1084699_1084951_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211589.1|1085079_1086312_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_016211592.1|1086301_1086964_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_129556496.1|1087238_1088477_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_032126329.1|1088662_1089292_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211588.1|1089367_1090069_+	cyclase family protein	NA	NA	NA	NA	NA
WP_129556499.1|1090236_1091389_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016212343.1|1091628_1092435_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_016209808.1|1093739_1094108_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016209824.1|1094104_1094923_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209813.1|1095023_1095839_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_016209801.1|1096123_1098178_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_032126324.1|1098177_1098600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209805.1|1098778_1100272_-	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_016209818.1|1100404_1101220_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209799.1|1101315_1101732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209815.1|1102118_1102658_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_054300409.1|1102975_1104688_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	4.3e-25
WP_016209812.1|1105134_1106958_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_016209821.1|1107047_1107380_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209800.1|1107410_1108007_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_036777933.1|1108003_1109128_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_016209822.1|1109263_1109911_+	methyltransferase domain protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_016209810.1|1109967_1111881_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209803.1|1112085_1113123_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209820.1|1113181_1116481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|1117182_1118151_-	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209809.1|1118257_1118746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209823.1|1119170_1119614_+	response regulator	NA	NA	NA	NA	NA
WP_075273327.1|1120835_1121411_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1121356_1121722_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300408.1|1121772_1122429_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
>prophage 13
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	1130967	1198561	3062282	transposase,tRNA	uncultured_Mediterranean_phage(26.67%)	53	NA	NA
WP_155046942.1|1130967_1131853_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273597.1|1131843_1133688_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|1133959_1134934_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556498.1|1135113_1135722_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036778626.1|1135718_1137659_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_016210594.1|1137794_1138448_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210595.1|1138624_1139803_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210588.1|1140170_1141496_+	fimV domain protein	NA	NA	NA	NA	NA
WP_016210587.1|1142469_1143330_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_016210590.1|1143504_1144767_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210593.1|1144846_1145377_+	colicin V production protein	NA	NA	NA	NA	NA
WP_016210586.1|1145398_1146904_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210592.1|1146916_1147573_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016212005.1|1147962_1149723_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_105962623.1|1150623_1151776_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126856.1|1152081_1152423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1152483_1153545_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300406.1|1153845_1156581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|1158880_1159696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273595.1|1160104_1161475_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.6e-12
WP_054300405.1|1161530_1162031_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209947.1|1162552_1163215_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_036777555.1|1163241_1164471_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209940.1|1164627_1167399_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_052104625.1|1167474_1167918_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209931.1|1168070_1169543_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209926.1|1169654_1170716_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209945.1|1170712_1171747_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209932.1|1171749_1172790_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_036777579.1|1172972_1174088_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209930.1|1174126_1174480_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777561.1|1174500_1176369_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209935.1|1176390_1177335_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_016209925.1|1177568_1177847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1178056_1178695_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209944.1|1178669_1180097_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209927.1|1180297_1180975_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209939.1|1181109_1182384_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209943.1|1182451_1183207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209948.1|1183258_1184176_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_054300404.1|1184284_1185178_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075273594.1|1185250_1186621_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300403.1|1186660_1187635_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.0e-27
WP_016211771.1|1187927_1188116_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_016211770.1|1188129_1189263_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_054300402.1|1189462_1193608_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_054300401.1|1194210_1194492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1194823_1195177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1195390_1195585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1196250_1196778_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300400.1|1196834_1197077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1197221_1197488_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273592.1|1197586_1198561_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
>prophage 14
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	1250200	1359569	3062282	transposase,tRNA	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(13.33%)	93	NA	NA
WP_032126790.1|1250200_1251106_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1251334_1252606_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_054300386.1|1252630_1253368_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1253620_1254763_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1254779_1256381_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1256892_1257030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1257026_1258304_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1258653_1258836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273583.1|1259382_1259664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1259995_1260901_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1261129_1262401_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_155053507.1|1266676_1266790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|1268427_1268610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273583.1|1269156_1269438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1269769_1270675_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1270903_1272175_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_080664858.1|1276412_1276550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1276546_1277824_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1278173_1278356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273583.1|1278902_1279184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1279515_1280421_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1280649_1281921_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_054300386.1|1281945_1282683_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1282935_1284078_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1284094_1285696_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1286207_1286345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1286341_1287619_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1287968_1288151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273583.1|1288697_1288979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046960.1|1289105_1289759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212251.1|1289920_1290457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300384.1|1290618_1291434_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273581.1|1291842_1293210_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.6e-11
WP_052133287.1|1293265_1293664_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212039.1|1293852_1294410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212040.1|1294586_1295936_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_054300162.1|1296139_1297222_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210803.1|1297296_1298595_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_036776426.1|1298772_1299624_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210805.1|1299632_1300304_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_032126141.1|1300713_1301988_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210804.1|1302052_1303972_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126139.1|1303978_1304908_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_054300383.1|1305003_1307484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300382.1|1307754_1308177_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300380.1|1308447_1309104_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1309307_1309673_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|1309687_1310194_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211414.1|1310409_1311228_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|1311335_1311797_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211415.1|1311813_1312737_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211417.1|1312760_1313810_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_051307357.1|1313946_1314540_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211422.1|1314562_1315033_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032126143.1|1315121_1316393_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_054300250.1|1316492_1317152_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_075273327.1|1317141_1317717_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1317662_1318028_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211838.1|1318737_1318911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211840.1|1319381_1319846_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211839.1|1320004_1321477_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211841.1|1321594_1322047_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|1322906_1323968_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1324270_1325353_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300381.1|1325363_1326011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300380.1|1326474_1327131_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962623.1|1327459_1328612_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016211470.1|1329214_1329868_+	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|1329927_1331913_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_032126343.1|1332043_1332856_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_032126344.1|1332976_1334065_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_016211467.1|1334067_1334634_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_081007013.1|1334708_1335008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1336426_1336792_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046961.1|1336959_1337364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032127044.1|1337483_1337684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212482.1|1337898_1338042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1338585_1339738_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_054300378.1|1339747_1341445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|1343300_1343849_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_075273576.1|1343976_1344705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1344764_1348262_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_016210514.1|1348319_1349573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210515.1|1349681_1350584_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210512.1|1350637_1351675_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210506.1|1351810_1353049_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210510.1|1353041_1353770_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_081007040.1|1353800_1354457_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211831.1|1354594_1356322_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|1356622_1356976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1357391_1357892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046962.1|1358543_1358990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1358993_1359569_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	1380355	1420813	3062282	transposase,tRNA,protease	Klosneuvirus(25.0%)	34	NA	NA
WP_016210928.1|1380355_1380661_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_054300375.1|1380875_1381076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728346.1|1381882_1382215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1382232_1383096_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556556.1|1383128_1383704_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1383649_1384015_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211651.1|1384248_1385784_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016211650.1|1385908_1387393_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211648.1|1388052_1388592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|1389795_1390002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126642.1|1390071_1390533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300374.1|1390568_1393139_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	5.1e-30
WP_016209840.1|1393246_1393732_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_016209844.1|1393904_1394945_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209835.1|1394922_1395405_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209848.1|1395401_1397996_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209832.1|1398302_1398566_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209831.1|1398844_1399543_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|1399762_1399957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209827.1|1400032_1401592_-	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_129556633.1|1401910_1402807_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|1403023_1404499_-	APC family permease	NA	NA	NA	NA	NA
WP_016209826.1|1405021_1406044_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209830.1|1406374_1407742_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209846.1|1407977_1408232_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126639.1|1408247_1409534_+	GTPase HflX	NA	NA	NA	NA	NA
WP_016209836.1|1409553_1410768_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_016209838.1|1410767_1411661_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209839.1|1411858_1413157_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209829.1|1414536_1416936_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209834.1|1416932_1417691_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209842.1|1417867_1418257_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_054300373.1|1418984_1419842_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|1419838_1420813_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 16
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	1448734	1627688	3062282	tRNA,integrase,transposase,protease	Staphylococcus_phage(17.5%)	158	1490041:1490100	1570498:1571463
WP_016211285.1|1448734_1449514_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211286.1|1449531_1449879_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211289.1|1449990_1450263_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211767.1|1451879_1452689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211764.1|1453239_1454061_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126803.1|1454261_1455494_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_032126804.1|1455616_1456492_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211806.1|1456656_1457382_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_081007037.1|1457424_1458963_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211804.1|1458969_1460355_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_036780332.1|1461049_1462393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1463032_1463716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273555.1|1463993_1464527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210332.1|1464657_1465401_-	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_016210330.1|1465498_1465882_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210333.1|1466085_1466715_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_032126607.1|1466788_1468072_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_054300368.1|1468411_1469710_+	ankryin	NA	NA	NA	NA	NA
WP_016210325.1|1469863_1471240_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210327.1|1471375_1472707_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_054300367.1|1472767_1473286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210321.1|1473334_1474303_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_129556511.1|1474499_1475936_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300568.1|1476118_1476829_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.3	4.1e-38
WP_054300366.1|1476849_1477263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210320.1|1477412_1478486_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_016210322.1|1478622_1479519_-	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016211334.1|1479848_1480037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211336.1|1480085_1480700_+	chorismate mutase	NA	NA	NA	NA	NA
WP_032126265.1|1480765_1481683_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_052104656.1|1482006_1482510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082827.1|1482586_1483888_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_016211330.1|1484062_1485163_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_032126267.1|1485798_1486041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300365.1|1486034_1486352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300364.1|1486461_1487340_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075273553.1|1487513_1488440_+	MFS transporter	NA	NA	NA	NA	NA
WP_155046964.1|1488429_1489005_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300363.1|1488950_1489298_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212589.1|1489721_1490159_+	MFS transporter	NA	NA	NA	NA	NA
1490041:1490100	attL	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAG	NA	NA	NA	NA
WP_129556637.1|1490633_1491413_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1490041:1490100	attL	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAG	NA	NA	NA	NA
WP_016210843.1|1492027_1492258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210844.1|1492344_1493472_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_129556513.1|1493647_1495393_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_032126340.1|1495473_1496235_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_155046965.1|1496514_1498971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1499122_1499896_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016210841.1|1499954_1500326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1500539_1501514_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211148.1|1501718_1503047_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1503310_1503880_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211151.1|1503895_1504207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1504216_1505173_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1505285_1505639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211153.1|1505642_1506707_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211145.1|1506707_1508447_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_036779218.1|1508453_1508876_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211144.1|1508859_1509489_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_054300271.1|1510045_1511020_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007035.1|1511059_1511725_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273651.1|1512550_1513588_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300359.1|1513946_1514519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664876.1|1514742_1516605_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_081377865.1|1516963_1517248_+|transposase	transposase	transposase	NA	NA	NA	NA
1516701:1516990	attR	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_032126362.1|1518607_1518973_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1516701:1516990	attR	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_129556638.1|1519551_1520232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273551.1|1520231_1520534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211974.1|1520633_1521755_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_054300357.1|1522037_1522913_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212011.1|1523146_1524268_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_016212013.1|1524489_1524873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|1524888_1525566_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300276.1|1525609_1526584_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016211994.1|1528062_1528599_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_032126537.1|1528635_1528821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211991.1|1529061_1529967_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126538.1|1530875_1532294_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_081007034.1|1532558_1532843_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_080728343.1|1532824_1532965_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_052104693.1|1533046_1536913_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_016211564.1|1537078_1537954_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211563.1|1537986_1538148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300355.1|1538358_1538544_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|1538533_1539109_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1539054_1539420_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046966.1|1539380_1539761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1539833_1540808_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046967.1|1540946_1541561_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	40.1	1.5e-33
WP_054300353.1|1541611_1541839_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300565.1|1547865_1548366_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_016210112.1|1549059_1550487_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_122943012.1|1550603_1551059_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210108.1|1551244_1552510_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_016210114.1|1552602_1553862_+	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210107.1|1553933_1554206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210101.1|1554495_1555992_-	flagellin domain protein	NA	NA	NA	NA	NA
WP_016210113.1|1557622_1558672_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210110.1|1558859_1559615_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_036777611.1|1559675_1561265_-	APC family permease	NA	NA	NA	NA	NA
WP_016210106.1|1561447_1562539_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210105.1|1562558_1562879_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210099.1|1562962_1564240_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_017377579.1|1564261_1565098_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210111.1|1565104_1566739_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_054300275.1|1567043_1567919_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210117.1|1568154_1568514_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210103.1|1568795_1570154_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_075273327.1|1570506_1571082_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1571027_1571393_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046968.1|1571901_1573054_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.4	2.2e-57
WP_075273547.1|1573063_1573381_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1573595_1573961_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1573906_1574482_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211627.1|1574645_1574810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211632.1|1575035_1575890_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_054300351.1|1575925_1576747_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211631.1|1577002_1577809_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_155046729.1|1578067_1579114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1579331_1580484_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046942.1|1580869_1581756_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300349.1|1582907_1584632_-	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_032126825.1|1585183_1586497_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_016211481.1|1586729_1587872_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_098082850.1|1587946_1588123_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_052104609.1|1588158_1588791_-	MarC family protein	NA	NA	NA	NA	NA
WP_032126823.1|1588901_1589624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211482.1|1589612_1591886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1592021_1592360_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1592319_1592775_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212267.1|1592941_1593301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1593581_1594229_+	LysE family translocator	NA	NA	NA	NA	NA
WP_155046730.1|1594496_1594637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300161.1|1594855_1595917_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211733.1|1596531_1597356_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_054300347.1|1597411_1598803_-	protein kinase	NA	NA	NA	NA	NA
WP_016211732.1|1599224_1599923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126682.1|1600239_1600566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211399.1|1600673_1601417_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211403.1|1601430_1602474_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211405.1|1602609_1604382_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_129556522.1|1604588_1605821_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_054300271.1|1607131_1608106_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211669.1|1608930_1609281_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211666.1|1609435_1612255_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211664.1|1612627_1613356_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211555.1|1613606_1614965_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_032126677.1|1615039_1615603_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211557.1|1615797_1617027_-	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_016211554.1|1617072_1617699_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_032126678.1|1618025_1619036_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_054300346.1|1619046_1619922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1620068_1621151_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300345.1|1621232_1622312_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1622448_1622814_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1622759_1623335_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1624025_1625000_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1625554_1626616_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1626713_1627688_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 17
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	1656233	1700623	3062282	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_105962625.1|1656233_1657119_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300343.1|1657123_1657351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007030.1|1657386_1658358_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307341.1|1659051_1660650_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_016210848.1|1660816_1662001_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1662584_1663139_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210850.1|1663387_1664641_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210851.1|1664625_1665297_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210847.1|1665319_1666324_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210849.1|1666352_1667801_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210855.1|1667918_1668896_+	DMT family transporter	NA	NA	NA	NA	NA
WP_155046969.1|1669049_1669866_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1669886_1670861_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273543.1|1670900_1671143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776661.1|1672127_1672457_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_032126448.1|1672488_1672869_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211178.1|1672959_1673988_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016211180.1|1674050_1674515_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_032126449.1|1674535_1675459_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_081007029.1|1675525_1676134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776658.1|1676246_1678241_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211177.1|1678632_1679853_+	amino acid permease	NA	NA	NA	NA	NA
WP_155046970.1|1681277_1681526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211739.1|1681642_1682149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126783.1|1682259_1683501_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211741.1|1683646_1684423_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126790.1|1685586_1686492_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1687481_1687820_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1687779_1688235_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126602.1|1688387_1689695_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211857.1|1689945_1690824_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016211855.1|1690820_1691288_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|1691414_1691600_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_054300339.1|1691815_1692787_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.2e-25
WP_129556640.1|1693344_1694571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211351.1|1694646_1694985_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_032127067.1|1694981_1695584_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211349.1|1695580_1697575_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211350.1|1697638_1698577_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211352.1|1699255_1699696_+	universal stress protein	NA	NA	NA	NA	NA
WP_075273313.1|1699869_1700208_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007028.1|1700167_1700623_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	1710923	1779762	3062282	transposase,tRNA	Cedratvirus(14.29%)	59	NA	NA
WP_036779544.1|1710923_1711931_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1711930_1712188_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046972.1|1712447_1713038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300334.1|1714561_1715050_-	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_051307365.1|1715069_1715330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211834.1|1715587_1715902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|1719275_1720265_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1720598_1720784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046973.1|1721140_1721299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1721465_1723421_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016210749.1|1723719_1724181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210752.1|1724350_1725148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556641.1|1727524_1728787_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016211454.1|1732741_1733212_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_016211452.1|1733962_1735450_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211455.1|1735511_1736969_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_122942091.1|1737074_1737470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1737497_1738076_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_054300330.1|1738697_1739759_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274658.1|1739808_1741014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046974.1|1741165_1741327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300328.1|1741437_1742214_+	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_016212459.1|1742351_1742732_-	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_155046975.1|1742851_1743301_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_054300326.1|1743714_1744179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1744280_1744553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273534.1|1744746_1745628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|1745990_1747016_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300323.1|1747259_1747853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300322.1|1748240_1750175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1750213_1751128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1752698_1752965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1753041_1753698_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212446.1|1753732_1754494_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.1	1.2e-48
WP_016212445.1|1754856_1755123_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1755368_1755824_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1755783_1756122_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556531.1|1756084_1756282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211752.1|1756486_1757632_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211748.1|1757647_1759252_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211749.1|1759331_1760525_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_032126540.1|1760733_1761597_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212346.1|1761830_1761977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300321.1|1762771_1763143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300320.1|1763360_1763960_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047087.1|1763937_1764156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|1764606_1765632_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300318.1|1765779_1766757_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211465.1|1767384_1768368_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211464.1|1768518_1768866_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_032126752.1|1768862_1769465_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211466.1|1769552_1771073_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126753.1|1771142_1771607_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_054300317.1|1772547_1773081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046976.1|1773377_1773515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007073.1|1773580_1773751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777066.1|1773733_1776790_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209619.1|1776876_1778325_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209621.1|1778757_1779762_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 19
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	1808335	1852108	3062282	transposase	Escherichia_phage(33.33%)	40	NA	NA
WP_054300202.1|1808335_1809064_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_081007021.1|1809056_1809623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126786.1|1809921_1813002_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016211319.1|1813019_1814072_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211316.1|1814604_1815255_+	porin family protein	NA	NA	NA	NA	NA
WP_016211315.1|1815589_1816234_+	porin family protein	NA	NA	NA	NA	NA
WP_054300314.1|1816421_1816757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273532.1|1816717_1817305_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126997.1|1817522_1817762_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_032126998.1|1818083_1818431_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_036774554.1|1818529_1818808_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1818860_1819148_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1819151_1820038_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923708.1|1822500_1823376_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211346.1|1823907_1824549_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_016211340.1|1824576_1824798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211347.1|1824790_1825774_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211344.1|1825987_1826806_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_054300313.1|1826966_1828649_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	1.6e-32
WP_054300312.1|1828656_1829679_-	YHYH protein	NA	NA	NA	NA	NA
WP_016211341.1|1829877_1830048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1830192_1831167_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211940.1|1831280_1831613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1831733_1832993_-	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_054300310.1|1834794_1835319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211210.1|1835421_1836903_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_052104715.1|1836909_1837116_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211211.1|1837164_1838244_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211215.1|1838435_1840406_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_054300309.1|1840766_1842326_+	APC family permease	NA	NA	NA	NA	NA
WP_054300308.1|1842620_1842851_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300307.1|1842880_1843609_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300306.1|1843711_1843936_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016211983.1|1844183_1844843_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556643.1|1844938_1846303_+	histidine kinase	NA	NA	NA	NA	NA
WP_016212551.1|1846760_1847255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211946.1|1848610_1849366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556540.1|1849584_1849980_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211947.1|1849972_1851118_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_033923708.1|1851232_1852108_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	1896512	1970153	3062282	transposase	Staphylococcus_phage(22.22%)	63	NA	NA
WP_032126540.1|1896512_1897376_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300189.1|1897509_1897875_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1897931_1898096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046980.1|1898085_1898385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046981.1|1898374_1898551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300299.1|1898640_1899723_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|1901924_1903475_-	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_075273524.1|1903630_1904596_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1904636_1905611_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_098082828.1|1905975_1906233_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1906232_1907240_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212247.1|1907606_1908362_+	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1908989_1909964_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300162.1|1910303_1911386_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212246.1|1911489_1912146_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300297.1|1913081_1914149_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1914211_1915294_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210771.1|1915385_1918787_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_016210773.1|1918783_1921477_-	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210769.1|1921780_1923283_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_033923762.1|1923583_1923817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1923944_1924754_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_016210772.1|1924837_1926391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210397.1|1927599_1929774_+	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210388.1|1929770_1930445_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210399.1|1930470_1932462_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210390.1|1932476_1932818_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_032126670.1|1932822_1933260_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210394.1|1933285_1934671_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_122940572.1|1934781_1935207_-	flaG family protein	NA	NA	NA	NA	NA
WP_032126669.1|1935318_1936896_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210398.1|1937120_1938713_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210393.1|1939201_1941403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778065.1|1941496_1942930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1942972_1943488_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155046736.1|1943487_1944441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211168.1|1944418_1945078_-	wbqC-like family protein	NA	NA	NA	NA	NA
WP_036778066.1|1945074_1945803_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307350.1|1945792_1946539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664856.1|1946522_1947587_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_016211172.1|1947775_1948972_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_036778145.1|1949021_1950143_-	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	8.7e-11
WP_036781047.1|1950755_1951613_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_054300295.1|1951893_1952118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556646.1|1952928_1954314_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_016211278.1|1954365_1955625_-	threonine synthase	NA	NA	NA	NA	NA
WP_016211277.1|1955611_1956580_-	homoserine kinase	NA	NA	NA	NA	NA
WP_016211279.1|1956593_1959062_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_054300294.1|1959805_1960867_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300293.1|1961138_1961504_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1961560_1961725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|1961714_1961888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|1961860_1962013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300292.1|1962468_1963470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779544.1|1963724_1964732_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1964731_1964989_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007015.1|1965200_1965626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1966118_1967271_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_054300288.1|1967280_1967970_-	hypothetical protein	NA	A0A0N7AE80	Bacillus_phage	28.2	3.2e-08
WP_054300287.1|1968378_1968708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1968729_1969095_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1969040_1969616_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300285.1|1969616_1970153_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	2036188	2091103	3062282	tRNA,transposase,protease	Orpheovirus(16.67%)	56	NA	NA
WP_016209434.1|2036188_2037610_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_129556553.1|2037699_2039292_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_016209439.1|2039455_2040082_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_054300277.1|2040162_2042844_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_016209445.1|2043326_2044283_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_016209435.1|2044383_2044755_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_016209404.1|2044781_2045645_+	chemotaxis phosphatase CheX family protein	NA	NA	NA	NA	NA
WP_016209416.1|2045634_2046420_-	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209413.1|2046708_2047194_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_016209443.1|2047268_2047790_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016209405.1|2047835_2048729_-	cheW-like domain protein	NA	NA	NA	NA	NA
WP_016209406.1|2048725_2049547_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.2	5.0e-16
WP_016209408.1|2049861_2050032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209427.1|2050185_2051589_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_052047073.1|2051682_2052933_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080664816.1|2052919_2053651_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_016209424.1|2053662_2054940_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209433.1|2055039_2055414_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209412.1|2055498_2056386_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209436.1|2056443_2057172_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_129556555.1|2057168_2058299_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209444.1|2058429_2058858_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_032126508.1|2058952_2059312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209447.1|2059301_2060513_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016209421.1|2060509_2061298_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209411.1|2061460_2062255_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_054300276.1|2062460_2063435_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_032126933.1|2063603_2064905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2064908_2065208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2065197_2065362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2065418_2065784_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211553.1|2066123_2066864_-	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_016211549.1|2066867_2069372_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211548.1|2069634_2070591_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211550.1|2070574_2071336_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_054300275.1|2071413_2072289_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2072413_2072659_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016211262.1|2072718_2074992_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_075273504.1|2075046_2075400_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|2075589_2075883_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_032126515.1|2076055_2076235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307354.1|2076310_2076886_-	DedA family protein	NA	NA	NA	NA	NA
WP_032126514.1|2077168_2078485_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2078495_2078864_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016211265.1|2078894_2079557_-	adenylate kinase	NA	NA	NA	NA	NA
WP_054300274.1|2079731_2080097_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2080042_2080618_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126519.1|2080785_2081505_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_016211478.1|2081484_2082300_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126518.1|2082316_2084518_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211474.1|2084600_2085950_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_016211473.1|2086024_2086624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211476.1|2086607_2086817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777061.1|2087134_2088322_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211932.1|2088517_2089807_+	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_129556478.1|2090217_2091103_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	2103639	2145453	3062282	transposase,tRNA	Moraxella_phage(16.67%)	39	NA	NA
WP_054300173.1|2103639_2104701_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776407.1|2104949_2106086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211446.1|2106269_2107997_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_016211448.1|2107986_2109195_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211450.1|2109293_2110316_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155047009.1|2111091_2111265_+	phosphatase	NA	NA	NA	NA	NA
WP_052104774.1|2111409_2112042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2112089_2113151_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126170.1|2113314_2113587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211040.1|2113814_2115026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211037.1|2115376_2116006_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211042.1|2116054_2117071_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211035.1|2117317_2117533_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211043.1|2117585_2118035_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211039.1|2118114_2119860_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211036.1|2119951_2121823_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_054300271.1|2122170_2123145_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273494.1|2123164_2123725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|2124789_2127270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2127344_2128250_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016210899.1|2128749_2130633_-	APC family permease	NA	NA	NA	NA	NA
WP_016210896.1|2130686_2131769_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210904.1|2131811_2132462_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210903.1|2132682_2133054_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_129556487.1|2133172_2134510_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_054300270.1|2134588_2135566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210894.1|2135906_2136209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210902.1|2136719_2136974_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210898.1|2137062_2137413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300269.1|2138324_2138693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2138714_2139080_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2139136_2139301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007012.1|2139290_2139461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|2139455_2140517_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273492.1|2140625_2140745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556486.1|2140835_2141183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556630.1|2141268_2142618_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211781.1|2142927_2144175_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_054300173.1|2144391_2145453_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	2166311	2293876	3062282	transposase,tRNA,integrase,protease	Staphylococcus_phage(12.5%)	117	2194504:2194563	2223732:2224321
WP_075273313.1|2166311_2166650_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|2166609_2166870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300264.1|2167014_2167353_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300263.1|2167340_2167781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2167852_2168827_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212461.1|2169202_2169577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2169580_2170156_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2170101_2170467_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051307332.1|2170675_2170882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300262.1|2170929_2171220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104721.1|2171211_2172918_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_051307331.1|2172989_2174768_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_016210552.1|2175122_2175689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210553.1|2175813_2176467_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_054300261.1|2176493_2177936_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210545.1|2178032_2179010_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_129556482.1|2179158_2179764_+	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_026063577.1|2179835_2180129_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556629.1|2180355_2181102_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_017376905.1|2181332_2181560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|2181624_2181807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|2182243_2182798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046716.1|2183495_2183642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046984.1|2184063_2185182_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047108.1|2185993_2186392_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273488.1|2186447_2187083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2187167_2187533_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2187478_2188054_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211578.1|2188123_2188468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|2188483_2188678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|2188744_2189098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300258.1|2189195_2189975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211585.1|2190036_2190594_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_075273486.1|2190828_2191803_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.2e-29
WP_054300257.1|2191779_2192589_-	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.6	1.8e-29
WP_016211583.1|2192865_2193774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211579.1|2193841_2194327_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
2194504:2194563	attL	TGTAAAACTCCAGATATGATCTGACAAGCTTAAATCATCTGACAACATTTGTCTGATTGA	NA	NA	NA	NA
WP_054300162.1|2194537_2195620_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781361.1|2195890_2196280_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_054300237.1|2196299_2197361_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046986.1|2197549_2198436_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212302.1|2198620_2198920_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_081007067.1|2199140_2204615_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_036780532.1|2205126_2206167_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_054300162.1|2206269_2207352_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781387.1|2207444_2207717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|2207709_2207988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126152.1|2208190_2208781_+|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016211531.1|2208844_2209525_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300254.1|2209878_2210775_+	Abi family protein	NA	A3QSC6	Clostridium_virus	31.6	6.9e-35
WP_016211534.1|2210780_2211290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300253.1|2211276_2212227_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	34.7	6.9e-09
WP_016211528.1|2214081_2214387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664862.1|2214367_2215066_-	P-loop NTPase	NA	NA	NA	NA	NA
WP_032126157.1|2215929_2216334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|2216620_2218513_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_036780074.1|2218855_2219662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307360.1|2220753_2221683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2221771_2222677_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046987.1|2223767_2224451_-|transposase	transposase	transposase	NA	NA	NA	NA
2223732:2224321	attR	TCAATCAGACAAATGTTGTCAGATGATTTAAGCTTGTCAGATCATATCTGGAGTTTTACACCTAAGCTCTTCAAAAGCTATTTGATTTGACCGCACAAGTAATTTATATTTGAGTGCAAAGTGGTTAAGTTGTGCTTTTACACTCAATGTTTCTAGTTTACAAAATGCCACGATTGATGCAAAAATATGATTGCATTGTGACCGAACAGTTTTAGTCGGTGATTTTGCTAAACTTGCATTTTGTTTAATCGACTTATGATATTCTTCAATTTTCCATCGTTTTTGATAGATTTTGTAAAGCCCATCACCATCCGTCTCTAAATCATTTGTTATTAAATAGAGGTGACCTGTTGACCCGTCTTCGTTTGTGAAGATCTTTTTCATTAATCGCACTGGGAAATTAATTCCCTGAAGATATACATCTATGGCCTCACTATCTTTTAAATCAAGAGATTTGACTGGCTGGTAATTTCTATTGATTTTATCATCTAAACTGCAAGCAACTGTTCGATTAGATTTTATTCCTAAAATAAACAACTTATTTAACTTGGCATGAATATAATTCATGTTTTCTTTTGAACTGAACCAGT	NA	NA	NA	NA
WP_155046988.1|2224466_2224835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372266.1|2225167_2225653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300251.1|2225742_2227257_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209659.1|2227383_2228412_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_016209654.1|2228476_2229619_+	galactokinase	NA	NA	NA	NA	NA
WP_016209656.1|2229737_2231441_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209642.1|2231437_2233558_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209652.1|2233554_2234904_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209662.1|2234875_2237023_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209657.1|2237450_2237846_+	CrcB family protein	NA	NA	NA	NA	NA
WP_016209643.1|2237854_2238739_-	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_075273480.1|2238770_2240669_-	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209655.1|2240751_2241024_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_032126161.1|2241127_2243560_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209663.1|2243627_2244929_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_016209647.1|2245010_2245616_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209645.1|2245728_2247033_-	trigger factor	NA	NA	NA	NA	NA
WP_016209661.1|2247636_2248512_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_075273478.1|2248627_2249299_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209658.1|2249475_2250831_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_016209641.1|2250951_2251689_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032126159.1|2251768_2252482_-	aldolase	NA	NA	NA	NA	NA
WP_016209651.1|2253127_2254402_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2254432_2255008_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209649.1|2255052_2256018_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209640.1|2256476_2257496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300250.1|2257914_2258574_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_129556449.1|2258563_2259070_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|2259084_2259450_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046989.1|2259940_2261005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300248.1|2261237_2262212_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	3.1e-28
WP_155046989.1|2262304_2263369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|2263601_2264576_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_129556476.1|2264873_2265884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211684.1|2266428_2267004_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016211685.1|2267027_2268833_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211687.1|2268863_2269508_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_054300245.1|2269763_2270639_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556628.1|2270843_2271659_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.5e-32
WP_016210297.1|2271744_2273124_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_032126463.1|2273180_2274437_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_032126458.1|2274517_2276044_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_054300244.1|2276049_2277048_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_016210290.1|2277288_2278083_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210287.1|2278171_2279035_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_036777321.1|2279155_2280436_-	membrane protein	NA	NA	NA	NA	NA
WP_032126457.1|2281480_2281900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126460.1|2282807_2283245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210301.1|2283421_2284249_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_075273633.1|2284298_2284925_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_016210294.1|2285062_2285407_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_051307327.1|2285724_2286756_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.7e-35
WP_016210303.1|2287031_2287271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2287320_2288382_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210741.1|2289067_2289391_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_016210746.1|2289397_2293294_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_054300242.1|2293339_2293876_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 24
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	2300685	2371846	3062282	transposase,tRNA	Staphylococcus_phage(42.86%)	57	NA	NA
WP_054300271.1|2300685_2301660_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212172.1|2301679_2303152_-	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|2303454_2304429_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300240.1|2304728_2304932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|2305188_2306073_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036777316.1|2306382_2306796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211818.1|2307152_2308409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|2308611_2309112_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_054300238.1|2309408_2309687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273458.1|2309959_2310175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|2310227_2311289_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2311315_2311891_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2311836_2312202_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300559.1|2312917_2313466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2314346_2314802_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273456.1|2314761_2315061_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300276.1|2315183_2316158_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016209398.1|2316740_2317967_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|2318565_2320272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007011.1|2320439_2321660_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209395.1|2321908_2324599_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_016209384.1|2324890_2325706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300234.1|2326056_2326998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300233.1|2327539_2329183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209368.1|2329758_2331288_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_054300232.1|2331323_2332775_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209366.1|2332749_2333709_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_016209365.1|2333786_2337293_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.5	4.9e-193
WP_032126583.1|2337316_2337886_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	42.9	5.7e-27
WP_054300231.1|2338098_2339253_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_016209377.1|2339271_2340045_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_016209390.1|2340044_2340482_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_016209391.1|2340508_2341558_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_016209381.1|2341609_2342143_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_129556472.1|2342223_2344617_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_051307309.1|2344955_2345996_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_016209394.1|2348198_2349263_+	GHMP kinase	NA	NA	NA	NA	NA
WP_016209364.1|2349252_2350281_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_016209393.1|2350277_2350817_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_016209400.1|2351361_2353323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300230.1|2353760_2355392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209397.1|2355512_2356388_-	bacterial lipid A biosynthesis acyltransferase family protein	NA	NA	NA	NA	NA
WP_016209379.1|2356475_2357282_-	cytidylyltransferase	NA	NA	NA	NA	NA
WP_032126580.1|2357289_2358027_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.5	7.2e-22
WP_016209396.1|2358043_2358601_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_016209399.1|2358604_2359342_-	UMP kinase	NA	NA	NA	NA	NA
WP_016209372.1|2359345_2360224_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_032126579.1|2360398_2361166_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_016209375.1|2361588_2362398_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_054300229.1|2362475_2365133_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_016209389.1|2365133_2366171_+	asparaginase	NA	NA	NA	NA	NA
WP_016209373.1|2366172_2366994_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_016209387.1|2367123_2368008_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2368145_2368721_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2368666_2369032_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300228.1|2369937_2371191_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_155046990.1|2371168_2371846_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	2376710	2423221	3062282	tRNA,transposase,protease	Prochlorococcus_phage(33.33%)	48	NA	NA
WP_016210607.1|2376710_2377970_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210598.1|2378138_2378798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556471.1|2378939_2379611_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210609.1|2379970_2380906_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_016210606.1|2381002_2381629_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_054300226.1|2381634_2382216_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210601.1|2382287_2383379_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210599.1|2383461_2384175_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_122940948.1|2384268_2384973_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300148.1|2385295_2386357_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126800.1|2386481_2387216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046954.1|2387442_2387616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|2387722_2388142_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|2389104_2389350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|2389649_2390535_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300223.1|2390772_2391744_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_016209900.1|2391935_2393405_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209924.1|2393398_2394775_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209906.1|2394786_2395179_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209919.1|2395175_2396279_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_032126654.1|2396457_2397759_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209907.1|2397766_2398714_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_016209913.1|2398725_2399544_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_032126655.1|2399546_2400347_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209910.1|2400340_2401399_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_016209903.1|2401395_2402406_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|2402412_2402610_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_054300222.1|2402670_2405577_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209918.1|2405618_2406473_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_032126652.1|2406505_2407072_-	chorismate lyase	NA	NA	NA	NA	NA
WP_016209915.1|2407154_2408015_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016209922.1|2408106_2408523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300221.1|2408582_2409080_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_054300220.1|2409125_2412080_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209901.1|2412109_2412442_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209923.1|2412559_2413078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209908.1|2413552_2414263_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209899.1|2414259_2415294_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_032126651.1|2415397_2415583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2415703_2416069_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2416014_2416590_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212369.1|2416593_2417040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212599.1|2418274_2418484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2418533_2419595_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2419641_2420547_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2421339_2421678_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2421637_2422093_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2422246_2423221_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 26
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	2492054	2534496	3062282	transposase,tRNA	Synechococcus_phage(50.0%)	47	NA	NA
WP_081007066.1|2492054_2492393_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300215.1|2492387_2492882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|2493685_2493976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007010.1|2494025_2494646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210530.1|2495486_2496167_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_016210535.1|2496163_2496976_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_054300212.1|2497049_2500730_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_036776217.1|2500739_2502227_-	ribonuclease G	NA	NA	NA	NA	NA
WP_054300211.1|2502236_2502854_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016210528.1|2502923_2503442_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210536.1|2503438_2504338_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2504353_2505397_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210537.1|2505586_2505874_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210532.1|2505985_2507437_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_032126195.1|2507478_2508915_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_155046713.1|2509209_2509374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300210.1|2509511_2509700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007009.1|2509656_2509827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2509816_2509981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2510037_2510403_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212074.1|2510429_2510651_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_142396463.1|2510737_2510854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|2510964_2511165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212075.1|2511410_2511608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779278.1|2511721_2512675_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300148.1|2512794_2513856_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300208.1|2513833_2514625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|2514754_2515066_+	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_155046991.1|2515413_2515737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779281.1|2515761_2516217_-	arginine repressor	NA	NA	NA	NA	NA
WP_016211489.1|2516206_2517259_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211493.1|2517261_2518725_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211491.1|2519007_2519304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2519564_2520626_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210915.1|2520755_2521220_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_032126715.1|2521417_2522233_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210906.1|2522361_2524674_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_051307343.1|2524793_2525321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210909.1|2526013_2527291_+	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_016210914.1|2527296_2527548_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210913.1|2527581_2528103_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_032126716.1|2528273_2529257_-	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210908.1|2529347_2530163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2531374_2532436_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212580.1|2533171_2533522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2533609_2533975_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273438.1|2533920_2534496_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	2538992	2586545	3062282	transposase,integrase	Escherichia_phage(47.06%)	53	2548873:2548932	2561608:2561868
WP_054300202.1|2538992_2539721_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211244.1|2540122_2540818_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_016211242.1|2540771_2541740_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_129556456.1|2541783_2542533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211238.1|2542734_2544228_-	amino acid permease	NA	NA	NA	NA	NA
WP_129556626.1|2544670_2546059_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211235.1|2546488_2546926_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300202.1|2547420_2548149_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300206.1|2548434_2548671_+	hypothetical protein	NA	NA	NA	NA	NA
2548873:2548932	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_155046992.1|2549137_2549677_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	30.5	8.7e-09
WP_032126362.1|2549637_2550003_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2549948_2550524_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300203.1|2551006_2551465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|2551469_2552072_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211642.1|2552372_2552726_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_016211646.1|2552718_2552958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211918.1|2553329_2554298_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_051307368.1|2554297_2555578_-	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_054300202.1|2556284_2557013_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_075273432.1|2557323_2558058_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_016212023.1|2558054_2559047_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_054300201.1|2559442_2560171_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_054300200.1|2560472_2561051_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	3.9e-47
WP_155046993.1|2561043_2561406_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	37.6	1.3e-13
WP_016212024.1|2561550_2561799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|2561795_2562395_-	AAA family ATPase	NA	NA	NA	NA	NA
2561608:2561868	attR	TGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGAGCTTGGTCACGTATTGGATAACGTCCTTTTTTGGAGCCTTCTAACAGTTGTTGAATTTCAGGAGTAGTTAGAAAATCCCGATCTCGCTCATGACCATCACATGCCAGAGAATGTTCTACTTCAACACTCATCGCTGCAAACCTTTTTTCAGCTCAAACCCTAAGTTAACTCCTTTTAGCCATTGAGGGAGTGATTTACTC	NA	NA	NA	NA
WP_016212022.1|2562394_2562613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|2562842_2563571_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300198.1|2563982_2564312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2564462_2565191_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016210935.1|2565577_2566120_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2566116_2566803_-	acireductone synthase	NA	NA	NA	NA	NA
WP_036778484.1|2566806_2567418_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2567464_2568484_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2568585_2569380_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2569401_2570208_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2570286_2571336_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2571533_2572793_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2572839_2573517_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2573602_2573884_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_155046994.1|2573975_2575130_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.6	2.1e-20
WP_016210820.1|2575399_2576341_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2576844_2577069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2577360_2578065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300196.1|2578479_2579118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2579452_2579983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300195.1|2579979_2581512_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2581508_2582459_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2582879_2583512_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2583754_2583952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2584301_2584730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300194.1|2584807_2585506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2585483_2586545_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	2589757	2641967	3062282	transposase,tRNA	Staphylococcus_phage(22.22%)	52	NA	NA
WP_081007004.1|2589757_2590213_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2590172_2590511_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036778253.1|2590568_2592107_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_098082804.1|2592218_2593317_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2593554_2594754_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2594783_2595422_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|2595437_2597621_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|2597858_2598203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|2599248_2599455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|2599619_2600078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|2600665_2601793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2601916_2602579_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2602670_2602916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2603989_2604649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2604750_2605401_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|2605513_2605834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2605892_2606867_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2607117_2607339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300192.1|2607361_2607583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300191.1|2607627_2608584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300190.1|2609078_2610041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046995.1|2610167_2611053_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210162.1|2611738_2612776_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_032126295.1|2612806_2614261_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_016210181.1|2614270_2615455_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_016210176.1|2615528_2616536_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210183.1|2616604_2618608_-	transketolase	NA	NA	NA	NA	NA
WP_016210174.1|2619058_2620219_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	8.2e-121
WP_036776947.1|2620455_2621571_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210172.1|2621733_2622258_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.6	6.9e-51
WP_016210163.1|2622257_2622788_+	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_016210178.1|2622877_2623345_-	DoxX family protein	NA	NA	NA	NA	NA
WP_016210161.1|2623846_2624101_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210179.1|2624301_2624805_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_129556592.1|2625095_2625626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2625786_2626470_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|2626545_2627325_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_032126297.1|2627311_2628172_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210177.1|2628296_2628662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210175.1|2629047_2629377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300188.1|2629690_2631250_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	9.9e-37
WP_054300148.1|2631495_2632557_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211784.1|2633110_2633833_+	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_016211783.1|2633824_2634190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|2634470_2635748_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211782.1|2636347_2636530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2636591_2636957_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273426.1|2636902_2637478_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047233.1|2637474_2638116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210766.1|2638204_2638648_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_032126291.1|2638651_2639161_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210756.1|2639153_2641967_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
>prophage 29
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	2672033	2708362	3062282	transposase,tRNA,protease	Stx2-converting_phage(20.0%)	37	NA	NA
WP_054300173.1|2672033_2673095_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2673185_2673932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300186.1|2674200_2674920_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2675163_2675526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273422.1|2675712_2676240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2676384_2676801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2678883_2679795_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2679846_2680695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2681139_2681850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2681941_2682910_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2682897_2683545_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036779767.1|2683573_2684425_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2684439_2685717_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2685757_2686273_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_054300183.1|2686351_2687413_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2687434_2688523_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_036777788.1|2688567_2690403_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2690445_2690916_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2690952_2691288_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2691300_2692017_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2691953_2692970_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2692966_2693446_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2693529_2696010_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2696072_2696438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273418.1|2696776_2697115_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2697074_2697530_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2697544_2697835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777784.1|2697900_2699499_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2699629_2699965_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777781.1|2699992_2701657_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210581.1|2701653_2702298_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2702297_2703041_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2703099_2703339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2703489_2704857_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2704867_2705419_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2705499_2706483_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2706604_2708362_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 30
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	2858598	2924170	3062282	transposase	Erwinia_phage(18.18%)	55	NA	NA
WP_054300168.1|2858598_2859462_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2859758_2860811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046999.1|2861099_2861507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2861720_2862212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2862267_2863518_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2863620_2863839_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_036777591.1|2864296_2865151_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016210728.1|2865205_2865676_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2866000_2867380_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2867407_2867866_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2867843_2869061_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2869252_2869489_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2869502_2869658_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2869738_2870701_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2870860_2872177_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2872186_2872855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2873217_2875032_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_054300166.1|2875149_2875938_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211543.1|2876518_2878270_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|2878280_2879081_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|2879183_2879672_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_017375799.1|2881180_2881525_+	DMT family protein	NA	NA	NA	NA	NA
WP_016210038.1|2887218_2888181_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|2888367_2889627_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|2889850_2890177_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|2890371_2891322_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|2891379_2893446_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|2893451_2894447_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|2895032_2896613_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|2896769_2898179_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|2898238_2899372_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|2899511_2900336_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|2900563_2901193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|2901529_2901901_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|2902204_2902492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|2902643_2903492_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|2903619_2904660_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_129556667.1|2904732_2906310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|2906953_2907613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2907767_2908742_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2908817_2909837_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047000.1|2909884_2910031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047001.1|2910235_2910421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2911319_2912402_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300161.1|2912449_2913511_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|2913591_2913900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|2914014_2915331_-	MFS transporter	NA	NA	NA	NA	NA
WP_081007001.1|2915792_2917079_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|2917151_2918048_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|2918134_2919133_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|2919241_2919766_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|2920013_2921252_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|2921799_2922273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|2922269_2922665_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2923594_2924170_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP039190	Piscirickettsia salmonis strain Psal-160 chromosome, complete genome	3062282	2934298	3035170	3062282	transposase,tRNA	Staphylococcus_phage(35.71%)	103	NA	NA
WP_081007000.1|2934298_2935387_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300157.1|2935610_2936891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2937723_2938089_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2938034_2938610_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2938892_2939258_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047002.1|2939272_2939878_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036776867.1|2940248_2941646_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_051307313.1|2941765_2942713_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|2942709_2943225_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|2943211_2944411_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|2944407_2944731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|2944732_2945962_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|2945961_2947005_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|2947004_2947688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|2947684_2950174_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|2950190_2950445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|2950445_2950802_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|2951581_2952745_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|2952764_2955872_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|2955873_2957379_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|2957406_2957688_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|2957836_2958178_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|2958297_2960178_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_155053506.1|2960262_2961780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|2961878_2962994_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|2963121_2964120_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|2964123_2964882_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|2964883_2966083_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|2966066_2966738_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|2966759_2967536_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|2967539_2968538_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|2968539_2969118_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|2969114_2970584_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|2970627_2970915_-	trp operon repressor	NA	NA	NA	NA	NA
WP_054300271.1|2971046_2972021_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209699.1|2972221_2972818_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300152.1|2972844_2973210_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|2973266_2973422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273401.1|2973566_2974019_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300151.1|2974056_2974389_+	DMT family transporter	NA	NA	NA	NA	NA
WP_155047003.1|2975877_2976763_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|2976949_2977171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|2977286_2977919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2977896_2978958_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776841.1|2979397_2979937_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|2980021_2980558_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|2981209_2981512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|2981961_2982270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|2982590_2983040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|2983322_2984033_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|2984259_2984658_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|2985525_2986476_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|2986475_2988554_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|2988701_2989217_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|2989225_2989789_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|2989769_2990516_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|2990655_2991108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|2991243_2992080_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|2992076_2992973_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|2993005_2994073_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|2994091_2994460_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|2994485_2995934_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|2995943_2997323_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|2997363_2998695_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|2998666_2999626_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|2999718_3000222_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3000356_3001508_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3001504_3001984_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3002130_3004452_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3004396_3005023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3005027_3005927_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3005999_3006578_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3006878_3007136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081006999.1|3007144_3007516_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.2	3.4e-20
WP_081006998.1|3007720_3008176_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	1.3e-21
WP_032126637.1|3008292_3008586_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155046758.1|3009434_3009566_+	phosphatase	NA	NA	NA	NA	NA
WP_016212051.1|3010193_3010967_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126148.1|3011508_3011691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3012294_3013269_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3014363_3014702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007065.1|3014718_3015558_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_155047004.1|3015770_3016277_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300144.1|3016291_3016657_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3017961_3018657_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3018653_3020081_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3020106_3020370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3020442_3021417_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047005.1|3021475_3022326_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|3022524_3023499_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007064.1|3023538_3023814_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3023810_3024647_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3024647_3024989_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3024990_3025596_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3025592_3027587_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3027606_3028548_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052104719.1|3028775_3030200_+	MFS transporter	NA	NA	NA	NA	NA
WP_155047006.1|3030606_3030747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3031000_3031975_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3032033_3032690_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126480.1|3032736_3033420_-	methyltransferase	NA	NA	NA	NA	NA
WP_080664873.1|3033965_3034280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556613.1|3034174_3035170_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039191	Piscirickettsia salmonis strain Psal-160 plasmid unnamed1, complete sequence	120784	2231	110548	120784	protease,transposase,integrase	Streptococcus_phage(26.19%)	117	75788:75847	86689:88152
WP_054300202.1|2231_2960_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|3163_5740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047021.1|6034_6190_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300202.1|6213_6942_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273830.1|6971_7304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047014.1|7374_7716_-	hypothetical protein	NA	A0A1B1IQX9	uncultured_Mediterranean_phage	60.3	1.7e-21
WP_054300202.1|7871_8600_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273834.1|8806_9373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273836.1|9715_10777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|10806_11889_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300202.1|12008_12737_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046765.1|13623_13818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047015.1|14198_14522_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212122.1|15398_16100_+	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_016212121.1|16053_16977_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_105962625.1|17410_18296_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.7	4.5e-10
WP_054300271.1|18940_19915_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212151.1|20005_20968_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|20991_21306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|21369_22344_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_033923686.1|22468_23518_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|23626_24667_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|24680_25310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|25400_25700_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211886.1|25696_26125_-	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_052104769.1|27122_28046_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_129556707.1|28360_29380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|29761_30915_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300202.1|30981_31710_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|31807_32221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047016.1|32624_32852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927838.1|32881_33127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|33123_33423_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016212019.1|33579_34275_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_081377351.1|35088_35868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|35951_36104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|36056_36389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|36553_36931_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|37237_37621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273842.1|38090_38819_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	5.4e-38
WP_036781349.1|38934_39261_-	potassium ABC transporter ATPase	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.1e-11
WP_016212365.1|39262_39505_-	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_155047017.1|40858_41038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273844.1|41516_43151_+	protein kinase	NA	NA	NA	NA	NA
WP_129556709.1|43362_43452_+	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_129556710.1|43532_44003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273857.1|44156_44891_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	8.4e-39
WP_016212404.1|45667_45901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273881.1|46021_48208_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.2	9.2e-73
WP_036779532.1|48217_48619_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_016212456.1|48615_48903_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_054300271.1|48946_49921_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212579.1|50520_50718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|52223_52424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212061.1|53193_55236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|56428_56794_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274751.1|56739_57315_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.1e-08
WP_075274752.1|57311_57611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047018.1|57646_58450_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.9e-55
WP_129556718.1|58483_59669_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_075273741.1|59878_60613_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046767.1|60943_61105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|61104_61605_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273747.1|61866_62457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273741.1|62586_63321_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126360.1|64023_64758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|64880_65939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|66447_67194_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|67194_67599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377346.1|67992_68709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047010.1|68853_69096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|69628_70654_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_052104629.1|71475_72501_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212298.1|72780_73107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|73347_73824_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_155047011.1|73938_75091_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	9.8e-58
WP_075273780.1|75100_75808_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
75788:75847	attL	TTTAGCGCTTAGGTAATACAATACTCTGAAAATCAGCCATATTGTGAAATTGTGATAATT	NA	NA	NA	NA
WP_052104629.1|75946_76972_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273782.1|77351_77780_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.0	3.0e-12
WP_155053508.1|78014_78203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126795.1|78502_78763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|78766_79039_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_016211913.1|79364_80486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273786.1|80918_81317_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_105962623.1|81325_82479_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212499.1|83477_83852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|84056_84230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|84477_84927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212412.1|84919_85084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049901.1|85489_86011_+	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	34.4	6.9e-19
WP_075273790.1|86000_86303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|86847_87873_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300590.1|88489_88714_-	hypothetical protein	NA	NA	NA	NA	NA
86689:88152	attR	TTTAGCGCTTAGGTAATACAATACTCTGAAAATCAGCCATATTGTGAAATTGTGATAATTCGACTAAAAATTACTCCCAGTATTCGAAGTGCAGGTGCCAATAATCGATAAAGCAGCTAAAAATAGGCTTAAAACCTGATTATAGACGGACTGCTCCTGTTAGAACTTAATGAGCTGCATGGTCGCTAGGGCTTTGTGGTGCTTCATGATTACTGACAAGCGTTGCTTTGGACGCCCACCGGTTAAAAGCATTTTGCTACCACAAAGGATGCACTCAAACGGGTCAGTGTTGATAAAGCCTTTGAGGAGTGATGCATAAGTGATTTTTTTAACCGGCTCTACCGTCTGGTCCAGTAACTTATAAATTGTTGGCAGCAGCTTTCCGCGGGTGCGAAAGCTCAAGAAGCCGTAATAGCGGATCATCTTAAATGATTTAGTGGGGATGTGACGGATTAGACGCTCAATAAACTCAAATGTTGTACTGGTGTGCTTTTCCTGCTTACCCGTTTTGCGATCAATATAGCGAAAGATCACTTCTTTGCCATCATAGTGCAGTAAGCGTGAATTTGAGAGTGGCGGTCGCTTTAAGTATCGACCTAAATAATCAACGTTTTGGTGGTGTGAAGGCTGAGCTTTTGCAAAATGGACATGCCAGAGTTTATTGTATTCTGGGTTGATGAATCGATTAAATGATGTGAGGTCAGTAATGTGGTTTTGATATTGATGAGGAATCACGAGTTTCCCTGTTTTGTAAGCGGTGCGTAATAAATTAACAATCGAAAACCGCCACATTGGCATCGTTTTTTTCTTTGTGAAATAAACTTTCTTCCAGGTTGTCTTGCACTTAGATAAGCCACCACGTGTCACTGATAAGTGGACGTGCGTATTCCAATTTAAACTCTGGCCGAAAGTATGCAGAGCTGTGAATATACCGATCTTAATTTTTTTCTTCTTTGCAGTTTTGAGCAGAACATTTGCGGCGAGTCGTGATAGATGATTCAGTAGCTCACGATTAGCAAGGAAAAACGGGCAAAGTGCTTTTGGCATGGTGAATGTTATGTGCTGGTATTCGCACTTTGGGAGTAACTTATTCTGTGCAGCAATCCATTGCTCAGTGGCTTTTTTCCACATGAGGAGCATAGCCGTGATTTGCAGGTATAGGTGACGACTTTGGTGTGTTTGCATCCTGAGTTAGAGCAACTGTATTCATCATGACCTGCAAACTTAGTTCTACAGCTGAGCATTTTCACGACGACTTCAACCACAGAGCGAGGAATATTATCGCGATTGGCCACATAGTAGCGCCACCAAGCTCTGCCAGTTTGGAAAAGATGTTTAAGCGTGAATTGAATCAAACTAACTATCTCATTGTGTTGATTAACAAGCGATTAATCATACAGACAACGATAAATTATACAACGGCCCTCCTAAAGTCGCGAGCTGTACTCAGCGAGCCTATCCTTG	NA	NA	NA	NA
WP_129556699.1|89021_89222_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211871.1|89215_89551_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_032126138.1|90116_90380_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_075273796.1|90934_91738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|91858_92383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273798.1|92491_92716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|93116_93857_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_016212413.1|93904_94333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273802.1|94666_95395_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_075273804.1|95479_95818_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|95777_96233_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_075273806.1|96338_96902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273808.1|97163_97688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728342.1|97727_98231_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081377348.1|98545_99295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273810.1|99602_100310_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	34.2	1.4e-11
WP_129556718.1|100296_101482_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_054300271.1|102619_103594_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075273812.1|103590_104148_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.6e-08
WP_032126362.1|104093_104459_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273814.1|105806_106268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|106530_107367_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_129556717.1|107692_108919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|109573_110548_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.8	2.4e-25
