The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	45582	58682	3052649	transposase	Moraxella_phage(25.0%)	17	NA	NA
WP_075273371.1|45582_46158_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46103_46469_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46667_47429_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_036779326.1|47730_49257_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49628_50468_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50507_51815_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51789_52959_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|53013_53739_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54017_54407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54594_55500_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55547_55691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273385.1|55738_56542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007063.1|56569_57055_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	52.0	1.3e-40
WP_032126362.1|57092_57458_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|57403_57979_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007062.1|57942_58272_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.0	7.7e-08
WP_017377700.1|58388_58682_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
>prophage 2
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	152596	201593	3052649	transposase,protease	Bacillus_phage(50.0%)	57	NA	NA
WP_054300545.1|152596_153658_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|154052_154448_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|154469_154835_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154891_155056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|155045_155345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300544.1|155435_155882_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|156377_156944_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|156955_157741_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|158372_159296_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|159347_160343_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|160374_160869_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|160960_161218_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|161307_161730_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|162048_162765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|162808_163060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300543.1|163064_164501_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|164528_165971_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|166058_166397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|166481_167012_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|167072_169265_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|169307_169793_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|170062_170494_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036778324.1|170511_171342_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|171356_171500_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|171530_172415_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|172386_172608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|172781_173060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300542.1|173740_173977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|174002_174908_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556686.1|175338_176220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|176453_177029_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|176974_177340_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300541.1|177667_178447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126848.1|178980_179781_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016211858.1|179999_180758_+	ion transporter	NA	NA	NA	NA	NA
WP_016211859.1|180834_181122_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_075273327.1|181125_181701_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|181646_182012_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|182075_182348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300540.1|182615_182840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300539.1|183855_185199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|185491_186085_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|186053_186707_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|186884_187856_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|187878_188775_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|188933_189380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779493.1|189376_190018_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|190127_190706_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|191181_191619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|191943_193284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|193547_194942_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_054300538.1|196390_197458_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|197510_197933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|198173_198617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|198671_198929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|198906_199533_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|199610_201593_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
>prophage 3
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	217478	271377	3052649	tRNA,transposase,tail	Acinetobacter_phage(50.0%)	44	NA	NA
WP_016209854.1|217478_218465_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|218457_218700_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|218821_220366_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|220412_221699_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|221741_223136_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|223159_223339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|223335_223911_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|223856_224222_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210079.1|227227_227725_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|227895_228591_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|228693_230256_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|230571_232365_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|232450_232723_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|232728_233355_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|233341_234772_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|235104_236160_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|236128_236806_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|236795_237632_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|237791_238085_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|238191_238998_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|239302_240157_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_016210082.1|240311_241361_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_054300536.1|241411_242068_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|242085_243366_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|243639_245001_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_155046933.1|245274_245952_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016211802.1|251384_252656_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036778206.1|252712_253696_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|253692_254478_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_032126362.1|255174_255540_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|255485_256061_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300535.1|256064_256784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|256928_257129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|257176_257638_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|258061_259543_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|259605_260715_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|260812_262774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|263303_263708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|263760_264822_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046934.1|265185_265356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|265729_266812_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_105962623.1|268314_269467_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046935.1|269509_269932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270224_271377_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 4
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	434960	547212	3052649	tRNA,transposase,protease	Escherichia_phage(32.14%)	106	NA	NA
WP_054300513.1|434960_435824_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|436040_437600_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|437621_438656_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|438704_439274_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|439409_440381_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|440392_441970_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|442035_443022_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054300512.1|443353_444463_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|444568_445753_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|445830_447819_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|448027_448183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|448440_448740_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300510.1|449010_449193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|449249_449615_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|450531_451938_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|451955_452942_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|452944_454099_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|454095_454791_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|454925_456416_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|456436_457486_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|457552_458947_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|459825_461757_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|461761_462292_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|462326_462521_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|462563_462923_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|463342_464338_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_036777440.1|464350_466732_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|466737_467025_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|467296_467773_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|467917_468115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|468239_469214_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|470114_470213_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300507.1|470697_471987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|472223_472916_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|472957_473731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|473732_474674_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|474806_476384_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|476593_478351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|478899_479658_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|479865_480438_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|480541_481090_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|481391_481637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|481665_481962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|482229_483153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300506.1|483631_484039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|484110_484839_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126799.1|484919_485732_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_129556452.1|486852_487200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|487202_488942_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046941.1|489343_489607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300500.1|490278_491007_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_054300502.1|491036_491714_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.8	2.9e-09
WP_016212477.1|491886_492132_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_032126794.1|492128_492521_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_054300501.1|492532_493261_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_016212066.1|493621_494398_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016212069.1|494609_494777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212070.1|494751_495351_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_054300500.1|495760_496489_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_017375910.1|497017_497746_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|498644_499373_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211714.1|499447_502792_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|503408_504137_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155046942.1|505069_505956_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|506341_507070_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016212268.1|507226_507811_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|507814_508498_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|508979_509708_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211759.1|510039_511227_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016211756.1|511472_512198_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_032126312.1|512376_513171_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_129556590.1|513167_513563_-	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_051307363.1|513839_514022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|514246_515132_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046943.1|516902_517043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275117.1|517075_517498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211905.1|517741_518152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|518482_519058_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|519003_519369_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300493.1|519430_519643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300492.1|519801_520812_-	protein kinase	NA	NA	NA	NA	NA
WP_016210676.1|521115_523197_-	kinase domain protein	NA	NA	NA	NA	NA
WP_016210671.1|523652_524912_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_036778297.1|525044_525518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210672.1|525526_526909_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_016210677.1|526901_527516_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_016210675.1|527595_528312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210679.1|528479_530804_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.9	2.0e-17
WP_054300491.1|531479_533240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126421.1|533443_534535_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210055.1|534802_535441_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016210070.1|535479_535752_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_032126423.1|535845_536109_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210060.1|536105_536408_-	YciI family protein	NA	NA	NA	NA	NA
WP_016210053.1|536491_537034_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|537195_537822_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_036778098.1|537827_538667_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.3	1.4e-08
WP_016210061.1|538656_539301_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.8e-19
WP_032126424.1|539313_540138_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_016210057.1|540146_540656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210065.1|540796_541456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210075.1|541709_542801_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_016210064.1|542797_544162_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_016210052.1|544286_545483_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
WP_032126425.1|545503_546100_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210066.1|546543_547212_-|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
>prophage 5
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	555686	602576	3052649	integrase,transposase	Escherichia_phage(27.27%)	43	560126:560185	572114:572401
WP_032126790.1|555686_556592_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211874.1|556635_558354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046945.1|558672_559746_-	hypothetical protein	NA	NA	NA	NA	NA
560126:560185	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_016212522.1|560296_560551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300489.1|560647_561250_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_155046946.1|561252_561528_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032126389.1|562929_563118_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212230.1|564651_566100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|566155_567309_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_081007057.1|567366_567783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007056.1|569107_569317_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375841.1|569618_569828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|570134_570353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776735.1|570349_570802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212294.1|570815_571160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046947.1|571589_571757_+	phosphatase	NA	NA	NA	NA	NA
WP_016212659.1|571894_572140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|572284_572434_-	hypothetical protein	NA	NA	NA	NA	NA
572114:572401	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACG	NA	NA	NA	NA
WP_054300484.1|572658_573606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300483.1|574102_574657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211322.1|575192_575783_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211325.1|575845_577366_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211323.1|577355_578453_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211722.1|579880_583183_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_036780093.1|583192_584014_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_054300201.1|584117_584846_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_054300482.1|584875_586165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007054.1|586680_587913_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_080664881.1|588075_588282_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300481.1|588371_589100_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_081007053.1|589201_590062_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_016210616.1|590296_593107_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_016210625.1|593355_594102_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_129556587.1|594160_595063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|595162_595528_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|595473_596049_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_051307334.1|596065_596845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210618.1|597111_598161_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_016210617.1|598225_599650_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_036777984.1|599870_600320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210624.1|600338_600578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|600623_601094_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_075273327.1|602000_602576_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	618670	651857	3052649	tRNA,transposase	Escherichia_phage(57.14%)	34	NA	NA
WP_054300202.1|618670_619399_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_036780855.1|620010_620508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212214.1|620482_620983_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054300202.1|621141_621870_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019359.1|622014_622212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300478.1|622373_624110_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_054300477.1|624389_625118_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211623.1|625840_627481_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_036779883.1|627593_628943_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211625.1|628939_629809_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_054300475.1|630292_631021_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016212196.1|631429_631675_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016212195.1|631671_632058_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212193.1|632125_632464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|632586_633315_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211949.1|633454_634705_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_016211951.1|634738_635836_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_054300202.1|636012_636741_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_032126570.1|636957_637257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211816.1|637269_637623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|637664_639278_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_054300202.1|639483_640212_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|640699_641311_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_036779399.1|641667_641922_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|642020_643805_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779389.1|643893_644613_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|644795_645002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210948.1|645001_645238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|645250_645628_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|646134_646953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210947.1|647046_647244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|647338_648724_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|648850_649441_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_054300202.1|651128_651857_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 7
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	730255	784937	3052649	tRNA,transposase	Agrobacterium_phage(14.29%)	50	NA	NA
WP_081007050.1|730255_730783_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|730839_731205_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211061.1|731266_731620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211058.1|731740_732274_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_032126660.1|732412_734050_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.2	5.8e-88
WP_016211065.1|734054_734276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211066.1|734373_735387_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_016211063.1|735549_737778_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
WP_032126658.1|737758_738463_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|738697_739027_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_054300464.1|740107_741169_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126663.1|741195_741438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126664.1|742156_742840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212048.1|743033_743591_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_054300173.1|744354_745416_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664847.1|745488_746442_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300463.1|746942_749672_+	kinase	NA	NA	NA	NA	NA
WP_016210879.1|749774_750134_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210871.1|750130_750448_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210872.1|750464_751574_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210882.1|751600_752686_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210874.1|752808_753849_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210873.1|753863_754514_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210876.1|754581_755424_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_054300462.1|755889_756807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|757825_758020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036794860.1|758096_758390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|758657_759575_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_016211373.1|760125_760272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211374.1|760326_761517_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211370.1|761649_762093_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211369.1|762135_763179_-	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211368.1|763225_764617_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211371.1|764813_765737_+	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211372.1|765723_766581_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016212287.1|772392_773538_-|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_054300173.1|773616_774678_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211408.1|774901_776248_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_016211412.1|776362_777355_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211411.1|777358_777856_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211407.1|777852_778692_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_051307356.1|778724_780257_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_032126774.1|780416_780752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080728364.1|781648_781921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|782073_782439_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|782384_782960_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300461.1|783051_783360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|783416_783782_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212572.1|783911_784304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|784361_784937_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	841911	873674	3052649	tRNA,transposase	Catovirus(20.0%)	32	NA	NA
WP_016211428.1|841911_843975_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
WP_054300173.1|844245_845307_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300457.1|845467_846757_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300148.1|846944_848006_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273329.1|848053_849355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300455.1|849315_849681_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|849695_850202_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300454.1|850191_850542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|850643_851009_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|850954_851530_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046950.1|851519_851774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300452.1|851823_852885_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210196.1|852842_853196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779341.1|853549_855760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|855760_856447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210198.1|856758_857310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|857326_857728_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210190.1|857918_858794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126472.1|859013_859664_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_036778866.1|860126_862715_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.9	3.3e-122
WP_016210199.1|862820_863582_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_016210206.1|863578_864115_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210205.1|864163_865120_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210187.1|865200_868386_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210201.1|868389_869445_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_036778872.1|869674_870280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778869.1|870323_870986_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_016210194.1|871020_871368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|871424_871586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126473.1|871566_871749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126474.1|871957_872407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|872788_873674_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	879594	925401	3052649	transposase	Staphylococcus_phage(41.67%)	44	NA	NA
WP_081007004.1|879594_880050_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155082339.1|880009_880357_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300449.1|880477_881257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|881276_882251_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_054300448.1|882294_884664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|884853_885915_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300447.1|886327_888964_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_080664849.1|889012_890101_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016210997.1|890100_890784_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_032126469.1|890843_892505_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210998.1|892658_892913_+	LapA family protein	NA	NA	NA	NA	NA
WP_016211001.1|892990_893296_+	competence protein ComEA	NA	NA	NA	NA	NA
WP_016211002.1|893459_893858_+	VOC family protein	NA	NA	NA	NA	NA
WP_155046951.1|893939_894203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781250.1|895009_895795_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300446.1|895890_896625_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	1.1e-09
WP_016210826.1|898055_898922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210824.1|899031_900711_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210830.1|900837_902088_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_032126465.1|902163_902625_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210835.1|902621_903770_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_016210836.1|903775_904450_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_052133275.1|904479_905103_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210828.1|905218_905692_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_016210832.1|905693_906116_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210829.1|906102_907122_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_054300445.1|907391_907943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|908037_909099_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212318.1|909627_910059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|910060_910387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781320.1|910373_910601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|911447_912893_-	MFS transporter	NA	NA	NA	NA	NA
WP_016212205.1|913032_913212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046952.1|914897_915059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|915231_915405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212179.1|915827_915980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|916400_917462_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|917419_917668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300443.1|917720_917999_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211538.1|918237_919161_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_054300442.1|919855_921952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300441.1|922233_922596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300440.1|922740_923952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|924248_925401_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 10
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	960800	997898	3052649	tRNA,transposase,protease	Bacillus_phage(33.33%)	35	NA	NA
WP_026063519.1|960800_961217_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300357.1|961265_962141_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|962691_963276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556565.1|964745_965141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273603.1|965264_965441_-	phosphatase	NA	NA	NA	NA	NA
WP_105962625.1|965520_966406_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126745.1|967587_968190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122940402.1|968398_969022_+	porin family protein	NA	NA	NA	NA	NA
WP_016209896.1|969336_969906_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016209891.1|970052_970751_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_036777115.1|970892_971093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209884.1|971169_971793_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052104600.1|971902_972796_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209898.1|972902_974513_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_016209888.1|974509_975805_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209876.1|975826_977749_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209881.1|977859_978162_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209893.1|978254_983144_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_052104599.1|983198_984515_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.1	3.2e-65
WP_036777110.1|984639_985734_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_016209878.1|985785_986724_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_080664826.1|986804_987404_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209877.1|987570_988461_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_016209887.1|988663_989155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209894.1|989298_989790_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|989958_990672_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556650.1|991100_992075_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_054300433.1|992404_992635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007045.1|992934_993564_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211960.1|993885_994413_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_054300573.1|994676_995810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|995837_996419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|996988_997174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300431.1|997318_997621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007044.1|997580_997898_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	1001020	1044945	3052649	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_129556499.1|1001020_1002174_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_155046705.1|1002279_1002447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|1002392_1002968_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|1003008_1003617_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032126790.1|1003785_1004691_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556560.1|1004660_1005197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556559.1|1005277_1005706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212093.1|1005862_1006792_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_155082339.1|1006995_1007343_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1007302_1007758_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212654.1|1007749_1008034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212100.1|1008444_1009365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212098.1|1009365_1010217_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1010937_1011984_+	glutathione synthase	NA	NA	NA	NA	NA
WP_032126840.1|1011967_1013965_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_122941967.1|1014143_1014449_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|1014678_1014885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|1015145_1015847_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046955.1|1016088_1016268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046956.1|1016789_1016954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300430.1|1017423_1020180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|1020415_1021708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300429.1|1021761_1022022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300428.1|1022322_1022886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211709.1|1023030_1023177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|1025436_1027473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007043.1|1028196_1029939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300426.1|1029898_1031533_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|1031545_1032589_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|1032567_1033029_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_016211081.1|1033069_1034005_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211087.1|1034032_1035028_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_054300425.1|1035235_1036198_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126778.1|1036376_1036571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046957.1|1036785_1037637_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_052047048.1|1037692_1038193_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212611.1|1038289_1038610_+	histidine kinase	NA	NA	NA	NA	NA
WP_054300423.1|1038657_1039719_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212519.1|1039793_1040174_+	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300422.1|1040444_1040882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300421.1|1040932_1041778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274673.1|1041755_1042754_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1042714_1043080_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046958.1|1043025_1043586_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300417.1|1043970_1044945_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 12
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	1057614	1122504	3052649	tRNA,transposase	Bacillus_phage(30.0%)	58	NA	NA
WP_016210280.1|1057614_1058709_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_016210284.1|1058790_1059312_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210276.1|1059366_1059843_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210275.1|1059898_1060201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210273.1|1060265_1060973_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210274.1|1061345_1061744_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_032126334.1|1061783_1062215_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210271.1|1062225_1062909_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1062975_1065171_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_129556492.1|1065268_1066012_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210283.1|1066039_1066825_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_016210272.1|1066864_1067575_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210279.1|1067562_1068729_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210277.1|1068782_1069616_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210270.1|1069685_1072673_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210281.1|1072714_1074106_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_075273303.1|1074119_1074836_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016211367.1|1074991_1075774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126330.1|1075921_1076881_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_036779263.1|1076935_1078945_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_016211366.1|1079000_1079288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126332.1|1079540_1080740_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_075273298.1|1081386_1081962_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300410.1|1081907_1082273_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|1082406_1083270_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1083500_1083794_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126328.1|1084774_1085026_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211589.1|1085154_1086387_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_016211592.1|1086376_1087039_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_129556496.1|1087313_1088552_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_032126329.1|1088737_1089367_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211588.1|1089442_1090144_+	cyclase family protein	NA	NA	NA	NA	NA
WP_129556499.1|1090311_1091464_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016212343.1|1091703_1092510_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_016209808.1|1093814_1094183_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016209824.1|1094179_1094998_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209813.1|1095098_1095914_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_016209801.1|1096198_1098253_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_032126324.1|1098252_1098675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209805.1|1098853_1100347_-	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_016209818.1|1100479_1101295_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209799.1|1101390_1101807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209815.1|1102193_1102733_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_054300409.1|1103050_1104763_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	4.3e-25
WP_016209812.1|1105209_1107033_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_016209821.1|1107122_1107455_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209800.1|1107485_1108082_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_036777933.1|1108078_1109203_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_016209822.1|1109338_1109986_+	methyltransferase domain protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_016209810.1|1110042_1111956_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209803.1|1112160_1113198_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209820.1|1113256_1116556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|1117257_1118226_-	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209809.1|1118332_1118821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209823.1|1119245_1119689_+	response regulator	NA	NA	NA	NA	NA
WP_075273327.1|1120910_1121486_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1121431_1121797_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300408.1|1121847_1122504_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
>prophage 13
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	1131042	1198637	3052649	tRNA,transposase	uncultured_Mediterranean_phage(26.67%)	54	NA	NA
WP_155046942.1|1131042_1131928_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273597.1|1131918_1133763_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|1134034_1135009_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556498.1|1135188_1135797_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036778626.1|1135793_1137734_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_016210594.1|1137869_1138523_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210595.1|1138699_1139878_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210588.1|1140245_1141571_+	fimV domain protein	NA	NA	NA	NA	NA
WP_032126176.1|1141661_1142444_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210587.1|1142545_1143406_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_016210590.1|1143580_1144843_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210593.1|1144922_1145453_+	colicin V production protein	NA	NA	NA	NA	NA
WP_016210586.1|1145474_1146980_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210592.1|1146992_1147649_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016212005.1|1148038_1149799_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_105962623.1|1150699_1151852_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126856.1|1152157_1152499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1152559_1153621_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300406.1|1153921_1156657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|1158956_1159772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273595.1|1160180_1161551_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.6e-12
WP_054300405.1|1161606_1162107_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209947.1|1162628_1163291_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_036777555.1|1163317_1164547_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209940.1|1164703_1167475_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_052104625.1|1167550_1167994_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209931.1|1168146_1169619_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209926.1|1169730_1170792_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209945.1|1170788_1171823_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209932.1|1171825_1172866_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_036777579.1|1173048_1174164_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209930.1|1174202_1174556_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777561.1|1174576_1176445_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209935.1|1176466_1177411_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_016209925.1|1177644_1177923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1178132_1178771_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209944.1|1178745_1180173_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209927.1|1180373_1181051_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209939.1|1181185_1182460_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209943.1|1182527_1183283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209948.1|1183334_1184252_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_054300404.1|1184360_1185254_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075273594.1|1185326_1186697_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300403.1|1186736_1187711_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.0e-27
WP_016211771.1|1188003_1188192_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_016211770.1|1188205_1189339_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_054300402.1|1189538_1193684_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_054300401.1|1194286_1194568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1194899_1195253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1195466_1195661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1196326_1196854_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300400.1|1196910_1197153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1197297_1197564_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273592.1|1197662_1198637_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
>prophage 14
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	1250276	1287573	3052649	transposase	Bacillus_phage(50.0%)	35	NA	NA
WP_032126790.1|1250276_1251182_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1251410_1252682_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_054300386.1|1252706_1253444_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1253696_1254839_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1254855_1256457_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1256968_1257106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1257102_1258380_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1258729_1258912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273583.1|1259458_1259740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1260071_1260977_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1261205_1262477_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_054300386.1|1262501_1263239_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1263491_1264634_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1264650_1266252_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1266763_1266901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1266897_1268175_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1268524_1268707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273583.1|1269253_1269535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1269866_1270772_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1271000_1272272_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_054300386.1|1272296_1273034_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1273286_1274429_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1274445_1276047_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1276558_1276696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1276692_1277970_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1278319_1278502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273583.1|1279048_1279330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046960.1|1279456_1280110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212251.1|1280271_1280808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300384.1|1280969_1281785_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273581.1|1282193_1283561_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.6e-11
WP_052133287.1|1283616_1284015_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212039.1|1284203_1284761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212040.1|1284937_1286287_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_054300162.1|1286490_1287573_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 15
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	1294329	1349920	3052649	tRNA,transposase	Vibrio_phage(18.18%)	51	NA	NA
WP_032126139.1|1294329_1295259_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_054300383.1|1295354_1297835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300382.1|1298105_1298528_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300380.1|1298798_1299455_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1299658_1300024_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|1300038_1300545_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211414.1|1300760_1301579_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|1301686_1302148_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211415.1|1302164_1303088_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211417.1|1303111_1304161_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_051307357.1|1304297_1304891_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211422.1|1304913_1305384_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032126143.1|1305472_1306744_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_054300250.1|1306843_1307503_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_075273327.1|1307492_1308068_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1308013_1308379_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211838.1|1309088_1309262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211840.1|1309732_1310197_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211839.1|1310355_1311828_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211841.1|1311945_1312398_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|1313257_1314319_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1314621_1315704_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300381.1|1315714_1316362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300380.1|1316825_1317482_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962623.1|1317810_1318963_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016211470.1|1319565_1320219_+	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|1320278_1322264_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_032126343.1|1322394_1323207_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_032126344.1|1323327_1324416_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_016211467.1|1324418_1324985_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_081007013.1|1325059_1325359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1326777_1327143_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046961.1|1327310_1327715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032127044.1|1327834_1328035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212482.1|1328249_1328393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1328936_1330089_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_054300378.1|1330098_1331796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|1333651_1334200_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_075273576.1|1334327_1335056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1335115_1338613_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_016210514.1|1338670_1339924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210515.1|1340032_1340935_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210512.1|1340988_1342026_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210506.1|1342161_1343400_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210510.1|1343392_1344121_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_081007040.1|1344151_1344808_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211831.1|1344945_1346673_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|1346973_1347327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1347742_1348243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046962.1|1348894_1349341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1349344_1349920_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	1370706	1411164	3052649	tRNA,transposase,protease	Klosneuvirus(25.0%)	34	NA	NA
WP_016210928.1|1370706_1371012_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_054300375.1|1371226_1371427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728346.1|1372233_1372566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1372583_1373447_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556556.1|1373479_1374055_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1374000_1374366_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211651.1|1374599_1376135_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016211650.1|1376259_1377744_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211648.1|1378403_1378943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|1380146_1380353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126642.1|1380422_1380884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300374.1|1380919_1383490_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	5.1e-30
WP_016209840.1|1383597_1384083_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_016209844.1|1384255_1385296_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209835.1|1385273_1385756_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209848.1|1385752_1388347_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209832.1|1388653_1388917_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209831.1|1389195_1389894_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|1390113_1390308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209827.1|1390383_1391943_-	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_129556633.1|1392261_1393158_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|1393374_1394850_-	APC family permease	NA	NA	NA	NA	NA
WP_016209826.1|1395372_1396395_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209830.1|1396725_1398093_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209846.1|1398328_1398583_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126639.1|1398598_1399885_+	GTPase HflX	NA	NA	NA	NA	NA
WP_016209836.1|1399904_1401119_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_016209838.1|1401118_1402012_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209839.1|1402209_1403508_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209829.1|1404887_1407287_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209834.1|1407283_1408042_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209842.1|1408218_1408608_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_054300373.1|1409335_1410193_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|1410189_1411164_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 17
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	1439085	1618039	3052649	integrase,tRNA,transposase,protease	Staphylococcus_phage(17.5%)	158	1480392:1480451	1560849:1561814
WP_016211285.1|1439085_1439865_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211286.1|1439882_1440230_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211289.1|1440341_1440614_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211767.1|1442230_1443040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211764.1|1443590_1444412_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126803.1|1444612_1445845_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_032126804.1|1445967_1446843_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211806.1|1447007_1447733_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_081007037.1|1447775_1449314_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211804.1|1449320_1450706_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_036780332.1|1451400_1452744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1453383_1454067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273555.1|1454344_1454878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210332.1|1455008_1455752_-	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_016210330.1|1455849_1456233_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210333.1|1456436_1457066_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_032126607.1|1457139_1458423_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_054300368.1|1458762_1460061_+	ankryin	NA	NA	NA	NA	NA
WP_016210325.1|1460214_1461591_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210327.1|1461726_1463058_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_054300367.1|1463118_1463637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210321.1|1463685_1464654_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_129556511.1|1464850_1466287_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300568.1|1466469_1467180_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.3	4.1e-38
WP_054300366.1|1467200_1467614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210320.1|1467763_1468837_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_016210322.1|1468973_1469870_-	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016211334.1|1470199_1470388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211336.1|1470436_1471051_+	chorismate mutase	NA	NA	NA	NA	NA
WP_032126265.1|1471116_1472034_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_052104656.1|1472357_1472861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082827.1|1472937_1474239_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_016211330.1|1474413_1475514_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_032126267.1|1476149_1476392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300365.1|1476385_1476703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300364.1|1476812_1477691_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075273553.1|1477864_1478791_+	MFS transporter	NA	NA	NA	NA	NA
WP_155046964.1|1478780_1479356_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300363.1|1479301_1479649_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212589.1|1480072_1480510_+	MFS transporter	NA	NA	NA	NA	NA
1480392:1480451	attL	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAG	NA	NA	NA	NA
WP_129556637.1|1480984_1481764_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1480392:1480451	attL	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAG	NA	NA	NA	NA
WP_016210843.1|1482378_1482609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210844.1|1482695_1483823_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_129556513.1|1483998_1485744_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_032126340.1|1485824_1486586_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_155046965.1|1486865_1489322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1489473_1490247_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016210841.1|1490305_1490677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1490890_1491865_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211148.1|1492069_1493398_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1493661_1494231_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211151.1|1494246_1494558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1494567_1495524_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1495636_1495990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211153.1|1495993_1497058_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211145.1|1497058_1498798_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_036779218.1|1498804_1499227_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211144.1|1499210_1499840_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_054300271.1|1500396_1501371_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007035.1|1501410_1502076_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273651.1|1502901_1503939_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300359.1|1504297_1504870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664876.1|1505093_1506956_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_081377865.1|1507314_1507599_+|transposase	transposase	transposase	NA	NA	NA	NA
1507052:1507341	attR	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_032126362.1|1508958_1509324_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1507052:1507341	attR	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_129556638.1|1509902_1510583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273551.1|1510582_1510885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211974.1|1510984_1512106_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_054300357.1|1512388_1513264_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212011.1|1513497_1514619_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_016212013.1|1514840_1515224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|1515239_1515917_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300276.1|1515960_1516935_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016211994.1|1518413_1518950_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_032126537.1|1518986_1519172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211991.1|1519412_1520318_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126538.1|1521226_1522645_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_081007034.1|1522909_1523194_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_080728343.1|1523175_1523316_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_052104693.1|1523397_1527264_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_016211564.1|1527429_1528305_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211563.1|1528337_1528499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300355.1|1528709_1528895_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|1528884_1529460_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1529405_1529771_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046966.1|1529731_1530112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1530184_1531159_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046967.1|1531297_1531912_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	40.1	1.5e-33
WP_054300353.1|1531962_1532190_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300565.1|1538216_1538717_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_016210112.1|1539410_1540838_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_122943012.1|1540954_1541410_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210108.1|1541595_1542861_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_016210114.1|1542953_1544213_+	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210107.1|1544284_1544557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210101.1|1544846_1546343_-	flagellin domain protein	NA	NA	NA	NA	NA
WP_016210113.1|1547973_1549023_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210110.1|1549210_1549966_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_036777611.1|1550026_1551616_-	APC family permease	NA	NA	NA	NA	NA
WP_016210106.1|1551798_1552890_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210105.1|1552909_1553230_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210099.1|1553313_1554591_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_017377579.1|1554612_1555449_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210111.1|1555455_1557090_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_054300275.1|1557394_1558270_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210117.1|1558505_1558865_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210103.1|1559146_1560505_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_075273327.1|1560857_1561433_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1561378_1561744_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046968.1|1562252_1563405_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.4	2.2e-57
WP_075273547.1|1563414_1563732_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1563946_1564312_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1564257_1564833_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211627.1|1564996_1565161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211632.1|1565386_1566241_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_054300351.1|1566276_1567098_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211631.1|1567353_1568160_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_155046729.1|1568418_1569465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1569682_1570835_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046942.1|1571220_1572107_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300349.1|1573258_1574983_-	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_032126825.1|1575534_1576848_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_016211481.1|1577080_1578223_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_098082850.1|1578297_1578474_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_052104609.1|1578509_1579142_-	MarC family protein	NA	NA	NA	NA	NA
WP_032126823.1|1579252_1579975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211482.1|1579963_1582237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155082339.1|1582363_1582711_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1582670_1583126_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212267.1|1583292_1583652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1583932_1584580_+	LysE family translocator	NA	NA	NA	NA	NA
WP_155046730.1|1584847_1584988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300161.1|1585206_1586268_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211733.1|1586882_1587707_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_054300347.1|1587762_1589154_-	protein kinase	NA	NA	NA	NA	NA
WP_016211732.1|1589575_1590274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126682.1|1590590_1590917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211399.1|1591024_1591768_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211403.1|1591781_1592825_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211405.1|1592960_1594733_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_129556522.1|1594939_1596172_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_054300271.1|1597482_1598457_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211669.1|1599281_1599632_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211666.1|1599786_1602606_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211664.1|1602978_1603707_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211555.1|1603957_1605316_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_032126677.1|1605390_1605954_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211557.1|1606148_1607378_-	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_016211554.1|1607423_1608050_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_032126678.1|1608376_1609387_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_054300346.1|1609397_1610273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1610419_1611502_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300345.1|1611583_1612663_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1612799_1613165_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1613110_1613686_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1614376_1615351_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1615905_1616967_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1617064_1618039_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 18
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	1646584	1690974	3052649	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_105962625.1|1646584_1647470_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300343.1|1647474_1647702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007030.1|1647737_1648709_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307341.1|1649402_1651001_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_016210848.1|1651167_1652352_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1652935_1653490_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210850.1|1653738_1654992_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210851.1|1654976_1655648_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210847.1|1655670_1656675_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210849.1|1656703_1658152_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210855.1|1658269_1659247_+	DMT family transporter	NA	NA	NA	NA	NA
WP_155046969.1|1659400_1660217_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1660237_1661212_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273543.1|1661251_1661494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776661.1|1662478_1662808_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_032126448.1|1662839_1663220_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211178.1|1663310_1664339_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016211180.1|1664401_1664866_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_032126449.1|1664886_1665810_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_081007029.1|1665876_1666485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776658.1|1666597_1668592_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211177.1|1668983_1670204_+	amino acid permease	NA	NA	NA	NA	NA
WP_155046970.1|1671628_1671877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211739.1|1671993_1672500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126783.1|1672610_1673852_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211741.1|1673997_1674774_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126790.1|1675937_1676843_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155082339.1|1677823_1678171_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1678130_1678586_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126602.1|1678738_1680046_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211857.1|1680296_1681175_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016211855.1|1681171_1681639_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|1681765_1681951_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_054300339.1|1682166_1683138_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.2e-25
WP_129556640.1|1683695_1684922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211351.1|1684997_1685336_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_032127067.1|1685332_1685935_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211349.1|1685931_1687926_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211350.1|1687989_1688928_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211352.1|1689606_1690047_+	universal stress protein	NA	NA	NA	NA	NA
WP_155082339.1|1690211_1690559_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007028.1|1690518_1690974_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	1701274	1770129	3052649	tRNA,transposase	Cedratvirus(14.29%)	59	NA	NA
WP_036779544.1|1701274_1702282_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1702281_1702539_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046972.1|1702798_1703389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300334.1|1704912_1705401_-	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_051307365.1|1705420_1705681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211834.1|1705938_1706253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|1709626_1710616_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1710949_1711135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046973.1|1711491_1711650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1711816_1713772_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016210749.1|1714070_1714532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210752.1|1714701_1715499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556641.1|1717875_1719138_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016211454.1|1723092_1723563_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_016211452.1|1724313_1725801_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211455.1|1725862_1727320_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_122942091.1|1727425_1727821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1727848_1728427_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_054300330.1|1729048_1730110_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274658.1|1730159_1731365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046974.1|1731516_1731678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300328.1|1731788_1732565_+	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_016212459.1|1732702_1733083_-	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_155046975.1|1733202_1733652_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_054300326.1|1734065_1734530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1734631_1734904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273534.1|1735097_1735979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|1736341_1737367_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300323.1|1737610_1738204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300322.1|1738591_1740526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1740564_1741479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1743049_1743316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1743392_1744049_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212446.1|1744083_1744845_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.1	1.2e-48
WP_016212445.1|1745207_1745474_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1745719_1746175_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1746134_1746473_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556531.1|1746435_1746633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211752.1|1746837_1747983_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211748.1|1747998_1749603_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211749.1|1749682_1750876_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_032126540.1|1751084_1751948_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212346.1|1752181_1752328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300321.1|1753122_1753494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300320.1|1753711_1754311_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047087.1|1754288_1754507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|1754957_1755983_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300318.1|1756130_1757108_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211465.1|1757735_1758719_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211464.1|1758869_1759217_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_032126752.1|1759213_1759816_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211466.1|1759903_1761424_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126753.1|1761493_1761958_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_054300317.1|1762914_1763448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046976.1|1763744_1763882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007073.1|1763947_1764118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777066.1|1764100_1767157_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209619.1|1767243_1768692_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209621.1|1769124_1770129_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 20
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	1798702	1842475	3052649	transposase	Escherichia_phage(33.33%)	40	NA	NA
WP_054300202.1|1798702_1799431_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_081007021.1|1799423_1799990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126786.1|1800288_1803369_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016211319.1|1803386_1804439_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211316.1|1804971_1805622_+	porin family protein	NA	NA	NA	NA	NA
WP_016211315.1|1805956_1806601_+	porin family protein	NA	NA	NA	NA	NA
WP_054300314.1|1806788_1807124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273532.1|1807084_1807672_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126997.1|1807889_1808129_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_032126998.1|1808450_1808798_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_036774554.1|1808896_1809175_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1809227_1809515_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1809518_1810405_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923708.1|1812867_1813743_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211346.1|1814274_1814916_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_016211340.1|1814943_1815165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211347.1|1815157_1816141_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211344.1|1816354_1817173_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_054300313.1|1817333_1819016_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	1.6e-32
WP_054300312.1|1819023_1820046_-	YHYH protein	NA	NA	NA	NA	NA
WP_016211341.1|1820244_1820415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1820559_1821534_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211940.1|1821647_1821980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1822100_1823360_-	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_054300310.1|1825161_1825686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211210.1|1825788_1827270_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_052104715.1|1827276_1827483_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211211.1|1827531_1828611_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211215.1|1828802_1830773_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_054300309.1|1831133_1832693_+	APC family permease	NA	NA	NA	NA	NA
WP_054300308.1|1832987_1833218_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300307.1|1833247_1833976_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300306.1|1834078_1834303_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016211983.1|1834550_1835210_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556643.1|1835305_1836670_+	histidine kinase	NA	NA	NA	NA	NA
WP_016212551.1|1837127_1837622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211946.1|1838977_1839733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556540.1|1839951_1840347_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211947.1|1840339_1841485_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_033923708.1|1841599_1842475_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	1886879	1905661	3052649	transposase	Staphylococcus_phage(50.0%)	17	NA	NA
WP_032126540.1|1886879_1887743_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300189.1|1887876_1888242_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1888298_1888463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046980.1|1888452_1888752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046981.1|1888741_1888918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300299.1|1889007_1890090_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|1892291_1893842_-	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_075273524.1|1893997_1894963_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1895003_1895978_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_098082828.1|1896342_1896600_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1896599_1897607_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212247.1|1897973_1898729_+	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1899356_1900331_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300162.1|1900670_1901753_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212246.1|1901856_1902513_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300297.1|1903448_1904516_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1904578_1905661_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 22
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	1950172	1960520	3052649	transposase	Acinetobacter_phage(50.0%)	15	NA	NA
WP_054300294.1|1950172_1951234_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300293.1|1951505_1951871_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1951927_1952092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|1952081_1952255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|1952227_1952380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300292.1|1952835_1953837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779544.1|1954091_1955099_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1955098_1955356_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007015.1|1955567_1955993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1956485_1957638_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_054300288.1|1957647_1958337_-	hypothetical protein	NA	A0A0N7AE80	Bacillus_phage	28.2	3.2e-08
WP_054300287.1|1958745_1959075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1959096_1959462_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1959407_1959983_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300285.1|1959983_1960520_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	2026555	2081470	3052649	tRNA,transposase,protease	Orpheovirus(16.67%)	56	NA	NA
WP_016209434.1|2026555_2027977_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_129556553.1|2028066_2029659_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_016209439.1|2029822_2030449_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_054300277.1|2030529_2033211_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_016209445.1|2033693_2034650_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_016209435.1|2034750_2035122_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_016209404.1|2035148_2036012_+	chemotaxis phosphatase CheX family protein	NA	NA	NA	NA	NA
WP_016209416.1|2036001_2036787_-	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209413.1|2037075_2037561_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_016209443.1|2037635_2038157_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016209405.1|2038202_2039096_-	cheW-like domain protein	NA	NA	NA	NA	NA
WP_016209406.1|2039092_2039914_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.2	5.0e-16
WP_016209408.1|2040228_2040399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209427.1|2040552_2041956_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_052047073.1|2042049_2043300_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080664816.1|2043286_2044018_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_016209424.1|2044029_2045307_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209433.1|2045406_2045781_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209412.1|2045865_2046753_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209436.1|2046810_2047539_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_129556555.1|2047535_2048666_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209444.1|2048796_2049225_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_032126508.1|2049319_2049679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209447.1|2049668_2050880_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016209421.1|2050876_2051665_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209411.1|2051827_2052622_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_054300276.1|2052827_2053802_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_032126933.1|2053970_2055272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2055275_2055575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2055564_2055729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2055785_2056151_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211553.1|2056490_2057231_-	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_016211549.1|2057234_2059739_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211548.1|2060001_2060958_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211550.1|2060941_2061703_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_054300275.1|2061780_2062656_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2062780_2063026_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016211262.1|2063085_2065359_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_075273504.1|2065413_2065767_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|2065956_2066250_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_032126515.1|2066422_2066602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307354.1|2066677_2067253_-	DedA family protein	NA	NA	NA	NA	NA
WP_032126514.1|2067535_2068852_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2068862_2069231_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016211265.1|2069261_2069924_-	adenylate kinase	NA	NA	NA	NA	NA
WP_054300274.1|2070098_2070464_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2070409_2070985_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126519.1|2071152_2071872_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_016211478.1|2071851_2072667_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126518.1|2072683_2074885_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211474.1|2074967_2076317_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_016211473.1|2076391_2076991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211476.1|2076974_2077184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777061.1|2077501_2078689_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211932.1|2078884_2080174_+	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_129556478.1|2080584_2081470_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	2094006	2135820	3052649	tRNA,transposase	Moraxella_phage(16.67%)	39	NA	NA
WP_054300173.1|2094006_2095068_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776407.1|2095316_2096453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211446.1|2096636_2098364_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_016211448.1|2098353_2099562_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211450.1|2099660_2100683_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155047009.1|2101458_2101632_+	phosphatase	NA	NA	NA	NA	NA
WP_052104774.1|2101776_2102409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2102456_2103518_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126170.1|2103681_2103954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211040.1|2104181_2105393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211037.1|2105743_2106373_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211042.1|2106421_2107438_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211035.1|2107684_2107900_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211043.1|2107952_2108402_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211039.1|2108481_2110227_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211036.1|2110318_2112190_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_054300271.1|2112537_2113512_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273494.1|2113531_2114092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|2115156_2117637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2117711_2118617_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016210899.1|2119116_2121000_-	APC family permease	NA	NA	NA	NA	NA
WP_016210896.1|2121053_2122136_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210904.1|2122178_2122829_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210903.1|2123049_2123421_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_129556487.1|2123539_2124877_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_054300270.1|2124955_2125933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210894.1|2126273_2126576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210902.1|2127086_2127341_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210898.1|2127429_2127780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300269.1|2128691_2129060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2129081_2129447_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2129503_2129668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007012.1|2129657_2129828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|2129822_2130884_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273492.1|2130992_2131112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556486.1|2131202_2131550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556630.1|2131635_2132985_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211781.1|2133294_2134542_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_054300173.1|2134758_2135820_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	2156669	2284243	3052649	integrase,tRNA,transposase,protease	Staphylococcus_phage(12.5%)	117	2184871:2184930	2214099:2214688
WP_155082339.1|2156669_2157017_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|2156976_2157237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300264.1|2157381_2157720_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300263.1|2157707_2158148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2158219_2159194_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212461.1|2159569_2159944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2159947_2160523_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2160468_2160834_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051307332.1|2161042_2161249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300262.1|2161296_2161587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104721.1|2161578_2163285_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_051307331.1|2163356_2165135_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_016210552.1|2165489_2166056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210553.1|2166180_2166834_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_054300261.1|2166860_2168303_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210545.1|2168399_2169377_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_129556482.1|2169525_2170131_+	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_026063577.1|2170202_2170496_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556629.1|2170722_2171469_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_017376905.1|2171699_2171927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|2171991_2172174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|2172610_2173165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046716.1|2173862_2174009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046984.1|2174430_2175549_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047108.1|2176360_2176759_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273488.1|2176814_2177450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2177534_2177900_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2177845_2178421_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211578.1|2178490_2178835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|2178850_2179045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|2179111_2179465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300258.1|2179562_2180342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211585.1|2180403_2180961_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_075273486.1|2181195_2182170_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.2e-29
WP_054300257.1|2182146_2182956_-	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.6	1.8e-29
WP_016211583.1|2183232_2184141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211579.1|2184208_2184694_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
2184871:2184930	attL	TGTAAAACTCCAGATATGATCTGACAAGCTTAAATCATCTGACAACATTTGTCTGATTGA	NA	NA	NA	NA
WP_054300162.1|2184904_2185987_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781361.1|2186257_2186647_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_054300237.1|2186666_2187728_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046986.1|2187916_2188803_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212302.1|2188987_2189287_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_081007067.1|2189507_2194982_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_036780532.1|2195493_2196534_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_054300162.1|2196636_2197719_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781387.1|2197811_2198084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|2198076_2198355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126152.1|2198557_2199148_+|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016211531.1|2199211_2199892_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300254.1|2200245_2201142_+	Abi family protein	NA	A3QSC6	Clostridium_virus	31.6	6.9e-35
WP_016211534.1|2201147_2201657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300253.1|2201643_2202594_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	34.7	6.9e-09
WP_016211528.1|2204448_2204754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664862.1|2204734_2205433_-	P-loop NTPase	NA	NA	NA	NA	NA
WP_032126157.1|2206296_2206701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|2206987_2208880_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_036780074.1|2209222_2210029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307360.1|2211120_2212050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2212138_2213044_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046987.1|2214134_2214818_-|transposase	transposase	transposase	NA	NA	NA	NA
2214099:2214688	attR	TCAATCAGACAAATGTTGTCAGATGATTTAAGCTTGTCAGATCATATCTGGAGTTTTACACCTAAGCTCTTCAAAAGCTATTTGATTTGACCGCACAAGTAATTTATATTTGAGTGCAAAGTGGTTAAGTTGTGCTTTTACACTCAATGTTTCTAGTTTACAAAATGCCACGATTGATGCAAAAATATGATTGCATTGTGACCGAACAGTTTTAGTCGGTGATTTTGCTAAACTTGCATTTTGTTTAATCGACTTATGATATTCTTCAATTTTCCATCGTTTTTGATAGATTTTGTAAAGCCCATCACCATCCGTCTCTAAATCATTTGTTATTAAATAGAGGTGACCTGTTGACCCGTCTTCGTTTGTGAAGATCTTTTTCATTAATCGCACTGGGAAATTAATTCCCTGAAGATATACATCTATGGCCTCACTATCTTTTAAATCAAGAGATTTGACTGGCTGGTAATTTCTATTGATTTTATCATCTAAACTGCAAGCAACTGTTCGATTAGATTTTATTCCTAAAATAAACAACTTATTTAACTTGGCATGAATATAATTCATGTTTTCTTTTGAACTGAACCAGT	NA	NA	NA	NA
WP_155046988.1|2214833_2215202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372266.1|2215534_2216020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300251.1|2216109_2217624_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209659.1|2217750_2218779_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_016209654.1|2218843_2219986_+	galactokinase	NA	NA	NA	NA	NA
WP_016209656.1|2220104_2221808_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209642.1|2221804_2223925_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209652.1|2223921_2225271_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209662.1|2225242_2227390_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209657.1|2227817_2228213_+	CrcB family protein	NA	NA	NA	NA	NA
WP_016209643.1|2228221_2229106_-	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_075273480.1|2229137_2231036_-	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209655.1|2231118_2231391_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_032126161.1|2231494_2233927_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209663.1|2233994_2235296_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_016209647.1|2235377_2235983_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209645.1|2236095_2237400_-	trigger factor	NA	NA	NA	NA	NA
WP_016209661.1|2238003_2238879_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_075273478.1|2238994_2239666_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209658.1|2239842_2241198_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_016209641.1|2241318_2242056_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032126159.1|2242135_2242849_-	aldolase	NA	NA	NA	NA	NA
WP_016209651.1|2243494_2244769_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2244799_2245375_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209649.1|2245419_2246385_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209640.1|2246843_2247863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300250.1|2248281_2248941_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_129556449.1|2248930_2249437_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|2249451_2249817_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046989.1|2250307_2251372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300248.1|2251604_2252579_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	3.1e-28
WP_155046989.1|2252671_2253736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|2253968_2254943_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_129556476.1|2255240_2256251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211684.1|2256795_2257371_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016211685.1|2257394_2259200_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211687.1|2259230_2259875_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_054300245.1|2260130_2261006_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556628.1|2261210_2262026_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.5e-32
WP_016210297.1|2262111_2263491_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_032126463.1|2263547_2264804_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_032126458.1|2264884_2266411_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_054300244.1|2266416_2267415_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_016210290.1|2267655_2268450_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210287.1|2268538_2269402_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_036777321.1|2269522_2270803_-	membrane protein	NA	NA	NA	NA	NA
WP_032126457.1|2271847_2272267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126460.1|2273174_2273612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210301.1|2273788_2274616_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_075273633.1|2274665_2275292_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_016210294.1|2275429_2275774_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_051307327.1|2276091_2277123_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.7e-35
WP_016210303.1|2277398_2277638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2277687_2278749_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210741.1|2279434_2279758_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_016210746.1|2279764_2283661_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_054300242.1|2283706_2284243_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 26
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	2291052	2362213	3052649	tRNA,transposase	Staphylococcus_phage(42.86%)	57	NA	NA
WP_054300271.1|2291052_2292027_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212172.1|2292046_2293519_-	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|2293821_2294796_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300240.1|2295095_2295299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|2295555_2296440_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036777316.1|2296749_2297163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211818.1|2297519_2298776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|2298978_2299479_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_054300238.1|2299775_2300054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273458.1|2300326_2300542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|2300594_2301656_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2301682_2302258_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2302203_2302569_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300559.1|2303284_2303833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2304713_2305169_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273456.1|2305128_2305428_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300276.1|2305550_2306525_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016209398.1|2307107_2308334_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|2308932_2310639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007011.1|2310806_2312027_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209395.1|2312275_2314966_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_016209384.1|2315257_2316073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300234.1|2316423_2317365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300233.1|2317906_2319550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209368.1|2320125_2321655_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_054300232.1|2321690_2323142_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209366.1|2323116_2324076_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_016209365.1|2324153_2327660_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.5	4.9e-193
WP_032126583.1|2327683_2328253_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	42.9	5.7e-27
WP_054300231.1|2328465_2329620_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_016209377.1|2329638_2330412_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_016209390.1|2330411_2330849_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_016209391.1|2330875_2331925_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_016209381.1|2331976_2332510_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_129556472.1|2332590_2334984_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_051307309.1|2335322_2336363_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_016209394.1|2338565_2339630_+	GHMP kinase	NA	NA	NA	NA	NA
WP_016209364.1|2339619_2340648_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_016209393.1|2340644_2341184_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_016209400.1|2341728_2343690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300230.1|2344127_2345759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209397.1|2345879_2346755_-	bacterial lipid A biosynthesis acyltransferase family protein	NA	NA	NA	NA	NA
WP_016209379.1|2346842_2347649_-	cytidylyltransferase	NA	NA	NA	NA	NA
WP_032126580.1|2347656_2348394_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.5	7.2e-22
WP_016209396.1|2348410_2348968_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_016209399.1|2348971_2349709_-	UMP kinase	NA	NA	NA	NA	NA
WP_016209372.1|2349712_2350591_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_032126579.1|2350765_2351533_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_016209375.1|2351955_2352765_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_054300229.1|2352842_2355500_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_016209389.1|2355500_2356538_+	asparaginase	NA	NA	NA	NA	NA
WP_016209373.1|2356539_2357361_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_016209387.1|2357490_2358375_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2358512_2359088_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2359033_2359399_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300228.1|2360304_2361558_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_155046990.1|2361535_2362213_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	2367077	2413588	3052649	tRNA,transposase,protease	Prochlorococcus_phage(33.33%)	48	NA	NA
WP_016210607.1|2367077_2368337_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210598.1|2368505_2369165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556471.1|2369306_2369978_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210609.1|2370337_2371273_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_016210606.1|2371369_2371996_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_054300226.1|2372001_2372583_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210601.1|2372654_2373746_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210599.1|2373828_2374542_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_122940948.1|2374635_2375340_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300148.1|2375662_2376724_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126800.1|2376848_2377583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046954.1|2377809_2377983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|2378089_2378509_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|2379471_2379717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|2380016_2380902_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300223.1|2381139_2382111_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_016209900.1|2382302_2383772_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209924.1|2383765_2385142_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209906.1|2385153_2385546_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209919.1|2385542_2386646_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_032126654.1|2386824_2388126_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209907.1|2388133_2389081_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_016209913.1|2389092_2389911_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_032126655.1|2389913_2390714_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209910.1|2390707_2391766_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_016209903.1|2391762_2392773_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|2392779_2392977_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_054300222.1|2393037_2395944_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209918.1|2395985_2396840_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_032126652.1|2396872_2397439_-	chorismate lyase	NA	NA	NA	NA	NA
WP_016209915.1|2397521_2398382_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016209922.1|2398473_2398890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300221.1|2398949_2399447_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_054300220.1|2399492_2402447_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209901.1|2402476_2402809_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209923.1|2402926_2403445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209908.1|2403919_2404630_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209899.1|2404626_2405661_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_032126651.1|2405764_2405950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2406070_2406436_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2406381_2406957_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212369.1|2406960_2407407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212599.1|2408641_2408851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2408900_2409962_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2410008_2410914_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155082339.1|2411697_2412045_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2412004_2412460_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2412613_2413588_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 28
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	2482421	2524863	3052649	tRNA,transposase	Synechococcus_phage(50.0%)	47	NA	NA
WP_081007066.1|2482421_2482760_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300215.1|2482754_2483249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|2484052_2484343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007010.1|2484392_2485013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210530.1|2485853_2486534_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_016210535.1|2486530_2487343_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_054300212.1|2487416_2491097_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_036776217.1|2491106_2492594_-	ribonuclease G	NA	NA	NA	NA	NA
WP_054300211.1|2492603_2493221_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016210528.1|2493290_2493809_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210536.1|2493805_2494705_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2494720_2495764_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210537.1|2495953_2496241_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210532.1|2496352_2497804_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_032126195.1|2497845_2499282_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_155046713.1|2499576_2499741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300210.1|2499878_2500067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007009.1|2500023_2500194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2500183_2500348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2500404_2500770_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212074.1|2500796_2501018_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_142396463.1|2501104_2501221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|2501331_2501532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212075.1|2501777_2501975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779278.1|2502088_2503042_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300148.1|2503161_2504223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300208.1|2504200_2504992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|2505121_2505433_+	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_155046991.1|2505780_2506104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779281.1|2506128_2506584_-	arginine repressor	NA	NA	NA	NA	NA
WP_016211489.1|2506573_2507626_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211493.1|2507628_2509092_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211491.1|2509374_2509671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2509931_2510993_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210915.1|2511122_2511587_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_032126715.1|2511784_2512600_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210906.1|2512728_2515041_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_051307343.1|2515160_2515688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210909.1|2516380_2517658_+	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_016210914.1|2517663_2517915_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210913.1|2517948_2518470_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_032126716.1|2518640_2519624_-	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210908.1|2519714_2520530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2521741_2522803_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212580.1|2523538_2523889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2523976_2524342_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273438.1|2524287_2524863_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	2529359	2576912	3052649	integrase,transposase	Escherichia_phage(47.06%)	53	2539240:2539299	2551975:2552235
WP_054300202.1|2529359_2530088_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211244.1|2530489_2531185_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_016211242.1|2531138_2532107_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_129556456.1|2532150_2532900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211238.1|2533101_2534595_-	amino acid permease	NA	NA	NA	NA	NA
WP_129556626.1|2535037_2536426_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211235.1|2536855_2537293_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300202.1|2537787_2538516_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300206.1|2538801_2539038_+	hypothetical protein	NA	NA	NA	NA	NA
2539240:2539299	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_155046992.1|2539504_2540044_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	30.5	8.7e-09
WP_032126362.1|2540004_2540370_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2540315_2540891_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300203.1|2541373_2541832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|2541836_2542439_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211642.1|2542739_2543093_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_016211646.1|2543085_2543325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211918.1|2543696_2544665_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_051307368.1|2544664_2545945_-	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_054300202.1|2546651_2547380_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_075273432.1|2547690_2548425_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_016212023.1|2548421_2549414_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_054300201.1|2549809_2550538_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_054300200.1|2550839_2551418_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	3.9e-47
WP_155046993.1|2551410_2551773_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	37.6	1.3e-13
WP_016212024.1|2551917_2552166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|2552162_2552762_-	AAA family ATPase	NA	NA	NA	NA	NA
2551975:2552235	attR	TGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGAGCTTGGTCACGTATTGGATAACGTCCTTTTTTGGAGCCTTCTAACAGTTGTTGAATTTCAGGAGTAGTTAGAAAATCCCGATCTCGCTCATGACCATCACATGCCAGAGAATGTTCTACTTCAACACTCATCGCTGCAAACCTTTTTTCAGCTCAAACCCTAAGTTAACTCCTTTTAGCCATTGAGGGAGTGATTTACTC	NA	NA	NA	NA
WP_016212022.1|2552761_2552980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|2553209_2553938_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300198.1|2554349_2554679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2554829_2555558_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016210935.1|2555944_2556487_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2556483_2557170_-	acireductone synthase	NA	NA	NA	NA	NA
WP_036778484.1|2557173_2557785_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2557831_2558851_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2558952_2559747_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2559768_2560575_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2560653_2561703_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2561900_2563160_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2563206_2563884_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2563969_2564251_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_155046994.1|2564342_2565497_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.6	2.1e-20
WP_016210820.1|2565766_2566708_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2567211_2567436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2567727_2568432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300196.1|2568846_2569485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2569819_2570350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300195.1|2570346_2571879_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2571875_2572826_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2573246_2573879_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2574121_2574319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2574668_2575097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300194.1|2575174_2575873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2575850_2576912_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	2580124	2632334	3052649	tRNA,transposase	Staphylococcus_phage(22.22%)	52	NA	NA
WP_081007004.1|2580124_2580580_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155082339.1|2580539_2580887_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036778253.1|2580935_2582474_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_098082804.1|2582585_2583684_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2583921_2585121_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2585150_2585789_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|2585804_2587988_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|2588225_2588570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|2589615_2589822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|2589986_2590445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|2591032_2592160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2592283_2592946_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2593037_2593283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2594356_2595016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2595117_2595768_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|2595880_2596201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2596259_2597234_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2597484_2597706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300192.1|2597728_2597950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300191.1|2597994_2598951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300190.1|2599445_2600408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046995.1|2600534_2601420_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210162.1|2602105_2603143_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_032126295.1|2603173_2604628_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_016210181.1|2604637_2605822_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_016210176.1|2605895_2606903_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210183.1|2606971_2608975_-	transketolase	NA	NA	NA	NA	NA
WP_016210174.1|2609425_2610586_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	8.2e-121
WP_036776947.1|2610822_2611938_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210172.1|2612100_2612625_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.6	6.9e-51
WP_016210163.1|2612624_2613155_+	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_016210178.1|2613244_2613712_-	DoxX family protein	NA	NA	NA	NA	NA
WP_016210161.1|2614213_2614468_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210179.1|2614668_2615172_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_129556592.1|2615462_2615993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2616153_2616837_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|2616912_2617692_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_032126297.1|2617678_2618539_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210177.1|2618663_2619029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210175.1|2619414_2619744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300188.1|2620057_2621617_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	9.9e-37
WP_054300148.1|2621862_2622924_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211784.1|2623477_2624200_+	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_016211783.1|2624191_2624557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|2624837_2626115_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211782.1|2626714_2626897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2626958_2627324_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273426.1|2627269_2627845_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273424.1|2627859_2628483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210766.1|2628571_2629015_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_032126291.1|2629018_2629528_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210756.1|2629520_2632334_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
>prophage 31
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	2662400	2698729	3052649	tRNA,transposase,protease	Stx2-converting_phage(20.0%)	37	NA	NA
WP_054300173.1|2662400_2663462_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2663552_2664299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300186.1|2664567_2665287_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2665530_2665893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273422.1|2666079_2666607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2666751_2667168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2669250_2670162_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2670213_2671062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2671506_2672217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2672308_2673277_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2673264_2673912_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036779767.1|2673940_2674792_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2674806_2676084_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2676124_2676640_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_054300183.1|2676718_2677780_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2677801_2678890_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_036777788.1|2678934_2680770_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2680812_2681283_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2681319_2681655_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2681667_2682384_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2682320_2683337_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2683333_2683813_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2683896_2686377_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2686439_2686805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155082340.1|2687134_2687482_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2687441_2687897_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2687911_2688202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777784.1|2688267_2689866_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2689996_2690332_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777781.1|2690359_2692024_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210581.1|2692020_2692665_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2692664_2693408_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2693466_2693706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2693856_2695224_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2695234_2695786_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2695866_2696850_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2696971_2698729_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 32
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	2848965	2914537	3052649	transposase	Erwinia_phage(18.18%)	55	NA	NA
WP_054300168.1|2848965_2849829_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2850125_2851178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046999.1|2851466_2851874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2852087_2852579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2852634_2853885_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2853987_2854206_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_036777591.1|2854663_2855518_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016210728.1|2855572_2856043_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2856367_2857747_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2857774_2858233_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2858210_2859428_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2859619_2859856_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2859869_2860025_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2860105_2861068_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2861227_2862544_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2862553_2863222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2863584_2865399_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_054300166.1|2865516_2866305_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211543.1|2866885_2868637_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|2868647_2869448_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|2869550_2870039_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_017375799.1|2871547_2871892_+	DMT family protein	NA	NA	NA	NA	NA
WP_016210038.1|2877585_2878548_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|2878734_2879994_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|2880217_2880544_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|2880738_2881689_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|2881746_2883813_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|2883818_2884814_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|2885399_2886980_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|2887136_2888546_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|2888605_2889739_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|2889878_2890703_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|2890930_2891560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|2891896_2892268_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|2892571_2892859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|2893010_2893859_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|2893986_2895027_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_129556667.1|2895099_2896677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|2897320_2897980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2898134_2899109_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2899184_2900204_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047000.1|2900251_2900398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047001.1|2900602_2900788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2901686_2902769_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300161.1|2902816_2903878_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|2903958_2904267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|2904381_2905698_-	MFS transporter	NA	NA	NA	NA	NA
WP_081007001.1|2906159_2907446_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|2907518_2908415_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|2908501_2909500_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|2909608_2910133_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|2910380_2911619_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|2912166_2912640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|2912636_2913032_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2913961_2914537_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP039181	Piscirickettsia salmonis strain Psal-158 chromosome, complete genome	3052649	2924665	3025537	3052649	tRNA,transposase	Staphylococcus_phage(35.71%)	103	NA	NA
WP_081007000.1|2924665_2925754_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300157.1|2925977_2927258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2928090_2928456_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2928401_2928977_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2929259_2929625_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047002.1|2929639_2930245_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036776867.1|2930615_2932013_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_051307313.1|2932132_2933080_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|2933076_2933592_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|2933578_2934778_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|2934774_2935098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|2935099_2936329_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|2936328_2937372_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|2937371_2938055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|2938051_2940541_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|2940557_2940812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|2940812_2941169_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|2941948_2943112_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|2943131_2946239_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|2946240_2947746_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|2947773_2948055_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|2948203_2948545_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|2948664_2950545_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_075274705.1|2950629_2952228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|2952245_2953361_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|2953488_2954487_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|2954490_2955249_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|2955250_2956450_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|2956433_2957105_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|2957126_2957903_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|2957906_2958905_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|2958906_2959485_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|2959481_2960951_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|2960994_2961282_-	trp operon repressor	NA	NA	NA	NA	NA
WP_054300271.1|2961413_2962388_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209699.1|2962588_2963185_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300152.1|2963211_2963577_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|2963633_2963789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273401.1|2963933_2964386_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300151.1|2964423_2964756_+	DMT family transporter	NA	NA	NA	NA	NA
WP_155047003.1|2966244_2967130_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|2967316_2967538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|2967653_2968286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2968263_2969325_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776841.1|2969764_2970304_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|2970388_2970925_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|2971576_2971879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|2972328_2972637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|2972957_2973407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|2973689_2974400_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|2974626_2975025_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|2975892_2976843_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|2976842_2978921_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|2979068_2979584_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|2979592_2980156_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|2980136_2980883_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|2981022_2981475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|2981610_2982447_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|2982443_2983340_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|2983372_2984440_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|2984458_2984827_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|2984852_2986301_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|2986310_2987690_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|2987730_2989062_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|2989033_2989993_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|2990085_2990589_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|2990723_2991875_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|2991871_2992351_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|2992497_2994819_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|2994763_2995390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|2995394_2996294_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|2996366_2996945_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|2997245_2997503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081006999.1|2997511_2997883_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.2	3.4e-20
WP_081006998.1|2998087_2998543_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	1.3e-21
WP_032126637.1|2998659_2998953_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155046758.1|2999801_2999933_+	phosphatase	NA	NA	NA	NA	NA
WP_016212051.1|3000560_3001334_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126148.1|3001875_3002058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3002661_3003636_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3004730_3005069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007065.1|3005085_3005925_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_155047004.1|3006137_3006644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300144.1|3006658_3007024_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3008328_3009024_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3009020_3010448_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3010473_3010737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3010809_3011784_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047005.1|3011842_3012693_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|3012891_3013866_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007064.1|3013905_3014181_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3014177_3015014_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3015014_3015356_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3015357_3015963_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3015959_3017954_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3017973_3018915_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052104719.1|3019142_3020567_+	MFS transporter	NA	NA	NA	NA	NA
WP_155047006.1|3020973_3021114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3021367_3022342_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3022400_3023057_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126480.1|3023103_3023787_-	methyltransferase	NA	NA	NA	NA	NA
WP_080664873.1|3024332_3024647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556613.1|3024541_3025537_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039182	Piscirickettsia salmonis strain Psal-158 plasmid unnamed1, complete sequence	120784	2231	110548	120784	integrase,protease,transposase	Streptococcus_phage(26.19%)	117	75788:75847	86689:88152
WP_054300202.1|2231_2960_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|3163_5740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047021.1|6034_6190_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300202.1|6213_6942_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273830.1|6971_7304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047014.1|7374_7716_-	hypothetical protein	NA	A0A1B1IQX9	uncultured_Mediterranean_phage	60.3	1.7e-21
WP_054300202.1|7871_8600_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273834.1|8806_9373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273836.1|9715_10777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|10806_11889_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300202.1|12008_12737_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046765.1|13623_13818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047015.1|14198_14522_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212122.1|15398_16100_+	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_016212121.1|16053_16977_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_105962625.1|17410_18296_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.7	4.5e-10
WP_054300271.1|18940_19915_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212151.1|20005_20968_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|20991_21306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|21369_22344_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_033923686.1|22468_23518_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|23626_24667_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|24680_25310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|25400_25700_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211886.1|25696_26125_-	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_052104769.1|27122_28046_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_129556707.1|28360_29380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|29761_30915_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300202.1|30981_31710_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|31807_32221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047016.1|32624_32852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927838.1|32881_33127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|33123_33423_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016212019.1|33579_34275_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_081377351.1|35088_35868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|35951_36104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|36056_36389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|36553_36931_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|37237_37621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273842.1|38090_38819_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	5.4e-38
WP_036781349.1|38934_39261_-	potassium ABC transporter ATPase	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.1e-11
WP_016212365.1|39262_39505_-	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_155047017.1|40858_41038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273844.1|41516_43151_+	protein kinase	NA	NA	NA	NA	NA
WP_129556709.1|43362_43452_+	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_129556710.1|43532_44003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273857.1|44156_44891_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	8.4e-39
WP_016212404.1|45667_45901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273881.1|46021_48208_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.2	9.2e-73
WP_036779532.1|48217_48619_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_016212456.1|48615_48903_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_054300271.1|48946_49921_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212579.1|50520_50718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|52223_52424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212061.1|53193_55236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|56428_56794_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274751.1|56739_57315_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.1e-08
WP_075274752.1|57311_57611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047018.1|57646_58450_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.9e-55
WP_129556718.1|58483_59669_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_075273741.1|59878_60613_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046767.1|60943_61105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|61104_61605_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273747.1|61866_62457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273741.1|62586_63321_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126360.1|64023_64758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|64880_65939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|66447_67194_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|67194_67599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377346.1|67992_68709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047010.1|68853_69096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|69628_70654_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_052104629.1|71475_72501_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212298.1|72780_73107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|73347_73824_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_155047011.1|73938_75091_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	9.8e-58
WP_075273780.1|75100_75808_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
75788:75847	attL	TTTAGCGCTTAGGTAATACAATACTCTGAAAATCAGCCATATTGTGAAATTGTGATAATT	NA	NA	NA	NA
WP_052104629.1|75946_76972_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273782.1|77351_77780_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.0	3.0e-12
WP_155053508.1|78014_78203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126795.1|78502_78763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|78766_79039_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_016211913.1|79364_80486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273786.1|80918_81317_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_105962623.1|81325_82479_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212499.1|83477_83852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|84056_84230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|84477_84927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212412.1|84919_85084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049901.1|85489_86011_+	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	34.4	6.9e-19
WP_075273790.1|86000_86303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|86847_87873_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300590.1|88489_88714_-	hypothetical protein	NA	NA	NA	NA	NA
86689:88152	attR	TTTAGCGCTTAGGTAATACAATACTCTGAAAATCAGCCATATTGTGAAATTGTGATAATTCGACTAAAAATTACTCCCAGTATTCGAAGTGCAGGTGCCAATAATCGATAAAGCAGCTAAAAATAGGCTTAAAACCTGATTATAGACGGACTGCTCCTGTTAGAACTTAATGAGCTGCATGGTCGCTAGGGCTTTGTGGTGCTTCATGATTACTGACAAGCGTTGCTTTGGACGCCCACCGGTTAAAAGCATTTTGCTACCACAAAGGATGCACTCAAACGGGTCAGTGTTGATAAAGCCTTTGAGGAGTGATGCATAAGTGATTTTTTTAACCGGCTCTACCGTCTGGTCCAGTAACTTATAAATTGTTGGCAGCAGCTTTCCGCGGGTGCGAAAGCTCAAGAAGCCGTAATAGCGGATCATCTTAAATGATTTAGTGGGGATGTGACGGATTAGACGCTCAATAAACTCAAATGTTGTACTGGTGTGCTTTTCCTGCTTACCCGTTTTGCGATCAATATAGCGAAAGATCACTTCTTTGCCATCATAGTGCAGTAAGCGTGAATTTGAGAGTGGCGGTCGCTTTAAGTATCGACCTAAATAATCAACGTTTTGGTGGTGTGAAGGCTGAGCTTTTGCAAAATGGACATGCCAGAGTTTATTGTATTCTGGGTTGATGAATCGATTAAATGATGTGAGGTCAGTAATGTGGTTTTGATATTGATGAGGAATCACGAGTTTCCCTGTTTTGTAAGCGGTGCGTAATAAATTAACAATCGAAAACCGCCACATTGGCATCGTTTTTTTCTTTGTGAAATAAACTTTCTTCCAGGTTGTCTTGCACTTAGATAAGCCACCACGTGTCACTGATAAGTGGACGTGCGTATTCCAATTTAAACTCTGGCCGAAAGTATGCAGAGCTGTGAATATACCGATCTTAATTTTTTTCTTCTTTGCAGTTTTGAGCAGAACATTTGCGGCGAGTCGTGATAGATGATTCAGTAGCTCACGATTAGCAAGGAAAAACGGGCAAAGTGCTTTTGGCATGGTGAATGTTATGTGCTGGTATTCGCACTTTGGGAGTAACTTATTCTGTGCAGCAATCCATTGCTCAGTGGCTTTTTTCCACATGAGGAGCATAGCCGTGATTTGCAGGTATAGGTGACGACTTTGGTGTGTTTGCATCCTGAGTTAGAGCAACTGTATTCATCATGACCTGCAAACTTAGTTCTACAGCTGAGCATTTTCACGACGACTTCAACCACAGAGCGAGGAATATTATCGCGATTGGCCACATAGTAGCGCCACCAAGCTCTGCCAGTTTGGAAAAGATGTTTAAGCGTGAATTGAATCAAACTAACTATCTCATTGTGTTGATTAACAAGCGATTAATCATACAGACAACGATAAATTATACAACGGCCCTCCTAAAGTCGCGAGCTGTACTCAGCGAGCCTATCCTTG	NA	NA	NA	NA
WP_129556699.1|89021_89222_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211871.1|89215_89551_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_032126138.1|90116_90380_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_075273796.1|90934_91738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|91858_92383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273798.1|92491_92716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|93116_93857_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_016212413.1|93904_94333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273802.1|94666_95395_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_075273804.1|95479_95818_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|95777_96233_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_075273806.1|96338_96902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273808.1|97163_97688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728342.1|97727_98231_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081377348.1|98545_99295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273810.1|99602_100310_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	34.2	1.4e-11
WP_129556718.1|100296_101482_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_054300271.1|102619_103594_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075273812.1|103590_104148_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.6e-08
WP_032126362.1|104093_104459_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273814.1|105806_106268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|106530_107367_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_129556717.1|107692_108919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|109573_110548_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.8	2.4e-25
