The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	31805	91594	3194906	tRNA,transposase	Staphylococcus_phage(28.57%)	52	NA	NA
WP_036772169.1|31805_32681_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33039_34395_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34486_34993_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34989_35358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36760_38545_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39025_40153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40225_40981_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|41017_43711_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43742_44294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44401_45415_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45535_45760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46115_46877_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47019_47814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|47958_48711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49022_50549_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50687_51761_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|51800_53108_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53082_54252_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54306_55032_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55497_57603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|57817_58282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58301_58811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59195_60137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60418_61870_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773655.1|62336_62741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63301_64276_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|65010_65388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|65977_66952_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773242.1|66991_67546_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|67726_68626_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|68630_69257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|69201_71523_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|71669_72149_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|72145_73297_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|73431_73935_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|74028_75003_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|74992_76306_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|76346_77726_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|77732_79184_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|79209_79578_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378407.1|79596_80664_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|80696_81593_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|81589_82426_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|82561_83014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|83152_83899_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|83879_84443_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|84451_84967_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|85108_87187_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|87186_88137_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|89004_89403_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|89628_89958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|90574_91594_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	123076	241144	3194906	tRNA,transposase,protease	Staphylococcus_phage(12.5%)	106	NA	NA
WP_075278722.1|123076_123952_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|124392_124686_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|124686_124941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|124957_127450_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|127442_128126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|128125_129169_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|129168_130398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|130399_130729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|130725_131925_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|132037_132427_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|132426_133371_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|133490_134888_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|135213_135735_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|135858_136167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|136181_141404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|141794_143801_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|143931_146262_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|146437_147268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|147384_147780_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|147776_148310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|148306_148708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|149102_149423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|149432_150389_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|150898_151423_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|151523_152522_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|152610_153507_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|153580_154867_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|155326_156643_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|156756_156927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|156946_157921_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|158047_158308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|158575_158866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|161404_162445_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|162547_163519_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|163641_164490_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|164641_164929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|165239_165611_+	isochorismatase	NA	NA	NA	NA	NA
WP_155052673.1|166671_166896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|167033_167171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|167184_167397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242723.1|167393_167693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|167920_168745_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|168883_170017_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|170076_171486_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|171633_173214_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|173971_174967_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|174972_177039_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|177096_178047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|178241_178568_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|178790_180050_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|180309_181185_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|181223_182186_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|187880_188225_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|188321_189245_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|189744_190233_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|190335_191136_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|191146_192898_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|193787_194030_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|194033_194432_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|194663_195539_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|196257_196716_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|196897_197083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|197798_199613_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|200023_200692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|200701_202018_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|202177_203140_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|203220_203376_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|203389_203626_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|203818_205036_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|205013_205472_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|205499_206879_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|206915_207134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|207453_208749_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|208953_209145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|209343_210219_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|210406_211672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|211705_212581_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|212702_213161_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|213184_214105_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|214232_215015_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|215105_216605_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|216918_218802_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|219061_219724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|219790_220900_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|220911_221556_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|221574_222561_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|222645_223722_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|223923_224748_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|225050_226016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|226334_227387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|227445_228420_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|228755_229184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|229420_229903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|229958_231209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|231311_231530_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|232001_232856_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|232910_233381_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|233677_233914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|234060_234441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|234499_235375_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|236141_237053_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|237169_238018_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|238084_239095_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|239118_239442_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375571.1|239452_239854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|240124_241144_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	314947	357306	3194906	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|314947_315823_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|315903_316536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|316489_317935_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|317969_318389_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|319162_319531_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|319540_320080_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|320240_320672_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|320675_321374_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|321621_322128_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|322170_322539_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|322809_326886_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|326949_331158_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|331319_331694_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|331798_332272_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|332287_334399_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|334426_335617_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|335623_335935_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|336057_336696_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|336711_337329_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|337325_337622_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|337636_338461_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|338477_338753_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|338758_339091_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|339103_339838_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|339851_340265_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|340264_340465_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|340464_340722_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|340843_341212_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|341229_341541_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|341556_342099_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|342111_342417_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|342445_342838_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|342850_343384_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|343393_343747_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|343757_344258_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|344263_344446_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|344448_344883_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|344883_346206_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|346262_346376_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|346519_346876_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|346901_347291_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|347300_347921_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|347942_348920_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|348968_349367_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|349479_350727_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|350713_351370_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|351454_351733_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|351975_352203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|352335_353130_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|353438_354653_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|355050_355230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|355198_355852_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|356227_356476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|356565_357306_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	366729	421642	3194906	tRNA,transposase,protease	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_017376975.1|366729_367281_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_017376974.1|367291_368659_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376973.1|368809_369046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376972.1|369104_369848_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_027242667.1|369847_370489_+	lipoprotein	NA	NA	NA	NA	NA
WP_017376970.1|370488_372153_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_017376969.1|372181_372517_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_027242666.1|372681_374280_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376966.1|374339_374630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772765.1|374830_375262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|375324_377805_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|377891_378371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|378343_379384_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|379320_380037_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|380049_380385_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|380421_380892_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|380934_382770_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|382814_383903_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|383924_384986_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|385063_385579_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|385619_386897_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|386911_387763_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|387791_388439_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|388435_389395_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_048875861.1|389916_390786_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|390930_391185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|391329_391896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|392001_392442_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_051929598.1|392399_392657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242664.1|392953_394156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|394439_395414_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046563.1|395883_396021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|396037_396253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|396457_397069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|397065_397323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|397573_397966_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|398095_398644_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|398643_399471_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|399520_401206_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|401283_401745_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|401781_402345_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|402571_402901_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|402881_403106_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|403250_403841_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|403865_405137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|405154_406408_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|406404_407049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|407121_408171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|408272_409910_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|409944_410274_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|410430_410718_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376927.1|411144_411282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|411787_413008_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|413066_415865_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|416170_417337_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|417435_417972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|418033_418366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|418623_419526_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|419595_420093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|420238_421642_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	451079	499218	3194906	transposase	Staphylococcus_phage(100.0%)	42	NA	NA
WP_036774259.1|451079_452054_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420729.1|452401_453040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|453159_454563_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242658.1|455905_457369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420728.1|457444_458251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242656.1|458530_459349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|459366_459960_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376894.1|460176_460410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242655.1|460633_461530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420727.1|461834_462605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376891.1|462774_463677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|463673_464897_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_027242653.1|464914_465841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|465856_466897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242651.1|467011_467422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376888.1|467474_467978_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_017376887.1|467970_468717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376886.1|468719_469850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|469854_470094_+	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_027242650.1|472583_473072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|473074_474151_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_017376878.1|474143_474797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875870.1|474803_475229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|475265_478265_+	ATPase AAA	NA	NA	NA	NA	NA
WP_027242646.1|478326_479829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|480280_481900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|481941_484245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376870.1|484521_485418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|485420_488747_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_144420818.1|488948_489137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|489148_489625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|489667_489895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|490076_490610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|490640_490982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772347.1|490984_491401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876253.1|491562_492219_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036771639.1|492215_493190_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|493631_493895_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|494322_495297_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_087910671.1|495684_496149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910670.1|496242_496428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|498243_499218_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 6
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	504022	558705	3194906	transposase	Streptococcus_phage(22.22%)	52	NA	NA
WP_048875872.1|504022_505306_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|505478_505616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|505612_507016_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|507129_507567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|507687_508116_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|508363_508801_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|509232_510621_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|511067_512561_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|512755_513511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|514010_514241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|515345_516356_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|516352_516574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|517292_518234_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|518761_519160_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|519099_519954_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|520045_520327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|520412_521090_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|521135_522416_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|522591_523641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|523719_524520_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|524533_525328_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|525430_526450_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|526496_527108_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|527111_527798_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|527794_528337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|528629_529817_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|530061_530787_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|530972_531761_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|531757_532153_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|532545_533586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|533582_534986_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|537401_537659_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|537698_539084_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242633.1|539413_540511_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_017377120.1|540544_541795_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|541795_542428_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|542717_543170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|543215_544058_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|544092_544584_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|544779_546747_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|546974_547379_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|547356_548385_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|548371_549160_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|549586_550990_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377110.1|551191_552202_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_075275363.1|552214_552682_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377107.1|553011_554382_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_017377106.1|554684_555155_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377105.1|555432_555708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|555718_557122_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069971661.1|557296_557734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|557730_558705_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 7
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	590496	723890	3194906	plate,tRNA,transposase	Staphylococcus_phage(13.64%)	111	NA	NA
WP_036772726.1|590496_591045_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|591797_593177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|593536_595000_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|595183_595996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|596460_598455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|598849_600229_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|600266_600704_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|600746_601463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|603009_603540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|603606_605427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|605991_606498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|606582_607986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|608100_608355_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|608507_608780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|609355_609538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|609654_610230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046568.1|610238_610397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|611297_611540_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|611842_612934_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|612914_613868_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|614091_615576_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|615615_616119_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|616378_617554_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|617701_618106_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|618262_619138_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|619172_619526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|622855_623281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|623511_624648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|624634_625957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|625949_627068_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|627188_627722_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|627860_629498_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|629502_629724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|629832_630846_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|631117_633346_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_026063593.1|633326_634031_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|634265_634595_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|635995_636214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|636272_637148_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|637140_638007_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|638074_639394_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|639863_640424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|640742_641669_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|642564_643473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|647169_648009_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|648195_648411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|648459_649035_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|649031_649370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|649538_650528_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|651517_652420_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875883.1|652679_653216_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|653360_654278_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|654712_655723_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|656530_657067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|658279_658627_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|658771_659731_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|659832_660615_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|660747_661707_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|661731_662136_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|662164_662839_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|662938_664654_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|664650_665013_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|665027_666182_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|666185_667193_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|667195_668212_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|668427_669513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|669619_670012_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|670144_671428_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|671443_672745_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|672762_674565_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|674569_675562_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|675642_676719_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|676816_677791_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|677858_678830_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|679013_679283_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|679884_681171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|681235_681916_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155052676.1|687571_687859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375775.1|687897_688092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275355.1|688139_689114_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_027242570.1|689327_690467_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|690675_692046_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|692424_693417_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|693420_693936_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|693932_694772_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|694804_696355_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|696462_696834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|698054_698216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|698796_700200_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|700234_700672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|700695_701670_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|701728_702157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|702344_703151_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|703225_703618_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|703662_704484_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|704496_705480_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|705481_706750_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|706756_709261_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|709391_710417_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|710413_711124_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|711048_711879_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|712028_712412_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|712446_713346_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|713391_714063_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|714145_714721_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|714819_715620_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|715761_716619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|717481_718618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|718684_721855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|721867_722578_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|722582_723890_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	732532	778848	3194906	plate,transposase	Staphylococcus_phage(21.43%)	51	NA	NA
WP_017376356.1|732532_732931_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|732927_734616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|734597_735554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|735596_736112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|736216_737149_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|737368_737755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|737772_738417_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|738567_739407_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|739482_740085_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|740085_740940_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|741297_741609_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|741633_743022_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|743177_743909_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|743905_744433_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|744464_745022_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|745027_746008_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|746147_746948_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|746951_747719_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|747715_748180_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|748202_748856_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|748859_749207_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|749240_749492_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|749568_750837_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|750839_751598_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|751659_752550_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|752600_753284_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|753293_753641_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155062809.1|753910_756034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|756025_756898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|757065_758895_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|759062_759704_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|760028_760475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|760492_760666_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|760724_761774_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|761780_762731_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|762785_763730_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|763757_764495_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|764583_764826_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|764900_766124_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|766155_767004_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|767000_768053_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|768189_768810_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|769035_770188_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|771208_772183_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|772179_772350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|773318_773915_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|773883_775044_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|775554_775896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|775999_777034_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|777030_777741_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|777873_778848_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 9
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	787008	841319	3194906	tRNA,transposase,protease	Prochlorococcus_phage(33.33%)	49	NA	NA
WP_017377942.1|787008_787515_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243058.1|787596_788013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|788104_788965_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|789062_789608_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|789690_790542_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|790583_793490_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|793550_793748_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|793754_794765_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|794761_795820_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|795834_796614_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|796616_797429_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|797440_798388_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|798398_799691_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|799869_800973_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|800969_801362_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|801374_802751_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|802744_804214_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|804407_804842_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|805137_805314_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|806348_807374_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_017377925.1|807875_808268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|809660_810311_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|811009_811804_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|811983_812628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|812802_813777_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|814177_814435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|816112_816790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|817023_817848_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|817941_818655_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|818744_819836_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|819907_820489_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|820494_821121_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|821217_822165_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|822511_823174_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|823344_824004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|824172_825432_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|825428_826514_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|826506_827388_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|827376_828627_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|830012_830333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|830591_830858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|831348_831567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|832552_832774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|832770_833853_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|833863_834235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|834231_834411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|837114_837390_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|838225_839683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|840110_841319_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	884999	947540	3194906	tRNA,transposase	Staphylococcus_phage(28.57%)	53	NA	NA
WP_048875904.1|884999_885875_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|886131_886569_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|886629_887262_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|887277_887925_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|887927_889991_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|890317_891610_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|891998_894209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|894225_894882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|897267_898143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|898401_899013_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|899440_902029_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|902131_902893_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|902889_903426_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|903474_904431_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|904508_907694_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|907697_908753_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|908982_909585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|909628_910291_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|910325_910673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375702.1|911141_912173_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|912635_914039_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|915157_915502_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|915593_916049_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|916297_916432_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|916424_917066_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|917062_917779_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|917782_919102_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155051395.1|919783_919927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773644.1|920906_923543_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_036773645.1|923584_924670_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|924669_925353_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_017377748.1|925413_927075_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377747.1|927227_927482_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|927560_927878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|928030_928429_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|928510_929149_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|929305_930280_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|930652_930928_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|931477_931762_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|933578_934172_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|935280_936162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|936273_937953_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|938079_939330_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|939405_939867_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|939863_941012_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|941017_941692_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|941688_942345_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|942470_942944_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|942945_943368_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|943354_944374_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|944533_944713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|944931_945213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|946664_947540_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	951442	1018405	3194906	tRNA,transposase,protease	Bacillus_phage(20.0%)	56	NA	NA
WP_080999971.1|951442_952846_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|953204_953972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|954085_955489_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|955485_955647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|955962_956937_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|957177_958461_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|958527_959451_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|961646_963791_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|963812_964019_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|964079_964700_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|964740_965634_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|965719_966445_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|966506_966911_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|967073_969182_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|969305_970355_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|970351_971818_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|971960_973298_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|973365_974856_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|975084_975456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|975606_976434_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|976736_977393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|977340_978264_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|978277_979201_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027243109.1|979475_980132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|981831_982059_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376989.1|982383_982932_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|983012_983288_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|983287_984337_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|984449_986387_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|986534_988247_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|988315_989035_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|989031_989634_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|989748_990636_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|990826_991174_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|991224_992064_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|992159_992906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|993102_993729_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|994044_994614_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|994757_995456_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|996162_996786_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|996895_997789_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|997895_999506_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|999502_1000798_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|1000819_1002742_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|1002852_1003155_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|1003249_1008136_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1008183_1009506_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1009630_1010725_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1010776_1011715_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1011795_1012380_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1012764_1013655_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1013857_1014349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1014488_1014980_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1015148_1015862_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065653747.1|1015924_1017265_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1017529_1018405_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	1024018	1086545	3194906	transposase	Staphylococcus_phage(33.33%)	57	NA	NA
WP_017377787.1|1024018_1024246_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1024272_1025313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1025379_1025949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1026179_1026584_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1026596_1026737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1026831_1028031_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1028051_1028663_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1028864_1029626_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1029921_1030848_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1031008_1031965_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1032109_1032379_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1032645_1033620_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1033773_1034001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1034117_1034543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1034699_1035629_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1036075_1036606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|1036927_1037233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1037710_1038022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1038361_1039528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1041715_1042687_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1043289_1043463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1043858_1044776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1044776_1045628_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1046068_1047115_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1047104_1049096_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1049205_1049580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1049833_1050016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1050277_1050979_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027242868.1|1050979_1051447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376293.1|1053085_1055836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1056071_1057364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1057850_1058756_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376296.1|1059533_1060250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1060535_1061297_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1061329_1062733_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1062729_1062894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1062953_1063241_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1063985_1064714_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1064682_1065429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420708.1|1065509_1065899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1065895_1066870_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1067026_1067344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772457.1|1069819_1070128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1070203_1070476_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1073009_1073447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1074048_1075236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1075506_1077141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1077191_1077920_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1079347_1080310_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1080533_1081529_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1081556_1082492_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1082535_1082997_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1082975_1083593_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1083622_1084597_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1084651_1085119_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1085131_1085776_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1085816_1086545_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 13
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	1095245	1144813	3194906	transposase	Acinetobacter_phage(22.22%)	39	NA	NA
WP_082300708.1|1095245_1095806_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1097130_1097526_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1097534_1097891_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1097883_1098759_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1098844_1099423_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1099380_1099674_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1100634_1102146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1102393_1103797_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1104002_1104437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1104519_1105224_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1105482_1105971_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1105999_1106674_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1106914_1107790_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275340.1|1108320_1108929_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1109199_1109658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1109936_1110326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1110511_1111327_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1111549_1112455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1112618_1113380_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1113383_1114250_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1114335_1114947_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1115325_1116573_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1116724_1117426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1117723_1117897_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1118386_1118887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1119965_1120193_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420705.1|1120278_1120479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1120507_1121188_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1121210_1123385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1123630_1124701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1124697_1126101_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619408.1|1126249_1126735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1126806_1127628_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1128294_1129794_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1130097_1132791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1132787_1136189_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_048875961.1|1137776_1139180_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1140258_1140930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1143838_1144813_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 14
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	1169536	1225932	3194906	tRNA,transposase	Staphylococcus_phage(28.57%)	52	NA	NA
WP_053093677.1|1169536_1170256_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1170483_1170660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1170908_1171232_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1171320_1173339_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1173361_1174315_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1174480_1175668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1176381_1177020_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1177317_1178313_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_027242772.1|1178453_1179500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1179492_1180518_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1180584_1182615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1183921_1184149_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1185492_1185636_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1185632_1186325_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420703.1|1186585_1186909_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_027242770.1|1187051_1187462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155082328.1|1187471_1187609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1187618_1187945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1188091_1189129_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1189170_1189416_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_027242766.1|1189396_1189855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1189862_1191437_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1191591_1192161_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1192470_1194273_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1194269_1195211_+	signal peptidase I	NA	NA	NA	NA	NA
WP_036771308.1|1195238_1195460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242761.1|1195622_1196297_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1196302_1197202_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1197215_1197959_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1197961_1198693_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1198689_1199073_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1199210_1200458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1200868_1202014_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1202006_1202360_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1202640_1203183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1203827_1204016_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1204035_1205010_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1205053_1205929_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1206282_1207110_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1207209_1207371_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1208021_1209362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1210413_1210641_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|1210782_1212144_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1212239_1212899_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144420701.1|1213739_1214096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1214692_1216252_-	APC family permease	NA	NA	NA	NA	NA
WP_017375893.1|1218782_1219853_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1219910_1220117_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1220123_1221599_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1221734_1222298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1222467_1223871_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1224837_1225932_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	1242174	1289899	3194906	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_036772169.1|1242174_1243050_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1243119_1244223_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1244290_1244614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1244770_1245553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1245688_1246666_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1246739_1248731_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1248786_1249068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1249321_1250521_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_051929862.1|1252952_1253465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1253651_1254527_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1254563_1254728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1255936_1256350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1256360_1256696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1256840_1257959_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1258188_1258455_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1259737_1259965_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1259975_1260482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1260559_1261177_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1261308_1262541_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1262530_1263193_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1263467_1264724_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1264861_1265521_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1265595_1266297_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1267044_1268019_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1269227_1269581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1269794_1269989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1270056_1270569_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1270706_1271561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1271609_1272254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1272287_1272932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243125.1|1273454_1273748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1273846_1274629_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1274711_1275662_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1277704_1280545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1280567_1281149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1281268_1281997_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1282142_1283117_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1283232_1284138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1284736_1285483_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1285735_1286128_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1286165_1286813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1288528_1289899_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	1313718	1354927	3194906	transposase	Enterobacteria_phage(16.67%)	36	NA	NA
WP_048876023.1|1313718_1314822_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1314912_1316065_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_144420700.1|1317466_1317616_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1318240_1320607_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1320654_1321851_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1322419_1324852_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1325173_1326673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1326781_1327354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1327668_1329138_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1329210_1329960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1329963_1330737_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1330835_1331786_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1331925_1333368_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1333583_1334768_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1334891_1335578_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1335713_1336298_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1336387_1336717_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1337052_1337292_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_017377970.1|1337340_1337532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1338306_1338600_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1338748_1338910_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1339424_1339964_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1340302_1340947_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1341280_1341931_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1342454_1343507_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1343524_1346605_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1346770_1347019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1347084_1347960_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1348882_1349389_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1349406_1349604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1349622_1349766_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1349833_1350007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1350211_1351525_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1351534_1351798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1351856_1352831_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1354699_1354927_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 17
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	1386144	1439878	3194906	tRNA,transposase	Bacillus_thuringiensis_phage(25.0%)	45	NA	NA
WP_036772026.1|1386144_1387020_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1387124_1390427_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1390423_1392247_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1392286_1392685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1392793_1393810_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1394244_1395699_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1395780_1398837_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081329473.1|1400227_1400647_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376676.1|1401019_1401484_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1401556_1402558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1405450_1405783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1406144_1406288_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1406275_1407220_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420692.1|1407223_1407613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1407431_1407770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1408144_1408744_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1408743_1409091_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1409241_1410225_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1411134_1411449_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1411597_1411756_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1411727_1412657_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1413571_1413988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1415116_1415833_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1416581_1416740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1416788_1417364_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1417508_1417787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1417851_1418727_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1418892_1422759_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1422914_1423724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1423773_1424595_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1424794_1426027_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1426197_1426923_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1426965_1428504_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1428510_1429896_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1430209_1431259_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1431818_1432196_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|1432387_1433263_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1434244_1434472_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1434524_1435043_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_146619432.1|1435298_1435490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420793.1|1435898_1436672_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243181.1|1436785_1437757_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376772.1|1437738_1438710_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420687.1|1439145_1439331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1439341_1439878_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	1458813	1518723	3194906	tRNA,transposase	Staphylococcus_phage(17.65%)	49	NA	NA
WP_051929845.1|1458813_1459638_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1460041_1461016_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1461201_1461795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1461975_1462440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1462834_1463116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1463112_1464516_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1465167_1465548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1465787_1466444_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1466588_1466885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1466944_1467232_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036772296.1|1468421_1468799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1468998_1470048_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1470024_1471842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1472112_1472691_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1472718_1473183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1473219_1474677_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1474738_1476226_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1476995_1477598_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1478159_1478630_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1480277_1481021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1481172_1481604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1484241_1485588_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1485675_1487481_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1487946_1488744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1489128_1489590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1489812_1490787_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1490829_1490952_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1491023_1492979_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1493368_1493554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1493875_1494865_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1495277_1496903_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1497011_1497326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1497621_1499007_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1499171_1499399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1499539_1499998_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1500198_1500384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1500452_1501280_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1501734_1502259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376824.1|1502531_1502690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1502859_1503813_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1504007_1504982_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1505109_1506135_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1506787_1507075_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1507134_1507467_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1507671_1508232_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_017376814.1|1510826_1511552_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_026063564.1|1511926_1514746_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_048876146.1|1515595_1516729_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_017376809.1|1516953_1518723_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
>prophage 19
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	1541083	1576523	3194906	integrase,transposase,protease	Staphylococcus_phage(33.33%)	36	1562424:1562483	1572884:1573174
WP_048876008.1|1541083_1542058_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_144420681.1|1542101_1542287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1542466_1542631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1542632_1543508_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1543823_1544744_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1544759_1545143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1545469_1546426_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_144420678.1|1546693_1546972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243017.1|1547470_1548814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|1548987_1549131_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1549210_1550185_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1550332_1552204_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1552236_1552335_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1552570_1553200_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1553183_1553606_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1553612_1555352_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1555352_1556417_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1556420_1556774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1556886_1557855_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1557864_1558176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1558191_1558761_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1559024_1560353_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1560393_1561368_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1561954_1562356_-|transposase	transposase	transposase	NA	NA	NA	NA
1562424:1562483	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_146619459.1|1562875_1565332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1565534_1566386_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1566431_1568138_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1569609_1570584_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1570946_1571192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1571555_1572584_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1572713_1572917_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420676.1|1573201_1574158_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
1572884:1573174	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGGCCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTAGTGGAGTGTGCCGCTTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTCT	NA	NA	NA	NA
WP_047927838.1|1574450_1574696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1574692_1574992_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1575214_1575685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1576295_1576523_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 20
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	1581975	1624906	3194906	transposase	Staphylococcus_phage(20.0%)	41	NA	NA
WP_053856766.1|1581975_1583379_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1583566_1584424_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1584548_1585184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1585232_1585484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1585739_1586639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1586775_1587849_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1587949_1588363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1588383_1589097_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1589284_1590697_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1590906_1591875_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1592608_1592977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1592980_1593298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1593373_1594348_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1594867_1595368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1595438_1596767_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1596902_1598291_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1598438_1599749_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1600089_1601373_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1601446_1602067_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1602265_1602526_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1602728_1602875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1602850_1603444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1605307_1605526_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1606778_1607549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1607635_1607851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1607947_1609069_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1609335_1610310_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1610572_1611694_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1611986_1612274_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1612246_1612750_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1612830_1613490_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1613831_1614749_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1614878_1615052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1615717_1617076_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_017376486.1|1617150_1617714_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376485.1|1617908_1619138_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1619183_1619810_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1619959_1621147_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1621155_1621848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1621969_1623122_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1623922_1624906_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 21
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	1683241	1773556	3194906	tRNA,transposase,protease	Burkholderia_phage(14.29%)	82	NA	NA
WP_036774017.1|1683241_1684117_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1684506_1684845_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1684841_1685438_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1685440_1687435_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1687498_1688437_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1688785_1689760_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1689963_1690161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1690322_1690727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1692310_1692751_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1693077_1693953_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1693965_1694208_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1694614_1694869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1696080_1697046_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1697138_1697450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1697650_1698427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1699256_1699448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1700176_1701226_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1701396_1702170_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1702230_1703820_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1704010_1705102_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1705124_1705442_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1705528_1706806_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1706827_1707664_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1707670_1709305_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1709736_1710096_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1710377_1711736_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1711761_1712004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1712497_1712677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1712932_1714189_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1714302_1714560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1714704_1715715_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1716091_1716946_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1716975_1717809_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036773204.1|1718385_1719159_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1719240_1719561_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1719779_1720685_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1720770_1721169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1721313_1721811_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242786.1|1723483_1724575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1724673_1725051_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1725130_1726105_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1727649_1728369_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1728452_1728740_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1729024_1729897_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1729853_1730630_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1730834_1731170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1731568_1731925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1732086_1732362_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1732471_1732819_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1732836_1733616_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1733615_1734125_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1734160_1734409_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1734720_1735056_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1735355_1736606_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1736687_1738715_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1739260_1739479_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1739650_1740013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1740161_1741565_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1741846_1743022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1743039_1745037_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1745017_1745998_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1746053_1746896_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_027242816.1|1746895_1747300_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1747292_1747712_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1747734_1748364_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1748932_1751122_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1751133_1752339_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1752323_1754171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1754155_1755394_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1755380_1757249_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1757282_1758536_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1758541_1759399_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1759417_1760146_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1761284_1762076_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1762441_1762729_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|1764851_1765241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1765417_1766176_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1766172_1768572_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1768585_1769863_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1769952_1771251_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1771448_1772342_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1772341_1773556_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 22
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	1784255	1834740	3194906	tRNA,transposase	Vibrio_phage(14.29%)	46	NA	NA
WP_069971651.1|1784255_1785131_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1785503_1785767_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1786073_1788668_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1788664_1789147_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1789124_1790165_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1790339_1790825_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1790932_1793503_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1793536_1793998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1794334_1795210_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1795487_1797248_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1797341_1798007_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1798019_1799525_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1799546_1800077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1800150_1801413_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1801599_1802472_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1802573_1803362_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1803454_1804780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1805133_1806309_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1806477_1807131_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1807286_1809227_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1809223_1809847_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1810011_1810986_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1811257_1811878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1811874_1813278_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1813345_1813762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1814169_1814667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1814663_1815638_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|1815717_1816287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1816431_1816968_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1816972_1817269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1817277_1817883_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1818068_1818467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1818657_1818861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1819005_1819161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1819285_1819738_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1819854_1821327_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1821765_1822230_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1822918_1824169_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1824278_1824749_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1824771_1825365_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1825502_1826552_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1826575_1827499_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1827515_1827977_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1828084_1828903_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1829512_1829656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1833819_1834740_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 23
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	1897038	1912354	3194906	transposase	Staphylococcus_phage(50.0%)	16	NA	NA
WP_017378288.1|1897038_1897260_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1897318_1898293_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1898491_1898656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1898652_1899288_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046602.1|1899564_1900344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1900376_1901138_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1901114_1902104_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1902239_1903115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1903133_1903793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148037443.1|1903819_1904029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1904034_1904481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1904477_1905881_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1905994_1906840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1906984_1908634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1908724_1909510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|1910950_1912354_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	1941027	1982784	3194906	tRNA,transposase	uncultured_Mediterranean_phage(40.0%)	39	NA	NA
WP_144420657.1|1941027_1942089_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1942800_1942962_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1943878_1944418_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1944800_1945217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1945312_1946128_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1946260_1947754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1947939_1948365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1948361_1950422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1950705_1951521_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1951621_1952440_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1952436_1952805_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1952986_1953814_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1953877_1954606_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1955008_1955737_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1956126_1956852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1956886_1960759_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1960959_1962093_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1962106_1962295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1962518_1963877_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_036773947.1|1965483_1966359_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1966870_1967506_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999981.1|1967518_1967992_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_155046603.1|1967919_1968072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929627.1|1968265_1968616_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1968675_1968963_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1969015_1969795_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376416.1|1969914_1970085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376415.1|1970219_1971137_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1971188_1971944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1972011_1973286_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376412.1|1973406_1974084_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376411.1|1974284_1975709_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_016209938.1|1975683_1976322_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376410.1|1976684_1976963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376409.1|1977196_1978141_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376408.1|1978162_1980031_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376407.1|1980051_1980405_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_026063528.1|1980443_1981559_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1981743_1982784_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
>prophage 25
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	1987127	2043197	3194906	tRNA,transposase	Klosneuvirus(22.22%)	49	NA	NA
WP_017376399.1|1987127_1989899_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376398.1|1990055_1991288_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1991529_1992192_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376397.1|1992651_1994133_+	MFS transporter	NA	NA	NA	NA	NA
WP_036773116.1|1994330_1995305_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|1995828_1998555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|1999442_2000417_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|2000667_2001372_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|2002611_2003130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|2004097_2005582_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2005706_2007242_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2007264_2007594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2007490_2007706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2009689_2010889_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2011098_2011959_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2012074_2012653_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2012809_2013451_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2013489_2013711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2013703_2014687_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2015080_2015578_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2015722_2015998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2016149_2017832_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2017839_2018862_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2019030_2020032_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2020145_2020484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2020959_2022219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2022427_2022655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2022683_2022902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2023039_2023405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2023472_2023715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2023729_2024065_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2024069_2024507_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_036772812.1|2024532_2025918_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2026028_2026460_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2026565_2028077_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2028367_2029960_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2030160_2032356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772819.1|2032449_2033883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2033925_2034441_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2034440_2035388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2035371_2036037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2036033_2036762_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2036751_2037498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2037481_2038546_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2038750_2039938_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2039994_2041113_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2041560_2041818_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2042097_2042775_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2042993_2043197_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	2062897	2112432	3194906	tRNA,transposase,protease	Burkholderia_virus(20.0%)	41	NA	NA
WP_017377787.1|2062897_2063125_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2063214_2063970_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2064383_2064980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2065059_2067864_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2067844_2068798_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2068790_2070161_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2070331_2071735_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2072506_2072833_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420651.1|2073037_2073691_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_017376600.1|2074010_2074190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2074445_2075702_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2075940_2076087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2076169_2076526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2077021_2077381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2077390_2077774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2078662_2078803_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2078947_2079868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2082025_2082556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2082566_2083622_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2083637_2085677_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2085663_2086494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2086560_2090100_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2090213_2090933_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2091171_2091801_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2091920_2093324_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2093469_2095413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2095930_2096791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2097226_2098972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|2099374_2100847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2101029_2101629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2101766_2101964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2102164_2102305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2102372_2103152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2103716_2104118_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2104262_2104640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2105099_2106407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2107155_2107413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2107464_2108868_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2109108_2110818_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2110987_2111350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|2111457_2112432_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 27
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	2127001	2253839	3194906	tRNA,transposase,protease	Staphylococcus_phage(14.81%)	116	NA	NA
WP_017377892.1|2127001_2128423_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_026063687.1|2128512_2130111_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377894.1|2130267_2130894_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027242839.1|2130974_2133647_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377896.1|2134129_2135086_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_017377897.1|2135138_2135558_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_048875958.1|2135584_2136448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377899.1|2136437_2137229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2137533_2138505_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2138853_2139162_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2139158_2139815_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2139948_2140434_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2140511_2141033_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2141078_2141972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2141968_2142790_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2142984_2143134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2143361_2144192_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046606.1|2145597_2145768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2145920_2147324_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_144420645.1|2147433_2148690_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2148661_2149393_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2149404_2150682_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2150781_2151156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2151240_2152128_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2152185_2152914_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2152910_2154020_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2154171_2154600_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2154694_2155051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2155043_2156255_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2156251_2157040_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2157202_2157997_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2158446_2159187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2159190_2161689_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2161951_2162908_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2162891_2163653_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2163860_2164835_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2164943_2165699_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2165823_2166069_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2166128_2168402_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2168456_2168759_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2168999_2169293_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2169463_2169643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2169718_2170330_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2170576_2171893_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2171903_2172272_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2172302_2172965_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2173387_2173966_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2173945_2174353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2174476_2174773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2174819_2175695_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876123.1|2175764_2177945_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_017376060.1|2178048_2179398_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_036772012.1|2179471_2180161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2180293_2181481_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376055.1|2181999_2182644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2182640_2183954_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2184158_2184332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2184601_2185075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2185219_2185414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2185678_2186554_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210558.1|2186740_2187496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376051.1|2187569_2189222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376050.1|2189261_2190800_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_087910638.1|2190799_2192500_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_075275404.1|2192588_2193764_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_017376046.1|2193802_2194765_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_017376045.1|2195042_2195465_-	universal stress protein	NA	NA	NA	NA	NA
WP_017376044.1|2195770_2196412_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376043.1|2196540_2197875_+	dihydroorotase	NA	NA	NA	NA	NA
WP_048875952.1|2197989_2198625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771517.1|2199369_2200506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771498.1|2200689_2202420_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_017376037.1|2202409_2203618_+	MFS transporter	NA	NA	NA	NA	NA
WP_075275290.1|2203716_2204718_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420641.1|2204961_2205597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2205616_2206591_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875951.1|2206634_2207471_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2207616_2208036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2208312_2208993_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2208958_2209309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2209341_2210553_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2210893_2211523_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2211571_2212588_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2212834_2213050_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2213102_2213552_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2213631_2215377_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2215468_2217340_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2217784_2218501_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2219938_2220808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2220764_2220992_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2221960_2222875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2222920_2223943_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2224011_2225061_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155052687.1|2225689_2225860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243219.1|2226144_2226453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2226619_2228023_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376857.1|2228049_2228280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2228601_2228826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2228836_2230048_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036774710.1|2230442_2231342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|2231515_2231917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2232163_2233207_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2233326_2233563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2234351_2235905_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2238085_2238313_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2239183_2240158_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017375736.1|2240884_2241967_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_017375735.1|2242009_2242660_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375734.1|2242882_2243254_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_027243178.1|2243364_2244726_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155046609.1|2246446_2246653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2246963_2248046_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2248042_2248354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2249399_2250374_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2251380_2252160_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2252621_2253839_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	2266688	2327656	3194906	integrase,transposase	Staphylococcus_phage(30.0%)	47	2274541:2274600	2324962:2325722
WP_144420638.1|2266688_2267771_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2267767_2268079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2269576_2270512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2271104_2272250_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2274492_2275656_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2274541:2274600	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|2275684_2275909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2277256_2278432_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2278777_2281288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2281346_2282159_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275283.1|2282599_2283211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2283353_2284328_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2284432_2285764_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2285962_2286031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2286162_2287605_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2287996_2289409_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2290098_2290545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2291139_2291988_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2292241_2293300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2293291_2294998_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2295069_2296803_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2297099_2297666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2297790_2298444_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2298470_2299931_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2300027_2301005_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2301474_2302878_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2303403_2303697_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2303923_2304688_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2304895_2305123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2305186_2305369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2305931_2306111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376902.1|2306174_2306486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2307340_2308045_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2308242_2308383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2308787_2309312_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|2309458_2310715_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2310782_2311262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2311702_2313106_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420632.1|2313520_2315836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2316408_2318301_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2318472_2319447_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2319750_2320557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2320625_2321237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2322718_2323015_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2323011_2323854_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2324244_2325030_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2325034_2326438_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2324962:2325722	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2326711_2327656_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	2348498	2376151	3194906	transposase,protease	Staphylococcus_phage(25.0%)	28	NA	NA
WP_017377305.1|2348498_2349800_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2349881_2350487_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2350599_2351904_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2352504_2353380_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2353495_2354167_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2354346_2355702_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2355822_2356560_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2356638_2357355_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2358003_2359278_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2359308_2359884_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2359928_2360894_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2361357_2362266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|2362653_2362905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2363049_2363478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2363463_2364408_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2364612_2364765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2364793_2365528_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2365622_2365883_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2366101_2367067_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|2367043_2367340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2367530_2367980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2368239_2368668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2368763_2369264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2369200_2369362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2370242_2370464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2371962_2372640_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2373954_2374293_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2375176_2376151_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 30
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	2415396	2448845	3194906	tRNA,transposase	Burkholderia_virus(33.33%)	23	NA	NA
WP_080999971.1|2415396_2416800_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2416913_2417489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2418734_2418962_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2419251_2419791_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2420100_2421588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2421639_2422065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2422283_2423687_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2423683_2424061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2424020_2424566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2424961_2426188_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2426788_2428441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2428377_2428572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963645.1|2428904_2430095_-	MFS transporter	NA	NA	NA	NA	NA
WP_027243147.1|2430343_2433016_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2433304_2434141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2434801_2435692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2436160_2437135_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876012.1|2437619_2439023_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2439168_2440572_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155051406.1|2440656_2442438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2444382_2445786_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2445819_2447349_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2447384_2448845_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 31
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	2484296	2542860	3194906	tRNA,transposase	Burkholderia_virus(28.57%)	55	NA	NA
WP_036773116.1|2484296_2485271_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2485323_2486319_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2486361_2487336_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376319.1|2487960_2488641_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017376318.1|2488640_2489450_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027242903.1|2489523_2493204_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_026063524.1|2493213_2494701_-	ribonuclease G	NA	NA	NA	NA	NA
WP_017376313.1|2494710_2495328_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_017376312.1|2495397_2495916_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376311.1|2495912_2496812_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2496827_2497871_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376309.1|2498068_2498356_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2498476_2499937_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2500016_2501453_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2501577_2502552_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2504742_2505504_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2506661_2506889_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2507842_2508055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2508072_2508390_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2508416_2509106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2509446_2509650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2509781_2510717_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2510729_2511512_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2511641_2511953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2512296_2512623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2512647_2513103_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2513092_2514145_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2514147_2515611_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2515745_2515973_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2517389_2517854_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2518110_2518926_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2519054_2521367_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2521483_2522011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2522702_2523980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2523990_2524242_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2524275_2524797_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2524966_2525953_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2526043_2526859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2527287_2527683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2527655_2527883_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_047927746.1|2528851_2529439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2530041_2530713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875918.1|2530857_2531439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420767.1|2531481_2532159_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243185.1|2532437_2533394_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_017377736.1|2533453_2534119_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017377737.1|2534152_2534698_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_155046615.1|2534977_2535139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774946.1|2535835_2536450_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_144420620.1|2536376_2537579_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875923.1|2537564_2538560_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2538563_2538968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2539935_2540163_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2541131_2541728_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046616.1|2541696_2542860_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
>prophage 32
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	2552581	2603995	3194906	tRNA,transposase	Bacillus_phage(20.0%)	55	NA	NA
WP_048876031.1|2552581_2553985_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|2554090_2554315_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2554497_2555319_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|2555464_2555719_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377841.1|2556107_2557892_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|2557980_2558700_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2558861_2559068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2559067_2559304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2559316_2559670_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2560207_2561041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2561133_2561331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2561428_2562814_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2562940_2563531_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2564562_2564850_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2564909_2565074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2565070_2566441_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2566807_2568220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2568289_2569060_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2569552_2569840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2571316_2571610_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2571567_2572389_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2572533_2572758_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155046618.1|2573012_2573540_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|2573716_2573977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2573895_2574051_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2574149_2575124_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2576452_2576602_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2576718_2577012_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2577820_2578396_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2578473_2579349_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2579413_2580034_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2580018_2581101_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2581334_2581739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2583229_2584531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2584677_2585346_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2586278_2586842_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2586898_2588095_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_017376587.1|2588219_2589584_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376586.1|2589580_2590672_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376585.1|2590926_2591577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2591769_2591964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2592071_2592224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376583.1|2592490_2593618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063543.1|2593707_2594541_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376581.1|2594544_2595195_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_017376580.1|2595184_2596024_-	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_016210074.1|2596029_2596656_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376579.1|2596816_2597359_+	septation protein A	NA	NA	NA	NA	NA
WP_017376578.1|2597442_2597745_+	YciI family protein	NA	NA	NA	NA	NA
WP_144420763.1|2597762_2598005_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376576.1|2598103_2598376_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376575.1|2598414_2599053_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376574.1|2599085_2600177_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376573.1|2600348_2602091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2603020_2603995_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 33
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	2613289	2657004	3194906	tRNA,transposase	Staphylococcus_phage(30.0%)	42	NA	NA
WP_080999966.1|2613289_2614639_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2614936_2615494_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2615587_2616094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2616598_2617294_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|2617424_2618213_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2618246_2619650_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2620073_2621048_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2621304_2621532_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2622619_2623150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2623146_2624679_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2624675_2625626_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2626046_2626679_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2626921_2627119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2627468_2627897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2627974_2628970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2629114_2629366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2629470_2630115_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2630350_2630848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2631359_2632334_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2632704_2632998_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2633810_2634146_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2634466_2636005_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2636157_2637256_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2637494_2638694_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2638724_2639351_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2639379_2640264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2640397_2640628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2640765_2642007_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_144420613.1|2642286_2642658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2644789_2644951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2645326_2646454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2646570_2647233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2647318_2647579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2647997_2648759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2650820_2651480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2651580_2652231_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2652378_2653068_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155082331.1|2653090_2653975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155082332.1|2653983_2654310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2654458_2654710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046691.1|2655233_2655830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2656029_2657004_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 34
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	2671681	2731750	3194906	tRNA,transposase	Staphylococcus_phage(26.67%)	56	NA	NA
WP_048875904.1|2671681_2672557_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2672677_2673178_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2673174_2673441_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2673606_2674581_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2674760_2675381_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2675687_2677091_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771922.1|2677925_2679116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|2679682_2680150_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|2680651_2680906_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|2681107_2681611_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|2681827_2682433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2682593_2683277_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2683352_2684132_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|2684118_2684979_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|2685102_2685468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377271.1|2685853_2686183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2686593_2687568_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_144420611.1|2688102_2688303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155052690.1|2688335_2689667_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	2.4e-36
WP_017377275.1|2690749_2691472_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2691463_2691832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2692094_2693396_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2693491_2693935_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2693938_2694448_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2694440_2697254_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2697750_2698683_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2698787_2699714_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2699892_2701431_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2701604_2701865_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2703139_2703748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2703794_2704523_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2704769_2704907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377696.1|2706069_2706609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2706843_2707755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2708014_2708311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2708655_2709809_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2710405_2710954_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2711057_2711621_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2711838_2712597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2713872_2714100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2714322_2714502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2714757_2716014_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2716081_2716726_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_017378393.1|2717530_2717737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816949.1|2718737_2719136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378390.1|2719329_2720907_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378389.1|2721040_2721982_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378388.1|2721983_2722757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963621.1|2724365_2724572_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2724838_2725126_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378384.1|2725131_2727513_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|2727525_2728521_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_016210495.1|2728652_2729012_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378382.1|2729054_2729249_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|2729283_2729814_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378381.1|2729818_2731750_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
>prophage 35
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	2769528	2822557	3194906	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2769528_2770503_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2770659_2772234_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2772458_2772737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2772806_2773682_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2773691_2774852_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2774966_2776115_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2776125_2778927_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2779033_2779732_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2779744_2781508_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2781511_2781859_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2781852_2782227_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2783174_2784458_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2784867_2786163_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2786518_2787064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242732.1|2787651_2788173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2788184_2789564_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2789799_2790234_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2790230_2791583_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2791582_2792698_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2792698_2793715_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2793704_2795375_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2795394_2795730_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2795757_2797197_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2797193_2798240_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2798382_2799879_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2800174_2801176_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2801281_2801893_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2802013_2802391_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2802441_2803848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2803841_2804909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2805015_2806617_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2806865_2807783_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2807851_2809546_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2809780_2810710_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2810740_2812144_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2812374_2813079_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2813145_2813802_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2813812_2814694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2814864_2817534_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2817894_2818869_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2818948_2819920_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2819973_2820948_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2821067_2821289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2821352_2821661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2821585_2822557_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	2837123	2891384	3194906	transposase	Staphylococcus_phage(37.5%)	51	NA	NA
WP_026063658.1|2837123_2837852_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2838161_2838416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2839129_2841784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2841822_2842113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2842229_2843528_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2844098_2844587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2844567_2844870_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2845116_2845605_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2845638_2846277_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2846398_2846938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2847027_2848254_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2848866_2849124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2849210_2850110_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2850254_2850521_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2850512_2850662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2850889_2851765_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2851894_2852122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2852188_2852383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2852441_2853416_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2853453_2853642_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2853642_2855415_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2855404_2856397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2857004_2857697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2858183_2858753_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2858749_2859724_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2859763_2860267_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2860357_2861761_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2862459_2862645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2862750_2864154_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420599.1|2864158_2864731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2864764_2866192_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|2867477_2869847_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2869922_2870741_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2871092_2871638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2872120_2873359_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2873335_2874310_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017375625.1|2874402_2874630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|2874634_2875126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243039.1|2875798_2876686_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_027243038.1|2876775_2878266_-	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_017376549.1|2878289_2879171_-	ROK family protein	NA	NA	NA	NA	NA
WP_017376548.1|2879167_2879890_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376547.1|2880589_2881381_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|2881567_2881813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420598.1|2881964_2882195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376543.1|2882224_2883004_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_047927468.1|2883029_2883335_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_144420752.1|2883331_2884225_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_027243035.1|2884580_2885879_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376538.1|2888481_2889663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2889956_2891384_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	2898970	2948616	3194906	tRNA,transposase	Bodo_saltans_virus(14.29%)	43	NA	NA
WP_062312049.1|2898970_2900338_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2900830_2901310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2901489_2903553_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2903561_2904287_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2904914_2905628_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2905632_2906163_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2906397_2906631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2906743_2906992_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2907799_2909992_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2910009_2910318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2910971_2912681_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2912874_2913030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2914432_2915308_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2915633_2916395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2916619_2917351_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2917347_2917884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2917937_2918702_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2918704_2920282_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2920288_2920765_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2920740_2921172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2921204_2921960_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2922134_2922422_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2922804_2923029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2923368_2924532_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2924566_2925544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2925537_2926224_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2926162_2927278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2927557_2928163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2928400_2928880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2930702_2931356_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2931468_2932020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2932119_2933094_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2933379_2933904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2934601_2935426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2935681_2936038_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2936034_2937438_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2937557_2938118_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2938275_2938842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243087.1|2941607_2942303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2942343_2942556_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2944128_2945238_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2945293_2946775_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2947212_2948616_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 38
NZ_CP039176	Piscirickettsia salmonis strain Psal-139 chromosome, complete genome	3194906	3076298	3141547	3194906	transposase,protease	Hokovirus(14.29%)	55	NA	NA
WP_017376170.1|3076298_3077399_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3077756_3078731_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3078867_3079746_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3079753_3079984_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3080037_3081042_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3081260_3082088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3082169_3083558_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3083845_3085246_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3085340_3086267_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3086263_3087400_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3087396_3088404_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3088400_3089564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3089573_3090425_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3090456_3091629_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3091625_3093014_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3093042_3093450_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3093469_3094477_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3094473_3095346_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3095342_3096203_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3096204_3098475_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3098476_3099622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3099668_3100154_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3100193_3100817_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3106496_3107249_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243062.1|3108580_3109204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3109308_3110097_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3110096_3110828_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3110861_3112589_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3112602_3113664_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3113978_3115193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3115325_3115850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3116467_3117316_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3117302_3118001_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3118055_3118817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3118809_3119232_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3119361_3119913_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3119968_3120931_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3120931_3121147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3121333_3122143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3122122_3122965_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3122961_3124206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3124344_3125433_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3125450_3125951_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3126138_3126738_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3126743_3127907_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3127939_3128893_+	glutathione synthase	NA	NA	NA	NA	NA
WP_017376261.1|3129256_3130321_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3130317_3133380_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3133532_3133985_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3134016_3134373_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3134791_3135565_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376269.1|3138188_3138479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3138703_3139579_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3139575_3140133_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3140143_3141547_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039177	Piscirickettsia salmonis strain Psal-139 plasmid unnamed1, complete sequence	175590	0	117510	175590	terminase,transposase,portal,integrase	Streptococcus_phage(40.0%)	120	11253:11312	117876:119611
WP_017377655.1|1412_1658_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|1654_2041_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|2128_2857_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|2835_3456_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|3801_4488_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|5437_5800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|5802_7542_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|7943_8096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|8123_8807_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|8888_9866_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|9941_10112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|10152_10881_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
11253:11312	attL	GATGTATCTTAGCTAAATCTGTCAGCACCTTTTTAATTTTAGTATCAACAACCTGTTTTT	NA	NA	NA	NA
WP_036771293.1|11426_11693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046692.1|11988_13887_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|14308_15037_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_082884401.1|15134_15257_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|15673_15838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|15858_17145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|17327_18056_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|18183_19161_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046631.1|19235_19886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126795.1|22517_22778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|22781_23054_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|23129_23858_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|24426_25398_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|26262_27090_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|27943_28414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|29307_29451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|30657_31257_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|31610_32387_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|32747_33476_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|33545_33746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|33664_34636_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027242938.1|35049_35418_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017375972.1|35419_35728_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017375841.1|36172_36382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|36688_36907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242936.1|36903_37356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420845.1|37483_37714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876207.1|38219_39695_-	response regulator	NA	NA	NA	NA	NA
WP_017375966.1|39695_40262_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_144420846.1|40406_40871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|40875_41301_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_036817204.1|41571_42567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817201.1|42870_43278_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017375960.1|43385_44429_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_017375959.1|44730_44964_+	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_146619517.1|45101_45254_-	phosphatase	NA	NA	NA	NA	NA
WP_081078123.1|45283_45646_+	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
WP_026063496.1|46524_46890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242932.1|47022_47250_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242931.1|47258_47666_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242930.1|47811_49194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375952.1|49383_49587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242929.1|49782_50166_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|50252_50735_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|50737_52069_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|52273_52708_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|52794_53181_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|53218_53953_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|53999_54713_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_144420848.1|56091_56277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243190.1|56280_59625_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017377509.1|59805_60534_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|60627_61602_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|61915_62278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|62317_62827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|63058_64039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|64504_65482_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|65962_66940_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|66954_67116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|67333_67588_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|67577_67865_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_036771347.1|68359_69337_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|70337_70550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|70707_71685_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_075317322.1|71671_73186_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_047927782.1|73981_74371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|74286_75264_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_048876196.1|75293_76442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243215.1|78255_79278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|79760_80489_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_048876194.1|81728_82262_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|82442_82784_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|82964_83231_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|83303_85169_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|85336_85621_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|85964_86693_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|86774_87266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|87998_88226_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|89777_90206_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|90141_90528_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|90557_91286_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|91297_91447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|91693_92422_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|93799_94762_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|94785_95115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|95181_96222_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|96235_96427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|96631_97201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|97243_97543_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774376.1|97539_97968_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|98277_99006_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|99179_99953_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|100666_101602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|101876_102605_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243201.1|102770_103010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|103073_106415_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|106572_107301_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|107594_107990_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|108042_108771_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|109254_109983_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|110153_110723_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|110727_111411_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|111562_112291_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_080963627.1|112309_112528_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774644.1|113507_114569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|115077_115824_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|115824_116229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|116535_117510_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
117876:119611	attR	GATGTATCTTAGCTAAATCTGTCAGCACCTTTTTAATTTTAGTATCAACAACCTGTTTTTTAGGTTGATACCGATAAACTGATCGGCCAATACGGCACATCTTGCATGCTTTATTCCCGCTCAATGCATGAGCTTTGACAGCATAATCAACTAAGTCACGCCGACTCGCTGCGGTTATAGCTTTTTTTCAACAATATCCTTGAGCACTTTGTGCTCTAGGCTAATGTCTGCGTACATCTGTTTCAAACGACGGTTTTCGTCTTCAAACTCTTTTAAACGCTGTAGATCTGAAACGCCCATGCCTTGATATTTGGATCTGAGTTTGTAGTAGCTGCTTTTAGCAATACCATACTGGCGACAAATATCTTCAACTTTAACACCCGCTTGGCCTTCATTAAGCATGGCTACAATTTGTGATTCTGTTAGTTTTGATCGTTTCATCTTCTCTCTCCTGGCTAAGTTAATTTAACAGAAGATTCCACTTATCACTTGTACTATTTTAAGGGAGGGTTACCGAGTTATGTGAGAGCACAGTAGTGGAGTGTGCCGATTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTTGCGACAGAACCCTCCTTGGTTCGCAGCGCCAACATCATATCATTAAATCAAATTGCGACAGAACCATTATAGCTCATCATCTTCATATCTTGTATGTTTAGGATCATTACAAACATACCATCCACTAGAACTAGAATTTGTACATACCCCATACCTTTTAGATAAATCAAAGTACATAGTTGTGCTAGAAGGAGATTGTGATGATTTAGCATCAAAAAGTGAGCCAAAATGATTGTAAGTCGTGACATATAAATTACTTTTATCTGAATTTTTAATATATATTGCGCTGACAGGATCATTTACTCTACTTTCTAAAAACCATTTTAAATTATTAGGTACGTTATCCATAAATGGATCACACTGTTTGAAATAAACCCAATCCCAATCCGTCGTTTTTCCAGCAATATTAGAAGTTAAACAGCTTAAAAACCAACCATCAGATGAAAATGCACGGCCATATAGTGAAAGCATCAATATTCTAGAATTTTTCATATCATAGTATGTTCTATTCAAATAATTTGAATTATACGAACCTGAATACATAGGATAGTAATTATTATCAGATTTATCATAAAACCTCATACCAATTTCATACCAAAATGTATTTACTTTTGATGGTGTTTTAAAAAAGTATTTAGACATTTTATTTGCATCTAAAACAATATTAGTTCCACTTGATTTTGAAATAATTCCATAGTTGCCATACCATTGAATAGATAGATCTTTATTTAAACGAGGTTTTAATTTTCCATCTCTTACATCCCATTTTTGATAAGGGTTATAAATATCACAAGGCCAAAACTCTACATAATCCCATTTATCATCACCTTTGATGACATTTTCTGGTGCAGTCATACATAGAGGGATTCCAAATTGAGATTTAGAGAAAGCAACTCTGCCAAGAGTATCATAAATAGCTTTTTGACTTTCTACATTAGAACATGTTTGAGCGTATAAATAAGATCGAGACGTTTTCATAGAAGAGTCTCTTGATTGAGTTGGAGCTAAACAGTAACCTCCCTGAGTTGTAATTAACTGGCTTGGTATTGTAGGTAAATCTTTAAAT	NA	NA	NA	NA
>prophage 2
NZ_CP039177	Piscirickettsia salmonis strain Psal-139 plasmid unnamed1, complete sequence	175590	123457	125079	175590	transposase	Acinetobacter_phage(50.0%)	3	NA	NA
WP_017375632.1|123457_123793_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|123987_124191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|124284_125079_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
>prophage 3
NZ_CP039177	Piscirickettsia salmonis strain Psal-139 plasmid unnamed1, complete sequence	175590	131449	133867	175590	transposase,portal	unidentified_phage(50.0%)	2	NA	NA
WP_048875857.1|131449_132424_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|133411_133867_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
>prophage 4
NZ_CP039177	Piscirickettsia salmonis strain Psal-139 plasmid unnamed1, complete sequence	175590	138585	145553	175590	transposase	Streptococcus_phage(100.0%)	7	NA	NA
WP_017377509.1|138585_139314_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|139455_140388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|140417_141146_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|141148_141421_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|142271_143000_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|143055_143676_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|144824_145553_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 5
NZ_CP039177	Piscirickettsia salmonis strain Psal-139 plasmid unnamed1, complete sequence	175590	154420	158060	175590	transposase	unidentified_phage(50.0%)	5	NA	NA
WP_036773116.1|154420_155395_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_017375692.1|155538_155772_+	hypothetical protein	NA	Q7Y5W4	Haemophilus_phage	42.6	1.3e-06
WP_017375691.1|155795_156497_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.6	9.6e-32
WP_036773107.1|156480_156798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|157085_158060_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
>prophage 6
NZ_CP039177	Piscirickettsia salmonis strain Psal-139 plasmid unnamed1, complete sequence	175590	161510	172972	175590	head,capsid,transposase,tail	Streptococcus_phage(18.18%)	17	NA	NA
WP_036771639.1|161510_162485_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|162534_163074_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|163087_163672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|164056_164368_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|164364_164790_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|164968_165364_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|165360_165711_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|165710_166133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|166134_166458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|166514_166781_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|166784_168863_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|168855_169197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|169193_169865_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_036772541.1|170462_171191_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|171220_171610_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|171632_172361_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|172363_172972_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
>prophage 1
NZ_CP039179	Piscirickettsia salmonis strain Psal-139 plasmid unnamed3, complete sequence	50691	5714	19511	50691	tail,head,capsid,transposase	Moraxella_phage(16.67%)	19	NA	NA
WP_155082336.1|5714_6419_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	2.5e-11
WP_155082337.1|6372_6690_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	42.2	5.3e-14
WP_075275454.1|6739_7279_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|7292_7877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|8261_8573_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|8569_8995_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|9173_9569_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|9565_9916_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|9915_10338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|10339_10663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|10719_10986_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|10989_13068_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|13060_13402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|13398_14070_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|13999_14785_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|14774_15332_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|15328_18019_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|18077_18506_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|18533_19511_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 1
NZ_CP039180	Piscirickettsia salmonis strain Psal-139 plasmid unnamed4, complete sequence	33497	3344	19366	33497	integrase,head,capsid,terminase,tail,transposase	unidentified_phage(35.71%)	21	NA	NA
WP_036771330.1|3344_4319_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4854_5445_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5675_5936_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5928_6282_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6458_7433_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|7965_8331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|8475_8730_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8713_9070_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|9167_10142_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|10767_11634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|11846_12230_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|12316_12799_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|12801_12987_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|13006_13981_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|14077_14470_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|14505_15087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|15467_16442_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|16515_16731_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|17534_18050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|18395_18953_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|18949_19366_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
