The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	31805	91594	3194963	tRNA,transposase	Staphylococcus_phage(28.57%)	52	NA	NA
WP_036772169.1|31805_32681_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33039_34395_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34486_34993_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34989_35358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36760_38545_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39025_40153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40225_40981_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|41017_43711_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43742_44294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44401_45415_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45535_45760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46115_46877_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47019_47814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|47958_48711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49022_50549_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50687_51761_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|51800_53108_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53082_54252_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54306_55032_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55497_57603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|57817_58282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58301_58811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59195_60137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60418_61870_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773655.1|62336_62741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63301_64276_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|65010_65388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|65977_66952_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773242.1|66991_67546_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|67726_68626_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|68630_69257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|69201_71523_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|71669_72149_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|72145_73297_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|73431_73935_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|74028_75003_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|74992_76306_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|76346_77726_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|77732_79184_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|79209_79578_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378407.1|79596_80664_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|80696_81593_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|81589_82426_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|82561_83014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|83152_83899_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|83879_84443_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|84451_84967_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|85108_87187_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|87186_88137_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|89004_89403_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|89628_89958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|90574_91594_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	123076	241144	3194963	protease,tRNA,transposase	Staphylococcus_phage(12.5%)	105	NA	NA
WP_075278722.1|123076_123952_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|124392_124686_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|124686_124941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|124957_127450_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|127442_128126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|128125_129169_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|129168_130398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|130399_130729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|130725_131925_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|132037_132427_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|132426_133371_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|133490_134888_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|135213_135735_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|135858_136167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|136181_141404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|141794_143801_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|143931_146262_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|146437_147268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|147384_147780_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|147776_148310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|148306_148708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|149102_149423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|149432_150389_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|150898_151423_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|151523_152522_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|152610_153507_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|153580_154867_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|155326_156643_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|156756_156927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|156946_157921_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|158047_158308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|158575_158866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|161404_162445_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|162547_163519_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|163641_164490_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|164641_164929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|165239_165611_+	isochorismatase	NA	NA	NA	NA	NA
WP_017377540.1|166662_166896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|167033_167171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|167184_167397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|167920_168745_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|168883_170017_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|170076_171486_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|171633_173214_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|173971_174967_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|174972_177039_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|177096_178047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|178241_178568_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|178790_180050_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|180309_181185_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|181223_182186_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|187880_188225_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|188321_189245_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|189744_190233_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|190335_191136_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|191146_192898_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|193787_194030_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|194033_194432_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|194663_195539_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|196257_196716_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|196897_197083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|197798_199613_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|200023_200692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|200701_202018_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|202177_203140_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|203220_203376_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|203389_203626_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|203818_205036_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|205013_205472_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|205499_206879_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|206915_207134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|207453_208749_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|208953_209145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|209343_210219_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|210406_211672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|211705_212581_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|212702_213161_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|213184_214105_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|214232_215015_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|215105_216605_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|216918_218802_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|219061_219724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|219790_220900_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|220911_221556_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|221574_222561_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|222645_223722_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|223923_224748_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|225050_226016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|226334_227387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|227445_228420_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|228755_229184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|229420_229903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|229958_231209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|231311_231530_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|232001_232856_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|232910_233381_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|233677_233914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|234060_234441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|234499_235375_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|236141_237053_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|237169_238018_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|238084_239095_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|239118_239442_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375569.1|239452_239848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|240124_241144_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	314947	357306	3194963	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|314947_315823_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|315903_316536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|316489_317935_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|317969_318389_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|319162_319531_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|319540_320080_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|320240_320672_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|320675_321374_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|321621_322128_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|322170_322539_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|322809_326886_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|326949_331158_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|331319_331694_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|331798_332272_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|332287_334399_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|334426_335617_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|335623_335935_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|336057_336696_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|336711_337329_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|337325_337622_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|337636_338461_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|338477_338753_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|338758_339091_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|339103_339838_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|339851_340265_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|340264_340465_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|340464_340722_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|340843_341212_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|341229_341541_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|341556_342099_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|342111_342417_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|342445_342838_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|342850_343384_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|343393_343747_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|343757_344258_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|344263_344446_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|344448_344883_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|344883_346206_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|346262_346376_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|346519_346876_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|346901_347291_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|347300_347921_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|347942_348920_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|348968_349367_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|349479_350727_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|350713_351370_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|351454_351733_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|351975_352203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|352335_353130_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|353438_354653_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|355050_355230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|355198_355852_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|356227_356476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|356565_357306_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	375324	425007	3194963	tRNA,transposase	Staphylococcus_phage(25.0%)	54	NA	NA
WP_017376964.1|375324_377805_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|377891_378371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|378343_379384_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|379320_380037_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|380049_380385_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|380421_380892_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|380934_382770_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|382814_383903_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|383924_384986_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|385063_385579_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|385619_386897_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|386911_387763_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|387791_388439_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|388435_389395_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_048875861.1|389916_390786_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|390930_391185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|391329_391896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|392001_392442_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_051929598.1|392399_392657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242664.1|392953_394156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|394439_395414_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046563.1|395883_396021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|396037_396253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|396457_397069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|397065_397323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|397573_397966_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|398095_398644_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|398643_399471_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|399520_401206_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|401283_401745_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|401781_402345_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|402571_402901_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|402881_403106_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|403250_403841_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|403865_405137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|405154_406408_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|406404_407049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|407121_408171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|408272_409910_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|409944_410274_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|410430_410718_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376927.1|411144_411282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046565.1|411244_411538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|411787_413008_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|413066_415865_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|416170_417337_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|417435_417972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|418033_418366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|418623_419526_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|419595_420093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|420238_421642_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|421842_422571_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963630.1|422740_423598_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_048875864.1|423981_425007_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	451079	499218	3194963	transposase	Staphylococcus_phage(100.0%)	42	NA	NA
WP_036774259.1|451079_452054_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377364.1|452203_453040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|453159_454563_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242658.1|455905_457369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856768.1|457444_458239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242656.1|458530_459349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|459366_459960_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376894.1|460176_460410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242655.1|460633_461530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420727.1|461834_462605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376891.1|462774_463677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|463673_464897_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_027242653.1|464914_465841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|465856_466897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242651.1|467011_467422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376888.1|467474_467978_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_017376887.1|467970_468717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376886.1|468719_469850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|469854_470094_+	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_027242650.1|472583_473072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|473074_474151_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_017376878.1|474143_474797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875870.1|474803_475229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|475265_478265_+	ATPase AAA	NA	NA	NA	NA	NA
WP_027242646.1|478326_479829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|480280_481900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|481941_484245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376870.1|484521_485418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|485420_488747_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_144420818.1|488948_489137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|489148_489625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|489667_489895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|490076_490610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|490640_490982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772347.1|490984_491401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876253.1|491562_492219_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036771639.1|492215_493190_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|493631_493895_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|494322_495297_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_087910671.1|495684_496149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910670.1|496242_496428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|498243_499218_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 6
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	504022	558705	3194963	transposase	Streptococcus_phage(22.22%)	52	NA	NA
WP_048875872.1|504022_505306_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|505478_505616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|505612_507016_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|507129_507567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|507687_508116_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|508363_508801_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|509232_510621_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|511067_512561_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|512755_513511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|514010_514241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|515345_516356_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|516352_516574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|517292_518234_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|518761_519160_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|519099_519954_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|520045_520327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|520412_521090_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|521135_522416_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|522591_523641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|523719_524520_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|524533_525328_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|525430_526450_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|526496_527108_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|527111_527798_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|527794_528337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|528629_529817_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|530061_530787_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|530972_531761_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|531757_532153_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|532545_533586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|533582_534986_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|537401_537659_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|537698_539084_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242633.1|539413_540511_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_017377120.1|540544_541795_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|541795_542428_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|542717_543170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|543215_544058_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|544092_544584_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|544779_546747_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|546974_547379_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|547356_548385_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|548371_549160_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|549586_550990_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377110.1|551191_552202_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_075275363.1|552214_552682_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377107.1|553011_554382_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_017377106.1|554684_555155_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377105.1|555432_555708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|555718_557122_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069971661.1|557296_557734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|557730_558705_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 7
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	590496	723890	3194963	plate,tRNA,transposase	Staphylococcus_phage(13.64%)	111	NA	NA
WP_036772726.1|590496_591045_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|591797_593177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|593536_595000_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|595183_595996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|596460_598455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|598849_600229_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|600266_600704_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|600746_601463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|603009_603540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|603606_605427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|605991_606498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|606582_607986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|608100_608355_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|608507_608780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|609355_609538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|609654_610230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046568.1|610238_610397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|611297_611540_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|611842_612934_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|612914_613868_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|614091_615576_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|615615_616119_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|616378_617554_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|617701_618106_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|618262_619138_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|619172_619526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|622855_623281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|623511_624648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|624634_625957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|625949_627068_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|627188_627722_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|627860_629498_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|629502_629724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|629832_630846_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|631117_633346_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_026063593.1|633326_634031_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|634265_634595_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|635995_636214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|636272_637148_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|637140_638007_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|638074_639394_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|639863_640424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|640742_641669_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|642564_643473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|647169_648009_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|648195_648411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|648459_649035_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|649031_649370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|649538_650528_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|651517_652420_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875883.1|652679_653216_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|653360_654278_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|654712_655723_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|656530_657067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|658279_658627_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|658771_659731_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|659832_660615_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|660747_661707_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|661731_662136_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|662164_662839_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|662938_664654_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|664650_665013_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|665027_666182_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|666185_667193_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|667195_668212_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|668427_669513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|669619_670012_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|670144_671428_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|671443_672745_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|672762_674565_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|674569_675562_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|675642_676719_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|676816_677791_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|677858_678830_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|679013_679283_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|679884_681171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|681235_681916_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376024.1|687571_687820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375775.1|687897_688092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275355.1|688139_689114_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_027242570.1|689327_690467_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|690675_692046_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|692424_693417_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|693420_693936_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|693932_694772_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|694804_696355_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|696462_696834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|698054_698216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|698796_700200_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|700234_700672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|700695_701670_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|701728_702157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|702344_703151_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|703225_703618_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|703662_704484_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|704496_705480_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|705481_706750_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|706756_709261_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|709391_710417_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|710413_711124_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|711048_711879_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|712028_712412_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|712446_713346_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|713391_714063_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|714145_714721_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|714819_715620_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|715761_716619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|717481_718618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|718684_721855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|721867_722578_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|722582_723890_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	732532	778848	3194963	plate,transposase	Staphylococcus_phage(21.43%)	52	NA	NA
WP_017376356.1|732532_732931_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|732927_734616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|734597_735554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|735596_736112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|736216_737149_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|737368_737755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|737772_738417_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|738567_739407_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|739482_740085_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|740085_740940_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|741297_741609_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|741633_743022_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|743177_743909_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|743905_744433_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|744464_745022_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|745027_746008_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|746147_746948_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|746951_747719_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|747715_748180_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|748202_748856_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|748859_749207_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|749240_749492_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|749569_750838_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|750840_751599_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|751660_752551_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|752601_753285_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|753294_753642_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155046683.1|753911_755645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556468.1|755731_756034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|756025_756898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|757065_758895_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|759062_759704_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|760028_760475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|760492_760666_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|760724_761774_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|761780_762731_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|762785_763730_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|763757_764495_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|764583_764826_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|764900_766124_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|766155_767004_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|767000_768053_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|768189_768810_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|769035_770188_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|771208_772183_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|772179_772350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|773318_773915_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|773883_775044_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|775554_775896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|775999_777034_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|777030_777741_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|777873_778848_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 9
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	787008	841319	3194963	protease,tRNA,transposase	Prochlorococcus_phage(33.33%)	49	NA	NA
WP_017377942.1|787008_787515_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_155046572.1|787596_788019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|788104_788965_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|789062_789608_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|789690_790542_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|790583_793490_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|793550_793748_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|793754_794765_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|794761_795820_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|795834_796614_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|796616_797429_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|797440_798388_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|798398_799691_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|799869_800973_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|800969_801362_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|801374_802751_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|802744_804214_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|804407_804842_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|805137_805314_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|806348_807374_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_155046573.1|807836_808268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|809660_810311_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|811009_811804_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|811983_812628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|812802_813777_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|814177_814435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|816112_816790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|817023_817848_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|817941_818655_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|818744_819836_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|819907_820489_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|820494_821121_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|821217_822165_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|822511_823174_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|823344_824004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|824172_825432_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|825428_826514_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|826506_827388_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|827376_828627_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|830012_830333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|830591_830858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|831348_831567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|832552_832774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|832770_833853_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|833863_834235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|834231_834411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|837114_837390_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|838225_839683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|840110_841319_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	884999	947540	3194963	tRNA,transposase	Staphylococcus_phage(28.57%)	52	NA	NA
WP_048875904.1|884999_885875_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|886131_886569_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|886629_887262_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|887277_887925_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|887927_889991_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|890317_891610_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|891998_894209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|894225_894882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|897267_898143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|898401_899013_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|899440_902029_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|902131_902893_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|902889_903426_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|903474_904431_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|904508_907694_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|907697_908753_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|908982_909585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|909628_910291_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|910325_910673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375702.1|911141_912173_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|912635_914039_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|915157_915502_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|915593_916049_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|916297_916432_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|916424_917066_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|917062_917779_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|917782_919102_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155046577.1|919783_919945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773644.1|920906_923543_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_036773645.1|923584_924670_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|924669_925353_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_017377748.1|925413_927075_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377747.1|927227_927482_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|927560_927878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|928030_928429_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|928510_929149_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|929305_930280_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|930652_930928_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|931477_931762_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|933578_934172_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|935280_936162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|936273_937953_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|938079_939330_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|939405_939867_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|939863_941012_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|941017_941692_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|941688_942345_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|942470_942944_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|942945_943368_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|943354_944374_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_027243174.1|944931_945213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|946664_947540_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	951442	1018405	3194963	protease,tRNA,transposase	Bacillus_phage(20.0%)	57	NA	NA
WP_080999971.1|951442_952846_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|953204_953972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|954085_955489_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|955485_955647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|955962_956937_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|957177_958461_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|958527_959451_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|961646_963791_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|963812_964019_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|964079_964700_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|964740_965634_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|965719_966445_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|966506_966911_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|967073_969182_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|969305_970355_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|970351_971818_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|971960_973298_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|973365_974856_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|975084_975456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|975606_976434_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|976736_977393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|977340_978264_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|978277_979201_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420713.1|979430_980132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|981831_982059_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_016210338.1|982126_982264_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376989.1|982383_982932_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|983012_983288_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|983287_984337_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|984449_986387_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|986534_988247_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|988315_989035_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|989031_989634_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|989748_990636_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|990826_991174_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|991224_992064_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|992159_992906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|993102_993729_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|994044_994614_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|994757_995456_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|996162_996786_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|996895_997789_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|997895_999506_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|999502_1000798_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|1000819_1002742_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|1002852_1003155_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|1003249_1008136_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1008183_1009506_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1009630_1010725_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1010776_1011715_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1011795_1012380_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1012764_1013655_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1013857_1014349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1014488_1014980_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1015148_1015862_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065653747.1|1015924_1017265_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1017529_1018405_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	1024018	1086545	3194963	transposase	Staphylococcus_phage(33.33%)	57	NA	NA
WP_017377787.1|1024018_1024246_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1024272_1025313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1025379_1025949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1026179_1026584_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1026596_1026737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1026831_1028031_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1028051_1028663_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1028864_1029626_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1029921_1030848_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1031008_1031965_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1032109_1032379_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1032645_1033620_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1033773_1034001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1034117_1034543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1034699_1035629_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1036075_1036606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|1036927_1037233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1037710_1038022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1038361_1039528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1041715_1042687_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1043289_1043463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1043858_1044776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1044776_1045628_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1046068_1047115_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1047104_1049096_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1049205_1049580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1049833_1050016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1050277_1050979_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420709.1|1050979_1051399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619460.1|1053052_1055836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1056071_1057364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1057850_1058756_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046684.1|1059548_1060250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1060535_1061297_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1061329_1062733_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1062729_1062894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1062953_1063241_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1063985_1064714_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1064682_1065429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046685.1|1065479_1065899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1065895_1066870_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1067026_1067344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772457.1|1069819_1070128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1070203_1070476_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1073009_1073447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1074048_1075236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1075506_1077141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1077191_1077920_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1079347_1080310_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1080533_1081529_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1081556_1082492_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1082535_1082997_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1082975_1083593_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1083622_1084597_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1084651_1085119_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1085131_1085776_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1085816_1086545_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 13
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	1095245	1144813	3194963	transposase	Acinetobacter_phage(22.22%)	39	NA	NA
WP_082300708.1|1095245_1095806_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1097130_1097526_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1097534_1097891_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1097883_1098759_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1098844_1099423_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1099380_1099674_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1100634_1102146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1102393_1103797_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1104002_1104437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1104519_1105224_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1105482_1105971_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1105999_1106674_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1106914_1107790_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275340.1|1108320_1108929_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1109199_1109658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1109936_1110326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1110511_1111327_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1111549_1112455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1112618_1113380_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1113383_1114250_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1114335_1114947_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1115325_1116573_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1116724_1117426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1117723_1117897_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1118386_1118887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1119965_1120193_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774233.1|1120245_1120479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1120507_1121188_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1121210_1123385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1123630_1124701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1124697_1126101_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619408.1|1126249_1126735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1126806_1127628_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1128294_1129794_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1130097_1132791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1132787_1136189_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_048875961.1|1137776_1139180_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1140258_1140930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1143838_1144813_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 14
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	1169536	1225932	3194963	tRNA,transposase	Staphylococcus_phage(28.57%)	51	NA	NA
WP_053093677.1|1169536_1170256_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1170483_1170660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1170908_1171232_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1171320_1173339_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1173361_1174315_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1174480_1175668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1176381_1177020_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1177317_1178313_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_027242772.1|1178453_1179500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1179492_1180518_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1180584_1182615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1183921_1184149_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1185492_1185636_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1185632_1186325_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876033.1|1186594_1186909_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_027242770.1|1187051_1187462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1187618_1187945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1188091_1189129_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1189170_1189416_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_129556541.1|1189540_1189855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1189862_1191437_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1191591_1192161_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1192470_1194273_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1194269_1195211_+	signal peptidase I	NA	NA	NA	NA	NA
WP_036771308.1|1195238_1195460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242761.1|1195622_1196297_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1196302_1197202_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1197215_1197959_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1197961_1198693_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1198689_1199073_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1199210_1200458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1200868_1202014_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1202006_1202360_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1202640_1203183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1203827_1204016_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1204035_1205010_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1205053_1205929_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1206282_1207110_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1207209_1207371_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1208021_1209362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1210413_1210641_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|1210782_1212144_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1212239_1212899_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144420701.1|1213739_1214096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1214692_1216252_-	APC family permease	NA	NA	NA	NA	NA
WP_017375893.1|1218782_1219853_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1219910_1220117_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1220123_1221599_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1221734_1222298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1222467_1223871_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1224837_1225932_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	1242174	1289899	3194963	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_036772169.1|1242174_1243050_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1243119_1244223_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1244290_1244614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1244770_1245553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1245688_1246666_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1246739_1248731_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1248786_1249068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1249321_1250521_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_051929862.1|1252952_1253465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1253651_1254527_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1254563_1254728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1255936_1256350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1256360_1256696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1256840_1257959_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1258188_1258455_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1259737_1259965_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1259975_1260482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1260559_1261177_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1261308_1262541_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1262530_1263193_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1263467_1264724_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1264861_1265521_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1265595_1266297_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1267044_1268019_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1269227_1269581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1269794_1269989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1270056_1270569_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1270706_1271561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1271609_1272254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1272287_1272932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653744.1|1273472_1273748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1273846_1274629_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1274711_1275662_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1277704_1280545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1280567_1281149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1281268_1281997_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1282142_1283117_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1283232_1284138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1284736_1285483_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1285735_1286128_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1286165_1286813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1288528_1289899_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	1313718	1354928	3194963	transposase	Enterobacteria_phage(16.67%)	37	NA	NA
WP_048876023.1|1313718_1314822_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1314912_1316065_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1316478_1317330_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|1317467_1317617_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1318241_1320608_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1320655_1321852_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1322420_1324853_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1325174_1326674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1326782_1327355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1327669_1329139_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1329211_1329961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1329964_1330738_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1330836_1331787_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1331926_1333369_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1333584_1334769_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1334892_1335579_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1335714_1336299_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1336388_1336718_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1337053_1337293_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_155046686.1|1337386_1337533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1338307_1338601_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1338749_1338911_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1339425_1339965_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1340303_1340948_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1341281_1341932_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1342455_1343508_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1343525_1346606_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1346771_1347020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1347085_1347961_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1348883_1349390_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1349407_1349605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1349623_1349767_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1349834_1350008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1350212_1351526_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1351535_1351799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1351857_1352832_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1354700_1354928_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 17
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	1386145	1439879	3194963	tRNA,transposase	Bacillus_thuringiensis_phage(25.0%)	46	NA	NA
WP_036772026.1|1386145_1387021_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1387125_1390428_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1390424_1392248_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1392287_1392686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1392794_1393811_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1394245_1395700_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1395781_1398838_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_144420694.1|1399131_1399368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081329473.1|1400228_1400648_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376676.1|1401020_1401485_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1401557_1402559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1405451_1405784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1406145_1406289_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1406276_1407221_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080963606.1|1407224_1407611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1407432_1407771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1408145_1408745_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1408744_1409092_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1409242_1410226_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1411135_1411450_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1411598_1411757_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1411728_1412658_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1413572_1413989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1415117_1415834_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1416582_1416741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1416789_1417365_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1417509_1417788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1417852_1418728_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1418893_1422760_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1422915_1423725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1423774_1424596_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1424795_1426028_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1426198_1426924_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1426966_1428505_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1428511_1429897_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1430210_1431260_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1431819_1432197_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|1432388_1433264_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1434245_1434473_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1434525_1435044_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_146619432.1|1435299_1435491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420793.1|1435899_1436673_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243181.1|1436786_1437758_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376772.1|1437739_1438711_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420687.1|1439146_1439332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1439342_1439879_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	1458814	1508233	3194963	transposase	Staphylococcus_phage(23.08%)	45	NA	NA
WP_051929845.1|1458814_1459639_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1460042_1461017_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1461202_1461796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1461976_1462441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1462835_1463117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1463113_1464517_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1465168_1465549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1465788_1466445_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1466589_1466886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1466945_1467233_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036772296.1|1468422_1468800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1468999_1470049_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1470025_1471843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1472113_1472692_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1472719_1473184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1473220_1474678_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1474739_1476227_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1476996_1477599_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1478160_1478631_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1480278_1481022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1481173_1481605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1484242_1485589_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1485676_1487482_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1487947_1488745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1489129_1489591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1489813_1490788_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1490830_1490953_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1491024_1492980_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1493369_1493555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1493876_1494866_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1495278_1496904_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1497012_1497327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1497622_1499008_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1499172_1499400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1499540_1499999_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1500199_1500385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1500453_1501281_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1501735_1502260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376824.1|1502532_1502691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1502860_1503814_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1504008_1504983_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1505110_1506136_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1506788_1507076_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1507135_1507468_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1507672_1508233_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
>prophage 19
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	1516954	1576525	3194963	protease,tRNA,transposase,integrase	Staphylococcus_phage(25.0%)	58	1505805:1505864	1576230:1576840
1505805:1505864	attL	CCACCACGTGTCACTGATAAGTGGACGTGCGTATTCCAATTTAAACTCTGGCCGAAAGTA	NA	NA	NA	NA
WP_017376809.1|1516954_1518724_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_017376808.1|1518862_1519906_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376807.1|1519919_1520663_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_027243093.1|1520775_1521093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1521154_1521334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243094.1|1521396_1522104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420791.1|1522887_1524099_+	protein kinase	NA	NA	NA	NA	NA
WP_017376801.1|1524154_1524979_-	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_017376798.1|1526166_1526802_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017376797.1|1527083_1527443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1527716_1530002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420683.1|1529990_1530647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|1530823_1531456_+	MarC family protein	NA	NA	NA	NA	NA
WP_027243097.1|1531491_1531677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243098.1|1531742_1532888_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243099.1|1533123_1534437_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_155046588.1|1535552_1535762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420682.1|1536296_1536458_-	phosphatase	NA	NA	NA	NA	NA
WP_017376785.1|1537864_1538770_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376784.1|1539010_1539196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242578.1|1539232_1539769_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_027242577.1|1539786_1541088_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_048876008.1|1541084_1542059_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_155046589.1|1542138_1542288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1542467_1542632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1542633_1543509_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1543824_1544745_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1544760_1545144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1545470_1546427_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_144420678.1|1546694_1546973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243017.1|1547471_1548815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|1548988_1549132_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1549211_1550186_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1550333_1552205_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1552237_1552336_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1552571_1553201_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1553184_1553607_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1553613_1555353_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1555353_1556418_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1556421_1556775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1556887_1557856_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1557865_1558177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1558192_1558762_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1559025_1560354_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1560394_1561369_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1561955_1562357_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146619459.1|1562876_1565333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1565535_1566387_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1566432_1568139_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1569610_1570585_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1570947_1571193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1571556_1572585_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1572715_1572919_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420676.1|1573203_1574160_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_047927838.1|1574452_1574698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1574694_1574994_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1575216_1575687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1576297_1576525_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
1576230:1576840	attR	TACTTTCGGCCAGAGTTTAAATTGGAATACGCACGTCCACTTATCAGTGACACGTGGTGGTGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGATAGGTTAGCATTGGCTGTATGCAACCGATCATGATTGTAATATCGAATATAGGCCTCAACATCCTCCTTCATAGTATCACGGGTTAAGTGAATCACATTCAACAGCCATTCGTGCTTTAGGCTGCCAAAAAAACGCTCGACAACCGCATTGTCAACGCAAGCACCGACACTGCTCATAGAAGCGGTGATTTTATGCTTCTTCAACAGTTTTCGATATTTTTTACTGGTATACTGCGAACCACGATCACTGTGAAATAACAAGTGTTCTGTCGGCTGCCGCAAGTGAATCGCCATATCCATTGCACGACAAACTAGATTTTCGCTCATTCTCTTATTCATCGCCCAGCCAATCACTTTTCGAGAGTATAAATCAATAACGACCGCAAGATACAACCAGCCTTCAGCAGTTCTAAGGTAGGTAATGTCACCTGCCCATGAGTGATTTGCAATGACTGGATTAAACTGCTGATTCAATACGTTATCTGCAACAGC	NA	NA	NA	NA
>prophage 20
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	1581977	1624908	3194963	transposase	Staphylococcus_phage(20.0%)	41	NA	NA
WP_053856766.1|1581977_1583381_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1583568_1584426_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1584550_1585186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1585234_1585486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1585741_1586641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1586777_1587851_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1587951_1588365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1588385_1589099_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1589286_1590699_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1590908_1591877_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1592610_1592979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1592982_1593300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1593375_1594350_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1594869_1595370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1595440_1596769_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1596904_1598293_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1598440_1599751_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1600091_1601375_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1601448_1602069_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1602267_1602528_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1602730_1602877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1602852_1603446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1605309_1605528_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1606780_1607551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1607637_1607853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1607949_1609071_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1609337_1610312_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1610574_1611696_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1611988_1612276_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1612248_1612752_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1612832_1613492_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1613833_1614751_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1614880_1615054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1615719_1617078_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_144420789.1|1617269_1617716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376485.1|1617910_1619140_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1619185_1619812_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1619961_1621149_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1621157_1621850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1621971_1623124_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1623924_1624908_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 21
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	1683243	1773558	3194963	protease,tRNA,transposase	Burkholderia_phage(14.29%)	82	NA	NA
WP_036774017.1|1683243_1684119_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1684508_1684847_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1684843_1685440_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1685442_1687437_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1687500_1688439_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1688787_1689762_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1689965_1690163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1690324_1690729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1692312_1692753_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1693079_1693955_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1693967_1694210_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1694616_1694871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1696082_1697048_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1697140_1697452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1697652_1698429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1699258_1699450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1700178_1701228_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1701398_1702172_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1702232_1703822_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1704012_1705104_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1705126_1705444_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1705530_1706808_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1706829_1707666_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1707672_1709307_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1709738_1710098_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1710379_1711738_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1711763_1712006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1712499_1712679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1712934_1714191_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1714304_1714562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1714706_1715717_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1716093_1716948_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1716977_1717811_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_047927608.1|1718438_1719161_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1719242_1719563_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1719781_1720687_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1720772_1721171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1721315_1721813_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047927093.1|1723473_1724577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1724675_1725053_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1725132_1726107_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1727651_1728371_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1728454_1728742_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1729026_1729899_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1729855_1730632_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1730836_1731172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1731570_1731927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1732088_1732364_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1732473_1732821_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1732838_1733618_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1733617_1734127_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1734162_1734411_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1734722_1735058_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1735357_1736608_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1736689_1738717_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1739262_1739481_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1739652_1740015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1740163_1741567_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1741848_1743024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1743041_1745039_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1745019_1746000_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1746055_1746898_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_027242816.1|1746897_1747302_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1747294_1747714_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1747736_1748366_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1748934_1751124_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1751135_1752341_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1752325_1754173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1754157_1755396_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1755382_1757251_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1757284_1758538_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1758543_1759401_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1759419_1760148_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1761286_1762078_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1762443_1762731_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|1764853_1765243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1765419_1766178_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1766174_1768574_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1768587_1769865_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1769954_1771253_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1771450_1772344_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1772343_1773558_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 22
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	1784257	1834742	3194963	tRNA,transposase	Vibrio_phage(14.29%)	46	NA	NA
WP_069971651.1|1784257_1785133_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1785505_1785769_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1786075_1788670_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1788666_1789149_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1789126_1790167_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1790341_1790827_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1790934_1793505_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1793538_1794000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1794336_1795212_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1795489_1797250_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1797343_1798009_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1798021_1799527_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1799548_1800079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1800152_1801415_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1801601_1802474_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1802575_1803364_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1803456_1804782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1805135_1806311_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1806479_1807133_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1807288_1809229_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1809225_1809849_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1810013_1810988_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1811259_1811880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1811876_1813280_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1813347_1813764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1814171_1814669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1814665_1815640_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|1815719_1816289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1816433_1816970_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1816974_1817271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1817279_1817885_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1818070_1818469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1818659_1818863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1819007_1819163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1819287_1819740_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1819856_1821329_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1821767_1822232_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1822920_1824171_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1824280_1824751_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1824773_1825367_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1825504_1826554_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1826577_1827501_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1827517_1827979_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1828086_1828905_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1829514_1829658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1833821_1834742_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 23
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	1897064	1912380	3194963	transposase	Staphylococcus_phage(50.0%)	15	NA	NA
WP_017378288.1|1897064_1897286_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1897344_1898319_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1898517_1898682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1898678_1899314_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046602.1|1899590_1900370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1900402_1901164_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1901140_1902130_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1902265_1903141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1903159_1903819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1904060_1904507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1904503_1905907_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1906020_1906866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1907010_1908660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1908750_1909536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|1910976_1912380_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	1941053	1982810	3194963	tRNA,transposase	uncultured_Mediterranean_phage(40.0%)	38	NA	NA
WP_144420657.1|1941053_1942115_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1942826_1942988_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1943904_1944444_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1944826_1945243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1945338_1946154_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1946286_1947780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1947965_1948391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1948387_1950448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1950731_1951547_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1951647_1952466_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1952462_1952831_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1953012_1953840_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1953903_1954632_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1955034_1955763_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1956152_1956878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1956912_1960785_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1960985_1962119_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1962132_1962321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1962544_1963903_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_036773947.1|1965509_1966385_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1966896_1967532_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999981.1|1967544_1968018_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_155046603.1|1967945_1968098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929627.1|1968291_1968642_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1968701_1968989_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1969041_1969821_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376415.1|1970245_1971163_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1971214_1971970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1972037_1973312_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376412.1|1973432_1974110_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376411.1|1974310_1975735_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_016209938.1|1975709_1976348_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376410.1|1976710_1976989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376409.1|1977222_1978167_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376408.1|1978188_1980057_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376407.1|1980077_1980431_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_026063528.1|1980469_1981585_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1981769_1982810_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
>prophage 25
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	1987153	2043223	3194963	tRNA,transposase	Klosneuvirus(22.22%)	49	NA	NA
WP_017376399.1|1987153_1989925_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376398.1|1990081_1991314_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1991555_1992218_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376397.1|1992677_1994159_+	MFS transporter	NA	NA	NA	NA	NA
WP_036773116.1|1994356_1995331_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|1995854_1998581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|1999468_2000443_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|2000693_2001398_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|2002637_2003156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|2004123_2005608_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2005732_2007268_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2007290_2007620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2007516_2007732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2009715_2010915_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2011124_2011985_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2012100_2012679_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2012835_2013477_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2013515_2013737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2013729_2014713_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2015106_2015604_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2015748_2016024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2016175_2017858_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2017865_2018888_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2019056_2020058_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2020171_2020510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2020985_2022245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2022453_2022681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2022709_2022928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2023065_2023431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2023498_2023741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2023755_2024091_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2024095_2024533_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_036772812.1|2024558_2025944_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2026054_2026486_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2026591_2028103_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2028393_2029986_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2030186_2032382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772819.1|2032475_2033909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2033951_2034467_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2034466_2035414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2035397_2036063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2036059_2036788_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2036777_2037524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2037507_2038572_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2038776_2039964_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2040020_2041139_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2041586_2041844_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2042123_2042801_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2043019_2043223_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	2062923	2112458	3194963	protease,tRNA,transposase	Burkholderia_virus(20.0%)	41	NA	NA
WP_017377787.1|2062923_2063151_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2063240_2063996_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2064409_2065006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2065085_2067890_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2067870_2068824_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2068816_2070187_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2070357_2071761_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2072532_2072859_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420651.1|2073063_2073717_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_017376600.1|2074036_2074216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2074471_2075728_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2075966_2076113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2076195_2076552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2077047_2077407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2077416_2077800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2078688_2078829_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2078973_2079894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2082051_2082582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2082592_2083648_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2083663_2085703_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2085689_2086520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2086586_2090126_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2090239_2090959_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2091197_2091827_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2091946_2093350_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2093495_2095439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2095956_2096817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2097252_2098998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|2099400_2100873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2101055_2101655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2101792_2101990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2102190_2102331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2102398_2103178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2103742_2104144_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2104288_2104666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2105125_2106433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2107181_2107439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2107490_2108894_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2109134_2110844_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2111013_2111376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|2111483_2112458_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 27
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	2127027	2253865	3194963	protease,tRNA,transposase	Staphylococcus_phage(14.81%)	116	NA	NA
WP_017377892.1|2127027_2128449_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_026063687.1|2128538_2130137_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377894.1|2130293_2130920_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027242839.1|2131000_2133673_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377896.1|2134155_2135112_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_017377897.1|2135164_2135584_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_048875958.1|2135610_2136474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377899.1|2136463_2137255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2137559_2138531_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2138879_2139188_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2139184_2139841_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2139974_2140460_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2140537_2141059_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2141104_2141998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2141994_2142816_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2143010_2143160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2143387_2144218_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046606.1|2145623_2145794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2145946_2147350_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_144420645.1|2147459_2148716_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2148687_2149419_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2149430_2150708_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2150807_2151182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2151266_2152154_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2152211_2152940_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2152936_2154046_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2154197_2154626_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2154720_2155077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2155069_2156281_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2156277_2157066_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2157228_2158023_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2158472_2159213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2159216_2161715_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2161977_2162934_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2162917_2163679_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2163886_2164861_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2164969_2165725_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2165849_2166095_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2166154_2168428_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2168482_2168785_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2169025_2169319_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2169489_2169669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2169744_2170356_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2170602_2171919_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2171929_2172298_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2172328_2172991_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2173413_2173992_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2173971_2174379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2174502_2174799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2174845_2175721_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876123.1|2175790_2177971_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_017376060.1|2178074_2179424_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_036772012.1|2179497_2180187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2180319_2181507_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376055.1|2182025_2182670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2182666_2183980_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2184184_2184358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2184627_2185101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2185245_2185440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2185704_2186580_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210558.1|2186766_2187522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376051.1|2187595_2189248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376050.1|2189287_2190826_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_087910638.1|2190825_2192526_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_075275404.1|2192614_2193790_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_017376046.1|2193828_2194791_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_017376045.1|2195068_2195491_-	universal stress protein	NA	NA	NA	NA	NA
WP_017376044.1|2195796_2196438_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376043.1|2196566_2197901_+	dihydroorotase	NA	NA	NA	NA	NA
WP_048875952.1|2198015_2198651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771517.1|2199395_2200532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771498.1|2200715_2202446_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_017376037.1|2202435_2203644_+	MFS transporter	NA	NA	NA	NA	NA
WP_075275290.1|2203742_2204744_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420641.1|2204987_2205623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2205642_2206617_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875951.1|2206660_2207497_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2207642_2208062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2208338_2209019_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2208984_2209335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2209367_2210579_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2210919_2211549_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2211597_2212614_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2212860_2213076_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2213128_2213578_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2213657_2215403_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2215494_2217366_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2217810_2218527_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2219964_2220834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2220790_2221018_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2221986_2222901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2222946_2223969_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2224037_2225087_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046689.1|2225709_2225886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243219.1|2226170_2226479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2226645_2228049_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046608.1|2228141_2228306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2228627_2228852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2228862_2230074_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036774710.1|2230468_2231368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|2231541_2231943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2232189_2233233_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2233352_2233589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2234377_2235931_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2238111_2238339_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2239209_2240184_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017375736.1|2240910_2241993_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_017375735.1|2242035_2242686_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375734.1|2242908_2243280_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_027243178.1|2243390_2244752_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155046609.1|2246472_2246679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2246989_2248072_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2248068_2248380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2249425_2250400_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2251406_2252186_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2252647_2253865_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	2266714	2327682	3194963	transposase,integrase	Staphylococcus_phage(30.0%)	47	2274567:2274626	2324988:2325748
WP_144420638.1|2266714_2267797_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2267793_2268105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2269602_2270538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2271130_2272276_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2274518_2275682_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2274567:2274626	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|2275710_2275935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2277282_2278458_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2278803_2281314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2281372_2282185_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275283.1|2282625_2283237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2283379_2284354_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2284458_2285790_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2285988_2286057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2286188_2287631_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2288022_2289435_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2290124_2290571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2291165_2292014_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2292267_2293326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2293317_2295024_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2295095_2296829_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2297125_2297692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2297816_2298470_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2298496_2299957_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2300053_2301031_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2301500_2302904_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2303429_2303723_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2303949_2304714_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2304921_2305149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2305212_2305395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2305957_2306137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046690.1|2306179_2306512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2307366_2308071_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2308268_2308409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2308813_2309338_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|2309484_2310741_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2310808_2311288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2311728_2313132_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420632.1|2313546_2315862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2316434_2318327_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2318498_2319473_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2319776_2320583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2320651_2321263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2322744_2323041_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2323037_2323880_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2324270_2325056_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2325060_2326464_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2324988:2325748	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2326737_2327682_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	2348524	2376177	3194963	protease,transposase	Staphylococcus_phage(25.0%)	28	NA	NA
WP_017377305.1|2348524_2349826_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2349907_2350513_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2350625_2351930_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2352530_2353406_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2353521_2354193_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2354372_2355728_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2355848_2356586_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2356664_2357381_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2358029_2359304_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2359334_2359910_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2359954_2360920_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2361383_2362292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|2362679_2362931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2363075_2363504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2363489_2364434_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2364638_2364791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2364819_2365554_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2365648_2365909_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2366127_2367093_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|2367069_2367366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2367556_2368006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2368265_2368694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2368789_2369290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2369226_2369388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2370268_2370490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2371988_2372666_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2373980_2374319_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2375202_2376177_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 30
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	2415422	2542886	3194963	tRNA,transposase	Burkholderia_virus(25.0%)	105	NA	NA
WP_080999971.1|2415422_2416826_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2416939_2417515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2418760_2418988_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2419277_2419817_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2420126_2421614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2421665_2422091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2422309_2423713_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2423709_2424087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2424046_2424592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2424987_2426214_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2426814_2428467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2428403_2428598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963645.1|2428930_2430121_-	MFS transporter	NA	NA	NA	NA	NA
WP_027243147.1|2430369_2433042_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2433330_2434167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2434827_2435718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2436186_2437161_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876012.1|2437645_2439049_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2439194_2440598_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|2440682_2442497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2444408_2445812_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2445845_2447375_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2447410_2448871_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_027242908.1|2448845_2449805_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376200.1|2449882_2453389_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_017376201.1|2453412_2453982_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_027242907.1|2454195_2455350_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376204.1|2455368_2456142_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|2456141_2456588_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376206.1|2456605_2457655_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_017376207.1|2457765_2458299_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_036771893.1|2458379_2460797_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_027242906.1|2461081_2462149_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_017376209.1|2464351_2465416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376210.1|2465405_2466434_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376211.1|2466430_2466970_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376212.1|2467506_2469417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420622.1|2469861_2471439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|2471535_2472411_-	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_080963646.1|2472499_2473399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063514.1|2473313_2474060_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_017376216.1|2474067_2474625_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_017376217.1|2474628_2475366_-	UMP kinase	NA	NA	NA	NA	NA
WP_017376218.1|2475369_2476248_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376219.1|2476412_2477180_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376220.1|2477586_2478396_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376221.1|2478473_2481131_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|2481134_2482172_+	asparaginase	NA	NA	NA	NA	NA
WP_017376223.1|2482173_2482995_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376224.1|2483125_2484010_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_036773116.1|2484322_2485297_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2485349_2486345_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2486387_2487362_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376319.1|2487986_2488667_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017376318.1|2488666_2489476_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027242903.1|2489549_2493230_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_026063524.1|2493239_2494727_-	ribonuclease G	NA	NA	NA	NA	NA
WP_017376313.1|2494736_2495354_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_017376312.1|2495423_2495942_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376311.1|2495938_2496838_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2496853_2497897_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376309.1|2498094_2498382_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2498502_2499963_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2500042_2501479_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2501603_2502578_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2504768_2505530_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2506687_2506915_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2507868_2508081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2508098_2508416_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2508442_2509132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2509472_2509676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2509807_2510743_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2510755_2511538_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2511667_2511979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2512322_2512649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2512673_2513129_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2513118_2514171_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2514173_2515637_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2515771_2515999_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2517415_2517880_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2518136_2518952_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2519080_2521393_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2521509_2522037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2522728_2524006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2524016_2524268_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2524301_2524823_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2524992_2525979_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2526069_2526885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2527313_2527709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2527681_2527909_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_047927746.1|2528877_2529465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2530067_2530739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875918.1|2530883_2531465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420767.1|2531507_2532185_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243185.1|2532463_2533420_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_017377736.1|2533479_2534145_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017377737.1|2534178_2534724_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_155046615.1|2535003_2535165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774946.1|2535861_2536476_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_144420620.1|2536402_2537605_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875923.1|2537590_2538586_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2538589_2538994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2539961_2540189_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2541157_2541754_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046616.1|2541722_2542886_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
>prophage 31
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	2552607	2604021	3194963	tRNA,transposase	Bacillus_phage(20.0%)	55	NA	NA
WP_048876031.1|2552607_2554011_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|2554116_2554341_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2554523_2555345_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|2555490_2555745_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377841.1|2556133_2557918_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|2558006_2558726_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2558887_2559094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2559093_2559330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2559342_2559696_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2560233_2561067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2561159_2561357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2561454_2562840_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2562966_2563557_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2564588_2564876_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2564935_2565100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2565096_2566467_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2566833_2568246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2568315_2569086_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2569578_2569866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2571342_2571636_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2571593_2572415_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2572559_2572784_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_080999969.1|2573038_2573512_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.4e-33
WP_080999968.1|2573742_2574003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2573921_2574077_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2574175_2575150_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2576478_2576628_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2576744_2577038_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2577846_2578422_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2578499_2579375_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2579439_2580060_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2580044_2581127_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2581360_2581765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2583255_2584557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2584703_2585372_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2586304_2586868_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2586924_2588121_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_017376587.1|2588245_2589610_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376586.1|2589606_2590698_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376585.1|2590952_2591603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2591795_2591990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2592097_2592250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376583.1|2592516_2593644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063543.1|2593733_2594567_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376581.1|2594570_2595221_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_017376580.1|2595210_2596050_-	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_016210074.1|2596055_2596682_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376579.1|2596842_2597385_+	septation protein A	NA	NA	NA	NA	NA
WP_017376578.1|2597468_2597771_+	YciI family protein	NA	NA	NA	NA	NA
WP_144420763.1|2597788_2598031_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376576.1|2598129_2598402_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376575.1|2598440_2599079_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376574.1|2599111_2600203_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376573.1|2600374_2602117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2603046_2604021_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 32
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	2613315	2731776	3194963	tRNA,transposase	Staphylococcus_phage(29.63%)	108	NA	NA
WP_080999966.1|2613315_2614665_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2614962_2615520_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2615613_2616120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2616624_2617320_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|2617450_2618239_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2618272_2619676_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2620099_2621074_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2621330_2621558_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2622645_2623176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2623172_2624705_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2624701_2625652_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2626072_2626705_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2626947_2627145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2627494_2627923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2628000_2628996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2629140_2629392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2629496_2630141_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2630376_2630874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2631385_2632360_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2632730_2633024_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2633836_2634172_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2634492_2636031_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2636183_2637282_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2637520_2638720_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2638750_2639377_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2639405_2640290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2640423_2640654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2640791_2642033_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_144420613.1|2642312_2642684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2644815_2644977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2645352_2646480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2646596_2647259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2647344_2647605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2648023_2648785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2650846_2651506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2651606_2652257_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2652404_2653094_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377795.1|2653116_2654280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2654484_2654736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046691.1|2655259_2655856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2656055_2657030_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376009.1|2658384_2658675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376008.1|2658997_2660035_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376007.1|2660065_2661520_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376006.1|2661529_2662714_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376005.1|2662787_2663795_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376004.1|2663863_2665867_-	transketolase	NA	NA	NA	NA	NA
WP_017376003.1|2666318_2667479_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376001.1|2667715_2668831_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376000.1|2668993_2669518_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017375999.1|2669517_2670048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2671707_2672583_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2672703_2673204_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2673200_2673467_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2673632_2674607_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2674786_2675407_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2675713_2677117_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771922.1|2677951_2679142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|2679708_2680176_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|2680677_2680932_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|2681133_2681637_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|2681853_2682459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2682619_2683303_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2683378_2684158_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|2684144_2685005_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|2685128_2685494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377271.1|2685879_2686209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2686619_2687594_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_144420611.1|2688128_2688329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377274.1|2688361_2689714_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	3.2e-36
WP_017377275.1|2690775_2691498_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2691489_2691858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2692120_2693422_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2693517_2693961_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2693964_2694474_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2694466_2697280_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2697776_2698709_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2698813_2699740_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2699918_2701457_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2701630_2701891_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2703165_2703774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2703820_2704549_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2704795_2704933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619438.1|2706083_2706635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2706869_2707781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2708040_2708337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2708681_2709835_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2710431_2710980_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2711083_2711647_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2711864_2712623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2713898_2714126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2714348_2714528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2714783_2716040_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2716107_2716752_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_017378393.1|2717556_2717763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378392.1|2718033_2718186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816949.1|2718763_2719162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378390.1|2719355_2720933_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378389.1|2721066_2722008_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378388.1|2722009_2722783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963621.1|2724391_2724598_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2724864_2725152_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378384.1|2725157_2727539_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|2727551_2728547_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_016210495.1|2728678_2729038_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378382.1|2729080_2729275_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|2729309_2729840_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378381.1|2729844_2731776_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
>prophage 33
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	2769554	2822583	3194963	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2769554_2770529_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2770685_2772260_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2772484_2772763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2772832_2773708_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2773717_2774878_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2774992_2776141_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2776151_2778953_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2779059_2779758_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2779770_2781534_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2781537_2781885_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2781878_2782253_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2783200_2784484_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2784893_2786189_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2786544_2787090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046622.1|2787683_2788199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2788210_2789590_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2789825_2790260_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2790256_2791609_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2791608_2792724_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2792724_2793741_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2793730_2795401_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2795420_2795756_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2795783_2797223_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2797219_2798266_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2798408_2799905_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2800200_2801202_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2801307_2801919_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2802039_2802417_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2802467_2803874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2803867_2804935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2805041_2806643_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2806891_2807809_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2807877_2809572_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2809806_2810736_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2810766_2812170_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2812400_2813105_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2813171_2813828_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2813838_2814720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2814890_2817560_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2817920_2818895_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2818974_2819946_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2819999_2820974_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2821093_2821315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2821378_2821687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2821611_2822583_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	2837149	2891410	3194963	transposase	Staphylococcus_phage(37.5%)	51	NA	NA
WP_026063658.1|2837149_2837878_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2838187_2838442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2839155_2841810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2841848_2842139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2842255_2843554_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2844124_2844613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2844593_2844896_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2845142_2845631_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2845664_2846303_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2846424_2846964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2847053_2848280_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2848892_2849150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2849236_2850136_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2850280_2850547_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2850538_2850688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2850915_2851791_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2851920_2852148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2852214_2852409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2852467_2853442_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2853479_2853668_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2853668_2855441_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2855430_2856423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2857030_2857723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2858209_2858779_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2858775_2859750_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2859789_2860293_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2860383_2861787_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2862485_2862671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2862776_2864180_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046624.1|2864226_2864757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2864790_2866218_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|2867503_2869873_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2869948_2870767_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2871118_2871664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2872146_2873385_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2873361_2874336_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017375625.1|2874428_2874656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|2874660_2875152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243039.1|2875824_2876712_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_027243038.1|2876801_2878292_-	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_017376549.1|2878315_2879197_-	ROK family protein	NA	NA	NA	NA	NA
WP_017376548.1|2879193_2879916_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376547.1|2880615_2881407_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|2881593_2881839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420598.1|2881990_2882221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376543.1|2882250_2883030_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_047927468.1|2883055_2883361_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_144420752.1|2883357_2884251_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_027243035.1|2884606_2885905_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376538.1|2888507_2889689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2889982_2891410_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	2898996	2948673	3194963	tRNA,transposase	Bodo_saltans_virus(14.29%)	43	NA	NA
WP_062312049.1|2898996_2900364_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2900856_2901336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2901515_2903579_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2903587_2904313_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2904940_2905654_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2905658_2906189_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2906423_2906657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2906769_2907018_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2907825_2910018_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2910035_2910344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2910997_2912707_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2912900_2913056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2914458_2915334_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2915659_2916421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2916645_2917377_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2917373_2917910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2917963_2918728_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2918730_2920308_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2920314_2920791_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2920766_2921198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2921230_2921986_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2922160_2922448_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2922830_2923055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2923394_2924558_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2924592_2925570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2925563_2926250_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2926188_2927304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2927583_2928189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2928426_2928906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2930728_2931382_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2931494_2932046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2932145_2933120_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2933405_2933930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2934627_2935452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2935707_2936064_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2936060_2937464_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2937583_2938144_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2938301_2938868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243087.1|2941664_2942360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2942400_2942613_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2944185_2945295_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2945350_2946832_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2947269_2948673_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP039171	Piscirickettsia salmonis strain Psal-138 chromosome, complete genome	3194963	3076355	3141604	3194963	protease,transposase	Hokovirus(14.29%)	57	NA	NA
WP_017376170.1|3076355_3077456_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3077813_3078788_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3078924_3079803_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3079810_3080041_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3080094_3081099_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3081317_3082145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3082226_3083615_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3083902_3085303_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3085397_3086324_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3086320_3087457_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3087453_3088461_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3088457_3089621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3089630_3090482_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3090513_3091686_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3091682_3093071_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3093099_3093507_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3093526_3094534_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3094530_3095403_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3095399_3096260_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3096261_3098532_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3098533_3099679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3099725_3100211_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3100250_3100874_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3106553_3107306_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155046626.1|3107908_3108076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243062.1|3108637_3109261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3109365_3110154_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3110153_3110885_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3110918_3112646_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3112659_3113721_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3114035_3115250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3115382_3115907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3116524_3117373_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3117359_3118058_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3118112_3118874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3118866_3119289_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3119418_3119970_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3120025_3120988_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3120988_3121204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3121390_3122200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3122179_3123022_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3123018_3124263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3124401_3125490_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3125507_3126008_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3126195_3126795_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3126800_3127964_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3127996_3128950_+	glutathione synthase	NA	NA	NA	NA	NA
WP_017376261.1|3129313_3130378_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3130374_3133437_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3133589_3134042_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3134073_3134430_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3134848_3135622_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243067.1|3136181_3136364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376269.1|3138245_3138536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3138760_3139636_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3139632_3140190_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3140200_3141604_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039172	Piscirickettsia salmonis strain Psal-138 plasmid unnamed1, complete sequence	175591	0	117511	175591	transposase,integrase,terminase,portal	Streptococcus_phage(40.0%)	121	11253:11312	117877:119612
WP_017377655.1|1412_1658_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|1654_2041_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|2128_2857_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|2835_3456_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|3801_4488_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|5437_5800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|5802_7542_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_051929558.1|8123_8807_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|8888_9866_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|9941_10112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|10152_10881_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
11253:11312	attL	GATGTATCTTAGCTAAATCTGTCAGCACCTTTTTAATTTTAGTATCAACAACCTGTTTTT	NA	NA	NA	NA
WP_036771293.1|11426_11693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046692.1|11988_13887_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|14308_15037_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_082884401.1|15134_15257_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|15673_15838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|15858_17145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|17327_18056_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|18183_19161_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046631.1|19235_19886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046632.1|21895_22045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126795.1|22517_22778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|22781_23054_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|23129_23858_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|24427_25399_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|26263_27091_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|27944_28415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|29308_29452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|30658_31258_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|31611_32388_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|32748_33477_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|33546_33747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|33665_34637_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027242938.1|35050_35419_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017375972.1|35420_35729_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017375841.1|36173_36383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|36689_36908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242936.1|36904_37357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420845.1|37484_37715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876207.1|38220_39696_-	response regulator	NA	NA	NA	NA	NA
WP_017375966.1|39696_40263_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_146619519.1|40407_40845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|40876_41302_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_036817204.1|41572_42568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817201.1|42871_43279_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017375960.1|43386_44430_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_017375959.1|44731_44965_+	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_146619517.1|45102_45255_-	phosphatase	NA	NA	NA	NA	NA
WP_081078123.1|45284_45647_+	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
WP_026063496.1|46525_46891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242932.1|47023_47251_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242931.1|47259_47667_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242930.1|47812_49195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375952.1|49384_49588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242929.1|49783_50167_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|50253_50736_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|50738_52070_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_155046635.1|52178_52709_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.6e-26
WP_087910668.1|52795_53182_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|53219_53954_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|54000_54714_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_144420848.1|56092_56278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243190.1|56281_59626_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017377509.1|59806_60535_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|60628_61603_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|61916_62279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|62318_62828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|63059_64040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|64505_65483_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|65963_66941_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|66955_67117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|67334_67589_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|67578_67866_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_036771347.1|68360_69338_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046693.1|69434_69575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093683.1|70338_70551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|70708_71686_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_075317322.1|71672_73187_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_047927782.1|73982_74372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|74287_75265_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_048876196.1|75294_76443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243215.1|78256_79279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|79761_80490_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_048876194.1|81729_82263_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|82443_82785_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|82965_83232_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|83304_85170_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|85337_85622_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|85965_86694_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|86775_87267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|87999_88227_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|89778_90207_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|90142_90529_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|90558_91287_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|91298_91448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|91694_92423_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|93800_94763_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|94786_95116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|95182_96223_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|96236_96428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|96632_97202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|97244_97544_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774376.1|97540_97969_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|98278_99007_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|99180_99954_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|100667_101603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|101877_102606_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243201.1|102771_103011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|103074_106416_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|106573_107302_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|107595_107991_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|108043_108772_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|109255_109984_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|110154_110724_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|110728_111412_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|111563_112292_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_080963627.1|112310_112529_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774644.1|113508_114570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|115078_115825_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|115825_116230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|116536_117511_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
117877:119612	attR	GATGTATCTTAGCTAAATCTGTCAGCACCTTTTTAATTTTAGTATCAACAACCTGTTTTTTAGGTTGATACCGATAAACTGATCGGCCAATACGGCACATCTTGCATGCTTTATTCCCGCTCAATGCATGAGCTTTGACAGCATAATCAACTAAGTCACGCCGACTCGCTGCGGTTATAGCTTTTTTTCAACAATATCCTTGAGCACTTTGTGCTCTAGGCTAATGTCTGCGTACATCTGTTTCAAACGACGGTTTTCGTCTTCAAACTCTTTTAAACGCTGTAGATCTGAAACGCCCATGCCTTGATATTTGGATCTGAGTTTGTAGTAGCTGCTTTTAGCAATACCATACTGGCGACAAATATCTTCAACTTTAACACCCGCTTGGCCTTCATTAAGCATGGCTACAATTTGTGATTCTGTTAGTTTTGATCGTTTCATCTTCTCTCTCCTGGCTAAGTTAATTTAACAGAAGATTCCACTTATCACTTGTACTATTTTAAGGGAGGGTTACCGAGTTATGTGAGAGCACAGTAGTGGAGTGTGCCGATTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTTGCGACAGAACCCTCCTTGGTTCGCAGCGCCAACATCATATCATTAAATCAAATTGCGACAGAACCATTATAGCTCATCATCTTCATATCTTGTATGTTTAGGATCATTACAAACATACCATCCACTAGAACTAGAATTTGTACATACCCCATACCTTTTAGATAAATCAAAGTACATAGTTGTGCTAGAAGGAGATTGTGATGATTTAGCATCAAAAAGTGAGCCAAAATGATTGTAAGTCGTGACATATAAATTACTTTTATCTGAATTTTTAATATATATTGCGCTGACAGGATCATTTACTCTACTTTCTAAAAACCATTTTAAATTATTAGGTACGTTATCCATAAATGGATCACACTGTTTGAAATAAACCCAATCCCAATCCGTCGTTTTTCCAGCAATATTAGAAGTTAAACAGCTTAAAAACCAACCATCAGATGAAAATGCACGGCCATATAGTGAAAGCATCAATATTCTAGAATTTTTCATATCATAGTATGTTCTATTCAAATAATTTGAATTATACGAACCTGAATACATAGGATAGTAATTATTATCAGATTTATCATAAAACCTCATACCAATTTCATACCAAAATGTATTTACTTTTGATGGTGTTTTAAAAAAGTATTTAGACATTTTATTTGCATCTAAAACAATATTAGTTCCACTTGATTTTGAAATAATTCCATAGTTGCCATACCATTGAATAGATAGATCTTTATTTAAACGAGGTTTTAATTTTCCATCTCTTACATCCCATTTTTGATAAGGGTTATAAATATCACAAGGCCAAAACTCTACATAATCCCATTTATCATCACCTTTGATGACATTTTCTGGTGCAGTCATACATAGAGGGATTCCAAATTGAGATTTAGAGAAAGCAACTCTGCCAAGAGTATCATAAATAGCTTTTTGACTTTCTACATTAGAACATGTTTGAGCGTATAAATAAGATCGAGACGTTTTCATAGAAGAGTCTCTTGATTGAGTTGGAGCTAAACAGTAACCTCCCTGAGTTGTAATTAACTGGCTTGGTATTGTAGGTAAATCTTTAAAT	NA	NA	NA	NA
>prophage 2
NZ_CP039172	Piscirickettsia salmonis strain Psal-138 plasmid unnamed1, complete sequence	175591	123458	125080	175591	transposase	Acinetobacter_phage(50.0%)	3	NA	NA
WP_017375632.1|123458_123794_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|123988_124192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|124285_125080_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
>prophage 3
NZ_CP039172	Piscirickettsia salmonis strain Psal-138 plasmid unnamed1, complete sequence	175591	131450	133868	175591	transposase,portal	unidentified_phage(50.0%)	2	NA	NA
WP_048875857.1|131450_132425_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|133412_133868_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
>prophage 4
NZ_CP039172	Piscirickettsia salmonis strain Psal-138 plasmid unnamed1, complete sequence	175591	138586	145554	175591	transposase	Streptococcus_phage(100.0%)	7	NA	NA
WP_017377509.1|138586_139315_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|139456_140389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|140418_141147_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|141149_141422_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|142272_143001_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|143056_143677_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|144825_145554_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 5
NZ_CP039172	Piscirickettsia salmonis strain Psal-138 plasmid unnamed1, complete sequence	175591	154421	158061	175591	transposase	unidentified_phage(50.0%)	5	NA	NA
WP_036773116.1|154421_155396_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_017375692.1|155539_155773_+	hypothetical protein	NA	Q7Y5W4	Haemophilus_phage	42.6	1.3e-06
WP_017375691.1|155796_156498_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.6	9.6e-32
WP_036773107.1|156481_156799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|157086_158061_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
>prophage 6
NZ_CP039172	Piscirickettsia salmonis strain Psal-138 plasmid unnamed1, complete sequence	175591	161511	172973	175591	transposase,head,capsid,tail	Streptococcus_phage(18.18%)	17	NA	NA
WP_036771639.1|161511_162486_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|162535_163075_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|163088_163673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|164057_164369_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|164365_164791_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|164969_165365_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|165361_165712_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|165711_166134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|166135_166459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|166515_166782_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|166785_168864_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|168856_169198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|169194_169866_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_036772541.1|170463_171192_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|171221_171611_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|171633_172362_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|172364_172973_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
>prophage 1
NZ_CP039174	Piscirickettsia salmonis strain Psal-138 plasmid unnamed3, complete sequence	50692	5716	19512	50692	capsid,tail,head,transposase	Moraxella_phage(18.18%)	18	NA	NA
WP_036771639.1|5716_6691_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|6740_7280_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|7293_7878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|8262_8574_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|8570_8996_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|9174_9570_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|9566_9917_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|9916_10339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|10340_10664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|10720_10987_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|10990_13069_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|13061_13403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|13399_14071_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|14000_14786_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|14775_15333_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|15329_18020_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|18078_18507_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|18534_19512_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 1
NZ_CP039175	Piscirickettsia salmonis strain Psal-138 plasmid unnamed4, complete sequence	33468	3315	19337	33468	transposase,integrase,terminase,capsid,tail,head	unidentified_phage(35.71%)	21	NA	NA
WP_036771330.1|3315_4290_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4825_5416_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5646_5907_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5899_6253_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6429_7404_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|7936_8302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876240.1|8509_8701_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8684_9041_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|9138_10113_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|10738_11605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|11817_12201_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|12287_12770_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|12772_12958_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|12977_13952_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|14048_14441_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|14476_15058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|15438_16413_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|16486_16702_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|17505_18021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|18366_18924_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|18920_19337_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
