The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	31805	91594	3195206	transposase,tRNA	Staphylococcus_phage(28.57%)	52	NA	NA
WP_036772169.1|31805_32681_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33039_34395_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34486_34993_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34989_35358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36760_38545_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39025_40153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40225_40981_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|41017_43711_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43742_44294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44401_45415_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45535_45760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46115_46877_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47019_47814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|47958_48711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49022_50549_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50687_51761_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|51800_53108_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53082_54252_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54306_55032_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55497_57603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|57817_58282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58301_58811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59195_60137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60418_61870_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773655.1|62336_62741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63301_64276_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|65010_65388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|65977_66952_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773242.1|66991_67546_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|67726_68626_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|68630_69257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|69201_71523_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|71669_72149_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|72145_73297_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|73431_73935_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|74028_75003_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|74992_76306_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|76346_77726_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|77732_79184_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|79209_79578_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378407.1|79596_80664_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|80696_81593_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|81589_82426_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|82561_83014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|83152_83899_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|83879_84443_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|84451_84967_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|85108_87187_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|87186_88137_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|89004_89403_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|89628_89958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|90574_91594_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	123076	241144	3195206	transposase,protease,tRNA	Staphylococcus_phage(12.5%)	106	NA	NA
WP_075278722.1|123076_123952_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|124392_124686_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|124686_124941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|124957_127450_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|127442_128126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|128125_129169_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|129168_130398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|130399_130729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|130725_131925_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|132037_132427_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|132426_133371_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|133490_134888_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|135213_135735_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|135858_136167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|136181_141404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|141794_143801_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|143931_146262_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|146437_147268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|147384_147780_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|147776_148310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|148306_148708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|149102_149423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|149432_150389_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|150898_151423_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|151523_152522_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|152610_153507_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|153580_154867_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|155326_156643_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|156756_156927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|156946_157921_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|158047_158308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|158575_158866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|161404_162445_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|162547_163519_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|163641_164490_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|164641_164929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|165239_165611_+	isochorismatase	NA	NA	NA	NA	NA
WP_155052673.1|166671_166896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|167033_167171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|167184_167397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242723.1|167393_167693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|167920_168745_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|168883_170017_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|170076_171486_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|171633_173214_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|173971_174967_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|174972_177039_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|177096_178047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|178241_178568_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|178790_180050_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|180309_181185_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|181223_182186_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|187880_188225_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|188321_189245_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|189744_190233_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|190335_191136_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|191146_192898_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|193787_194030_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|194033_194432_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|194663_195539_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|196257_196716_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|196897_197083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|197798_199613_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|200023_200692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|200701_202018_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|202177_203140_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|203220_203376_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|203389_203626_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|203818_205036_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|205013_205472_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|205499_206879_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|206915_207134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|207453_208749_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|208953_209145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|209343_210219_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|210406_211672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|211705_212581_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|212702_213161_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|213184_214105_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|214232_215015_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|215105_216605_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|216918_218802_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|219061_219724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|219790_220900_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|220911_221556_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|221574_222561_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|222645_223722_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|223923_224748_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|225050_226016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|226334_227387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|227445_228420_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|228755_229184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|229420_229903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|229958_231209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|231311_231530_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|232001_232856_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|232910_233381_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|233677_233914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|234060_234441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|234499_235375_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|236141_237053_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|237169_238018_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|238084_239095_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|239118_239442_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375571.1|239452_239854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|240124_241144_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	314947	357306	3195206	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|314947_315823_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|315903_316536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|316489_317935_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|317969_318389_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|319162_319531_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|319540_320080_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|320240_320672_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|320675_321374_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|321621_322128_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|322170_322539_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|322809_326886_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|326949_331158_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|331319_331694_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|331798_332272_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|332287_334399_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|334426_335617_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|335623_335935_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|336057_336696_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|336711_337329_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|337325_337622_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|337636_338461_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|338477_338753_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|338758_339091_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|339103_339838_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|339851_340265_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|340264_340465_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|340464_340722_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|340843_341212_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|341229_341541_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|341556_342099_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|342111_342417_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|342445_342838_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|342850_343384_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|343393_343747_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|343757_344258_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|344263_344446_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|344448_344883_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|344883_346206_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|346262_346376_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|346519_346876_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|346901_347291_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|347300_347921_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|347942_348920_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|348968_349367_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|349479_350727_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|350713_351370_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|351454_351733_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|351975_352203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|352335_353130_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|353438_354653_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|355050_355230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|355198_355852_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|356227_356476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|356565_357306_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	363786	421642	3195206	transposase,tRNA,protease	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_017376977.1|363786_365544_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_065653729.1|365545_366649_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376975.1|366729_367281_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_017376974.1|367291_368659_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376973.1|368809_369046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376972.1|369104_369848_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_027242667.1|369847_370489_+	lipoprotein	NA	NA	NA	NA	NA
WP_017376970.1|370488_372153_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_017376969.1|372181_372517_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_027242666.1|372681_374280_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376966.1|374339_374630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772765.1|374830_375262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|375324_377805_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|377891_378371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|378343_379384_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|379320_380037_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|380049_380385_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|380421_380892_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|380934_382770_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|382814_383903_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|383924_384986_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|385063_385579_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|385619_386897_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|386911_387763_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|387791_388439_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|388435_389395_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_048875861.1|389916_390786_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|390930_391185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|391329_391896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|392001_392442_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_027242664.1|392953_394156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|394439_395414_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_036772941.1|396013_396253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|396457_397069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|397065_397323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|397573_397966_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|398095_398644_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|398643_399471_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|399520_401206_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|401283_401745_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|401781_402345_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|402571_402901_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|402881_403106_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|403250_403841_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|403865_405137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|405154_406408_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|406404_407049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|407121_408171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|408272_409910_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|409944_410274_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|410430_410718_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376927.1|411144_411282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|411787_413008_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|413066_415865_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|416170_417337_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|417435_417972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|418033_418366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|418623_419526_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|419595_420093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|420238_421642_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	451079	499218	3195206	transposase	Staphylococcus_phage(100.0%)	42	NA	NA
WP_036774259.1|451079_452054_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420729.1|452401_453040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|453159_454563_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242658.1|455905_457369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856768.1|457444_458239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242656.1|458530_459349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|459366_459960_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376894.1|460176_460410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242655.1|460633_461530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420727.1|461834_462605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376891.1|462774_463677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|463673_464897_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_027242653.1|464914_465841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|465856_466897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242651.1|467011_467422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376888.1|467474_467978_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_017376887.1|467970_468717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376886.1|468719_469850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|469854_470094_+	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_027242650.1|472583_473072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|473074_474151_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_017376878.1|474143_474797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875870.1|474803_475229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|475265_478265_+	ATPase AAA	NA	NA	NA	NA	NA
WP_027242646.1|478326_479829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|480280_481900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|481941_484245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376870.1|484521_485418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|485420_488747_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_144420818.1|488948_489137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|489148_489625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|489667_489895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|490076_490610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|490640_490982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772347.1|490984_491401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876253.1|491562_492219_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036771639.1|492215_493190_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|493631_493895_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|494322_495297_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_087910671.1|495684_496149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910670.1|496242_496428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|498243_499218_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 6
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	504022	558705	3195206	transposase	Streptococcus_phage(22.22%)	52	NA	NA
WP_048875872.1|504022_505306_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|505478_505616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|505612_507016_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|507129_507567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|507687_508116_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|508363_508801_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|509232_510621_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|511067_512561_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|512755_513511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|514010_514241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|515345_516356_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|516352_516574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|517292_518234_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|518761_519160_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|519099_519954_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|520045_520327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|520412_521090_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|521135_522416_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|522591_523641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|523719_524520_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|524533_525328_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|525430_526450_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|526496_527108_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|527111_527798_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|527794_528337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|528629_529817_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|530061_530787_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|530972_531761_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|531757_532153_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|532545_533586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|533582_534986_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|537401_537659_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|537698_539084_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242633.1|539413_540511_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_017377120.1|540544_541795_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|541795_542428_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|542717_543170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|543215_544058_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|544092_544584_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|544779_546747_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|546974_547379_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|547356_548385_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|548371_549160_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|549586_550990_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377110.1|551191_552202_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_075275363.1|552214_552682_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377107.1|553011_554382_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_017377106.1|554684_555155_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377105.1|555432_555708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|555718_557122_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069971661.1|557296_557734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|557730_558705_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 7
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	590496	723888	3195206	plate,transposase,tRNA	Acinetobacter_phage(14.29%)	110	NA	NA
WP_036772726.1|590496_591045_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|591797_593177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|593536_595000_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|595183_595996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|596460_598455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|598849_600229_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|600266_600704_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|600746_601463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|603009_603540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|603606_605427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|605991_606498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|606582_607986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|608100_608355_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|608507_608780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|609355_609538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|609654_610230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046568.1|610238_610397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|611297_611540_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|611842_612934_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|612914_613868_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|614091_615576_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|615615_616119_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|616378_617554_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|617701_618106_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|618262_619138_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|619172_619526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|622855_623281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|623511_624648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|624634_625957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|625949_627068_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|627188_627722_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|627860_629498_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|629502_629724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|629832_630846_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|631117_633346_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_026063593.1|633326_634031_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|634265_634595_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|635995_636214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|636272_637148_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|637140_638007_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|638074_639394_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|639863_640424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|640742_641669_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|642564_643473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|647169_648009_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|648195_648411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|648459_649035_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|649031_649370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|649538_650528_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|651517_652420_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875883.1|652679_653216_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|653360_654278_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|654712_655723_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|656530_657067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|658279_658627_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|658771_659731_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|659832_660615_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|660747_661707_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|661731_662136_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|662164_662839_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|662938_664654_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|664650_665013_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|665027_666182_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|666185_667193_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|667195_668212_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|668427_669513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|669619_670012_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|670144_671428_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|671443_672745_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|672762_674565_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|674569_675562_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|675642_676719_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|676816_677791_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|677858_678830_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|679013_679283_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|679884_681171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|681235_681916_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155052676.1|687570_687858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375775.1|687896_688091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275355.1|688138_689113_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_027242570.1|689326_690466_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|690674_692045_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|692423_693416_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|693419_693935_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|693931_694771_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|694803_696354_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|696461_696833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|698053_698215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|698795_700199_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|700233_700671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774104.1|701726_702155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|702342_703149_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|703223_703616_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|703660_704482_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|704494_705478_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|705479_706748_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|706754_709259_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|709389_710415_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|710411_711122_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|711046_711877_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|712026_712410_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|712444_713344_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|713389_714061_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|714143_714719_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|714817_715618_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|715759_716617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|717479_718616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|718682_721853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|721865_722576_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|722580_723888_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	732530	778831	3195206	plate,transposase	Staphylococcus_phage(21.43%)	52	NA	NA
WP_017376356.1|732530_732929_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|732925_734614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|734595_735552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|735594_736110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|736214_737147_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|737366_737753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|737770_738415_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|738565_739405_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|739480_740083_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|740083_740938_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|741295_741607_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|741631_743020_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|743175_743907_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|743903_744431_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|744462_745020_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|745025_746006_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|746145_746946_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|746949_747717_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|747713_748178_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|748200_748854_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|748857_749205_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|749238_749490_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|749567_750836_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|750838_751597_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|751658_752549_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|752599_753283_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|753292_753640_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155074352.1|753912_755628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556468.1|755714_756017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|756008_756881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|757048_758878_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|759045_759687_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|760011_760458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|760475_760649_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|760707_761757_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|761763_762714_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|762768_763713_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|763740_764478_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|764566_764809_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|764883_766107_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|766138_766987_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|766983_768036_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|768172_768793_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|769018_770171_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|771191_772166_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|772162_772333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|773301_773898_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|773866_775027_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|775537_775879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|775982_777017_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|777013_777724_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|777856_778831_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 9
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	786991	841302	3195206	tRNA,transposase,protease	Prochlorococcus_phage(33.33%)	49	NA	NA
WP_017377942.1|786991_787498_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243058.1|787579_787996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|788087_788948_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|789045_789591_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|789673_790525_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|790566_793473_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|793533_793731_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|793737_794748_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|794744_795803_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|795817_796597_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|796599_797412_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|797423_798371_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|798381_799674_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|799852_800956_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|800952_801345_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|801357_802734_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|802727_804197_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|804390_804825_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|805120_805297_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|806331_807357_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_017377925.1|807858_808251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|809643_810294_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|810992_811787_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|811966_812611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|812785_813760_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|814160_814418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|816095_816773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|817006_817831_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|817924_818638_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|818727_819819_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|819890_820472_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|820477_821104_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|821200_822148_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|822494_823157_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|823327_823987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|824155_825415_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|825411_826497_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|826489_827371_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|827359_828610_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|829995_830316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|830574_830841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|831331_831550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|832535_832757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|832753_833836_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|833846_834218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|834214_834394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|837097_837373_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|838208_839666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|840093_841302_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	884981	947501	3195206	transposase,tRNA	Staphylococcus_phage(28.57%)	53	NA	NA
WP_048875904.1|884981_885857_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|886113_886551_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|886611_887244_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|887259_887907_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|887909_889973_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|890299_891592_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|891980_894191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|894207_894864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|897249_898125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|898383_898995_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|899422_902011_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|902113_902875_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|902871_903408_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|903456_904413_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|904490_907676_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|907679_908735_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|908964_909567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|909610_910273_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|910307_910655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375702.1|911123_912155_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|912617_914021_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|915139_915484_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|915575_916031_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|916279_916414_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|916406_917048_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|917044_917761_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|917764_919084_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155051395.1|919765_919909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773644.1|920888_923525_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_036773645.1|923566_924652_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|924651_925335_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_017377748.1|925395_927057_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377747.1|927209_927464_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|927542_927860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|928012_928411_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|928492_929131_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|929287_930262_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|930634_930910_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|931459_931744_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|933560_934154_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|935241_936123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|936234_937914_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|938040_939291_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|939366_939828_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|939824_940973_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|940978_941653_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|941649_942306_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|942431_942905_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|942906_943329_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|943315_944335_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|944494_944674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|944892_945174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|946625_947501_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	951403	1018366	3195206	transposase,protease,tRNA	Bacillus_phage(20.0%)	56	NA	NA
WP_048876012.1|951403_952807_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|953165_953933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|954046_955450_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|955446_955608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|955923_956898_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|957138_958422_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|958488_959412_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|961607_963752_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|963773_963980_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|964040_964661_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|964701_965595_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|965680_966406_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|966467_966872_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|967034_969143_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|969266_970316_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|970312_971779_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|971921_973259_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|973326_974817_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|975045_975417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|975567_976395_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|976697_977354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|977301_978225_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|978238_979162_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027243109.1|979436_980093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|981792_982020_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376989.1|982344_982893_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|982973_983249_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|983248_984298_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|984410_986348_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|986495_988208_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|988276_988996_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|988992_989595_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|989709_990597_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|990787_991135_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|991185_992025_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|992120_992867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|993063_993690_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|994005_994575_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|994718_995417_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|996123_996747_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|996856_997750_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|997856_999467_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|999463_1000759_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|1000780_1002703_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|1002813_1003116_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|1003210_1008097_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1008144_1009467_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1009591_1010686_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1010737_1011676_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1011756_1012341_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1012725_1013616_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1013818_1014310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1014449_1014941_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1015109_1015823_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065653747.1|1015885_1017226_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1017490_1018366_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	1023979	1086506	3195206	transposase	Staphylococcus_phage(33.33%)	57	NA	NA
WP_017377787.1|1023979_1024207_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1024233_1025274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1025340_1025910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1026140_1026545_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1026557_1026698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1026792_1027992_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1028012_1028624_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1028825_1029587_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1029882_1030809_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1030969_1031926_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1032070_1032340_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1032606_1033581_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1033734_1033962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1034078_1034504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1034660_1035590_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1036036_1036567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|1036888_1037194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1037671_1037983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1038322_1039489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1041676_1042648_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1043250_1043424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1043819_1044737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1044737_1045589_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1046029_1047076_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1047065_1049057_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1049166_1049541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1049794_1049977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1050238_1050940_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027242868.1|1050940_1051408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376293.1|1053046_1055797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1056032_1057325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1057811_1058717_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376296.1|1059494_1060211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1060496_1061258_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1061290_1062694_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1062690_1062855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1062914_1063202_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1063946_1064675_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1064643_1065390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420708.1|1065470_1065860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1065856_1066831_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1066987_1067305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772457.1|1069780_1070089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1070164_1070437_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1072970_1073408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1074009_1075197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1075467_1077102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1077152_1077881_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1079308_1080271_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1080494_1081490_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1081517_1082453_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1082496_1082958_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1082936_1083554_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1083583_1084558_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1084612_1085080_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1085092_1085737_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1085777_1086506_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 13
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	1095206	1144774	3195206	transposase	Acinetobacter_phage(22.22%)	39	NA	NA
WP_082300708.1|1095206_1095767_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1097091_1097487_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1097495_1097852_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1097844_1098720_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1098805_1099384_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1099341_1099635_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1100595_1102107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1102354_1103758_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1103963_1104398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1104480_1105185_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1105443_1105932_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1105960_1106635_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1106875_1107751_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275340.1|1108281_1108890_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1109160_1109619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1109897_1110287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1110472_1111288_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1111510_1112416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1112579_1113341_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1113344_1114211_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1114296_1114908_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1115286_1116534_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1116685_1117387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1117684_1117858_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1118347_1118848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1119926_1120154_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420705.1|1120239_1120440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1120468_1121149_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1121171_1123346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1123591_1124662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1124658_1126062_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619408.1|1126210_1126696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1126767_1127589_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1128255_1129755_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1130058_1132752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1132748_1136150_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_048875961.1|1137737_1139141_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1140219_1140891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1143799_1144774_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 14
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	1169497	1226185	3195206	transposase,tRNA	Staphylococcus_phage(28.57%)	50	NA	NA
WP_053093677.1|1169497_1170217_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1170444_1170621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1170869_1171193_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1171281_1173300_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1173322_1174276_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1174441_1175629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1176342_1176981_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1177278_1178274_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_017375767.1|1179731_1180757_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1180823_1182854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1184160_1184388_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1185731_1185875_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1185871_1186564_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876033.1|1186833_1187148_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_027242770.1|1187290_1187701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1187857_1188184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1188330_1189368_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1189409_1189655_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_155052681.1|1189740_1190094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1190101_1191676_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1191830_1192400_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1192709_1194512_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1194508_1195450_+	signal peptidase I	NA	NA	NA	NA	NA
WP_036771308.1|1195477_1195699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242761.1|1195861_1196536_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1196541_1197441_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1197454_1198198_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1198200_1198932_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1198928_1199312_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1199449_1200697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1201107_1202253_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1202245_1202599_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1202879_1203422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1204066_1204255_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1204274_1205249_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1205292_1206168_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1206521_1207349_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1207448_1207610_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1208260_1209601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1210652_1210880_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|1211021_1212383_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1212478_1213138_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144420701.1|1213978_1214335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1214931_1216491_-	APC family permease	NA	NA	NA	NA	NA
WP_017375893.1|1219035_1220106_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1220163_1220370_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1220376_1221852_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1221987_1222551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1222720_1224124_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1225090_1226185_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	1242427	1290152	3195206	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_036772169.1|1242427_1243303_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1243372_1244476_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1244543_1244867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1245023_1245806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1245941_1246919_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1246992_1248984_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1249039_1249321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1249574_1250774_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_051929862.1|1253205_1253718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1253904_1254780_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1254816_1254981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1256189_1256603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1256613_1256949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1257093_1258212_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1258441_1258708_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1259990_1260218_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1260228_1260735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1260812_1261430_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1261561_1262794_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1262783_1263446_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1263720_1264977_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1265114_1265774_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1265848_1266550_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1267297_1268272_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1269480_1269834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1270047_1270242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1270309_1270822_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1270959_1271814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1271862_1272507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1272540_1273185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243125.1|1273707_1274001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1274099_1274882_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1274964_1275915_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1277957_1280798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1280820_1281402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1281521_1282250_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1282395_1283370_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1283485_1284391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1284989_1285736_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1285988_1286381_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1286418_1287066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1288781_1290152_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	1313977	1355187	3195206	transposase	Enterobacteria_phage(16.67%)	37	NA	NA
WP_048876023.1|1313977_1315081_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1315171_1316324_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1316737_1317589_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|1317726_1317876_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1318500_1320867_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1320914_1322111_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1322679_1325112_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1325433_1326933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1327041_1327614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1327928_1329398_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1329470_1330220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1330223_1330997_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1331095_1332046_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1332185_1333628_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1333843_1335028_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1335151_1335838_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1335973_1336558_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1336647_1336977_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1337312_1337552_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_017377970.1|1337600_1337792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1338566_1338860_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1339008_1339170_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1339684_1340224_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1340562_1341207_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1341540_1342191_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1342714_1343767_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1343784_1346865_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1347030_1347279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1347344_1348220_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1349142_1349649_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1349666_1349864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1349882_1350026_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1350093_1350267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1350471_1351785_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1351794_1352058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1352116_1353091_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1354959_1355187_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 17
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	1386404	1440138	3195206	transposase,tRNA	Bacillus_thuringiensis_phage(25.0%)	45	NA	NA
WP_036772026.1|1386404_1387280_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1387384_1390687_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1390683_1392507_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1392546_1392945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1393053_1394070_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1394504_1395959_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1396040_1399097_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081329473.1|1400487_1400907_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376676.1|1401279_1401744_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1401816_1402818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1405710_1406043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1406404_1406548_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1406535_1407480_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420692.1|1407483_1407873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1407691_1408030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1408404_1409004_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1409003_1409351_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1409501_1410485_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1411394_1411709_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1411857_1412016_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1411987_1412917_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1413831_1414248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1415376_1416093_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1416841_1417000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1417048_1417624_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1417768_1418047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1418111_1418987_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1419152_1423019_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1423174_1423984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1424033_1424855_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1425054_1426287_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1426457_1427183_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1427225_1428764_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1428770_1430156_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1430469_1431519_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1432078_1432456_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|1432647_1433523_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1434504_1434732_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1434784_1435303_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_146619432.1|1435558_1435750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420793.1|1436158_1436932_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243181.1|1437045_1438017_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376772.1|1437998_1438970_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420687.1|1439405_1439591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1439601_1440138_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	1459072	1518982	3195206	transposase,tRNA	Staphylococcus_phage(17.65%)	49	NA	NA
WP_051929845.1|1459072_1459897_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1460300_1461275_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1461460_1462054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1462234_1462699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1463093_1463375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1463371_1464775_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1465426_1465807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1466046_1466703_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1466847_1467144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1467203_1467491_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036772296.1|1468680_1469058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1469257_1470307_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1470283_1472101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1472371_1472950_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1472977_1473442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1473478_1474936_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1474997_1476485_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1477254_1477857_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1478418_1478889_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1480536_1481280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1481431_1481863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1484500_1485847_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1485934_1487740_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1488205_1489003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1489387_1489849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1490071_1491046_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1491088_1491211_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1491282_1493238_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1493627_1493813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1494134_1495124_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1495536_1497162_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1497270_1497585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1497880_1499266_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1499430_1499658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1499798_1500257_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1500457_1500643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1500711_1501539_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1501993_1502518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376824.1|1502790_1502949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1503118_1504072_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1504266_1505241_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1505368_1506394_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1507046_1507334_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1507393_1507726_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1507930_1508491_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_017376814.1|1511085_1511811_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_026063564.1|1512185_1515005_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_048876146.1|1515854_1516988_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_017376809.1|1517212_1518982_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
>prophage 19
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	1541342	1576783	3195206	integrase,transposase,protease	Staphylococcus_phage(33.33%)	36	1562683:1562742	1573144:1573434
WP_048876008.1|1541342_1542317_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_144420681.1|1542360_1542546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1542725_1542890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1542891_1543767_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1544082_1545003_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1545018_1545402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1545728_1546685_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_144420678.1|1546952_1547231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243017.1|1547729_1549073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|1549246_1549390_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1549469_1550444_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1550591_1552463_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1552495_1552594_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1552829_1553459_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1553442_1553865_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1553871_1555611_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1555611_1556676_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1556679_1557033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1557145_1558114_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1558123_1558435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1558450_1559020_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1559283_1560612_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1560652_1561627_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1562213_1562615_-|transposase	transposase	transposase	NA	NA	NA	NA
1562683:1562742	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_146619459.1|1563134_1565591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1565793_1566645_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1566690_1568397_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1569868_1570843_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1571205_1571451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1571814_1572843_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1572973_1573177_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420676.1|1573461_1574418_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
1573144:1573434	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGGCCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTAGTGGAGTGTGCCGCTTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTCT	NA	NA	NA	NA
WP_047927838.1|1574710_1574956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1574952_1575252_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1575474_1575945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1576555_1576783_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 20
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	1582235	1625166	3195206	transposase	Staphylococcus_phage(20.0%)	41	NA	NA
WP_053856766.1|1582235_1583639_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1583826_1584684_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1584808_1585444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1585492_1585744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1585999_1586899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1587035_1588109_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1588209_1588623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1588643_1589357_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1589544_1590957_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1591166_1592135_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1592868_1593237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1593240_1593558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1593633_1594608_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1595127_1595628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1595698_1597027_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1597162_1598551_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1598698_1600009_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1600349_1601633_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1601706_1602327_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1602525_1602786_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1602988_1603135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1603110_1603704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1605567_1605786_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1607038_1607809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1607895_1608111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1608207_1609329_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1609595_1610570_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1610832_1611954_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1612246_1612534_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1612506_1613010_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1613090_1613750_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1614091_1615009_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1615138_1615312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1615977_1617336_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_017376486.1|1617410_1617974_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376485.1|1618168_1619398_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1619443_1620070_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1620219_1621407_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1621415_1622108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1622229_1623382_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1624182_1625166_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 21
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	1683501	1773816	3195206	transposase,protease,tRNA	Burkholderia_phage(14.29%)	82	NA	NA
WP_036774017.1|1683501_1684377_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1684766_1685105_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1685101_1685698_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1685700_1687695_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1687758_1688697_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1689045_1690020_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1690223_1690421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1690582_1690987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1692570_1693011_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1693337_1694213_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1694225_1694468_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1694874_1695129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1696340_1697306_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1697398_1697710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1697910_1698687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1699516_1699708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1700436_1701486_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1701656_1702430_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1702490_1704080_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1704270_1705362_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1705384_1705702_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1705788_1707066_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1707087_1707924_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1707930_1709565_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1709996_1710356_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1710637_1711996_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1712021_1712264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1712757_1712937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1713192_1714449_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1714562_1714820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1714964_1715975_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1716351_1717206_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1717235_1718069_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036773204.1|1718645_1719419_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1719500_1719821_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1720039_1720945_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1721030_1721429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1721573_1722071_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242786.1|1723743_1724835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1724933_1725311_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1725390_1726365_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1727909_1728629_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1728712_1729000_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1729284_1730157_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1730113_1730890_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1731094_1731430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1731828_1732185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1732346_1732622_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1732731_1733079_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1733096_1733876_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1733875_1734385_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1734420_1734669_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1734980_1735316_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1735615_1736866_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1736947_1738975_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1739520_1739739_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1739910_1740273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1740421_1741825_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1742106_1743282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1743299_1745297_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1745277_1746258_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1746313_1747156_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_027242816.1|1747155_1747560_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1747552_1747972_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1747994_1748624_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1749192_1751382_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1751393_1752599_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1752583_1754431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1754415_1755654_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1755640_1757509_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1757542_1758796_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1758801_1759659_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1759677_1760406_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1761544_1762336_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1762701_1762989_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|1765111_1765501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1765677_1766436_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1766432_1768832_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1768845_1770123_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1770212_1771511_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1771708_1772602_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1772601_1773816_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 22
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	1784515	1835000	3195206	transposase,tRNA	Vibrio_phage(14.29%)	46	NA	NA
WP_069971651.1|1784515_1785391_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1785763_1786027_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1786333_1788928_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1788924_1789407_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1789384_1790425_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1790599_1791085_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1791192_1793763_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1793796_1794258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1794594_1795470_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1795747_1797508_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1797601_1798267_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1798279_1799785_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1799806_1800337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1800410_1801673_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1801859_1802732_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1802833_1803622_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1803714_1805040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1805393_1806569_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1806737_1807391_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1807546_1809487_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1809483_1810107_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1810271_1811246_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1811517_1812138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1812134_1813538_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1813605_1814022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1814429_1814927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1814923_1815898_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|1815977_1816547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1816691_1817228_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1817232_1817529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1817537_1818143_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1818328_1818727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1818917_1819121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1819265_1819421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1819545_1819998_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1820114_1821587_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1822025_1822490_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1823178_1824429_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1824538_1825009_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1825031_1825625_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1825762_1826812_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1826835_1827759_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1827775_1828237_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1828344_1829163_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1829772_1829916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1834079_1835000_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 23
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	1897290	1912606	3195206	transposase	Staphylococcus_phage(50.0%)	16	NA	NA
WP_017378288.1|1897290_1897512_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1897570_1898545_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1898743_1898908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1898904_1899540_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046602.1|1899816_1900596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1900628_1901390_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1901366_1902356_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1902491_1903367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1903385_1904045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378292.1|1904074_1904281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1904286_1904733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1904729_1906133_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1906246_1907092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1907236_1908886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1908976_1909762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|1911202_1912606_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	1941279	1983036	3195206	transposase,tRNA	uncultured_Mediterranean_phage(40.0%)	39	NA	NA
WP_144420657.1|1941279_1942341_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1943052_1943214_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1944130_1944670_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1945052_1945469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1945564_1946380_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1946512_1948006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1948191_1948617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1948613_1950674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1950957_1951773_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1951873_1952692_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1952688_1953057_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1953238_1954066_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1954129_1954858_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1955260_1955989_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1956378_1957104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1957138_1961011_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1961211_1962345_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1962358_1962547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1962770_1964129_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_036773947.1|1965735_1966611_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1967122_1967758_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999981.1|1967770_1968244_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_155046603.1|1968171_1968324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929627.1|1968517_1968868_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1968927_1969215_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1969267_1970047_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376416.1|1970166_1970337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376415.1|1970471_1971389_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1971440_1972196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1972263_1973538_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376412.1|1973658_1974336_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376411.1|1974536_1975961_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_016209938.1|1975935_1976574_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376410.1|1976936_1977215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376409.1|1977448_1978393_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376408.1|1978414_1980283_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376407.1|1980303_1980657_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_026063528.1|1980695_1981811_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1981995_1983036_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
>prophage 25
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	1987379	2043449	3195206	transposase,tRNA	Klosneuvirus(22.22%)	49	NA	NA
WP_017376399.1|1987379_1990151_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376398.1|1990307_1991540_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1991781_1992444_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376397.1|1992903_1994385_+	MFS transporter	NA	NA	NA	NA	NA
WP_036773116.1|1994582_1995557_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|1996080_1998807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|1999694_2000669_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|2000919_2001624_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|2002863_2003382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|2004349_2005834_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2005958_2007494_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2007516_2007846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2007742_2007958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2009941_2011141_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2011350_2012211_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2012326_2012905_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2013061_2013703_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2013741_2013963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2013955_2014939_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2015332_2015830_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2015974_2016250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2016401_2018084_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2018091_2019114_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2019282_2020284_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2020397_2020736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2021211_2022471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2022679_2022907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2022935_2023154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2023291_2023657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2023724_2023967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2023981_2024317_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2024321_2024759_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_036772812.1|2024784_2026170_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2026280_2026712_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2026817_2028329_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2028619_2030212_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2030412_2032608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772819.1|2032701_2034135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2034177_2034693_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2034692_2035640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2035623_2036289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2036285_2037014_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2037003_2037750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2037733_2038798_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2039002_2040190_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2040246_2041365_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2041812_2042070_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2042349_2043027_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2043245_2043449_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	2063149	2112684	3195206	tRNA,transposase,protease	Burkholderia_virus(20.0%)	41	NA	NA
WP_017377787.1|2063149_2063377_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2063466_2064222_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2064635_2065232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2065311_2068116_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2068096_2069050_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2069042_2070413_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2070583_2071987_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2072758_2073085_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420651.1|2073289_2073943_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_017376600.1|2074262_2074442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2074697_2075954_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2076192_2076339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2076421_2076778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2077273_2077633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2077642_2078026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2078914_2079055_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2079199_2080120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2082277_2082808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2082818_2083874_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2083889_2085929_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2085915_2086746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2086812_2090352_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2090465_2091185_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2091423_2092053_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2092172_2093576_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2093721_2095665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2096182_2097043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2097478_2099224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|2099626_2101099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2101281_2101881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2102018_2102216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2102416_2102557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2102624_2103404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2103968_2104370_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2104514_2104892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2105351_2106659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2107407_2107665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2107716_2109120_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2109360_2111070_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2111239_2111602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|2111709_2112684_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 27
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	2127253	2254090	3195206	transposase,tRNA,protease	Staphylococcus_phage(14.81%)	115	NA	NA
WP_017377892.1|2127253_2128675_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_026063687.1|2128764_2130363_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377894.1|2130519_2131146_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027242839.1|2131226_2133899_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377896.1|2134381_2135338_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_017377897.1|2135390_2135810_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_048875958.1|2135836_2136700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377899.1|2136689_2137481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2137785_2138757_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2139105_2139414_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2139410_2140067_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2140200_2140686_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2140763_2141285_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2141330_2142224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2142220_2143042_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2143236_2143386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046606.1|2145848_2146019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2146171_2147575_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_144420645.1|2147684_2148941_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2148912_2149644_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2149655_2150933_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2151032_2151407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2151491_2152379_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2152436_2153165_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2153161_2154271_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2154422_2154851_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2154945_2155302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2155294_2156506_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2156502_2157291_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2157453_2158248_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2158697_2159438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2159441_2161940_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2162202_2163159_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2163142_2163904_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2164111_2165086_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2165194_2165950_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2166074_2166320_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2166379_2168653_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2168707_2169010_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2169250_2169544_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2169714_2169894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2169969_2170581_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2170827_2172144_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2172154_2172523_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2172553_2173216_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2173638_2174217_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2174196_2174604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2174727_2175024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2175070_2175946_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876123.1|2176015_2178196_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_017376060.1|2178299_2179649_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_155074355.1|2179722_2180361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2180544_2181732_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376055.1|2182250_2182895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2182891_2184205_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2184409_2184583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2184852_2185326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2185470_2185665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2185929_2186805_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210558.1|2186991_2187747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376051.1|2187820_2189473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376050.1|2189512_2191051_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_087910638.1|2191050_2192751_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_075275404.1|2192839_2194015_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_017376046.1|2194053_2195016_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_017376045.1|2195293_2195716_-	universal stress protein	NA	NA	NA	NA	NA
WP_017376044.1|2196021_2196663_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376043.1|2196791_2198126_+	dihydroorotase	NA	NA	NA	NA	NA
WP_048875952.1|2198240_2198876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771517.1|2199620_2200757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771498.1|2200940_2202671_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_017376037.1|2202660_2203869_+	MFS transporter	NA	NA	NA	NA	NA
WP_075275290.1|2203967_2204969_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420641.1|2205212_2205848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2205867_2206842_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875951.1|2206885_2207722_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2207867_2208287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2208563_2209244_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2209209_2209560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2209592_2210804_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2211144_2211774_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2211822_2212839_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2213085_2213301_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2213353_2213803_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2213882_2215628_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2215719_2217591_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2218035_2218752_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2220189_2221059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2221015_2221243_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2222211_2223126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2223171_2224194_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2224262_2225312_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155052687.1|2225940_2226111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243219.1|2226395_2226704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2226870_2228274_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046608.1|2228366_2228531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2228852_2229077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2229087_2230299_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036774710.1|2230693_2231593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|2231766_2232168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2232414_2233458_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2233577_2233814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2234602_2236156_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2238336_2238564_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2239434_2240409_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017375736.1|2241135_2242218_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_017375735.1|2242260_2242911_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375734.1|2243133_2243505_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_027243178.1|2243615_2244977_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155046609.1|2246697_2246904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2247214_2248297_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2248293_2248605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2249650_2250625_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2251631_2252411_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2252872_2254090_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	2266939	2327907	3195206	integrase,transposase	Staphylococcus_phage(30.0%)	47	2274792:2274851	2325213:2325973
WP_144420638.1|2266939_2268022_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2268018_2268330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2269827_2270763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2271355_2272501_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2274743_2275907_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2274792:2274851	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|2275935_2276160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2277507_2278683_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2279028_2281539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2281597_2282410_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377669.1|2282850_2283555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2283604_2284579_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2284683_2286015_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2286213_2286282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2286413_2287856_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2288247_2289660_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2290349_2290796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2291390_2292239_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2292492_2293551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2293542_2295249_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2295320_2297054_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2297350_2297917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2298041_2298695_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2298721_2300182_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2300278_2301256_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2301725_2303129_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2303654_2303948_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2304174_2304939_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2305146_2305374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2305437_2305620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2306182_2306362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376902.1|2306425_2306737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2307591_2308296_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2308493_2308634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2309038_2309563_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|2309709_2310966_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2311033_2311513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2311953_2313357_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243186.1|2313771_2316153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2316659_2318552_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2318723_2319698_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2320001_2320808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2320876_2321488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2322969_2323266_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2323262_2324105_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2324495_2325281_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2325285_2326689_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2325213:2325973	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2326962_2327907_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	2348749	2376401	3195206	transposase,protease	Staphylococcus_phage(22.22%)	29	NA	NA
WP_017377305.1|2348749_2350051_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2350132_2350738_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2350850_2352155_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2352755_2353631_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2353746_2354418_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2354597_2355953_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2356073_2356811_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2356889_2357606_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2358254_2359529_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2359559_2360135_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2360179_2361145_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2361608_2362517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|2362904_2363156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2363300_2363729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2363714_2364659_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2364863_2365016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2365044_2365779_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2365873_2366134_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155074356.1|2366352_2367066_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.5	7.9e-34
WP_080963567.1|2367062_2367317_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	5.3e-09
WP_146619452.1|2367293_2367590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2367780_2368230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2368489_2368918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2369013_2369514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2369450_2369612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2370492_2370714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2372212_2372890_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2374204_2374543_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2375426_2376401_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 30
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	2415645	2486568	3195206	transposase,tRNA	Staphylococcus_phage(28.57%)	52	NA	NA
WP_080999971.1|2415645_2417049_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2417162_2417738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2418983_2419211_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2419500_2420040_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2420349_2421837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2421888_2422314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2422532_2423936_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2423932_2424310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2424269_2424815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2425210_2426437_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2427037_2428690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2428626_2428821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963645.1|2429153_2430344_-	MFS transporter	NA	NA	NA	NA	NA
WP_027243147.1|2430592_2433265_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2433553_2434390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2435050_2435941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2436409_2437384_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876012.1|2437868_2439272_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2439417_2440821_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|2440905_2442720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2444631_2446035_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2446068_2447598_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2447633_2449094_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_027242908.1|2449068_2450028_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376200.1|2450105_2453612_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_017376201.1|2453635_2454205_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_027242907.1|2454418_2455573_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376204.1|2455591_2456365_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|2456364_2456811_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376206.1|2456828_2457878_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_017376207.1|2457988_2458522_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_036771893.1|2458602_2461020_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_027242906.1|2461304_2462372_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_017376209.1|2464574_2465639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376210.1|2465628_2466657_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376211.1|2466653_2467193_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376212.1|2467729_2469640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420622.1|2470084_2471662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|2471758_2472634_-	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_080963646.1|2472722_2473622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063514.1|2473536_2474283_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_017376216.1|2474290_2474848_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_017376217.1|2474851_2475589_-	UMP kinase	NA	NA	NA	NA	NA
WP_017376218.1|2475592_2476471_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376219.1|2476635_2477403_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376220.1|2477809_2478619_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376221.1|2478696_2481354_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|2481357_2482395_+	asparaginase	NA	NA	NA	NA	NA
WP_017376223.1|2482396_2483218_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376224.1|2483348_2484233_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_036773116.1|2484545_2485520_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2485572_2486568_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	2498316	2543108	3195206	transposase,tRNA	Burkholderia_virus(33.33%)	44	NA	NA
WP_017376309.1|2498316_2498604_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2498724_2500185_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2500264_2501701_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2501825_2502800_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2504990_2505752_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2506909_2507137_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2508090_2508303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2508320_2508638_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2508664_2509354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2509694_2509898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2510029_2510965_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2510977_2511760_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2511889_2512201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2512544_2512871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2512895_2513351_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2513340_2514393_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2514395_2515859_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2515993_2516221_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2517637_2518102_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2518358_2519174_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2519302_2521615_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2521731_2522259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2522950_2524228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2524238_2524490_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2524523_2525045_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2525214_2526201_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2526291_2527107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2527535_2527931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2527903_2528131_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_047927746.1|2529099_2529687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2530289_2530961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875918.1|2531105_2531687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420767.1|2531729_2532407_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243185.1|2532685_2533642_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_017377736.1|2533701_2534367_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017377737.1|2534400_2534946_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_155046615.1|2535225_2535387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774946.1|2536083_2536698_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_144420620.1|2536624_2537827_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875923.1|2537812_2538808_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2538811_2539216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2540183_2540411_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2541379_2541976_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046616.1|2541944_2543108_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
>prophage 32
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	2552829	2604243	3195206	transposase,tRNA	Bacillus_phage(20.0%)	55	NA	NA
WP_048876031.1|2552829_2554233_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|2554338_2554563_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2554745_2555567_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|2555712_2555967_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377841.1|2556355_2558140_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|2558228_2558948_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2559109_2559316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2559315_2559552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2559564_2559918_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2560455_2561289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2561381_2561579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2561676_2563062_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2563188_2563779_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2564810_2565098_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2565157_2565322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2565318_2566689_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2567055_2568468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2568537_2569308_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2569800_2570088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2571564_2571858_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2571815_2572637_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2572781_2573006_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155046618.1|2573260_2573788_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|2573964_2574225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2574143_2574299_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2574397_2575372_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2576700_2576850_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2576966_2577260_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2578068_2578644_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2578721_2579597_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2579661_2580282_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2580266_2581349_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2581582_2581987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2583477_2584779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2584925_2585594_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2586526_2587090_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2587146_2588343_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_017376587.1|2588467_2589832_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376586.1|2589828_2590920_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376585.1|2591174_2591825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2592017_2592212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2592319_2592472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376583.1|2592738_2593866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063543.1|2593955_2594789_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376581.1|2594792_2595443_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_017376580.1|2595432_2596272_-	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_016210074.1|2596277_2596904_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376579.1|2597064_2597607_+	septation protein A	NA	NA	NA	NA	NA
WP_017376578.1|2597690_2597993_+	YciI family protein	NA	NA	NA	NA	NA
WP_144420763.1|2598010_2598253_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376576.1|2598351_2598624_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376575.1|2598662_2599301_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376574.1|2599333_2600425_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376573.1|2600596_2602339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2603268_2604243_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 33
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	2613537	2731997	3195206	transposase,tRNA	Staphylococcus_phage(29.63%)	108	NA	NA
WP_080999966.1|2613537_2614887_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2615184_2615742_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2615835_2616342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2616846_2617542_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|2617672_2618461_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2618494_2619898_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2620321_2621296_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2621552_2621780_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2622867_2623398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2623394_2624927_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2624923_2625874_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2626294_2626927_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2627169_2627367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2627716_2628145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2628222_2629218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2629362_2629614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2629718_2630363_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2630598_2631096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2631607_2632582_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2632952_2633246_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2634058_2634394_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2634714_2636253_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2636405_2637504_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2637742_2638942_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2638972_2639599_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2639627_2640512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2640645_2640876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2641013_2642255_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_144420613.1|2642534_2642906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2645037_2645199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2645574_2646702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2646818_2647481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2647566_2647827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2648245_2649007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155074357.1|2649151_2649526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2651067_2651727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2651827_2652478_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2652625_2653315_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377795.1|2653337_2654501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2654705_2654957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046691.1|2655480_2656077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2656276_2657251_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376009.1|2658605_2658896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376008.1|2659218_2660256_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376007.1|2660286_2661741_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376006.1|2661750_2662935_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376005.1|2663008_2664016_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376004.1|2664084_2666088_-	transketolase	NA	NA	NA	NA	NA
WP_017376003.1|2666539_2667700_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376001.1|2667936_2669052_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376000.1|2669214_2669739_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017375999.1|2669738_2670269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2671928_2672804_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2672924_2673425_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2673421_2673688_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2673853_2674828_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2675007_2675628_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2675934_2677338_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771922.1|2678172_2679363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|2679929_2680397_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|2680898_2681153_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|2681354_2681858_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|2682074_2682680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2682840_2683524_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2683599_2684379_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|2684365_2685226_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|2685349_2685715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377271.1|2686100_2686430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2686840_2687815_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_144420611.1|2688349_2688550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155052690.1|2688582_2689914_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	2.4e-36
WP_017377275.1|2690996_2691719_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2691710_2692079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2692341_2693643_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2693738_2694182_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2694185_2694695_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2694687_2697501_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2697997_2698930_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2699034_2699961_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2700139_2701678_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2701851_2702112_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2703386_2703995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2704041_2704770_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2705016_2705154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377696.1|2706316_2706856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2707090_2708002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2708261_2708558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2708902_2710056_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2710652_2711201_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2711304_2711868_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2712085_2712844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2714119_2714347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2714569_2714749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2715004_2716261_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2716328_2716973_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_017378393.1|2717777_2717984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816949.1|2718984_2719383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378390.1|2719576_2721154_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378389.1|2721287_2722229_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378388.1|2722230_2723004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963621.1|2724612_2724819_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2725085_2725373_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378384.1|2725378_2727760_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|2727772_2728768_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_016210495.1|2728899_2729259_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378382.1|2729301_2729496_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|2729530_2730061_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378381.1|2730065_2731997_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
>prophage 34
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	2769775	2822804	3195206	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2769775_2770750_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2770906_2772481_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2772705_2772984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2773053_2773929_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2773938_2775099_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2775213_2776362_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2776372_2779174_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2779280_2779979_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2779991_2781755_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2781758_2782106_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2782099_2782474_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2783421_2784705_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2785114_2786410_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2786765_2787311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242732.1|2787898_2788420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2788431_2789811_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2790046_2790481_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2790477_2791830_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2791829_2792945_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2792945_2793962_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2793951_2795622_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2795641_2795977_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2796004_2797444_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2797440_2798487_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2798629_2800126_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2800421_2801423_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2801528_2802140_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2802260_2802638_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2802688_2804095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2804088_2805156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2805262_2806864_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2807112_2808030_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2808098_2809793_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2810027_2810957_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2810987_2812391_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2812621_2813326_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2813392_2814049_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2814059_2814941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2815111_2817781_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2818141_2819116_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2819195_2820167_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2820220_2821195_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2821314_2821536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2821599_2821908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2821832_2822804_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	2837370	2891631	3195206	transposase	Staphylococcus_phage(37.5%)	51	NA	NA
WP_026063658.1|2837370_2838099_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2838408_2838663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2839376_2842031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2842069_2842360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2842476_2843775_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2844345_2844834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2844814_2845117_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2845363_2845852_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2845885_2846524_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2846645_2847185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2847274_2848501_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2849113_2849371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2849457_2850357_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2850501_2850768_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2850759_2850909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2851136_2852012_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2852141_2852369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2852435_2852630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2852688_2853663_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2853700_2853889_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2853889_2855662_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2855651_2856644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2857251_2857944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2858430_2859000_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2858996_2859971_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2860010_2860514_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2860604_2862008_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2862706_2862892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2862997_2864401_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420599.1|2864405_2864978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2865011_2866439_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|2867724_2870094_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2870169_2870988_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2871339_2871885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2872367_2873606_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2873582_2874557_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017375625.1|2874649_2874877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|2874881_2875373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243039.1|2876045_2876933_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_027243038.1|2877022_2878513_-	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_017376549.1|2878536_2879418_-	ROK family protein	NA	NA	NA	NA	NA
WP_017376548.1|2879414_2880137_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376547.1|2880836_2881628_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|2881814_2882060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420598.1|2882211_2882442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376543.1|2882471_2883251_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_047927468.1|2883276_2883582_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_144420752.1|2883578_2884472_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_027243035.1|2884827_2886126_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376538.1|2888728_2889910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2890203_2891631_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	2899217	2948918	3195206	transposase,tRNA	Bodo_saltans_virus(14.29%)	43	NA	NA
WP_062312049.1|2899217_2900585_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2901077_2901557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2901736_2903800_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2903808_2904534_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2905161_2905875_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2905879_2906410_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2906644_2906878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2906990_2907239_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2908046_2910239_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2910256_2910565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2911218_2912928_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2913121_2913277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2914679_2915555_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2915880_2916642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2916866_2917598_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2917594_2918131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2918184_2918949_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2918951_2920529_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2920535_2921012_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2920987_2921419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2921451_2922207_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2922381_2922669_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2923051_2923276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2923615_2924779_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2924813_2925791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2925784_2926471_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2926409_2927525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2927804_2928410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2928647_2929127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2930949_2931603_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2931715_2932267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2932366_2933341_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2933626_2934151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2934848_2935673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2935928_2936285_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2936281_2937685_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2937804_2938365_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2938522_2939089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243087.1|2941909_2942605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2942645_2942858_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2944430_2945540_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2945595_2947077_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2947514_2948918_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP039107	Piscirickettsia salmonis strain Psal-134 chromosome, complete genome	3195206	3076600	3141849	3195206	transposase,protease	Hokovirus(14.29%)	55	NA	NA
WP_017376170.1|3076600_3077701_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3078058_3079033_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3079169_3080048_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3080055_3080286_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3080339_3081344_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3081562_3082390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3082471_3083860_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3084147_3085548_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3085642_3086569_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3086565_3087702_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3087698_3088706_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3088702_3089866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3089875_3090727_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3090758_3091931_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3091927_3093316_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3093344_3093752_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3093771_3094779_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3094775_3095648_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3095644_3096505_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3096506_3098777_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3098778_3099924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3099970_3100456_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3100495_3101119_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3106798_3107551_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243062.1|3108882_3109506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3109610_3110399_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3110398_3111130_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3111163_3112891_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3112904_3113966_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3114280_3115495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3115627_3116152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3116769_3117618_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3117604_3118303_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3118357_3119119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3119111_3119534_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3119663_3120215_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3120270_3121233_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3121233_3121449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3121635_3122445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3122424_3123267_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3123263_3124508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3124646_3125735_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3125752_3126253_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3126440_3127040_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3127045_3128209_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3128241_3129195_+	glutathione synthase	NA	NA	NA	NA	NA
WP_017376261.1|3129558_3130623_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3130619_3133682_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3133834_3134287_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3134318_3134675_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3135093_3135867_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376269.1|3138490_3138781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3139005_3139881_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3139877_3140435_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3140445_3141849_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039108	Piscirickettsia salmonis strain Psal-134 plasmid unnamed1, complete sequence	186049	0	52409	186049	portal,terminase,transposase	Streptococcus_phage(47.37%)	58	NA	NA
WP_017377655.1|1412_1658_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|1654_2041_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|2128_2857_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|2835_3456_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|3801_4488_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|5437_5800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|5802_7542_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|7943_8096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|8123_8807_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|8888_9866_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|9941_10112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|10152_10881_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_036771293.1|11426_11693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772437.1|11988_13887_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|14308_15037_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_082884401.1|15134_15257_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|15673_15838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|15858_17145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|17327_18056_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|18183_19161_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046631.1|19235_19886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126795.1|22517_22778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|22781_23054_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|23129_23858_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|24427_25399_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|26263_27091_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|27944_28415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|29308_29452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|30658_31258_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|31611_32388_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|32748_33477_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|33546_33747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|33665_34637_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027242938.1|35050_35419_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017375972.1|35420_35729_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017375841.1|36173_36383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|36689_36908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242936.1|36904_37357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420845.1|37484_37715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876207.1|38220_39696_-	response regulator	NA	NA	NA	NA	NA
WP_017375966.1|39696_40263_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_144420846.1|40407_40872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|40876_41302_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_036817204.1|41572_42568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619517.1|42797_42950_-	phosphatase	NA	NA	NA	NA	NA
WP_081078123.1|42979_43342_+	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
WP_026063496.1|44220_44586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242932.1|44718_44946_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242931.1|44954_45362_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242930.1|45507_46890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375952.1|47079_47283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242929.1|47478_47862_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|47948_48431_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|48433_49765_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|49969_50404_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|50490_50877_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|50914_51649_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|51695_52409_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
>prophage 2
NZ_CP039108	Piscirickettsia salmonis strain Psal-134 plasmid unnamed1, complete sequence	186049	57501	183431	186049	head,capsid,transposase,tail,portal,integrase	Streptococcus_phage(32.2%)	121	52513:52572	122272:122560
52513:52572	attL	TGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGTTGGGTGCACGAGTATGGCTC	NA	NA	NA	NA
WP_017377509.1|57501_58230_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
52513:52572	attL	TGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGTTGGGTGCACGAGTATGGCTC	NA	NA	NA	NA
WP_075275482.1|58323_59298_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|59611_59974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|60013_60523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|60754_61735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|62200_63178_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|63658_64636_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|64650_64812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|65029_65284_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|65273_65561_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_036771347.1|66055_67033_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_027243215.1|67144_68167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|68649_69378_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_048876194.1|70617_71151_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|71331_71673_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|71853_72120_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|72192_74058_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|74225_74510_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|74853_75582_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|75663_76155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|76887_77115_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|78666_79095_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|79030_79417_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|79446_80175_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|80186_80336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|80582_81311_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|82688_83651_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|83674_84004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|84070_85111_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|85124_85316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|85520_86090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|86132_86432_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774376.1|86428_86857_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|87166_87895_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|88068_88842_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|89555_90491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|90765_91494_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243201.1|91659_91899_-	hypothetical protein	NA	NA	NA	NA	NA
90900:91559	attR	TGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGTTGGGTGCACGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTCTTGGCGGTTAGATGAAACGTTGGTGAAAATTAAAGGTCGTTGGTATTACCTTTATCGAGCCATTGATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTTTTTCAAAAAGGCAATCGCCCAACCTTATGTGAAATCACCGCGTGTTGTGAATGTCGACAAGCACGCTTCATTTCCACCCGCTCACCAAAAAGCCAAAGATGAAGGTCTCTTTTCTAGTCAGTGTAAACTCAGGCGAGTGAAGTATTTAAACAACTGCATTGAAAATGATCACAAAGCGGTAAAGCGCAAATCCCGTTTCCGCCAATGGTACCAATCACTTTCTACAGCACGGCCTACCATTGACATAATGGAAGCGATGCGCATGGTTCAAAAAGGTCAATTACGTTATATTAAAAAACAGAATATCTGTGCCCAAAATCAGCTCATTGATAAATTATTTGGATTAGCTGCTTAATTCTAAGCAGAGAGCACAAGAAAATAACCTTTCTGAAGCTCACTATAATTTTTCGCAACAGTGCC	NA	NA	NA	NA
WP_051929623.1|91962_95304_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
90900:91559	attR	TGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGTTGGGTGCACGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTCTTGGCGGTTAGATGAAACGTTGGTGAAAATTAAAGGTCGTTGGTATTACCTTTATCGAGCCATTGATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTTTTTCAAAAAGGCAATCGCCCAACCTTATGTGAAATCACCGCGTGTTGTGAATGTCGACAAGCACGCTTCATTTCCACCCGCTCACCAAAAAGCCAAAGATGAAGGTCTCTTTTCTAGTCAGTGTAAACTCAGGCGAGTGAAGTATTTAAACAACTGCATTGAAAATGATCACAAAGCGGTAAAGCGCAAATCCCGTTTCCGCCAATGGTACCAATCACTTTCTACAGCACGGCCTACCATTGACATAATGGAAGCGATGCGCATGGTTCAAAAAGGTCAATTACGTTATATTAAAAAACAGAATATCTGTGCCCAAAATCAGCTCATTGATAAATTATTTGGATTAGCTGCTTAATTCTAAGCAGAGAGCACAAGAAAATAACCTTTCTGAAGCTCACTATAATTTTTCGCAACAGTGCC	NA	NA	NA	NA
WP_036772541.1|95461_96190_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|96483_96879_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|96931_97660_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|98143_98872_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|99042_99612_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|99616_100300_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|100451_101180_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_080963627.1|101198_101417_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774644.1|102396_103458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|103966_104713_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|104713_105118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771293.1|106937_107204_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155074358.1|107499_108573_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155074359.1|108578_109088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155074360.1|109075_109393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876182.1|109748_111644_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017375632.1|112343_112679_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|112873_113077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|113170_113965_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
WP_080999971.1|118015_119419_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000017.1|119683_119935_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_048875857.1|120335_121310_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|122297_122753_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
WP_016212398.1|122847_123309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773695.1|125369_127442_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_017377509.1|127471_128200_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|128341_129274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|129303_130032_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|130034_130307_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|131157_131886_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017375558.1|131998_132562_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|133710_134439_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155074361.1|135129_135819_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377667.1|136488_136659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377666.1|136803_137061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815609.1|138961_139417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816769.1|139660_140059_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_047927763.1|140055_140319_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048876259.1|140810_141827_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027243195.1|142152_143199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|143564_144539_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_017375692.1|144682_144916_+	hypothetical protein	NA	Q7Y5W4	Haemophilus_phage	42.6	1.3e-06
WP_017375691.1|144939_145641_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.6	9.6e-32
WP_036773107.1|145624_145942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|146229_147204_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242588.1|147542_147896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771953.1|147912_150192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|150654_151629_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|151678_152218_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|152231_152816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|153200_153512_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|153508_153934_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|154112_154508_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|154504_154855_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|154854_155277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|155278_155602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|155658_155925_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|155928_158007_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|157999_158341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|158337_159009_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|158938_159724_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|159713_160271_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|160267_162958_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|163016_163445_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|163472_164450_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017377525.1|164833_165631_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_075275471.1|166171_167146_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_155046640.1|167781_167949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876214.1|167917_168646_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_017377521.1|169154_169508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|170435_171164_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243190.1|171746_175091_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_048876213.1|175399_176290_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275473.1|177528_177705_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|177821_178529_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|178482_179361_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_144420840.1|179391_179823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|180205_180910_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|180921_181650_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|181679_182069_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|182091_182820_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|182822_183431_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
>prophage 1
NZ_CP039111	Piscirickettsia salmonis strain Psal-134 plasmid unnamed4, complete sequence	33468	3315	19337	33468	integrase,tail,capsid,transposase,terminase,head	unidentified_phage(35.71%)	21	NA	NA
WP_036771330.1|3315_4290_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4825_5416_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5646_5907_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5899_6253_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6429_7404_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|7936_8302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|8446_8701_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8684_9041_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|9138_10113_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|10738_11605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|11817_12201_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|12287_12770_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|12772_12958_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|12977_13952_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|14048_14441_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|14476_15058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|15438_16413_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|16486_16702_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|17505_18021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|18366_18924_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|18920_19337_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
