The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	31805	91601	3192883	tRNA,transposase	Staphylococcus_phage(28.57%)	52	NA	NA
WP_036772169.1|31805_32681_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33039_34395_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34486_34993_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34989_35358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36760_38545_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39025_40153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40225_40981_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|41017_43711_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43742_44294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44401_45415_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45535_45760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46115_46877_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47019_47814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|47958_48711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49022_50549_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50687_51761_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|51800_53108_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53082_54252_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54306_55032_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55497_57603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|57817_58282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58301_58811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59195_60137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60418_61870_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773655.1|62336_62741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63301_64276_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|65010_65388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|65977_66952_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773242.1|66991_67546_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|67733_68633_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|68637_69264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|69208_71530_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|71676_72156_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|72152_73304_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|73438_73942_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|74035_75010_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|74999_76313_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|76353_77733_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|77739_79191_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|79216_79585_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378407.1|79603_80671_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|80703_81600_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|81596_82433_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|82568_83021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|83159_83906_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|83886_84450_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|84458_84974_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|85115_87194_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|87193_88144_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|89011_89410_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|89635_89965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|90581_91601_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	123083	241151	3192883	protease,tRNA,transposase	Staphylococcus_phage(12.5%)	106	NA	NA
WP_075278722.1|123083_123959_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|124399_124693_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|124693_124948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|124964_127457_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|127449_128133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|128132_129176_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|129175_130405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|130406_130736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|130732_131932_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|132044_132434_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|132433_133378_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|133497_134895_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|135220_135742_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|135865_136174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|136188_141411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|141801_143808_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|143938_146269_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|146444_147275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|147391_147787_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|147783_148317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|148313_148715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|149109_149430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|149439_150396_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|150905_151430_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|151530_152529_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|152617_153514_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|153587_154874_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|155333_156650_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|156763_156934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|156953_157928_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|158054_158315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|158582_158873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|161411_162452_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|162554_163526_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|163648_164497_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|164648_164936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|165246_165618_+	isochorismatase	NA	NA	NA	NA	NA
WP_155052673.1|166678_166903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|167040_167178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|167191_167404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242723.1|167400_167700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|167927_168752_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|168890_170024_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|170083_171493_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|171640_173221_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|173978_174974_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|174979_177046_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|177103_178054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|178248_178575_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|178797_180057_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|180316_181192_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|181230_182193_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|187887_188232_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|188328_189252_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|189751_190240_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|190342_191143_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|191153_192905_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|193794_194037_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|194040_194439_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|194670_195546_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|196264_196723_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|196904_197090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|197805_199620_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|200030_200699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|200708_202025_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|202184_203147_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|203227_203383_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|203396_203633_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|203825_205043_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|205020_205479_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|205506_206886_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|206922_207141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|207460_208756_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|208960_209152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|209350_210226_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|210413_211679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|211712_212588_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|212709_213168_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|213191_214112_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|214239_215022_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|215112_216612_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|216925_218809_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|219068_219731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|219797_220907_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|220918_221563_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|221581_222568_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|222652_223729_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|223930_224755_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|225057_226023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|226341_227394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|227452_228427_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|228762_229191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|229427_229910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|229965_231216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|231318_231537_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|232008_232863_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|232917_233388_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|233684_233921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|234067_234448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|234506_235382_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|236148_237060_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|237176_238025_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|238091_239102_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|239125_239449_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375571.1|239459_239861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|240131_241151_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	314954	357313	3192883	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|314954_315830_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|315910_316543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|316496_317942_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|317976_318396_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|319169_319538_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|319547_320087_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|320247_320679_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|320682_321381_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|321628_322135_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|322177_322546_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|322816_326893_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|326956_331165_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|331326_331701_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|331805_332279_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|332294_334406_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|334433_335624_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|335630_335942_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|336064_336703_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|336718_337336_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|337332_337629_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|337643_338468_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|338484_338760_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|338765_339098_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|339110_339845_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|339858_340272_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|340271_340472_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|340471_340729_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|340850_341219_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|341236_341548_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|341563_342106_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|342118_342424_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|342452_342845_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|342857_343391_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|343400_343754_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|343764_344265_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|344270_344453_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|344455_344890_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|344890_346213_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|346269_346383_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|346526_346883_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|346908_347298_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|347307_347928_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|347949_348927_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|348975_349374_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|349486_350734_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|350720_351377_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|351461_351740_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|351982_352210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|352342_353137_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|353445_354660_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|355057_355237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|355205_355859_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|356234_356483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|356572_357313_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	366736	421649	3192883	protease,tRNA,transposase	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_017376975.1|366736_367288_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_017376974.1|367298_368666_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376973.1|368816_369053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376972.1|369111_369855_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_027242667.1|369854_370496_+	lipoprotein	NA	NA	NA	NA	NA
WP_017376970.1|370495_372160_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_017376969.1|372188_372524_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_027242666.1|372688_374287_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376966.1|374346_374637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772765.1|374837_375269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|375331_377812_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|377898_378378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|378350_379391_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|379327_380044_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|380056_380392_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|380428_380899_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|380941_382777_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|382821_383910_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|383931_384993_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|385070_385586_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|385626_386904_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|386918_387770_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|387798_388446_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|388442_389402_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_048875861.1|389923_390793_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|390937_391192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|391336_391903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|392008_392449_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_051929598.1|392406_392664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242664.1|392960_394163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|394446_395421_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046563.1|395890_396028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|396044_396260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|396464_397076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|397072_397330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|397580_397973_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|398102_398651_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|398650_399478_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|399527_401213_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|401290_401752_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|401788_402352_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|402578_402908_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|402888_403113_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|403257_403848_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|403872_405144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|405161_406415_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|406411_407056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|407128_408178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|408279_409917_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|409951_410281_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|410437_410725_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376927.1|411151_411289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|411794_413015_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|413073_415872_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|416177_417344_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|417442_417979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|418040_418373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|418630_419533_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|419602_420100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|420245_421649_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	451086	499225	3192883	transposase	Staphylococcus_phage(100.0%)	42	NA	NA
WP_036774259.1|451086_452061_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420729.1|452408_453047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|453166_454570_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242658.1|455912_457376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856768.1|457451_458246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242656.1|458537_459356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|459373_459967_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376894.1|460183_460417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242655.1|460640_461537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420727.1|461841_462612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376891.1|462781_463684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|463680_464904_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_027242653.1|464921_465848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|465863_466904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242651.1|467018_467429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376888.1|467481_467985_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_017376887.1|467977_468724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376886.1|468726_469857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|469861_470101_+	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_027242650.1|472590_473079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|473081_474158_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_017376878.1|474150_474804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875870.1|474810_475236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|475272_478272_+	ATPase AAA	NA	NA	NA	NA	NA
WP_027242646.1|478333_479836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|480287_481907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|481948_484252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376870.1|484528_485425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|485427_488754_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_144420818.1|488955_489144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|489155_489632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|489674_489902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|490083_490617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|490647_490989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772347.1|490991_491408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876253.1|491569_492226_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036771639.1|492222_493197_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|493638_493902_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|494329_495304_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_087910671.1|495691_496156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910670.1|496249_496435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|498250_499225_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 6
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	504029	558712	3192883	transposase	Streptococcus_phage(22.22%)	52	NA	NA
WP_048875872.1|504029_505313_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|505485_505623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|505619_507023_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|507136_507574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|507694_508123_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|508370_508808_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|509239_510628_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|511074_512568_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|512762_513518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|514017_514248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|515352_516363_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|516359_516581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|517299_518241_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|518768_519167_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|519106_519961_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|520052_520334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|520419_521097_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|521142_522423_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|522598_523648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|523726_524527_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|524540_525335_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|525437_526457_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|526503_527115_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|527118_527805_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|527801_528344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|528636_529824_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|530068_530794_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|530979_531768_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|531764_532160_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|532552_533593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|533589_534993_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|537408_537666_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|537705_539091_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242633.1|539420_540518_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_017377120.1|540551_541802_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|541802_542435_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|542724_543177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|543222_544065_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|544099_544591_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|544786_546754_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|546981_547386_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|547363_548392_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|548378_549167_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|549593_550997_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377110.1|551198_552209_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_075275363.1|552221_552689_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377107.1|553018_554389_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_017377106.1|554691_555162_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377105.1|555439_555715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|555725_557129_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069971661.1|557303_557741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|557737_558712_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 7
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	590503	723897	3192883	tRNA,transposase,plate	Staphylococcus_phage(13.64%)	111	NA	NA
WP_036772726.1|590503_591052_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|591804_593184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|593543_595007_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|595190_596003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|596467_598462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|598856_600236_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|600273_600711_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|600753_601470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|603016_603547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|603613_605434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|605998_606505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155082196.1|606589_607993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|608107_608362_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|608514_608787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|609362_609545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|609661_610237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046568.1|610245_610404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|611304_611547_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|611849_612941_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|612921_613875_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|614098_615583_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|615622_616126_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|616385_617561_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|617708_618113_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|618269_619145_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|619179_619533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|622862_623288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|623518_624655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|624641_625964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|625956_627075_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|627195_627729_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|627867_629505_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|629509_629731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|629839_630853_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|631124_633353_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_026063593.1|633333_634038_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|634272_634602_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|636002_636221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|636279_637155_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|637147_638014_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|638081_639401_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|639870_640431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|640749_641676_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|642571_643480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|647176_648016_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|648202_648418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|648466_649042_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|649038_649377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|649545_650535_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|651524_652427_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875883.1|652686_653223_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|653367_654285_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|654719_655730_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|656537_657074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|658286_658634_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|658778_659738_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|659839_660622_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|660754_661714_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|661738_662143_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|662171_662846_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|662945_664661_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|664657_665020_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|665034_666189_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|666192_667200_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|667202_668219_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|668434_669520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|669626_670019_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|670151_671435_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|671450_672752_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|672769_674572_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|674576_675569_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|675649_676726_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|676823_677798_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|677865_678837_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|679020_679290_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|679891_681178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|681242_681923_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155052676.1|687578_687866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375775.1|687904_688099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275355.1|688146_689121_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_027242570.1|689334_690474_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|690682_692053_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|692431_693424_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|693427_693943_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|693939_694779_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|694811_696362_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|696469_696841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|698061_698223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|698803_700207_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|700241_700679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|700702_701677_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|701735_702164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|702351_703158_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|703232_703625_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|703669_704491_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|704503_705487_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|705488_706757_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|706763_709268_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|709398_710424_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|710420_711131_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|711055_711886_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|712035_712419_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|712453_713353_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|713398_714070_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|714152_714728_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|714826_715627_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|715768_716626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|717488_718625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|718691_721862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|721874_722585_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|722589_723897_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	732539	778841	3192883	plate,transposase	Staphylococcus_phage(21.43%)	51	NA	NA
WP_017376356.1|732539_732938_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|732934_734623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|734604_735561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|735603_736119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|736223_737156_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|737375_737762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|737779_738424_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|738574_739414_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|739489_740092_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|740092_740947_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|741304_741616_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|741640_743029_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|743184_743916_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|743912_744440_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|744471_745029_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|745034_746015_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|746154_746955_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|746958_747726_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|747722_748187_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|748209_748863_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|748866_749214_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|749247_749499_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|749576_750845_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|750847_751606_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|751667_752558_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|752608_753292_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|753301_753649_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_069971660.1|753921_756027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|756018_756891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|757058_758888_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|759055_759697_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|760021_760468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|760485_760659_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|760717_761767_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|761773_762724_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|762778_763723_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|763750_764488_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|764576_764819_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|764893_766117_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|766148_766997_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|766993_768046_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|768182_768803_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|769028_770181_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|771201_772176_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|772172_772343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|773311_773908_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|773876_775037_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|775547_775889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|775992_777027_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|777023_777734_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|777866_778841_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 9
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	787001	841312	3192883	protease,tRNA,transposase	Prochlorococcus_phage(33.33%)	49	NA	NA
WP_017377942.1|787001_787508_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243058.1|787589_788006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|788097_788958_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|789055_789601_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|789683_790535_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|790576_793483_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|793543_793741_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|793747_794758_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|794754_795813_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|795827_796607_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|796609_797422_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|797433_798381_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|798391_799684_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|799862_800966_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|800962_801355_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|801367_802744_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|802737_804207_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|804400_804835_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|805130_805307_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|806341_807367_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_017377925.1|807868_808261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|809653_810304_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|811002_811797_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|811976_812621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|812795_813770_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|814170_814428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|816105_816783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|817016_817841_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|817934_818648_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|818737_819829_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|819900_820482_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|820487_821114_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|821210_822158_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|822504_823167_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|823337_823997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|824165_825425_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|825421_826507_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|826499_827381_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|827369_828620_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|830005_830326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|830584_830851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|831341_831560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|832545_832767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|832763_833846_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|833856_834228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|834224_834404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|837107_837383_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|838218_839676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|840103_841312_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	884992	947786	3192883	tRNA,transposase	Staphylococcus_phage(28.57%)	52	NA	NA
WP_048875904.1|884992_885868_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|886124_886562_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|886622_887255_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|887270_887918_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|887920_889984_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|890310_891603_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|891991_894202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|894218_894875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|897260_898136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|898394_899006_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|899433_902022_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|902124_902886_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|902882_903419_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|903467_904424_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|904501_907687_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|907690_908746_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|908975_909578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|909621_910284_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|910318_910666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375702.1|911134_912166_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|912628_914032_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|915150_915495_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|915586_916042_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|916290_916425_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|916417_917059_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|917055_917772_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|917775_919095_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155051395.1|919776_919920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773644.1|920899_923536_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_036773645.1|923577_924663_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|924662_925346_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_017377747.1|927508_927763_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|927841_928159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|928311_928710_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|928791_929430_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|929586_930561_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|930933_931209_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|931758_932043_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|933859_934453_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|935526_936408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|936519_938199_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|938325_939576_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|939651_940113_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|940109_941258_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|941263_941938_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|941934_942591_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|942716_943190_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|943191_943614_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|943600_944620_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|944779_944959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|945177_945459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|946910_947786_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	951688	1018651	3192883	protease,tRNA,transposase	Bacillus_phage(20.0%)	56	NA	NA
WP_048876012.1|951688_953092_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|953450_954218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|954331_955735_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|955731_955893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|956208_957183_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|957423_958707_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|958773_959697_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|961892_964037_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|964058_964265_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|964325_964946_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|964986_965880_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|965965_966691_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|966752_967157_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|967319_969428_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|969551_970601_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|970597_972064_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|972206_973544_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|973611_975102_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|975330_975702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|975852_976680_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|976982_977639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|977586_978510_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|978523_979447_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027243109.1|979721_980378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|982077_982305_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376989.1|982629_983178_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|983258_983534_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|983533_984583_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|984695_986633_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|986780_988493_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|988561_989281_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|989277_989880_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|989994_990882_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|991072_991420_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|991470_992310_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|992405_993152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|993348_993975_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|994290_994860_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|995003_995702_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|996408_997032_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|997141_998035_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|998141_999752_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|999748_1001044_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|1001065_1002988_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|1003098_1003401_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|1003495_1008382_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1008429_1009752_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1009876_1010971_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1011022_1011961_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1012041_1012626_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1013010_1013901_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1014103_1014595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1014734_1015226_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1015394_1016108_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065653747.1|1016170_1017511_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1017775_1018651_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	1024264	1159013	3192883	transposase	Staphylococcus_phage(17.39%)	115	NA	NA
WP_017377787.1|1024264_1024492_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1024518_1025559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1025625_1026195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1026425_1026830_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1026842_1026983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1027077_1028277_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1028297_1028909_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1029110_1029872_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1030167_1031094_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1031254_1032211_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1032355_1032625_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1032891_1033866_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1034019_1034247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1034363_1034789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1034945_1035875_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1036321_1036852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|1037173_1037479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1037956_1038268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1038607_1039774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376293.1|1041842_1044593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1044828_1046121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1046607_1047513_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376296.1|1048290_1049007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1049292_1050054_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1050086_1051490_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1051486_1051651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1051710_1051998_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1052742_1053471_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1053439_1054186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046685.1|1054236_1054656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1054652_1055627_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1055783_1056101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772457.1|1058576_1058885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1058960_1059233_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1061766_1062204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1062805_1063993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1064263_1065898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1065948_1066677_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1068104_1069067_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1069290_1070286_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1070313_1071249_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1071292_1071754_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1071732_1072350_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1072379_1073354_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1073408_1073876_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1073888_1074533_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1074573_1075302_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_027243102.1|1075695_1076004_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017377848.1|1076000_1076399_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027243103.1|1076395_1077196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243104.1|1077245_1078469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420707.1|1078449_1079748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243106.1|1079750_1080956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876048.1|1080990_1082880_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_082300708.1|1084002_1084563_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1085887_1086283_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1086291_1086648_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1086640_1087516_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1087601_1088180_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1088137_1088431_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1089391_1090903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1091150_1092554_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1092759_1093194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1093276_1093981_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1094239_1094728_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1094756_1095431_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1095671_1096547_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275340.1|1097077_1097686_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1097956_1098415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1098693_1099083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1099268_1100084_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1100306_1101212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1101375_1102137_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1102140_1103007_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1103092_1103704_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1104082_1105330_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1105481_1106183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1106480_1106654_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1107143_1107644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1108722_1108950_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420705.1|1109035_1109236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1109264_1109945_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1109967_1112142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1112387_1113458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1113454_1114858_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619408.1|1115006_1115492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1115563_1116385_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1117051_1118551_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1118854_1121548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1121544_1124946_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_048875961.1|1126533_1127937_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1129015_1129687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1132595_1133570_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378207.1|1134278_1135034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378208.1|1135328_1136879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929877.1|1137661_1138285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619549.1|1138636_1141804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242785.1|1142236_1143253_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_048876041.1|1143277_1144300_+	chorismate mutase	NA	NA	NA	NA	NA
WP_036771345.1|1144353_1145658_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_080963651.1|1145648_1146209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242782.1|1146201_1147284_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	4.5e-73
WP_036771342.1|1147329_1148430_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_036771340.1|1148470_1148959_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_027242779.1|1149107_1149797_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242778.1|1150000_1150327_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_016209480.1|1150376_1150604_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_027242777.1|1150615_1151068_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_048876039.1|1151277_1152696_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	2.0e-153
WP_027242775.1|1152731_1153829_+	alanine racemase	NA	NA	NA	NA	NA
WP_048876038.1|1153853_1154585_-	hypothetical protein	NA	M1IDP9	Pelagibacter_phage	35.8	9.1e-09
WP_027242774.1|1154700_1156071_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_048876037.1|1156176_1156650_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_016209463.1|1157294_1157678_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_053093677.1|1158293_1159013_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	1165138	1214687	3192883	tRNA,transposase	Staphylococcus_phage(37.5%)	46	NA	NA
WP_048876036.1|1165138_1165777_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1166074_1167070_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_027242772.1|1167210_1168257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1168249_1169275_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1169341_1171372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1172678_1172906_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1174249_1174393_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1174389_1175082_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420703.1|1175342_1175666_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_027242770.1|1175808_1176219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1176375_1176702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1176848_1177886_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1177927_1178173_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_027242766.1|1178153_1178612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1178619_1180194_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1180348_1180918_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1181227_1183030_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1183026_1183968_+	signal peptidase I	NA	NA	NA	NA	NA
WP_036771308.1|1183995_1184217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242761.1|1184379_1185054_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1185059_1185959_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1185972_1186716_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1186718_1187450_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1187446_1187830_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1187967_1189215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1189625_1190771_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1190763_1191117_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1191397_1191940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1192584_1192773_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1192792_1193767_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1193810_1194686_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1195039_1195867_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1195966_1196128_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1196778_1198119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1199170_1199398_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|1199539_1200901_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1200996_1201656_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144420701.1|1202496_1202853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1203449_1205009_-	APC family permease	NA	NA	NA	NA	NA
WP_027243001.1|1205369_1207340_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375893.1|1207537_1208608_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1208665_1208872_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1208878_1210354_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1210489_1211053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1211222_1212626_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1213592_1214687_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 14
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	1230929	1278653	3192883	transposase	Staphylococcus_phage(50.0%)	43	NA	NA
WP_036772169.1|1230929_1231805_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1231874_1232978_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1233045_1233369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1233525_1234308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1234443_1235421_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1235494_1237486_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1237541_1237823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1238076_1239276_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_051929862.1|1241707_1242220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155082197.1|1242406_1243120_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155082198.1|1243098_1243281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375562.1|1243317_1243482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1244690_1245104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1245114_1245450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1245594_1246713_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1246942_1247209_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1248491_1248719_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1248729_1249236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1249313_1249931_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1250062_1251295_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1251284_1251947_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1252221_1253478_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1253615_1254275_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1254349_1255051_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1255798_1256773_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1257981_1258335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1258548_1258743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1258810_1259323_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1259460_1260315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1260363_1261008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1261041_1261686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243125.1|1262208_1262502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1262600_1263383_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1263465_1264416_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1266458_1269299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1269321_1269903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1270022_1270751_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1270896_1271871_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1271986_1272892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1273490_1274237_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1274489_1274882_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1274919_1275567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1277282_1278653_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	1302472	1343682	3192883	transposase	Enterobacteria_phage(16.67%)	37	NA	NA
WP_048876023.1|1302472_1303576_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1303666_1304819_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1305232_1306084_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|1306221_1306371_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1306995_1309362_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1309409_1310606_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1311174_1313607_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1313928_1315428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1315536_1316109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1316423_1317893_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1317965_1318715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1318718_1319492_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1319590_1320541_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1320680_1322123_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1322338_1323523_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1323646_1324333_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1324468_1325053_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1325142_1325472_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1325807_1326047_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_017377970.1|1326095_1326287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1327061_1327355_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1327503_1327665_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1328179_1328719_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1329057_1329702_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1330035_1330686_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1331209_1332262_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1332279_1335360_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1335525_1335774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1335839_1336715_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1337637_1338144_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1338161_1338359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1338377_1338521_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1338588_1338762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1338966_1340280_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1340289_1340553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1340611_1341586_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1343454_1343682_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 16
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	1374899	1428633	3192883	tRNA,transposase	Bacillus_thuringiensis_phage(25.0%)	45	NA	NA
WP_036772026.1|1374899_1375775_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1375879_1379182_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1379178_1381002_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1381041_1381440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1381548_1382565_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1382999_1384454_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1384535_1387592_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081329473.1|1388982_1389402_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376676.1|1389774_1390239_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1390311_1391313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1394205_1394538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1394899_1395043_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1395030_1395975_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420692.1|1395978_1396368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1396186_1396525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1396899_1397499_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1397498_1397846_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1397996_1398980_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1399889_1400204_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1400352_1400511_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1400482_1401412_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1402326_1402743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1403871_1404588_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1405336_1405495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1405543_1406119_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1406263_1406542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1406606_1407482_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1407647_1411514_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1411669_1412479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1412528_1413350_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1413549_1414782_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1414952_1415678_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1415720_1417259_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1417265_1418651_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1418964_1420014_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1420573_1420951_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|1421142_1422018_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1422999_1423227_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1423279_1423798_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_146619432.1|1424053_1424245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420793.1|1424653_1425427_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243181.1|1425540_1426512_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376772.1|1426493_1427465_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420687.1|1427900_1428086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1428096_1428633_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	1447568	1507478	3192883	tRNA,transposase	Staphylococcus_phage(17.65%)	49	NA	NA
WP_051929845.1|1447568_1448393_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1448796_1449771_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1449956_1450550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1450730_1451195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1451589_1451871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1451867_1453271_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1453922_1454303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1454542_1455199_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1455343_1455640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1455699_1455987_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036772296.1|1457176_1457554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1457753_1458803_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1458779_1460597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1460867_1461446_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1461473_1461938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1461974_1463432_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1463493_1464981_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1465750_1466353_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1466914_1467385_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1469032_1469776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1469927_1470359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1472996_1474343_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1474430_1476236_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1476701_1477499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1477883_1478345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1478567_1479542_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1479584_1479707_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1479778_1481734_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1482123_1482309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1482630_1483620_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1484032_1485658_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1485766_1486081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1486376_1487762_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1487926_1488154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1488294_1488753_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1488953_1489139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1489207_1490035_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1490489_1491014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376824.1|1491286_1491445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1491614_1492568_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1492762_1493737_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1493864_1494890_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1495542_1495830_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1495889_1496222_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1496426_1496987_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_017376814.1|1499581_1500307_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_026063564.1|1500681_1503501_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_048876146.1|1504350_1505484_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_017376809.1|1505708_1507478_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
>prophage 18
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	1529838	1572135	3192883	protease,transposase,integrase	Staphylococcus_phage(30.0%)	42	1551179:1551238	1561640:1561930
WP_048876008.1|1529838_1530813_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_144420681.1|1530856_1531042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1531221_1531386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1531387_1532263_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1532578_1533499_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1533514_1533898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1534224_1535181_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_144420678.1|1535448_1535727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243017.1|1536225_1537569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|1537742_1537886_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1537965_1538940_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1539087_1540959_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1540991_1541090_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1541325_1541955_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1541938_1542361_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1542367_1544107_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1544107_1545172_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1545175_1545529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1545641_1546610_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1546619_1546931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1546946_1547516_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1547779_1549108_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1549148_1550123_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1550709_1551111_-|transposase	transposase	transposase	NA	NA	NA	NA
1551179:1551238	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_146619459.1|1551630_1554087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1554289_1555141_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1555186_1556893_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1558364_1559339_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1559701_1559947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1560310_1561339_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1561469_1561673_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420676.1|1561957_1562914_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
1561640:1561930	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGGCCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTAGTGGAGTGTGCCGCTTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTCT	NA	NA	NA	NA
WP_047927838.1|1563206_1563452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1563448_1563748_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1563970_1564441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1565051_1565279_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036772851.1|1566501_1566819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243023.1|1566812_1567055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243024.1|1567405_1568506_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_017377328.1|1568674_1569976_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_047927520.1|1570052_1570556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|1570731_1572135_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	1582129	1613950	3192883	transposase	Staphylococcus_phage(22.22%)	30	NA	NA
WP_036771330.1|1582129_1583104_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1583623_1584124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1584194_1585523_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1585658_1587047_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1587194_1588505_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1588845_1590129_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1590202_1590823_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1591021_1591282_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1591484_1591631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1591606_1592200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1594063_1594282_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1595534_1596305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1596391_1596607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1596703_1597825_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1598091_1599066_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1599328_1600450_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_155082205.1|1600594_1600744_+	phosphatase	NA	NA	NA	NA	NA
WP_017376491.1|1601030_1601318_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1601290_1601794_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1601874_1602534_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1602875_1603793_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1603922_1604096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1604761_1606120_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_017376486.1|1606194_1606758_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376485.1|1606952_1608182_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1608227_1608854_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1609003_1610191_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1610199_1610892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1611013_1612166_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1612966_1613950_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 20
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	1672285	1762600	3192883	protease,tRNA,transposase	Burkholderia_phage(14.29%)	82	NA	NA
WP_036774017.1|1672285_1673161_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1673550_1673889_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1673885_1674482_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1674484_1676479_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1676542_1677481_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1677829_1678804_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1679007_1679205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1679366_1679771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1681354_1681795_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1682121_1682997_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1683009_1683252_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1683658_1683913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1685124_1686090_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1686182_1686494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1686694_1687471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1688300_1688492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1689220_1690270_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1690440_1691214_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1691274_1692864_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1693054_1694146_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1694168_1694486_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1694572_1695850_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1695871_1696708_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1696714_1698349_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1698780_1699140_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1699421_1700780_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1700805_1701048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1701541_1701721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1701976_1703233_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1703346_1703604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1703748_1704759_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1705135_1705990_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1706019_1706853_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036773204.1|1707429_1708203_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1708284_1708605_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1708823_1709729_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1709814_1710213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1710357_1710855_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242786.1|1712527_1713619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1713717_1714095_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1714174_1715149_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1716693_1717413_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1717496_1717784_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1718068_1718941_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1718897_1719674_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1719878_1720214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1720612_1720969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1721130_1721406_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1721515_1721863_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1721880_1722660_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1722659_1723169_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1723204_1723453_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1723764_1724100_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1724399_1725650_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1725731_1727759_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1728304_1728523_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1728694_1729057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1729205_1730609_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1730890_1732066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1732083_1734081_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1734061_1735042_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1735097_1735940_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_027242816.1|1735939_1736344_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1736336_1736756_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1736778_1737408_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1737976_1740166_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1740177_1741383_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1741367_1743215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1743199_1744438_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1744424_1746293_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1746326_1747580_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1747585_1748443_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1748461_1749190_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1750328_1751120_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1751485_1751773_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|1753895_1754285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1754461_1755220_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1755216_1757616_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1757629_1758907_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1758996_1760295_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1760492_1761386_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1761385_1762600_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 21
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	1773299	1823784	3192883	tRNA,transposase	Vibrio_phage(14.29%)	46	NA	NA
WP_069971651.1|1773299_1774175_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1774547_1774811_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1775117_1777712_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1777708_1778191_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1778168_1779209_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1779383_1779869_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1779976_1782547_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1782580_1783042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1783378_1784254_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1784531_1786292_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1786385_1787051_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1787063_1788569_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1788590_1789121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1789194_1790457_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1790643_1791516_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1791617_1792406_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1792498_1793824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1794177_1795353_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1795521_1796175_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1796330_1798271_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1798267_1798891_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1799055_1800030_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1800301_1800922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1800918_1802322_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1802389_1802806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1803213_1803711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1803707_1804682_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|1804761_1805331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1805475_1806012_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1806016_1806313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1806321_1806927_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1807112_1807511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1807701_1807905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1808049_1808205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1808329_1808782_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1808898_1810371_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1810809_1811274_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1811962_1813213_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1813322_1813793_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1813815_1814409_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1814546_1815596_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1815619_1816543_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1816559_1817021_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1817128_1817947_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1818556_1818700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1822863_1823784_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 22
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	1894140	1902983	3192883	transposase	Staphylococcus_phage(50.0%)	12	NA	NA
WP_017378288.1|1894140_1894362_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1894420_1895395_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1895593_1895758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1895754_1896390_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046602.1|1896666_1897446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1897478_1898240_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1898216_1899206_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1899341_1900217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1900235_1900895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378292.1|1900924_1901131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1901136_1901583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1901579_1902983_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	1908052	1970388	3192883	tRNA,transposase	uncultured_Mediterranean_phage(16.67%)	51	NA	NA
WP_048875980.1|1908052_1909456_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927313.1|1910261_1913192_-	peptidase M16	NA	NA	NA	NA	NA
WP_027242809.1|1913335_1915294_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	2.5e-45
WP_144420783.1|1915487_1916135_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377496.1|1916190_1917516_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.3e-37
WP_075275301.1|1917550_1917820_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_017375667.1|1918090_1918576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817939.1|1919064_1919253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777920.1|1919562_1919796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242807.1|1920237_1920726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242806.1|1920855_1921824_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242805.1|1922530_1925857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377489.1|1925915_1926953_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377488.1|1927157_1929071_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	1.8e-117
WP_017377487.1|1929122_1929770_-	hypothetical protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_017377486.1|1929881_1931006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377485.1|1931002_1931599_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209821.1|1931629_1931962_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_027242804.1|1932064_1933918_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	2.2e-43
WP_027242803.1|1934364_1936077_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.5e-25
WP_036772905.1|1936285_1936639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420657.1|1938129_1939191_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1939902_1940064_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1940980_1941520_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1941902_1942319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1942414_1943230_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1943362_1944856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1945041_1945467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1945463_1947524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1947807_1948623_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1948723_1949542_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1949538_1949907_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1950088_1950916_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1950979_1951708_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1952110_1952839_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1953228_1953954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1953988_1957861_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1958061_1959195_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1959208_1959397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1959620_1960979_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_036773947.1|1962585_1963461_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1963972_1964608_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999981.1|1964620_1965094_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_155046603.1|1965021_1965174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929627.1|1965367_1965718_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1965777_1966065_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1966117_1966897_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376416.1|1967016_1967187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376415.1|1967321_1968239_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1968290_1969046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1969113_1970388_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
>prophage 24
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	1977545	2040299	3192883	tRNA,transposase	Klosneuvirus(18.18%)	55	NA	NA
WP_026063528.1|1977545_1978661_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1978845_1979886_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_027242800.1|1979888_1980923_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376402.1|1980919_1981981_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_017376401.1|1982092_1983565_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376400.1|1983717_1984161_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376399.1|1984229_1987001_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376398.1|1987157_1988390_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1988631_1989294_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376397.1|1989753_1991235_+	MFS transporter	NA	NA	NA	NA	NA
WP_036773116.1|1991432_1992407_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|1992930_1995657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|1996544_1997519_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|1997769_1998474_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|1999713_2000232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|2001199_2002684_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2002808_2004344_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2004366_2004696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2004592_2004808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2006791_2007991_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2008200_2009061_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2009176_2009755_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2009911_2010553_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2010591_2010813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2010805_2011789_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2012182_2012680_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2012824_2013100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2013251_2014934_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2014941_2015964_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2016132_2017134_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2017247_2017586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2018061_2019321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2019529_2019757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2019785_2020004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2020141_2020507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2020574_2020817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2020831_2021167_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2021171_2021609_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_036772812.1|2021634_2023020_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2023130_2023562_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2023667_2025179_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2025469_2027062_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2027262_2029458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772819.1|2029551_2030985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2031027_2031543_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2031542_2032490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2032473_2033139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2033135_2033864_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2033853_2034600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2034583_2035648_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2035852_2037040_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2037096_2038215_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2038662_2038920_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2039199_2039877_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2040095_2040299_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	2059999	2109822	3192883	protease,tRNA,transposase	Burkholderia_virus(20.0%)	42	NA	NA
WP_017377787.1|2059999_2060227_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2060316_2061072_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2061485_2062082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2062161_2064966_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2064946_2065900_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2065892_2067263_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2067433_2068837_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2069608_2069935_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420651.1|2070139_2070793_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_017376600.1|2071112_2071292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2071547_2072804_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2073042_2073189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2073271_2073628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2074123_2074483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2074492_2074876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2075764_2075905_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2076049_2076970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2079127_2079658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2079668_2080724_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2080739_2082779_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2082765_2083596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2083662_2087202_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2087315_2088035_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2088273_2088903_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2089022_2090426_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2090571_2092515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2093032_2093893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2094328_2096074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|2096476_2097949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2098131_2098731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2098868_2099066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2099266_2099407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2099474_2100254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155082200.1|2100818_2101061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155082201.1|2101205_2101508_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2101652_2102030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2102489_2103797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2104545_2104803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2104854_2106258_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2106498_2108208_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2108377_2108740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|2108847_2109822_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 26
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	2124391	2173085	3192883	protease,tRNA,transposase	unidentified_phage(15.38%)	50	NA	NA
WP_017377892.1|2124391_2125813_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_026063687.1|2125902_2127501_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377894.1|2127657_2128284_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027242839.1|2128364_2131037_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377896.1|2131519_2132476_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_017377897.1|2132528_2132948_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_048875958.1|2132974_2133838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377899.1|2133827_2134619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2134923_2135895_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2136243_2136552_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2136548_2137205_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2137338_2137824_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2137901_2138423_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2138468_2139362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2139358_2140180_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2140374_2140524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2140751_2141582_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046606.1|2142987_2143158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2143310_2144714_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_144420645.1|2144823_2146080_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2146051_2146783_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2146794_2148072_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2148171_2148546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2148630_2149518_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2149575_2150304_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2150300_2151410_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2151561_2151990_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2152084_2152441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2152433_2153645_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2153641_2154430_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2154592_2155387_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2155836_2156577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2156580_2159079_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2159341_2160298_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2160281_2161043_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2161250_2162225_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2162333_2163089_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2163213_2163459_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2163518_2165792_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2165846_2166149_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2166389_2166683_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2166853_2167033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2167108_2167720_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2167966_2169283_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2169293_2169662_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2169692_2170355_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2170777_2171356_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2171335_2171743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2171866_2172163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2172209_2173085_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	2180030	2237548	3192883	tRNA,transposase	Burkholderia_virus(18.18%)	51	NA	NA
WP_144420643.1|2180030_2181344_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2181548_2181722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2181991_2182465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2182609_2182804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2183068_2183944_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210558.1|2184130_2184886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376051.1|2184959_2186612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376050.1|2186651_2188190_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_087910638.1|2188189_2189890_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_075275404.1|2189978_2191154_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_017376046.1|2191192_2192155_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_017376045.1|2192432_2192855_-	universal stress protein	NA	NA	NA	NA	NA
WP_017376044.1|2193160_2193802_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376043.1|2193930_2195265_+	dihydroorotase	NA	NA	NA	NA	NA
WP_048875952.1|2195379_2196015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771517.1|2196759_2197896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771498.1|2198079_2199810_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_017376037.1|2199799_2201008_+	MFS transporter	NA	NA	NA	NA	NA
WP_075275290.1|2201106_2202108_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420641.1|2202351_2202987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2203006_2203981_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875951.1|2204024_2204861_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2205006_2205426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2205702_2206383_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2206348_2206699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2206731_2207943_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2208283_2208913_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2208961_2209978_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2210224_2210440_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2210492_2210942_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2211021_2212767_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2212858_2214730_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2215174_2215891_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2217328_2218198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2218154_2218382_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2219350_2220265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2220310_2221333_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2221401_2222451_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155052687.1|2223079_2223250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243219.1|2223534_2223843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2224009_2225413_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046608.1|2225505_2225670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2225991_2226216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2226226_2227438_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036774710.1|2227832_2228732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|2228905_2229307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2229553_2230597_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2230716_2230953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2231741_2233295_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2235475_2235703_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2236573_2237548_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
>prophage 28
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	2244353	2325046	3192883	transposase,integrase	Staphylococcus_phage(33.33%)	60	2271931:2271990	2322352:2323112
WP_144420638.1|2244353_2245436_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2245432_2245744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2246789_2247764_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2248770_2249550_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2250011_2251229_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275285.1|2251404_2252841_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211781.1|2253063_2254311_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036773927.1|2254801_2255437_-	peroxiredoxin C	NA	NA	NA	NA	NA
WP_017377683.1|2255988_2257491_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_144420775.1|2257549_2261314_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_017377681.1|2261462_2262641_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.6	7.7e-50
WP_027243160.1|2262928_2263459_-	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_017377679.1|2263556_2263763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2264078_2265161_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2265157_2265469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2266966_2267902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2268494_2269640_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2271882_2273046_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2271931:2271990	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|2273074_2273299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2274646_2275822_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2276167_2278678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2278736_2279549_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275283.1|2279989_2280601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2280743_2281718_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2281822_2283154_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2283352_2283421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2283552_2284995_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2285386_2286799_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2287488_2287935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2288529_2289378_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2289631_2290690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2290681_2292388_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2292459_2294193_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2294489_2295056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2295180_2295834_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2295860_2297321_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2297417_2298395_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2298864_2300268_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2300793_2301087_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2301313_2302078_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2302285_2302513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2302576_2302759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2303321_2303501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376902.1|2303564_2303876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2304730_2305435_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2305632_2305773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2306177_2306702_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|2306848_2308105_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2308172_2308652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2309092_2310496_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243186.1|2310910_2313292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2313798_2315691_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2315862_2316837_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2317140_2317947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2318015_2318627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2320108_2320405_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2320401_2321244_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2321634_2322420_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2322424_2323828_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2322352:2323112	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2324101_2325046_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	2345888	2373541	3192883	protease,transposase	Staphylococcus_phage(25.0%)	28	NA	NA
WP_017377305.1|2345888_2347190_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2347271_2347877_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2347989_2349294_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2349894_2350770_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2350885_2351557_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2351736_2353092_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2353212_2353950_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2354028_2354745_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2355393_2356668_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2356698_2357274_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2357318_2358284_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2358747_2359656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|2360043_2360295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2360439_2360868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2360853_2361798_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2362002_2362155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2362183_2362918_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2363012_2363273_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2363491_2364457_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|2364433_2364730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2364920_2365370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2365629_2366058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2366153_2366654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2366590_2366752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2367632_2367854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2369352_2370030_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2371344_2371683_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2372566_2373541_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 30
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	2412786	2446523	3192883	tRNA,transposase	Burkholderia_virus(33.33%)	24	NA	NA
WP_080999971.1|2412786_2414190_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2414303_2414879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2416124_2416352_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2416641_2417181_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2417490_2418978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2419029_2419455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2419673_2421077_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2421073_2421451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2421410_2421956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2422351_2423578_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2424178_2425831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2425767_2425962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963645.1|2426294_2427485_-	MFS transporter	NA	NA	NA	NA	NA
WP_155082202.1|2427733_2428993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155082203.1|2429305_2430694_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2430982_2431819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2432479_2433370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2433838_2434813_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876012.1|2435297_2436701_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2436846_2438250_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|2438334_2440149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2442060_2443464_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2443497_2445027_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2445062_2446523_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 31
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	2481974	2585773	3192883	tRNA,transposase	Bacillus_phage(18.52%)	101	NA	NA
WP_036773116.1|2481974_2482949_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2483001_2483997_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2484039_2485014_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376319.1|2485638_2486319_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017376318.1|2486318_2487128_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027242903.1|2487201_2490882_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_026063524.1|2490891_2492379_-	ribonuclease G	NA	NA	NA	NA	NA
WP_017376313.1|2492388_2493006_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_017376312.1|2493075_2493594_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376311.1|2493590_2494490_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2494505_2495549_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376309.1|2495746_2496034_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2496154_2497615_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2497694_2499131_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2499255_2500230_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2502420_2503182_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2504339_2504567_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2505520_2505733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2505750_2506068_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2506094_2506784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2507124_2507328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2507459_2508395_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2508407_2509190_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2509319_2509631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2509974_2510301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2510325_2510781_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2510770_2511823_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2511825_2513289_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2513423_2513651_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2515067_2515532_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2515788_2516604_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2516732_2519045_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2519161_2519689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2520380_2521658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2521668_2521920_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2521953_2522475_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2522644_2523631_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2523721_2524537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2524965_2525361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2525333_2525561_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_047927746.1|2526529_2527117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2527719_2528391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875918.1|2528535_2529117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420767.1|2529159_2529837_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243185.1|2530115_2531072_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_017377736.1|2531131_2531797_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017377737.1|2531830_2532376_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_155046615.1|2532655_2532817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774946.1|2533513_2534128_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_144420620.1|2534054_2535257_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875923.1|2535242_2536238_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2536241_2536646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2537613_2537841_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2538809_2539406_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046616.1|2539374_2540538_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
WP_155046617.1|2540682_2540823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2541527_2541755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875913.1|2541751_2542522_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017377194.1|2542518_2543832_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_027243130.1|2544756_2545626_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377197.1|2545622_2546972_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_017377198.1|2547084_2548725_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_027243131.1|2549110_2549377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377200.1|2549506_2549695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2550259_2551663_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|2551768_2551993_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2552175_2552997_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|2553142_2553397_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377841.1|2553785_2555570_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|2555658_2556378_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2556539_2556746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2556745_2556982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2556994_2557348_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2557885_2558719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2558811_2559009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2559106_2560492_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2560618_2561209_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2562240_2562528_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2562587_2562752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2562748_2564119_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2564485_2565898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2565967_2566738_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2567230_2567518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2568994_2569288_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2569245_2570067_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2570211_2570436_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155046618.1|2570690_2571218_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|2571394_2571655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2571573_2571729_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2571827_2572802_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2574130_2574280_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2574396_2574690_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2575498_2576074_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2576151_2577027_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2577091_2577712_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2577696_2578779_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2579012_2579417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2580907_2582209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2582355_2583024_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2583956_2584520_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2584576_2585773_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
>prophage 32
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	2600698	2654682	3192883	tRNA,transposase	Staphylococcus_phage(33.33%)	51	NA	NA
WP_036771330.1|2600698_2601673_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376571.1|2601839_2604164_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.7	7.6e-25
WP_017376570.1|2604338_2605055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063542.1|2605134_2605749_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_017376568.1|2605741_2607124_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_017376567.1|2607132_2607606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376566.1|2607738_2608998_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_144420761.1|2609521_2609701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|2609845_2610556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046619.1|2610623_2610881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999966.1|2610967_2612317_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2612614_2613172_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2613265_2613772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2614276_2614972_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|2615102_2615891_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2615924_2617328_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2617751_2618726_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2618982_2619210_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2620297_2620828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2620824_2622357_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2622353_2623304_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2623724_2624357_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2624599_2624797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2625146_2625575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2625652_2626648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2626792_2627044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2627148_2627793_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2628028_2628526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2629037_2630012_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2630382_2630676_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2631488_2631824_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2632144_2633683_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2633835_2634934_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2635172_2636372_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2636402_2637029_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2637057_2637942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2638075_2638306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2638443_2639685_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_144420613.1|2639964_2640336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2642467_2642629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2643004_2644132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2644248_2644911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2644996_2645257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2645675_2646437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2648498_2649158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2649258_2649909_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2650056_2650746_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377795.1|2650768_2651932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2652136_2652388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046691.1|2652911_2653508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2653707_2654682_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 33
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	2669359	2726487	3192883	tRNA,transposase	Staphylococcus_phage(30.77%)	53	NA	NA
WP_048875904.1|2669359_2670235_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2670355_2670856_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2670852_2671119_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2671284_2672259_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2672438_2673059_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2673365_2674769_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771922.1|2675603_2676794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|2677360_2677828_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|2678329_2678584_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|2678785_2679289_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|2679505_2680111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155082204.1|2680206_2680347_+	phosphatase	NA	NA	NA	NA	NA
WP_016210168.1|2680559_2681243_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2681318_2682098_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|2682084_2682945_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|2683068_2683434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377271.1|2683819_2684149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2684559_2685534_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_144420611.1|2686068_2686269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155052690.1|2686301_2687633_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	2.4e-36
WP_017377275.1|2688715_2689438_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2689429_2689798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2690060_2691362_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2691457_2691901_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2691904_2692414_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2692406_2695220_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2695716_2696649_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2696753_2697680_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2697858_2699397_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2699570_2699831_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2701105_2701714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2701760_2702489_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2702735_2702873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377696.1|2704035_2704575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2704809_2705721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2705980_2706277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2706621_2707775_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2708371_2708920_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2709023_2709587_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2709804_2710563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2711838_2712066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2712288_2712468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2712723_2713980_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2714047_2714692_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_017378393.1|2715496_2715703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816949.1|2716703_2717102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378390.1|2717295_2718873_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378389.1|2719006_2719948_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378388.1|2719949_2720723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963621.1|2722331_2722538_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2722804_2723092_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378384.1|2723097_2725479_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|2725491_2726487_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
>prophage 34
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	2767494	2820522	3192883	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2767494_2768469_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2768625_2770200_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2770424_2770703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2770772_2771648_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2771657_2772818_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2772932_2774081_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2774091_2776893_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2776999_2777698_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2777710_2779474_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2779477_2779825_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2779818_2780193_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2781140_2782424_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2782833_2784129_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2784484_2785030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242732.1|2785616_2786138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2786149_2787529_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2787764_2788199_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2788195_2789548_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2789547_2790663_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2790663_2791680_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2791669_2793340_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2793359_2793695_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2793722_2795162_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2795158_2796205_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2796347_2797844_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2798139_2799141_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2799246_2799858_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2799978_2800356_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2800406_2801813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2801806_2802874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2802980_2804582_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2804830_2805748_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2805816_2807511_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2807745_2808675_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2808705_2810109_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2810339_2811044_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2811110_2811767_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2811777_2812659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2812829_2815499_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2815859_2816834_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2816913_2817885_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2817938_2818913_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2819032_2819254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2819317_2819626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2819550_2820522_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	2835088	2889349	3192883	transposase	Staphylococcus_phage(37.5%)	51	NA	NA
WP_026063658.1|2835088_2835817_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2836126_2836381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2837094_2839749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2839787_2840078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2840194_2841493_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2842063_2842552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2842532_2842835_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2843081_2843570_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2843603_2844242_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2844363_2844903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2844992_2846219_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2846831_2847089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2847175_2848075_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2848219_2848486_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2848477_2848627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2848854_2849730_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2849859_2850087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2850153_2850348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2850406_2851381_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2851418_2851607_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2851607_2853380_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2853369_2854362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2854969_2855662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2856148_2856718_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2856714_2857689_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2857728_2858232_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2858322_2859726_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2860424_2860610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2860715_2862119_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420599.1|2862123_2862696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2862729_2864157_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|2865442_2867812_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2867887_2868706_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2869057_2869603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2870085_2871324_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2871300_2872275_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017375625.1|2872367_2872595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|2872599_2873091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243039.1|2873763_2874651_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_027243038.1|2874740_2876231_-	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_017376549.1|2876254_2877136_-	ROK family protein	NA	NA	NA	NA	NA
WP_017376548.1|2877132_2877855_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376547.1|2878554_2879346_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|2879532_2879778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420598.1|2879929_2880160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376543.1|2880189_2880969_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_047927468.1|2880994_2881300_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_144420752.1|2881296_2882190_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_027243035.1|2882545_2883844_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376538.1|2886446_2887628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2887921_2889349_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	2896935	2946593	3192883	tRNA,transposase	Bodo_saltans_virus(14.29%)	43	NA	NA
WP_062312049.1|2896935_2898303_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2898795_2899275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2899454_2901518_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2901526_2902252_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2902879_2903593_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2903597_2904128_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2904362_2904596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2904708_2904957_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2905764_2907957_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2907974_2908283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2908936_2910646_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2910839_2910995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2912397_2913273_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2913598_2914360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2914584_2915316_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2915312_2915849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2915902_2916667_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2916669_2918247_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2918253_2918730_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2918705_2919137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2919169_2919925_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2920099_2920387_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2920769_2920994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2921333_2922497_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2922531_2923509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2923502_2924189_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2924127_2925243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2925522_2926128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2926365_2926845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2928667_2929321_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2929433_2929985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2930084_2931059_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2931344_2931869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2932566_2933391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2933646_2934003_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2933999_2935403_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2935522_2936083_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2936240_2936807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243087.1|2939584_2940280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2940320_2940533_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2942105_2943215_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2943270_2944752_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2945189_2946593_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP039102	Piscirickettsia salmonis strain Psal-118 chromosome, complete genome	3192883	3074275	3139524	3192883	protease,transposase	Hokovirus(14.29%)	55	NA	NA
WP_017376170.1|3074275_3075376_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3075733_3076708_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3076844_3077723_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3077730_3077961_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3078014_3079019_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3079237_3080065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3080146_3081535_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3081822_3083223_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3083317_3084244_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3084240_3085377_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3085373_3086381_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3086377_3087541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3087550_3088402_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3088433_3089606_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3089602_3090991_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3091019_3091427_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3091446_3092454_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3092450_3093323_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3093319_3094180_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3094181_3096452_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3096453_3097599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3097645_3098131_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3098170_3098794_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3104473_3105226_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243062.1|3106557_3107181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3107285_3108074_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3108073_3108805_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3108838_3110566_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3110579_3111641_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3111955_3113170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3113302_3113827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3114444_3115293_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3115279_3115978_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3116032_3116794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3116786_3117209_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3117338_3117890_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3117945_3118908_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3118908_3119124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3119310_3120120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3120099_3120942_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3120938_3122183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3122321_3123410_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3123427_3123928_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3124115_3124715_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3124720_3125884_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3125916_3126870_+	glutathione synthase	NA	NA	NA	NA	NA
WP_017376261.1|3127233_3128298_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3128294_3131357_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3131509_3131962_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3131993_3132350_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3132768_3133542_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376269.1|3136165_3136456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3136680_3137556_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3137552_3138110_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3138120_3139524_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039103	Piscirickettsia salmonis strain Psal-118 plasmid unnamed1, complete sequence	175417	0	117510	175417	integrase,terminase,transposase,portal	Streptococcus_phage(40.0%)	120	11253:11312	117876:119611
WP_017377655.1|1412_1658_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|1654_2041_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|2128_2857_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|2835_3456_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|3801_4488_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|5437_5800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|5802_7542_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|7943_8096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|8123_8807_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|8888_9866_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|9941_10112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|10152_10881_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
11253:11312	attL	GATGTATCTTAGCTAAATCTGTCAGCACCTTTTTAATTTTAGTATCAACAACCTGTTTTT	NA	NA	NA	NA
WP_036771293.1|11426_11693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772437.1|11988_13887_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|14308_15037_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420842.1|15098_15257_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|15673_15838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|15858_17145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|17327_18056_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|18183_19161_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046631.1|19235_19886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126795.1|22517_22778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|22781_23054_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|23129_23858_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|24426_25398_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|26262_27090_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|27943_28414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|29307_29451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|30657_31257_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|31610_32387_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|32747_33476_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|33545_33746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|33664_34636_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027242938.1|35049_35418_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017375972.1|35419_35728_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017375841.1|36172_36382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|36688_36907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242936.1|36903_37356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420845.1|37483_37714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876207.1|38219_39695_-	response regulator	NA	NA	NA	NA	NA
WP_017375966.1|39695_40262_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_144420846.1|40406_40871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|40875_41301_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_036817204.1|41571_42567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817201.1|42870_43278_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017375960.1|43385_44429_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_017375959.1|44730_44964_+	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_146619517.1|45101_45254_-	phosphatase	NA	NA	NA	NA	NA
WP_081078123.1|45283_45646_+	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
WP_026063496.1|46524_46890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242932.1|47022_47250_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242931.1|47258_47666_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242930.1|47811_49194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375952.1|49383_49587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242929.1|49782_50166_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|50252_50735_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|50737_52069_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|52273_52708_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|52794_53181_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|53218_53953_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|53999_54713_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_144420848.1|56091_56277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243190.1|56280_59625_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017377509.1|59805_60534_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|60627_61602_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|61915_62278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|62317_62827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|63058_64039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|64504_65482_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|65962_66940_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|66954_67116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|67333_67588_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|67577_67865_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_036771347.1|68359_69337_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|70337_70550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|70707_71685_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_075317322.1|71671_73186_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_047927782.1|73981_74371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|74286_75264_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_048876196.1|75293_76442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243215.1|78255_79278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|79760_80489_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_048876194.1|81728_82262_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|82442_82784_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|82964_83231_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|83303_85169_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|85336_85621_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|85964_86693_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|86774_87266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|87998_88226_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|89777_90206_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|90141_90528_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|90557_91286_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|91297_91447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|91693_92422_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|93799_94762_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|94785_95115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|95181_96222_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|96235_96427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|96631_97201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|97243_97543_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774376.1|97539_97968_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|98277_99006_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|99179_99953_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|100666_101602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|101876_102605_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243201.1|102770_103010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|103073_106415_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|106572_107301_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|107594_107990_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|108042_108771_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|109254_109983_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|110153_110723_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|110727_111411_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|111562_112291_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_080963627.1|112309_112528_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774644.1|113507_114569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|115077_115824_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|115824_116229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|116535_117510_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
117876:119611	attR	GATGTATCTTAGCTAAATCTGTCAGCACCTTTTTAATTTTAGTATCAACAACCTGTTTTTTAGGTTGATACCGATAAACTGATCGGCCAATACGGCACATCTTGCATGCTTTATTCCCGCTCAATGCATGAGCTTTGACAGCATAATCAACTAAGTCACGCCGACTCGCTGCGGTTATAGCTTTTTTTCAACAATATCCTTGAGCACTTTGTGCTCTAGGCTAATGTCTGCGTACATCTGTTTCAAACGACGGTTTTCGTCTTCAAACTCTTTTAAACGCTGTAGATCTGAAACGCCCATGCCTTGATATTTGGATCTGAGTTTGTAGTAGCTGCTTTTAGCAATACCATACTGGCGACAAATATCTTCAACTTTAACACCCGCTTGGCCTTCATTAAGCATGGCTACAATTTGTGATTCTGTTAGTTTTGATCGTTTCATCTTCTCTCTCCTGGCTAAGTTAATTTAACAGAAGATTCCACTTATCACTTGTACTATTTTAAGGGAGGGTTACCGAGTTATGTGAGAGCACAGTAGTGGAGTGTGCCGATTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTTGCGACAGAACCCTCCTTGGTTCGCAGCGCCAACATCATATCATTAAATCAAATTGCGACAGAACCATTATAGCTCATCATCTTCATATCTTGTATGTTTAGGATCATTACAAACATACCATCCACTAGAACTAGAATTTGTACATACCCCATACCTTTTAGATAAATCAAAGTACATAGTTGTGCTAGAAGGAGATTGTGATGATTTAGCATCAAAAAGTGAGCCAAAATGATTGTAAGTCGTGACATATAAATTACTTTTATCTGAATTTTTAATATATATTGCGCTGACAGGATCATTTACTCTACTTTCTAAAAACCATTTTAAATTATTAGGTACGTTATCCATAAATGGATCACACTGTTTGAAATAAACCCAATCCCAATCCGTCGTTTTTCCAGCAATATTAGAAGTTAAACAGCTTAAAAACCAACCATCAGATGAAAATGCACGGCCATATAGTGAAAGCATCAATATTCTAGAATTTTTCATATCATAGTATGTTCTATTCAAATAATTTGAATTATACGAACCTGAATACATAGGATAGTAATTATTATCAGATTTATCATAAAACCTCATACCAATTTCATACCAAAATGTATTTACTTTTGATGGTGTTTTAAAAAAGTATTTAGACATTTTATTTGCATCTAAAACAATATTAGTTCCACTTGATTTTGAAATAATTCCATAGTTGCCATACCATTGAATAGATAGATCTTTATTTAAACGAGGTTTTAATTTTCCATCTCTTACATCCCATTTTTGATAAGGGTTATAAATATCACAAGGCCAAAACTCTACATAATCCCATTTATCATCACCTTTGATGACATTTTCTGGTGCAGTCATACATAGAGGGATTCCAAATTGAGATTTAGAGAAAGCAACTCTGCCAAGAGTATCATAAATAGCTTTTTGACTTTCTACATTAGAACATGTTTGAGCGTATAAATAAGATCGAGACGTTTTCATAGAAGAGTCTCTTGATTGAGTTGGAGCTAAACAGTAACCTCCCTGAGTTGTAATTAACTGGCTTGGTATTGTAGGTAAATCTTTAAAT	NA	NA	NA	NA
>prophage 2
NZ_CP039103	Piscirickettsia salmonis strain Psal-118 plasmid unnamed1, complete sequence	175417	123457	125079	175417	transposase	Acinetobacter_phage(50.0%)	3	NA	NA
WP_017375632.1|123457_123793_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|123987_124191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|124284_125079_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
>prophage 3
NZ_CP039103	Piscirickettsia salmonis strain Psal-118 plasmid unnamed1, complete sequence	175417	131449	133867	175417	transposase,portal	unidentified_phage(50.0%)	2	NA	NA
WP_048875857.1|131449_132424_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|133411_133867_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
>prophage 4
NZ_CP039103	Piscirickettsia salmonis strain Psal-118 plasmid unnamed1, complete sequence	175417	138585	145553	175417	transposase	Streptococcus_phage(100.0%)	7	NA	NA
WP_017377509.1|138585_139314_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|139455_140388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|140417_141146_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|141148_141421_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|142271_143000_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|143055_143676_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|144824_145553_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 5
NZ_CP039103	Piscirickettsia salmonis strain Psal-118 plasmid unnamed1, complete sequence	175417	151588	152323	175417	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_027243210.1|151588_152323_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.9e-36
>prophage 6
NZ_CP039103	Piscirickettsia salmonis strain Psal-118 plasmid unnamed1, complete sequence	175417	155540	160533	175417	transposase	Streptococcus_phage(66.67%)	5	NA	NA
WP_075275471.1|155540_156515_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_155046640.1|157150_157318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876214.1|157286_158015_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_017377521.1|158523_158877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|159804_160533_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 7
NZ_CP039103	Piscirickettsia salmonis strain Psal-118 plasmid unnamed1, complete sequence	175417	166896	172799	175417	transposase	Staphylococcus_phage(28.57%)	9	NA	NA
WP_075275473.1|166896_167073_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|167189_167897_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|167850_168729_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_144420840.1|168759_169191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|169573_170278_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|170289_171018_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|171047_171437_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|171459_172188_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|172190_172799_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
>prophage 1
NZ_CP039105	Piscirickettsia salmonis strain Psal-118 plasmid unnamed3, complete sequence	50690	32440	46235	50690	capsid,transposase,tail,head	Moraxella_phage(18.18%)	17	NA	NA
WP_036771639.1|32440_33415_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|33464_34004_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|34017_34602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|34986_35298_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|35294_35720_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|35898_36294_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|36290_36641_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|36640_37063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|37064_37388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|37444_37711_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|37714_39793_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|39785_40127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|40123_40795_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|40724_41510_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|41499_42057_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|42053_44744_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_036771347.1|45257_46235_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 1
NZ_CP039106	Piscirickettsia salmonis strain Psal-118 plasmid unnamed4, complete sequence	33526	3373	19395	33526	terminase,head,transposase,capsid,tail,integrase	unidentified_phage(35.71%)	21	NA	NA
WP_036771330.1|3373_4348_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4883_5474_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5704_5965_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5957_6311_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6487_7462_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|7994_8360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|8504_8759_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8742_9099_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|9196_10171_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|10796_11663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|11875_12259_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|12345_12828_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|12830_13016_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|13035_14010_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|14106_14499_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|14534_15116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|15496_16471_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|16544_16760_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|17563_18079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|18424_18982_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|18978_19395_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
