The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	31805	91594	3195023	tRNA,transposase	Staphylococcus_phage(28.57%)	52	NA	NA
WP_036772169.1|31805_32681_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33039_34395_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34486_34993_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34989_35358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36760_38545_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39025_40153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40225_40981_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|41017_43711_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43742_44294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44401_45415_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45535_45760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46115_46877_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47019_47814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|47958_48711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49022_50549_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50687_51761_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|51800_53108_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53082_54252_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54306_55032_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55497_57603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|57817_58282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58301_58811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59195_60137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60418_61870_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773655.1|62336_62741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63301_64276_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|65010_65388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|65977_66952_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773242.1|66991_67546_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|67726_68626_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|68630_69257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|69201_71523_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|71669_72149_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|72145_73297_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|73431_73935_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|74028_75003_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|74992_76306_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|76346_77726_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|77732_79184_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|79209_79578_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378407.1|79596_80664_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|80696_81593_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|81589_82426_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|82561_83014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|83152_83899_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|83879_84443_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|84451_84967_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|85108_87187_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|87186_88137_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|89004_89403_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|89628_89958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|90574_91594_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	123076	241153	3195023	protease,tRNA,transposase	Staphylococcus_phage(12.5%)	106	NA	NA
WP_075278722.1|123076_123952_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|124392_124686_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|124686_124941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|124957_127450_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|127442_128126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|128125_129169_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|129168_130398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|130399_130729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|130725_131925_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|132037_132427_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|132426_133371_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|133490_134888_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|135213_135735_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|135858_136167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|136181_141404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|141794_143801_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|143931_146262_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|146437_147268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|147384_147780_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|147776_148310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|148306_148708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|149102_149423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|149432_150389_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|150898_151423_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|151523_152522_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|152610_153507_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|153580_154867_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|155326_156643_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|156756_156927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|156946_157921_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|158047_158308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|158575_158866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|161404_162445_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|162547_163519_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|163641_164490_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|164641_164929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|165239_165611_+	isochorismatase	NA	NA	NA	NA	NA
WP_155052673.1|166671_166896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|167033_167171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|167184_167397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242723.1|167393_167693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|167920_168745_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|168883_170017_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|170076_171486_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|171633_173214_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|173980_174976_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|174981_177048_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|177105_178056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|178250_178577_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|178799_180059_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|180318_181194_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|181232_182195_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|187889_188234_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|188330_189254_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|189753_190242_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|190344_191145_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|191155_192907_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|193796_194039_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|194042_194441_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|194672_195548_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|196266_196725_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|196906_197092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|197807_199622_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|200032_200701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|200710_202027_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|202186_203149_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|203229_203385_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|203398_203635_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|203827_205045_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|205022_205481_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|205508_206888_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|206924_207143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|207462_208758_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|208962_209154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|209352_210228_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|210415_211681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|211714_212590_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|212711_213170_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|213193_214114_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|214241_215024_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|215114_216614_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|216927_218811_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|219070_219733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|219799_220909_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|220920_221565_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|221583_222570_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|222654_223731_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|223932_224757_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|225059_226025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|226343_227396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|227454_228429_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|228764_229193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|229429_229912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|229967_231218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|231320_231539_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|232010_232865_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|232919_233390_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|233686_233923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|234069_234450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|234508_235384_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|236150_237062_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|237178_238027_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|238093_239104_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|239127_239451_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375571.1|239461_239863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|240133_241153_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	314956	357315	3195023	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|314956_315832_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|315912_316545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|316498_317944_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|317978_318398_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|319171_319540_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|319549_320089_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|320249_320681_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|320684_321383_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|321630_322137_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|322179_322548_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|322818_326895_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|326958_331167_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|331328_331703_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|331807_332281_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|332296_334408_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|334435_335626_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|335632_335944_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|336066_336705_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|336720_337338_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|337334_337631_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|337645_338470_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|338486_338762_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|338767_339100_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|339112_339847_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|339860_340274_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|340273_340474_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|340473_340731_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|340852_341221_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|341238_341550_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|341565_342108_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|342120_342426_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|342454_342847_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|342859_343393_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|343402_343756_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|343766_344267_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|344272_344455_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|344457_344892_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|344892_346215_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|346271_346385_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|346528_346885_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|346910_347300_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|347309_347930_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|347951_348929_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|348977_349376_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|349488_350736_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|350722_351379_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|351463_351742_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|351984_352212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|352344_353139_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|353447_354662_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|355059_355239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|355207_355861_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|356236_356485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|356574_357315_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	366738	421651	3195023	protease,tRNA,transposase	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_017376975.1|366738_367290_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_017376974.1|367300_368668_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376973.1|368818_369055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376972.1|369113_369857_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_027242667.1|369856_370498_+	lipoprotein	NA	NA	NA	NA	NA
WP_017376970.1|370497_372162_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_017376969.1|372190_372526_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_027242666.1|372690_374289_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376966.1|374348_374639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772765.1|374839_375271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|375333_377814_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|377900_378380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|378352_379393_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|379329_380046_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|380058_380394_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|380430_380901_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|380943_382779_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|382823_383912_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|383933_384995_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|385072_385588_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|385628_386906_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|386920_387772_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|387800_388448_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|388444_389404_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_048875861.1|389925_390795_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|390939_391194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|391338_391905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|392010_392451_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_051929598.1|392408_392666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242664.1|392962_394165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|394448_395423_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046563.1|395892_396030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|396046_396262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|396466_397078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|397074_397332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|397582_397975_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|398104_398653_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|398652_399480_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|399529_401215_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|401292_401754_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|401790_402354_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|402580_402910_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|402890_403115_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|403259_403850_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|403874_405146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|405163_406417_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|406413_407058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|407130_408180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|408281_409919_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|409953_410283_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|410439_410727_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376927.1|411153_411291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|411796_413017_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|413075_415874_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|416179_417346_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|417444_417981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|418042_418375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|418632_419535_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|419604_420102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|420247_421651_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	451088	499227	3195023	transposase	Staphylococcus_phage(100.0%)	42	NA	NA
WP_036774259.1|451088_452063_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420729.1|452410_453049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|453168_454572_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242658.1|455914_457378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856768.1|457453_458248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242656.1|458539_459358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|459375_459969_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376894.1|460185_460419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242655.1|460642_461539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420727.1|461843_462614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376891.1|462783_463686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|463682_464906_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_027242653.1|464923_465850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|465865_466906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242651.1|467020_467431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376888.1|467483_467987_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_017376887.1|467979_468726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376886.1|468728_469859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|469863_470103_+	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_027242650.1|472592_473081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|473083_474160_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_017376878.1|474152_474806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875870.1|474812_475238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|475274_478274_+	ATPase AAA	NA	NA	NA	NA	NA
WP_027242646.1|478335_479838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|480289_481909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|481950_484254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376870.1|484530_485427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|485429_488756_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_144420818.1|488957_489146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|489157_489634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|489676_489904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|490085_490619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|490649_490991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772347.1|490993_491410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876253.1|491571_492228_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036771639.1|492224_493199_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|493640_493904_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|494331_495306_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_087910671.1|495693_496158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910670.1|496251_496437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|498252_499227_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 6
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	504031	558714	3195023	transposase	Streptococcus_phage(22.22%)	52	NA	NA
WP_048875872.1|504031_505315_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|505487_505625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|505621_507025_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|507138_507576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|507696_508125_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|508372_508810_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|509241_510630_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|511076_512570_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|512764_513520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|514019_514250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|515354_516365_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|516361_516583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|517301_518243_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|518770_519169_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|519108_519963_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|520054_520336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|520421_521099_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|521144_522425_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|522600_523650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|523728_524529_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|524542_525337_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|525439_526459_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|526505_527117_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|527120_527807_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|527803_528346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|528638_529826_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|530070_530796_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|530981_531770_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|531766_532162_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|532554_533595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|533591_534995_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|537410_537668_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|537707_539093_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242633.1|539422_540520_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_017377120.1|540553_541804_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|541804_542437_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|542726_543179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|543224_544067_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|544101_544593_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|544788_546756_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|546983_547388_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|547365_548394_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|548380_549169_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|549595_550999_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377110.1|551200_552211_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_075275363.1|552223_552691_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377107.1|553020_554391_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_017377106.1|554693_555164_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377105.1|555441_555717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|555727_557131_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069971661.1|557305_557743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|557739_558714_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 7
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	590505	723899	3195023	plate,tRNA,transposase	Staphylococcus_phage(13.64%)	111	NA	NA
WP_036772726.1|590505_591054_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|591806_593186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|593545_595009_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|595192_596005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|596469_598464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|598858_600238_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|600275_600713_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|600755_601472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|603018_603549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|603615_605436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|606000_606507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|606591_607995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|608109_608364_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|608516_608789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|609364_609547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|609663_610239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046568.1|610247_610406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|611306_611549_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|611851_612943_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|612923_613877_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|614100_615585_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|615624_616128_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|616387_617563_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|617710_618115_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|618271_619147_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|619181_619535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|622864_623290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|623520_624657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|624643_625966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|625958_627077_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|627197_627731_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|627869_629507_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|629511_629733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|629841_630855_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|631126_633355_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_026063593.1|633335_634040_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|634274_634604_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|636004_636223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|636281_637157_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|637149_638016_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|638083_639403_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|639872_640433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|640751_641678_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|642573_643482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|647178_648018_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|648204_648420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|648468_649044_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|649040_649379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|649547_650537_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|651526_652429_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875883.1|652688_653225_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|653369_654287_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|654721_655732_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|656539_657076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|658288_658636_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|658780_659740_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|659841_660624_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|660756_661716_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|661740_662145_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|662173_662848_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|662947_664663_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|664659_665022_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|665036_666191_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|666194_667202_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|667204_668221_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|668436_669522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|669628_670021_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|670153_671437_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|671452_672754_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|672771_674574_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|674578_675571_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|675651_676728_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|676825_677800_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|677867_678839_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|679022_679292_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|679893_681180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|681244_681925_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155052676.1|687580_687868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375775.1|687906_688101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275355.1|688148_689123_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_027242570.1|689336_690476_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|690684_692055_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|692433_693426_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|693429_693945_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|693941_694781_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|694813_696364_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|696471_696843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|698063_698225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|698805_700209_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|700243_700681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|700704_701679_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|701737_702166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|702353_703160_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|703234_703627_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|703671_704493_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|704505_705489_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|705490_706759_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|706765_709270_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|709400_710426_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|710422_711133_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|711057_711888_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|712037_712421_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|712455_713355_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|713400_714072_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|714154_714730_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|714828_715629_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|715770_716628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|717490_718627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|718693_721864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|721876_722587_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|722591_723899_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	732541	778857	3195023	plate,transposase	Staphylococcus_phage(21.43%)	51	NA	NA
WP_017376356.1|732541_732940_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|732936_734625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|734606_735563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|735605_736121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|736225_737158_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|737377_737764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|737781_738426_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|738576_739416_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|739491_740094_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|740094_740949_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|741306_741618_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|741642_743031_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|743186_743918_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|743914_744442_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|744473_745031_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|745036_746017_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|746156_746957_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|746960_747728_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|747724_748189_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|748211_748865_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|748868_749216_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|749249_749501_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|749577_750846_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|750848_751607_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|751668_752559_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|752609_753293_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|753302_753650_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_027242846.1|753922_756043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|756034_756907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|757074_758904_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|759071_759713_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|760037_760484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|760501_760675_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|760733_761783_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|761789_762740_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|762794_763739_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|763766_764504_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|764592_764835_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|764909_766133_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|766164_767013_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|767009_768062_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|768198_768819_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|769044_770197_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|771217_772192_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|772188_772359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|773327_773924_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|773892_775053_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|775563_775905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|776008_777043_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|777039_777750_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|777882_778857_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 9
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	787017	841328	3195023	protease,tRNA,transposase	Prochlorococcus_phage(33.33%)	49	NA	NA
WP_017377942.1|787017_787524_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243058.1|787605_788022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|788113_788974_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|789071_789617_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|789699_790551_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|790592_793499_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|793559_793757_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|793763_794774_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|794770_795829_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|795843_796623_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|796625_797438_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|797449_798397_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|798407_799700_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|799878_800982_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|800978_801371_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|801383_802760_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|802753_804223_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|804416_804851_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|805146_805323_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|806357_807383_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_017377925.1|807884_808277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|809669_810320_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|811018_811813_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|811992_812637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|812811_813786_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|814186_814444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|816121_816799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|817032_817857_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|817950_818664_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|818753_819845_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|819916_820498_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|820503_821130_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|821226_822174_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|822520_823183_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|823353_824013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|824181_825441_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|825437_826523_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|826515_827397_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|827385_828636_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|830021_830342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|830600_830867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|831357_831576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|832561_832783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|832779_833862_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|833872_834244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|834240_834420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|837123_837399_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|838234_839692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|840119_841328_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	885008	947542	3195023	tRNA,transposase	Staphylococcus_phage(28.57%)	53	NA	NA
WP_048875904.1|885008_885884_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|886140_886578_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|886638_887271_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|887286_887934_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|887936_890000_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|890326_891619_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|892007_894218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|894234_894891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|897276_898152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|898410_899022_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|899449_902038_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|902140_902902_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|902898_903435_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|903483_904440_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|904517_907703_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|907706_908762_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|908991_909594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|909637_910300_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|910334_910682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375702.1|911150_912182_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|912644_914048_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|915166_915511_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|915602_916058_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|916306_916441_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|916433_917075_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|917071_917788_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|917791_919111_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155051395.1|919792_919936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773644.1|920915_923552_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_036773645.1|923593_924679_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|924678_925362_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_017377748.1|925422_927084_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377747.1|927236_927491_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|927569_927887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|928039_928438_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|928519_929158_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|929314_930289_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|930661_930937_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|931486_931771_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|933587_934181_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|935282_936164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|936275_937955_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|938081_939332_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|939407_939869_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|939865_941014_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|941019_941694_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|941690_942347_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|942472_942946_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|942947_943370_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|943356_944376_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|944535_944715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|944933_945215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|946666_947542_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	951444	1018407	3195023	protease,tRNA,transposase	Bacillus_phage(20.0%)	56	NA	NA
WP_048876012.1|951444_952848_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|953206_953974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|954087_955491_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|955487_955649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|955964_956939_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|957179_958463_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|958529_959453_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|961648_963793_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|963814_964021_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|964081_964702_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|964742_965636_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|965721_966447_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|966508_966913_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|967075_969184_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|969307_970357_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|970353_971820_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|971962_973300_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|973367_974858_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|975086_975458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|975608_976436_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|976738_977395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|977342_978266_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|978279_979203_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027243109.1|979477_980134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|981833_982061_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376989.1|982385_982934_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|983014_983290_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|983289_984339_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|984451_986389_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|986536_988249_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|988317_989037_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|989033_989636_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|989750_990638_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|990828_991176_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|991226_992066_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|992161_992908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|993104_993731_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|994046_994616_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|994759_995458_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|996164_996788_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|996897_997791_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|997897_999508_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|999504_1000800_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|1000821_1002744_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|1002854_1003157_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|1003251_1008138_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1008185_1009508_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1009632_1010727_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1010778_1011717_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1011797_1012382_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1012766_1013657_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1013859_1014351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1014490_1014982_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1015150_1015864_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065653747.1|1015926_1017267_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1017531_1018407_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	1024020	1086547	3195023	transposase	Staphylococcus_phage(33.33%)	57	NA	NA
WP_017377787.1|1024020_1024248_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1024274_1025315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1025381_1025951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1026181_1026586_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1026598_1026739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1026833_1028033_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1028053_1028665_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1028866_1029628_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1029923_1030850_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1031010_1031967_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1032111_1032381_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1032647_1033622_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1033775_1034003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1034119_1034545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1034701_1035631_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1036077_1036608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|1036929_1037235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1037712_1038024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1038363_1039530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1041717_1042689_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1043291_1043465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1043860_1044778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1044778_1045630_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1046070_1047117_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1047106_1049098_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1049207_1049582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1049835_1050018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1050279_1050981_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027242868.1|1050981_1051449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376293.1|1053087_1055838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1056073_1057366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1057852_1058758_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376296.1|1059535_1060252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1060537_1061299_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1061331_1062735_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1062731_1062896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1062955_1063243_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1063987_1064716_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1064684_1065431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420708.1|1065511_1065901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1065897_1066872_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1067028_1067346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772457.1|1069821_1070130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1070205_1070478_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1073011_1073449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1074050_1075238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1075508_1077143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1077193_1077922_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1079349_1080312_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1080535_1081531_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1081558_1082494_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1082537_1082999_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1082977_1083595_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1083624_1084599_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1084653_1085121_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1085133_1085778_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1085818_1086547_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 13
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	1095247	1144815	3195023	transposase	Acinetobacter_phage(22.22%)	39	NA	NA
WP_082300708.1|1095247_1095808_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1097132_1097528_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1097536_1097893_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1097885_1098761_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1098846_1099425_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1099382_1099676_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1100636_1102148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1102395_1103799_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1104004_1104439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1104521_1105226_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1105484_1105973_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1106001_1106676_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1106916_1107792_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275340.1|1108322_1108931_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1109201_1109660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1109938_1110328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1110513_1111329_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1111551_1112457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1112620_1113382_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1113385_1114252_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1114337_1114949_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1115327_1116575_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1116726_1117428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1117725_1117899_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1118388_1118889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1119967_1120195_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420705.1|1120280_1120481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1120509_1121190_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1121212_1123387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1123632_1124703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1124699_1126103_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619408.1|1126251_1126737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1126808_1127630_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1128296_1129796_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1130099_1132793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1132789_1136191_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_048875961.1|1137778_1139182_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1140260_1140932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1143840_1144815_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 14
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	1169538	1225932	3195023	tRNA,transposase	Staphylococcus_phage(37.5%)	52	NA	NA
WP_053093677.1|1169538_1170258_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1170485_1170662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1170910_1171234_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1171322_1173341_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1173363_1174317_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1174482_1175670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1176383_1177022_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1177319_1178315_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_027242772.1|1178455_1179502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1179494_1180520_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1180586_1182617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1183923_1184151_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1185494_1185638_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1185634_1186327_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876033.1|1186596_1186911_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_027242770.1|1187053_1187464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1187620_1187947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1188093_1189131_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1189172_1189418_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_027242766.1|1189398_1189857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1189864_1191439_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1191593_1192163_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1192472_1194275_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1194271_1195213_+	signal peptidase I	NA	NA	NA	NA	NA
WP_036771308.1|1195240_1195462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242761.1|1195624_1196299_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1196304_1197204_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1197217_1197961_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1197963_1198695_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1198691_1199075_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1199212_1200460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1200870_1202016_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1202008_1202362_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1202642_1203185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1203829_1204018_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1204037_1205012_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1205055_1205931_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1206284_1207112_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1207211_1207373_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1208023_1209364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1210415_1210643_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|1210784_1212146_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1212241_1212901_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144420701.1|1213741_1214098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1214694_1216254_-	APC family permease	NA	NA	NA	NA	NA
WP_027243001.1|1216614_1218585_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375893.1|1218782_1219853_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1219910_1220117_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1220123_1221599_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1221734_1222298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1222467_1223871_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1224837_1225932_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	1242174	1289899	3195023	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_036772169.1|1242174_1243050_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1243119_1244223_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1244290_1244614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1244770_1245553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1245688_1246666_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1246739_1248731_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1248786_1249068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1249321_1250521_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_051929862.1|1252952_1253465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1253651_1254527_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1254563_1254728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1255936_1256350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1256360_1256696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1256840_1257959_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1258188_1258455_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1259737_1259965_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1259975_1260482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1260559_1261177_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1261308_1262541_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1262530_1263193_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1263467_1264724_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1264861_1265521_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1265595_1266297_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1267044_1268019_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1269227_1269581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1269794_1269989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1270056_1270569_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1270706_1271561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1271609_1272254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1272287_1272932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243125.1|1273454_1273748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1273846_1274629_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1274711_1275662_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1277704_1280545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1280567_1281149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1281268_1281997_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1282142_1283117_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1283232_1284138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1284736_1285483_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1285735_1286128_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1286165_1286813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1288528_1289899_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	1313718	1354928	3195023	transposase	Enterobacteria_phage(16.67%)	37	NA	NA
WP_048876023.1|1313718_1314822_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1314912_1316065_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1316478_1317330_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|1317467_1317617_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1318241_1320608_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1320655_1321852_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1322420_1324853_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1325174_1326674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1326782_1327355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1327669_1329139_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1329211_1329961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1329964_1330738_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1330836_1331787_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1331926_1333369_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1333584_1334769_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1334892_1335579_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1335714_1336299_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1336388_1336718_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1337053_1337293_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_017377970.1|1337341_1337533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1338307_1338601_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1338749_1338911_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1339425_1339965_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1340303_1340948_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1341281_1341932_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1342455_1343508_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1343525_1346606_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1346771_1347020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1347085_1347961_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1348883_1349390_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1349407_1349605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1349623_1349767_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1349834_1350008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1350212_1351526_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1351535_1351799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1351857_1352832_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1354700_1354928_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 17
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	1386145	1439879	3195023	tRNA,transposase	Bacillus_thuringiensis_phage(25.0%)	45	NA	NA
WP_036772026.1|1386145_1387021_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1387125_1390428_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1390424_1392248_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1392287_1392686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1392794_1393811_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1394245_1395700_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1395781_1398838_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081329473.1|1400228_1400648_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376676.1|1401020_1401485_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1401557_1402559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1405451_1405784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1406145_1406289_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1406276_1407221_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420692.1|1407224_1407614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1407432_1407771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1408145_1408745_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1408744_1409092_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1409242_1410226_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1411135_1411450_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1411598_1411757_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1411728_1412658_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1413572_1413989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1415117_1415834_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1416582_1416741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1416789_1417365_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1417509_1417788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1417852_1418728_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1418893_1422760_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1422915_1423725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1423774_1424596_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1424795_1426028_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1426198_1426924_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1426966_1428505_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1428511_1429897_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1430210_1431260_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1431819_1432197_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|1432388_1433264_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1434245_1434473_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1434525_1435044_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_146619432.1|1435299_1435491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420793.1|1435899_1436673_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243181.1|1436786_1437758_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376772.1|1437739_1438711_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420687.1|1439146_1439332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1439342_1439879_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	1458814	1508233	3195023	transposase	Staphylococcus_phage(23.08%)	45	NA	NA
WP_051929845.1|1458814_1459639_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1460042_1461017_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1461202_1461796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1461976_1462441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1462835_1463117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1463113_1464517_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1465168_1465549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1465788_1466445_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1466589_1466886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1466945_1467233_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036772296.1|1468422_1468800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1468999_1470049_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1470025_1471843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1472113_1472692_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1472719_1473184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1473220_1474678_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1474739_1476227_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1476996_1477599_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1478160_1478631_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1480278_1481022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1481173_1481605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1484242_1485589_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1485676_1487482_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1487947_1488745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1489129_1489591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1489813_1490788_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1490830_1490953_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1491024_1492980_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1493369_1493555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1493876_1494866_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1495278_1496904_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1497012_1497327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1497622_1499008_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1499172_1499400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1499540_1499999_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1500199_1500385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1500453_1501281_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1501735_1502260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376824.1|1502532_1502691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1502860_1503814_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1504008_1504983_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1505110_1506136_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1506788_1507076_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1507135_1507468_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1507672_1508233_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
>prophage 19
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	1516954	1576525	3195023	integrase,protease,tRNA,transposase	Staphylococcus_phage(25.0%)	57	1505805:1505864	1576230:1576840
1505805:1505864	attL	CCACCACGTGTCACTGATAAGTGGACGTGCGTATTCCAATTTAAACTCTGGCCGAAAGTA	NA	NA	NA	NA
WP_017376809.1|1516954_1518724_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_017376808.1|1518862_1519906_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376807.1|1519919_1520663_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_062312151.1|1520760_1521093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1521154_1521334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243094.1|1521396_1522104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420791.1|1522887_1524099_+	protein kinase	NA	NA	NA	NA	NA
WP_017376801.1|1524154_1524979_-	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_017376798.1|1526166_1526802_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017376797.1|1527083_1527443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1527716_1530002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420683.1|1529990_1530647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|1530823_1531456_+	MarC family protein	NA	NA	NA	NA	NA
WP_027243097.1|1531491_1531677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243098.1|1531742_1532888_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243099.1|1533123_1534437_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_155046588.1|1535552_1535762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420682.1|1536296_1536458_-	phosphatase	NA	NA	NA	NA	NA
WP_017376785.1|1537864_1538770_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027242578.1|1539232_1539769_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_027242577.1|1539786_1541088_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_048876008.1|1541084_1542059_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_144420681.1|1542102_1542288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1542467_1542632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1542633_1543509_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1543824_1544745_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1544760_1545144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1545470_1546427_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_144420678.1|1546694_1546973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243017.1|1547471_1548815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|1548988_1549132_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1549211_1550186_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1550333_1552205_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1552237_1552336_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1552571_1553201_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1553184_1553607_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1553613_1555353_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1555353_1556418_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1556421_1556775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1556887_1557856_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1557865_1558177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1558192_1558762_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1559025_1560354_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1560394_1561369_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1561955_1562357_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146619459.1|1562876_1565333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1565535_1566387_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1566432_1568139_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1569610_1570585_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1570947_1571193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1571556_1572585_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1572715_1572919_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420676.1|1573203_1574160_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_047927838.1|1574452_1574698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1574694_1574994_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1575216_1575687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1576297_1576525_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
1576230:1576840	attR	TACTTTCGGCCAGAGTTTAAATTGGAATACGCACGTCCACTTATCAGTGACACGTGGTGGTGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGATAGGTTAGCATTGGCTGTATGCAACCGATCATGATTGTAATATCGAATATAGGCCTCAACATCCTCCTTCATAGTATCACGGGTTAAGTGAATCACATTCAACAGCCATTCGTGCTTTAGGCTGCCAAAAAAACGCTCGACAACCGCATTGTCAACGCAAGCACCGACACTGCTCATAGAAGCGGTGATTTTATGCTTCTTCAACAGTTTTCGATATTTTTTACTGGTATACTGCGAACCACGATCACTGTGAAATAACAAGTGTTCTGTCGGCTGCCGCAAGTGAATCGCCATATCCATTGCACGACAAACTAGATTTTCGCTCATTCTCTTATTCATCGCCCAGCCAATCACTTTTCGAGAGTATAAATCAATAACGACCGCAAGATACAACCAGCCTTCAGCAGTTCTAAGGTAGGTAATGTCACCTGCCCATGAGTGATTTGCAATGACTGGATTAAACTGCTGATTCAATACGTTATCTGCAACAGC	NA	NA	NA	NA
>prophage 20
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	1581977	1624908	3195023	transposase	Staphylococcus_phage(20.0%)	41	NA	NA
WP_053856766.1|1581977_1583381_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1583568_1584426_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1584550_1585186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1585234_1585486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1585741_1586641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1586777_1587851_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1587951_1588365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1588385_1589099_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1589286_1590699_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1590908_1591877_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1592610_1592979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1592982_1593300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1593375_1594350_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1594869_1595370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1595440_1596769_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1596904_1598293_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1598440_1599751_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1600091_1601375_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1601448_1602069_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1602267_1602528_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1602730_1602877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1602852_1603446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1605309_1605528_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1606780_1607551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1607637_1607853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1607949_1609071_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1609337_1610312_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1610574_1611696_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1611988_1612276_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1612248_1612752_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1612832_1613492_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1613833_1614751_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1614880_1615054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1615719_1617078_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_017376486.1|1617152_1617716_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376485.1|1617910_1619140_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1619185_1619812_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1619961_1621149_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1621157_1621850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1621971_1623124_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1623924_1624908_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 21
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	1683243	1773558	3195023	protease,tRNA,transposase	Burkholderia_phage(14.29%)	82	NA	NA
WP_036774017.1|1683243_1684119_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1684508_1684847_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1684843_1685440_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1685442_1687437_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1687500_1688439_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1688787_1689762_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1689965_1690163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1690324_1690729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1692312_1692753_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1693079_1693955_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1693967_1694210_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1694616_1694871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1696082_1697048_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1697140_1697452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1697652_1698429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1699258_1699450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1700178_1701228_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1701398_1702172_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1702232_1703822_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1704012_1705104_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1705126_1705444_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1705530_1706808_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1706829_1707666_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1707672_1709307_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1709738_1710098_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1710379_1711738_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1711763_1712006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1712499_1712679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1712934_1714191_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1714304_1714562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1714706_1715717_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1716093_1716948_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1716977_1717811_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036773204.1|1718387_1719161_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1719242_1719563_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1719781_1720687_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1720772_1721171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1721315_1721813_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242786.1|1723485_1724577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1724675_1725053_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1725132_1726107_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1727651_1728371_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1728454_1728742_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1729026_1729899_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1729855_1730632_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1730836_1731172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1731570_1731927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1732088_1732364_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1732473_1732821_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1732838_1733618_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1733617_1734127_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1734162_1734411_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1734722_1735058_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1735357_1736608_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1736689_1738717_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1739262_1739481_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1739652_1740015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1740163_1741567_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1741848_1743024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1743041_1745039_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1745019_1746000_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1746055_1746898_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_027242816.1|1746897_1747302_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1747294_1747714_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1747736_1748366_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1748934_1751124_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1751135_1752341_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1752325_1754173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1754157_1755396_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1755382_1757251_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1757284_1758538_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1758543_1759401_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1759419_1760148_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1761286_1762078_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1762443_1762731_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|1764853_1765243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1765419_1766178_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1766174_1768574_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1768587_1769865_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1769954_1771253_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1771450_1772344_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1772343_1773558_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 22
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	1784257	1834742	3195023	tRNA,transposase	Vibrio_phage(14.29%)	46	NA	NA
WP_069971651.1|1784257_1785133_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1785505_1785769_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1786075_1788670_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1788666_1789149_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1789126_1790167_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1790341_1790827_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1790934_1793505_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1793538_1794000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1794336_1795212_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1795489_1797250_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1797343_1798009_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1798021_1799527_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1799548_1800079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1800152_1801415_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1801601_1802474_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1802575_1803364_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1803456_1804782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1805135_1806311_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1806479_1807133_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1807288_1809229_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1809225_1809849_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1810013_1810988_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1811259_1811880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1811876_1813280_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1813347_1813764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1814171_1814669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1814665_1815640_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|1815719_1816289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1816433_1816970_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1816974_1817271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1817279_1817885_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1818070_1818469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1818659_1818863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1819007_1819163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1819287_1819740_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1819856_1821329_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1821767_1822232_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1822920_1824171_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1824280_1824751_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1824773_1825367_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1825504_1826554_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1826577_1827501_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1827517_1827979_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1828086_1828905_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1829514_1829658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1833821_1834742_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 23
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	1897041	1912357	3195023	transposase	Staphylococcus_phage(50.0%)	16	NA	NA
WP_017378288.1|1897041_1897263_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1897321_1898296_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1898494_1898659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1898655_1899291_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046602.1|1899567_1900347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1900379_1901141_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1901117_1902107_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1902242_1903118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1903136_1903796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378292.1|1903825_1904032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1904037_1904484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1904480_1905884_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1905997_1906843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1906987_1908637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1908727_1909513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|1910953_1912357_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	1941030	1982787	3195023	tRNA,transposase	uncultured_Mediterranean_phage(40.0%)	39	NA	NA
WP_144420657.1|1941030_1942092_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1942803_1942965_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1943881_1944421_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1944803_1945220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1945315_1946131_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1946263_1947757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1947942_1948368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1948364_1950425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1950708_1951524_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1951624_1952443_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1952439_1952808_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1952989_1953817_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1953880_1954609_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1955011_1955740_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1956129_1956855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1956889_1960762_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1960962_1962096_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1962109_1962298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1962521_1963880_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_036773947.1|1965486_1966362_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1966873_1967509_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999981.1|1967521_1967995_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_155046603.1|1967922_1968075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929627.1|1968268_1968619_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1968678_1968966_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1969018_1969798_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376416.1|1969917_1970088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376415.1|1970222_1971140_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1971191_1971947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1972014_1973289_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376412.1|1973409_1974087_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376411.1|1974287_1975712_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_016209938.1|1975686_1976325_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376410.1|1976687_1976966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376409.1|1977199_1978144_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376408.1|1978165_1980034_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376407.1|1980054_1980408_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_026063528.1|1980446_1981562_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1981746_1982787_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
>prophage 25
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	1987130	2043200	3195023	tRNA,transposase	Klosneuvirus(22.22%)	49	NA	NA
WP_017376399.1|1987130_1989902_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376398.1|1990058_1991291_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1991532_1992195_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376397.1|1992654_1994136_+	MFS transporter	NA	NA	NA	NA	NA
WP_036773116.1|1994333_1995308_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|1995831_1998558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|1999445_2000420_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|2000670_2001375_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|2002614_2003133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|2004100_2005585_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2005709_2007245_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2007267_2007597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2007493_2007709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2009692_2010892_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2011101_2011962_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2012077_2012656_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2012812_2013454_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2013492_2013714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2013706_2014690_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2015083_2015581_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2015725_2016001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2016152_2017835_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2017842_2018865_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2019033_2020035_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2020148_2020487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2020962_2022222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2022430_2022658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2022686_2022905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2023042_2023408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2023475_2023718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2023732_2024068_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2024072_2024510_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_036772812.1|2024535_2025921_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2026031_2026463_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2026568_2028080_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2028370_2029963_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2030163_2032359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772819.1|2032452_2033886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2033928_2034444_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2034443_2035391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2035374_2036040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2036036_2036765_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2036754_2037501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2037484_2038549_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2038753_2039941_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2039997_2041116_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2041563_2041821_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2042100_2042778_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2042996_2043200_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	2062900	2112435	3195023	protease,tRNA,transposase	Burkholderia_virus(20.0%)	41	NA	NA
WP_017377787.1|2062900_2063128_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2063217_2063973_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2064386_2064983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2065062_2067867_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2067847_2068801_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2068793_2070164_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2070334_2071738_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2072509_2072836_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420651.1|2073040_2073694_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_017376600.1|2074013_2074193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2074448_2075705_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2075943_2076090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2076172_2076529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2077024_2077384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2077393_2077777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2078665_2078806_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2078950_2079871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2082028_2082559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2082569_2083625_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2083640_2085680_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2085666_2086497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2086563_2090103_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2090216_2090936_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2091174_2091804_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2091923_2093327_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2093472_2095416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2095933_2096794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2097229_2098975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|2099377_2100850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2101032_2101632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2101769_2101967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2102167_2102308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2102375_2103155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2103719_2104121_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2104265_2104643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2105102_2106410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2107158_2107416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2107467_2108871_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2109111_2110821_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2110990_2111353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|2111460_2112435_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 27
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	2127004	2253842	3195023	protease,tRNA,transposase	Staphylococcus_phage(14.81%)	116	NA	NA
WP_017377892.1|2127004_2128426_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_026063687.1|2128515_2130114_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377894.1|2130270_2130897_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027242839.1|2130977_2133650_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377896.1|2134132_2135089_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_017377897.1|2135141_2135561_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_048875958.1|2135587_2136451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377899.1|2136440_2137232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2137536_2138508_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2138856_2139165_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2139161_2139818_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2139951_2140437_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2140514_2141036_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2141081_2141975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2141971_2142793_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2142987_2143137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2143364_2144195_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046606.1|2145600_2145771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2145923_2147327_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_144420645.1|2147436_2148693_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2148664_2149396_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2149407_2150685_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2150784_2151159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2151243_2152131_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2152188_2152917_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2152913_2154023_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2154174_2154603_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2154697_2155054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2155046_2156258_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2156254_2157043_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2157205_2158000_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2158449_2159190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2159193_2161692_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2161954_2162911_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2162894_2163656_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2163863_2164838_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2164946_2165702_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2165826_2166072_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2166131_2168405_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2168459_2168762_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2169002_2169296_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2169466_2169646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2169721_2170333_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2170579_2171896_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2171906_2172275_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2172305_2172968_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2173390_2173969_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2173948_2174356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2174479_2174776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2174822_2175698_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876123.1|2175767_2177948_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_017376060.1|2178051_2179401_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_036772012.1|2179474_2180164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2180296_2181484_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376055.1|2182002_2182647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2182643_2183957_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2184161_2184335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2184604_2185078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2185222_2185417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2185681_2186557_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210558.1|2186743_2187499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376051.1|2187572_2189225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376050.1|2189264_2190803_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_087910638.1|2190802_2192503_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_075275404.1|2192591_2193767_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_017376046.1|2193805_2194768_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_017376045.1|2195045_2195468_-	universal stress protein	NA	NA	NA	NA	NA
WP_017376044.1|2195773_2196415_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376043.1|2196543_2197878_+	dihydroorotase	NA	NA	NA	NA	NA
WP_048875952.1|2197992_2198628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771517.1|2199372_2200509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771498.1|2200692_2202423_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_017376037.1|2202412_2203621_+	MFS transporter	NA	NA	NA	NA	NA
WP_075275290.1|2203719_2204721_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420641.1|2204964_2205600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2205619_2206594_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875951.1|2206637_2207474_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2207619_2208039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2208315_2208996_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2208961_2209312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2209344_2210556_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2210896_2211526_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2211574_2212591_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2212837_2213053_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2213105_2213555_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2213634_2215380_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2215471_2217343_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2217787_2218504_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2219941_2220811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2220767_2220995_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2221963_2222878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2222923_2223946_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2224014_2225064_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155052687.1|2225692_2225863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243219.1|2226147_2226456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2226622_2228026_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046608.1|2228118_2228283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2228604_2228829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2228839_2230051_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036774710.1|2230445_2231345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|2231518_2231920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2232166_2233210_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2233329_2233566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2234354_2235908_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2238088_2238316_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2239186_2240161_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017375736.1|2240887_2241970_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_017375735.1|2242012_2242663_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375734.1|2242885_2243257_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_027243178.1|2243367_2244729_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155046609.1|2246449_2246656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2246966_2248049_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2248045_2248357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2249402_2250377_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2251383_2252163_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2252624_2253842_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	2266691	2327659	3195023	integrase,transposase	Staphylococcus_phage(30.0%)	47	2274544:2274603	2324965:2325725
WP_144420638.1|2266691_2267774_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2267770_2268082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2269579_2270515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2271107_2272253_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2274495_2275659_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2274544:2274603	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|2275687_2275912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2277259_2278435_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2278780_2281291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2281349_2282162_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275283.1|2282602_2283214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2283356_2284331_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2284435_2285767_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2285965_2286034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2286165_2287608_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2287999_2289412_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2290101_2290548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2291142_2291991_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2292244_2293303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2293294_2295001_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2295072_2296806_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2297102_2297669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2297793_2298447_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2298473_2299934_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2300030_2301008_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2301477_2302881_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2303406_2303700_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2303926_2304691_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2304898_2305126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2305189_2305372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2305934_2306114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376902.1|2306177_2306489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2307343_2308048_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2308245_2308386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2308790_2309315_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|2309461_2310718_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2310785_2311265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2311705_2313109_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243186.1|2313523_2315905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2316411_2318304_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2318475_2319450_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2319753_2320560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2320628_2321240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2322721_2323018_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2323014_2323857_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2324247_2325033_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2325037_2326441_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2324965:2325725	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2326714_2327659_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	2348501	2376154	3195023	protease,transposase	Staphylococcus_phage(25.0%)	28	NA	NA
WP_017377305.1|2348501_2349803_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2349884_2350490_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2350602_2351907_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2352507_2353383_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2353498_2354170_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2354349_2355705_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2355825_2356563_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2356641_2357358_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2358006_2359281_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2359311_2359887_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2359931_2360897_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2361360_2362269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|2362656_2362908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2363052_2363481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2363466_2364411_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2364615_2364768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2364796_2365531_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2365625_2365886_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2366104_2367070_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|2367046_2367343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2367533_2367983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2368242_2368671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2368766_2369267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2369203_2369365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2370245_2370467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2371965_2372643_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2373957_2374296_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2375179_2376154_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 30
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	2415399	2542863	3195023	tRNA,transposase	Burkholderia_virus(25.0%)	106	NA	NA
WP_080999971.1|2415399_2416803_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2416916_2417492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2418737_2418965_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2419254_2419794_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2420103_2421591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2421642_2422068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2422286_2423690_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2423686_2424064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2424023_2424569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2424964_2426191_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2426791_2428444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2428380_2428575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963645.1|2428907_2430098_-	MFS transporter	NA	NA	NA	NA	NA
WP_027243147.1|2430346_2433019_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2433307_2434144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2434804_2435695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2436163_2437138_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876012.1|2437622_2439026_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2439171_2440575_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|2440659_2442474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2444385_2445789_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2445822_2447352_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2447387_2448848_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_027242908.1|2448822_2449782_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376200.1|2449859_2453366_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_017376201.1|2453389_2453959_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_027242907.1|2454172_2455327_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376204.1|2455345_2456119_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|2456118_2456565_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376206.1|2456582_2457632_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_017376207.1|2457742_2458276_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_036771893.1|2458356_2460774_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_027242906.1|2461058_2462126_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_017376209.1|2464328_2465393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376210.1|2465382_2466411_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376211.1|2466407_2466947_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376212.1|2467483_2469394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242905.1|2469441_2469630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420622.1|2469838_2471416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|2471512_2472388_-	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_080963646.1|2472476_2473376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063514.1|2473290_2474037_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_017376216.1|2474044_2474602_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_017376217.1|2474605_2475343_-	UMP kinase	NA	NA	NA	NA	NA
WP_017376218.1|2475346_2476225_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376219.1|2476389_2477157_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376220.1|2477563_2478373_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376221.1|2478450_2481108_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|2481111_2482149_+	asparaginase	NA	NA	NA	NA	NA
WP_017376223.1|2482150_2482972_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376224.1|2483102_2483987_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_036773116.1|2484299_2485274_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2485326_2486322_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2486364_2487339_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376319.1|2487963_2488644_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017376318.1|2488643_2489453_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027242903.1|2489526_2493207_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_026063524.1|2493216_2494704_-	ribonuclease G	NA	NA	NA	NA	NA
WP_017376313.1|2494713_2495331_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_017376312.1|2495400_2495919_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376311.1|2495915_2496815_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2496830_2497874_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376309.1|2498071_2498359_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2498479_2499940_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2500019_2501456_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2501580_2502555_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2504745_2505507_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2506664_2506892_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2507845_2508058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2508075_2508393_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2508419_2509109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2509449_2509653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2509784_2510720_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2510732_2511515_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2511644_2511956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2512299_2512626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2512650_2513106_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2513095_2514148_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2514150_2515614_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2515748_2515976_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2517392_2517857_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2518113_2518929_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2519057_2521370_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2521486_2522014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2522705_2523983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2523993_2524245_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2524278_2524800_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2524969_2525956_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2526046_2526862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2527290_2527686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2527658_2527886_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_047927746.1|2528854_2529442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2530044_2530716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875918.1|2530860_2531442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420767.1|2531484_2532162_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243185.1|2532440_2533397_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_017377736.1|2533456_2534122_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017377737.1|2534155_2534701_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_155046615.1|2534980_2535142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774946.1|2535838_2536453_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_144420620.1|2536379_2537582_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875923.1|2537567_2538563_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2538566_2538971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2539938_2540166_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2541134_2541731_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046616.1|2541699_2542863_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
>prophage 31
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	2552584	2603998	3195023	tRNA,transposase	Bacillus_phage(20.0%)	55	NA	NA
WP_048876031.1|2552584_2553988_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|2554093_2554318_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2554500_2555322_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|2555467_2555722_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377841.1|2556110_2557895_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|2557983_2558703_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2558864_2559071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2559070_2559307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2559319_2559673_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2560210_2561044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2561136_2561334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2561431_2562817_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2562943_2563534_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2564565_2564853_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2564912_2565077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2565073_2566444_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2566810_2568223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2568292_2569063_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2569555_2569843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2571319_2571613_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2571570_2572392_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2572536_2572761_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155046618.1|2573015_2573543_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|2573719_2573980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2573898_2574054_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2574152_2575127_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2576455_2576605_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2576721_2577015_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2577823_2578399_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2578476_2579352_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2579416_2580037_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2580021_2581104_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2581337_2581742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2583232_2584534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2584680_2585349_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2586281_2586845_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2586901_2588098_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_017376587.1|2588222_2589587_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376586.1|2589583_2590675_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376585.1|2590929_2591580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2591772_2591967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2592074_2592227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376583.1|2592493_2593621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063543.1|2593710_2594544_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376581.1|2594547_2595198_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_017376580.1|2595187_2596027_-	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_016210074.1|2596032_2596659_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376579.1|2596819_2597362_+	septation protein A	NA	NA	NA	NA	NA
WP_017376578.1|2597445_2597748_+	YciI family protein	NA	NA	NA	NA	NA
WP_144420763.1|2597765_2598008_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376576.1|2598106_2598379_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376575.1|2598417_2599056_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376574.1|2599088_2600180_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376573.1|2600351_2602094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2603023_2603998_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 32
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	2613291	2731752	3195023	tRNA,transposase	Staphylococcus_phage(29.63%)	107	NA	NA
WP_080999966.1|2613291_2614641_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2614938_2615496_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2615589_2616096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2616600_2617296_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|2617426_2618215_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2618248_2619652_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2620075_2621050_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2621306_2621534_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2622621_2623152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2623148_2624681_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2624677_2625628_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2626048_2626681_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2626923_2627121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2627470_2627899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2627976_2628972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2629116_2629368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2629472_2630117_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2630352_2630850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2631361_2632336_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2632706_2633000_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2633812_2634148_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2634468_2636007_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2636159_2637258_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2637496_2638696_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2638726_2639353_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2639381_2640266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2640399_2640630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2640767_2642009_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_144420613.1|2642288_2642660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2644791_2644953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2645328_2646456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2646572_2647235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2647320_2647581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2647999_2648761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2650822_2651482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2651582_2652233_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2652380_2653070_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377795.1|2653092_2654256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2654460_2654712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046691.1|2655235_2655832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2656031_2657006_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376009.1|2658360_2658651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376008.1|2658973_2660011_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376007.1|2660041_2661496_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376006.1|2661505_2662690_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376005.1|2662763_2663771_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376004.1|2663839_2665843_-	transketolase	NA	NA	NA	NA	NA
WP_017376003.1|2666294_2667455_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376001.1|2667691_2668807_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376000.1|2668969_2669494_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017375999.1|2669493_2670024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2671683_2672559_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2672679_2673180_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2673176_2673443_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2673608_2674583_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2674762_2675383_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2675689_2677093_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771922.1|2677927_2679118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|2679684_2680152_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|2680653_2680908_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|2681109_2681613_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|2681829_2682435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2682595_2683279_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2683354_2684134_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|2684120_2684981_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|2685104_2685470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377271.1|2685855_2686185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2686595_2687570_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_144420611.1|2688104_2688305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155052690.1|2688337_2689669_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	2.4e-36
WP_017377275.1|2690751_2691474_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2691465_2691834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2692096_2693398_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2693493_2693937_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2693940_2694450_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2694442_2697256_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2697752_2698685_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2698789_2699716_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2699894_2701433_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2701606_2701867_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2703141_2703750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2703796_2704525_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2704771_2704909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377696.1|2706071_2706611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2706845_2707757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2708016_2708313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2708657_2709811_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2710407_2710956_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2711059_2711623_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2711840_2712599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2713874_2714102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2714324_2714504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2714759_2716016_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2716083_2716728_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_017378393.1|2717532_2717739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816949.1|2718739_2719138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378390.1|2719331_2720909_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378389.1|2721042_2721984_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378388.1|2721985_2722759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963621.1|2724367_2724574_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2724840_2725128_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378384.1|2725133_2727515_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|2727527_2728523_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_016210495.1|2728654_2729014_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378382.1|2729056_2729251_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|2729285_2729816_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378381.1|2729820_2731752_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
>prophage 33
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	2769530	2822559	3195023	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2769530_2770505_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2770661_2772236_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2772460_2772739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2772808_2773684_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2773693_2774854_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2774968_2776117_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2776127_2778929_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2779035_2779734_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2779746_2781510_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2781513_2781861_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2781854_2782229_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2783176_2784460_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2784869_2786165_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2786520_2787066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242732.1|2787653_2788175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2788186_2789566_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2789801_2790236_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2790232_2791585_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2791584_2792700_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2792700_2793717_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2793706_2795377_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2795396_2795732_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2795759_2797199_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2797195_2798242_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2798384_2799881_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2800176_2801178_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2801283_2801895_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2802015_2802393_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2802443_2803850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2803843_2804911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2805017_2806619_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2806867_2807785_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2807853_2809548_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2809782_2810712_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2810742_2812146_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2812376_2813081_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2813147_2813804_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2813814_2814696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2814866_2817536_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2817896_2818871_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2818950_2819922_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2819975_2820950_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2821069_2821291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2821354_2821663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2821587_2822559_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	2837125	2891386	3195023	transposase	Staphylococcus_phage(37.5%)	51	NA	NA
WP_026063658.1|2837125_2837854_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2838163_2838418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2839131_2841786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2841824_2842115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2842231_2843530_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2844100_2844589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2844569_2844872_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2845118_2845607_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2845640_2846279_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2846400_2846940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2847029_2848256_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2848868_2849126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2849212_2850112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2850256_2850523_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2850514_2850664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2850891_2851767_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2851896_2852124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2852190_2852385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2852443_2853418_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2853455_2853644_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2853644_2855417_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2855406_2856399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2857006_2857699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2858185_2858755_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2858751_2859726_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2859765_2860269_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2860359_2861763_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2862461_2862647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2862752_2864156_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420599.1|2864160_2864733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2864766_2866194_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|2867479_2869849_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2869924_2870743_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2871094_2871640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2872122_2873361_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2873337_2874312_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017375625.1|2874404_2874632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|2874636_2875128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243039.1|2875800_2876688_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_027243038.1|2876777_2878268_-	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_017376549.1|2878291_2879173_-	ROK family protein	NA	NA	NA	NA	NA
WP_017376548.1|2879169_2879892_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376547.1|2880591_2881383_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|2881569_2881815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420598.1|2881966_2882197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376543.1|2882226_2883006_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_047927468.1|2883031_2883337_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_144420752.1|2883333_2884227_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_027243035.1|2884582_2885881_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376538.1|2888483_2889665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2889958_2891386_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	2898972	2948733	3195023	tRNA,transposase	Bodo_saltans_virus(14.29%)	43	NA	NA
WP_062312049.1|2898972_2900340_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2900832_2901312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2901491_2903555_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2903563_2904289_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2904916_2905630_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2905634_2906165_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2906399_2906633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2906745_2906994_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2907801_2909994_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2910011_2910320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2910973_2912683_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2912876_2913032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2914434_2915310_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2915635_2916397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2916621_2917353_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2917349_2917886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2917939_2918704_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2918706_2920284_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2920290_2920767_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2920742_2921174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2921206_2921962_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2922136_2922424_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2922806_2923031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2923370_2924534_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2924568_2925546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2925539_2926226_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2926164_2927280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2927559_2928165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2928402_2928882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2930704_2931358_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2931470_2932022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2932121_2933096_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2933381_2933906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2934603_2935428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2935683_2936040_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2936036_2937440_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2937559_2938120_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2938277_2938844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243087.1|2941724_2942420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2942460_2942673_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2944245_2945355_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2945410_2946892_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2947329_2948733_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP039097	Piscirickettsia salmonis strain Psal-117 chromosome, complete genome	3195023	3076415	3141664	3195023	protease,transposase	Hokovirus(14.29%)	55	NA	NA
WP_017376170.1|3076415_3077516_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3077873_3078848_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3078984_3079863_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3079870_3080101_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3080154_3081159_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3081377_3082205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3082286_3083675_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3083962_3085363_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3085457_3086384_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3086380_3087517_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3087513_3088521_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3088517_3089681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3089690_3090542_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3090573_3091746_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3091742_3093131_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3093159_3093567_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3093586_3094594_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3094590_3095463_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3095459_3096320_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3096321_3098592_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3098593_3099739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3099785_3100271_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3100310_3100934_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3106613_3107366_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243062.1|3108697_3109321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3109425_3110214_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3110213_3110945_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3110978_3112706_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3112719_3113781_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3114095_3115310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3115442_3115967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3116584_3117433_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3117419_3118118_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3118172_3118934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3118926_3119349_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3119478_3120030_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3120085_3121048_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3121048_3121264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3121450_3122260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3122239_3123082_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3123078_3124323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3124461_3125550_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3125567_3126068_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3126255_3126855_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3126860_3128024_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3128056_3129010_+	glutathione synthase	NA	NA	NA	NA	NA
WP_017376261.1|3129373_3130438_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3130434_3133497_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3133649_3134102_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3134133_3134490_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3134908_3135682_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376269.1|3138305_3138596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3138820_3139696_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3139692_3140250_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3140260_3141664_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039098	Piscirickettsia salmonis strain Psal-117 plasmid unnamed1, complete sequence	168649	0	68152	168649	transposase,integrase,portal	Streptococcus_phage(44.0%)	59	34547:34606	73877:74347
WP_017377655.1|1412_1658_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|1654_2041_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|2128_2857_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|2835_3456_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|3801_4488_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|5437_5800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|5802_7542_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|7943_8096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|8123_8807_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|8888_9866_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_146619466.1|10750_10915_-	phosphatase	NA	NA	NA	NA	NA
WP_017377787.1|11761_11989_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036771639.1|12146_13121_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_017375677.1|13140_13326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378394.1|13511_13952_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_017378395.1|13951_14206_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_047927763.1|15254_15518_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036816769.1|15514_15913_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_036815609.1|16156_16612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377666.1|18512_18770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377667.1|18914_19085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420839.1|19754_20681_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375910.1|20876_21605_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|22753_23374_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|23429_24158_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|25008_25281_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|25283_26012_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420837.1|26041_26974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377509.1|27115_27844_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_036773695.1|27873_29946_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_016212398.1|32006_32468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876221.1|32562_33018_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
WP_048875857.1|34005_34980_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
34547:34606	attL	TTGTGGGTCGTGACCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGT	NA	NA	NA	NA
WP_081000017.1|35380_35632_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_080999971.1|35896_37300_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243203.1|41350_42145_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
WP_017375836.1|42238_42442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|42636_42972_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_048876182.1|43671_45567_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771296.1|45922_47818_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771293.1|48113_48380_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|48919_49894_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027243200.1|50200_50605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|50605_51352_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_036774644.1|51860_52922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963627.1|53901_54120_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036772541.1|54138_54867_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_087910667.1|55018_55702_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_027243197.1|55706_56276_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_036772541.1|56446_57175_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_036815648.1|57658_58387_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420834.1|58439_58835_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036772541.1|59128_59857_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929623.1|60014_63356_-	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_027243201.1|63419_63659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|63824_64553_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243202.1|64827_65763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876188.1|66476_67250_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_036774373.1|67423_68152_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
73877:74347	attR	ACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGGTCACGACCCACAACCGGGCACTGTTGCAAAAAATTTAGATTTGAGTAGGGTGTAGCAATCAACTGAAATTAAGAGTGAATTACTGTGGCTAGACGTAAACGATTTAAGAAGAATCAACCCTTTAAATGGAAGCACTACTCTGGTGAGATCATTCTTTGGTTGGTGCGCTGGTATGGCCGCTATGCTTTGTCTTATCGTGACCTCAAAGAAATGACAGGTGAAAGAGGTCTTGAGCTTGAACGTTCAACAATCTGTCGTTGGGTTCATGAATATGGACCTGAAATCGCTAAACGGTTACGGCCCCACTTTCGCCAAACGTGTGCCTCTTGGCGGCTGGATGAAACGCTGGTTAAAATTAAAGGGCGCTGGTATTACCTTTATCGAGCGATTGATAAATATGGCCATACTTTGGATTGGATGCTCA	NA	NA	NA	NA
>prophage 2
NZ_CP039098	Piscirickettsia salmonis strain Psal-117 plasmid unnamed1, complete sequence	168649	71667	116647	168649	transposase,terminase,integrase,portal	Streptococcus_phage(33.33%)	42	63824:63883	111018:111613
63824:63883	attL	ATTAAGCAGCTAATCCAAATAATTTATCAATGAGCTGATTTTGGGCACAGATATTCTGTT	NA	NA	NA	NA
WP_036774388.1|71667_72630_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017377694.1|74007_74736_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|74982_75132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|75143_75872_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_081000015.1|75901_76288_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876191.1|76223_76652_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_082300723.1|78203_78431_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_155046637.1|79163_79655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|79736_80465_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_146619416.1|80808_80955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243206.1|81260_83126_+	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_080963664.1|83198_83465_-|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_080963665.1|83645_83987_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_048876194.1|84167_84701_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_036774350.1|85940_86669_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_027243215.1|87151_88174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876196.1|89987_91136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|91165_92143_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_047927782.1|92058_92448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075317322.1|93243_94758_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|94744_95722_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|95879_96092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|97092_98070_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_027243212.1|98564_98852_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_027243211.1|98841_99096_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_155046636.1|99313_99475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|99489_100467_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|100947_101925_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_144420849.1|102390_103371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|103602_104112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242596.1|104151_104514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275482.1|104827_105802_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_017377509.1|105895_106624_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_027243190.1|106804_110149_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_144420848.1|110152_110338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876202.1|111716_112430_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
111018:111613	attR	ATTAAGCAGCTAATCCAAATAATTTATCAATGAGCTGATTTTGGGCACAGATATTCTGTTTTTTAATATAACGTAATTGACCTTTTTGAACCATGCGCATCGCTTCCATTATGTCAATGGTAGGCCGTGCTGTAGAAAGTGATTGGTACCATTGGCGGAAACGGGATTTGCGCTTTACCGCTTTGTGATCATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACACTGACTAGAAAAGAGACCTTCATCTTTGGCTTTTTGGTGAGCGGGTGGAAATGAAGCGTGCTTGTCGACATTCACAACACGCGGTGATTTCACATAAGGTTGGGCGATTGCCTTTTTGAAAAAGCGCATCGCCGCTTTGGCATTTTGCTGTCGGCTGAGCATCCAGTCCAAAGTATTGCCATATTTATCAATGGCTCGATAAAGGTAATACCAACGACCTTTAATTTTCACCAACGTTTCATCTAACCGCCAAGAGGCACACGTTTGACGAAAGTGGGGCCTCAGCCGTTTGGCGATCTGCGAGCCATACTCGTGCACCCAACGACAAATGGTTGAACGCTCAATCTCAAGACCTCTTTCA	NA	NA	NA	NA
WP_036771649.1|112476_113211_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_087910668.1|113248_113635_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_047927581.1|113721_114156_-	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_048876205.1|114360_115692_-|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_075278733.1|115694_116177_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_027242929.1|116263_116647_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
>prophage 3
NZ_CP039098	Piscirickettsia salmonis strain Psal-117 plasmid unnamed1, complete sequence	168649	120783	125554	168649		Vibrio_phage(25.0%)	7	NA	NA
WP_081078123.1|120783_121146_-	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
WP_146619517.1|121175_121328_+	phosphatase	NA	NA	NA	NA	NA
WP_017375959.1|121465_121699_-	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_017375960.1|122000_123044_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_036817201.1|123151_123559_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_036817204.1|123862_124858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|125128_125554_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
>prophage 4
NZ_CP039098	Piscirickettsia salmonis strain Psal-117 plasmid unnamed1, complete sequence	168649	132953	133682	168649	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_036771279.1|132953_133682_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
>prophage 5
NZ_CP039098	Piscirickettsia salmonis strain Psal-117 plasmid unnamed1, complete sequence	168649	139339	143300	168649	transposase	Staphylococcus_phage(50.0%)	3	NA	NA
WP_048876208.1|139339_140167_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_048876229.1|141031_142003_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|142571_143300_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 6
NZ_CP039098	Piscirickettsia salmonis strain Psal-117 plasmid unnamed1, complete sequence	168649	147268	152121	168649	transposase	Streptococcus_phage(66.67%)	6	NA	NA
WP_036771347.1|147268_148246_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771359.1|148373_149102_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_017375754.1|149284_150571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046630.1|150591_150756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082884401.1|151172_151295_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|151392_152121_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
>prophage 7
NZ_CP039098	Piscirickettsia salmonis strain Psal-117 plasmid unnamed1, complete sequence	168649	155548	166031	168649	transposase	Streptococcus_phage(33.33%)	13	NA	NA
WP_048876210.1|155548_156277_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_081000019.1|156317_156488_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|156563_157541_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_048876213.1|157999_158890_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275473.1|160128_160305_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|160421_161129_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|161082_161961_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_144420840.1|161991_162423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|162805_163510_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|163521_164250_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|164279_164669_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|164691_165420_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|165422_166031_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
>prophage 1
NZ_CP039100	Piscirickettsia salmonis strain Psal-117 plasmid unnamed3, complete sequence	49577	32440	45122	49577	tail,transposase,head,capsid	Moraxella_phage(18.18%)	17	NA	NA
WP_036771639.1|32440_33415_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|33464_34004_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|34017_34602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|34986_35298_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|35294_35720_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|35898_36294_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|36290_36641_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|36640_37063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|37064_37388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|37444_37711_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|37714_39793_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|39785_40127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|40123_40795_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|40724_41510_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|41499_42057_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_155082180.1|42053_44045_+	hypothetical protein	NA	A0A0R6PIC9	Moraxella_phage	33.6	7.0e-104
WP_155082181.1|44429_45122_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	38.9	9.1e-35
>prophage 1
NZ_CP039101	Piscirickettsia salmonis strain Psal-117 plasmid unnamed4, complete sequence	33497	3344	19366	33497	terminase,capsid,transposase,integrase,head,tail	unidentified_phage(35.71%)	21	NA	NA
WP_036771330.1|3344_4319_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4854_5445_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5675_5936_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5928_6282_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6458_7433_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|7965_8331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|8475_8730_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8713_9070_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|9167_10142_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|10767_11634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|11846_12230_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|12316_12799_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|12801_12987_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|13006_13981_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|14077_14470_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|14505_15087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|15467_16442_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|16515_16731_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|17534_18050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|18395_18953_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|18949_19366_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
