The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	31805	91582	3194760	tRNA,transposase	Staphylococcus_phage(28.57%)	52	NA	NA
WP_036772169.1|31805_32681_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33039_34395_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34486_34993_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34989_35358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36760_38545_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39025_40153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40225_40981_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_155046559.1|41017_43699_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43730_44282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44389_45403_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45523_45748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46103_46865_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47007_47802_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|47946_48699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49010_50537_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50675_51749_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|51788_53096_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53070_54240_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54294_55020_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55485_57591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|57805_58270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58289_58799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59183_60125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60406_61858_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773655.1|62324_62729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63289_64264_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|64998_65376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|65965_66940_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773242.1|66979_67534_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|67714_68614_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|68618_69245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|69189_71511_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|71657_72137_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|72133_73285_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|73419_73923_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|74016_74991_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|74980_76294_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|76334_77714_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|77720_79172_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|79197_79566_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378407.1|79584_80652_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|80684_81581_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|81577_82414_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|82549_83002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|83140_83887_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|83867_84431_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|84439_84955_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|85096_87175_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|87174_88125_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|88992_89391_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|89616_89946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|90562_91582_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	123064	241132	3194760	protease,tRNA,transposase	Staphylococcus_phage(12.5%)	105	NA	NA
WP_075278722.1|123064_123940_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|124380_124674_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|124674_124929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|124945_127438_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|127430_128114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|128113_129157_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|129156_130386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|130387_130717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|130713_131913_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|132025_132415_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|132414_133359_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|133478_134876_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|135201_135723_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|135846_136155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|136169_141392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|141782_143789_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|143919_146250_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|146425_147256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|147372_147768_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|147764_148298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|148294_148696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|149090_149411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|149420_150377_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|150886_151411_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|151511_152510_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|152598_153495_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|153568_154855_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|155314_156631_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|156744_156915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|156934_157909_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|158035_158296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|158563_158854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|161392_162433_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|162535_163507_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|163629_164478_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|164629_164917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|165227_165599_+	isochorismatase	NA	NA	NA	NA	NA
WP_017377540.1|166650_166884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|167021_167159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|167172_167385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|167908_168733_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|168871_170005_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|170064_171474_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|171621_173202_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|173959_174955_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|174960_177027_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|177084_178035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|178229_178556_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|178778_180038_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|180297_181173_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|181211_182174_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|187868_188213_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|188309_189233_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|189732_190221_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|190323_191124_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|191134_192886_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|193775_194018_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|194021_194420_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|194651_195527_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|196245_196704_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|196885_197071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|197786_199601_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|200011_200680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|200689_202006_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|202165_203128_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|203208_203364_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|203377_203614_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|203806_205024_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|205001_205460_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|205487_206867_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|206903_207122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|207441_208737_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|208941_209133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|209331_210207_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|210394_211660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|211693_212569_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|212690_213149_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|213172_214093_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|214220_215003_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|215093_216593_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|216906_218790_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|219049_219712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|219778_220888_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|220899_221544_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|221562_222549_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|222633_223710_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|223911_224736_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|225038_226004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|226322_227375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|227433_228408_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|228743_229172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|229408_229891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|229946_231197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|231299_231518_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|231989_232844_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|232898_233369_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|233665_233902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|234048_234429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|234487_235363_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|236129_237041_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|237157_238006_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|238072_239083_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|239106_239430_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375571.1|239440_239842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|240112_241132_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	314935	357294	3194760	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|314935_315811_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|315891_316524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|316477_317923_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|317957_318377_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|319150_319519_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|319528_320068_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|320228_320660_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|320663_321362_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|321609_322116_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|322158_322527_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|322797_326874_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|326937_331146_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|331307_331682_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|331786_332260_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|332275_334387_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|334414_335605_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|335611_335923_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|336045_336684_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|336699_337317_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|337313_337610_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|337624_338449_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|338465_338741_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|338746_339079_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|339091_339826_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|339839_340253_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|340252_340453_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|340452_340710_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|340831_341200_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|341217_341529_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|341544_342087_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|342099_342405_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|342433_342826_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|342838_343372_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|343381_343735_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|343745_344246_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|344251_344434_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|344436_344871_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|344871_346194_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|346250_346364_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|346507_346864_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|346889_347279_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|347288_347909_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|347930_348908_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|348956_349355_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|349467_350715_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|350701_351358_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|351442_351721_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|351963_352191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|352323_353118_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|353426_354641_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|355038_355218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|355186_355840_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|356215_356464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|356553_357294_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	375312	424994	3194760	transposase,tRNA	Staphylococcus_phage(25.0%)	55	NA	NA
WP_017376964.1|375312_377793_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|377879_378359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|378331_379372_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|379308_380025_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|380037_380373_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|380409_380880_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|380922_382758_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|382802_383891_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|383912_384974_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|385051_385567_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|385607_386885_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|386899_387751_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|387779_388427_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|388423_389383_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_048875861.1|389904_390774_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|390918_391173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|391317_391884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|391989_392430_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_051929598.1|392387_392645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242664.1|392941_394144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|394427_395402_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046562.1|395583_395727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046563.1|395871_396009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|396025_396241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|396445_397057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|397053_397311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|397561_397954_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|398083_398632_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|398631_399459_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|399508_401194_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|401271_401733_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|401769_402333_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|402559_402889_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|402869_403094_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|403238_403829_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|403853_405125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|405142_406396_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|406392_407037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|407109_408159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|408260_409898_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|409932_410262_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|410418_410706_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376927.1|411132_411270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046565.1|411232_411526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|411775_412996_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|413054_415853_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|416158_417325_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|417423_417960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|418021_418354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|418611_419514_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|419583_420081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|420226_421630_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|421830_422559_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963630.1|422728_423586_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_048875864.1|423968_424994_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	451066	499205	3194760	transposase	Staphylococcus_phage(100.0%)	42	NA	NA
WP_036774259.1|451066_452041_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377364.1|452190_453027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|453146_454550_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242658.1|455892_457356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856768.1|457431_458226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242656.1|458517_459336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|459353_459947_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376894.1|460163_460397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242655.1|460620_461517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420727.1|461821_462592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376891.1|462761_463664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|463660_464884_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_027242653.1|464901_465828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|465843_466884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242651.1|466998_467409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376888.1|467461_467965_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_017376887.1|467957_468704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376886.1|468706_469837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|469841_470081_+	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_027242650.1|472570_473059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|473061_474138_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_017376878.1|474130_474784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875870.1|474790_475216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|475252_478252_+	ATPase AAA	NA	NA	NA	NA	NA
WP_027242646.1|478313_479816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|480267_481887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|481928_484232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376870.1|484508_485405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|485407_488734_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_144420818.1|488935_489124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|489135_489612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|489654_489882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|490063_490597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|490627_490969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772347.1|490971_491388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876253.1|491549_492206_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036771639.1|492202_493177_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|493618_493882_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|494309_495284_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_087910671.1|495671_496136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910670.1|496229_496415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|498230_499205_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 6
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	504009	558692	3194760	transposase	Streptococcus_phage(22.22%)	52	NA	NA
WP_048875872.1|504009_505293_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|505465_505603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|505599_507003_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|507116_507554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|507674_508103_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|508350_508788_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|509219_510608_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|511054_512548_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|512742_513498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|513997_514228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|515332_516343_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|516339_516561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|517279_518221_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|518748_519147_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|519086_519941_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|520032_520314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|520399_521077_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|521122_522403_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|522578_523628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|523706_524507_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|524520_525315_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|525417_526437_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|526483_527095_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|527098_527785_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|527781_528324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|528616_529804_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|530048_530774_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|530959_531748_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|531744_532140_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|532532_533573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|533569_534973_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|537388_537646_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|537685_539071_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242633.1|539400_540498_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_017377120.1|540531_541782_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|541782_542415_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|542704_543157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|543202_544045_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|544079_544571_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|544766_546734_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|546961_547366_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|547343_548372_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|548358_549147_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|549573_550977_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377110.1|551178_552189_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_075275363.1|552201_552669_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377107.1|552998_554369_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_017377106.1|554671_555142_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377105.1|555419_555695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|555705_557109_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069971661.1|557283_557721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|557717_558692_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 7
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	590483	723876	3194760	plate,tRNA,transposase	Staphylococcus_phage(13.64%)	110	NA	NA
WP_036772726.1|590483_591032_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|591784_593164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|593523_594987_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|595170_595983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|596446_598441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|598835_600215_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|600252_600690_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|600732_601449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|602995_603526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|603592_605413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|605977_606484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|606568_607972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|608086_608341_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|608493_608766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|609640_610216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046568.1|610224_610383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|611283_611526_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|611828_612920_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|612900_613854_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|614077_615562_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|615601_616105_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|616364_617540_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|617687_618092_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|618248_619124_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|619158_619512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|622841_623267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|623497_624634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|624620_625943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|625935_627054_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|627174_627708_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|627846_629484_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|629488_629710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|629818_630832_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|631103_633332_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_026063593.1|633312_634017_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|634251_634581_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|635981_636200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|636258_637134_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|637126_637993_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|638060_639380_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|639849_640410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|640728_641655_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|642550_643459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|647155_647995_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|648181_648397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|648445_649021_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|649017_649356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|649524_650514_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|651503_652406_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875883.1|652665_653202_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|653346_654264_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|654698_655709_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|656516_657053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|658265_658613_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|658757_659717_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|659818_660601_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|660733_661693_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|661717_662122_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|662150_662825_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|662924_664640_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|664636_664999_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|665013_666168_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|666171_667179_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|667181_668198_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|668413_669499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|669605_669998_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|670130_671414_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|671429_672731_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|672748_674551_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|674555_675548_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|675628_676705_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|676802_677777_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|677844_678816_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|678999_679269_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|679870_681157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|681221_681902_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376024.1|687557_687806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375775.1|687883_688078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275355.1|688125_689100_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_027242570.1|689313_690453_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|690661_692032_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|692410_693403_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|693406_693922_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|693918_694758_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|694790_696341_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|696448_696820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|698040_698202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|698782_700186_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|700220_700658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|700681_701656_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|701714_702143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|702330_703137_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|703211_703604_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|703648_704470_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|704482_705466_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|705467_706736_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|706742_709247_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|709377_710403_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|710399_711110_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|711034_711865_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|712014_712398_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|712432_713332_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|713377_714049_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|714131_714707_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|714805_715606_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|715747_716605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|717467_718604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|718670_721841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|721853_722564_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|722568_723876_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	732518	778819	3194760	plate,transposase	Staphylococcus_phage(21.43%)	51	NA	NA
WP_017376356.1|732518_732917_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|732913_734602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|734583_735540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|735582_736098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|736202_737135_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|737354_737741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|737758_738403_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|738553_739393_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|739468_740071_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|740071_740926_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|741283_741595_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|741619_743008_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|743163_743895_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|743891_744419_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|744450_745008_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|745013_745994_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|746133_746934_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|746937_747705_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|747701_748166_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|748188_748842_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|748845_749193_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|749226_749478_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|749554_750823_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|750825_751584_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|751645_752536_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|752586_753270_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|753279_753627_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155046569.1|753896_756005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|755996_756869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|757036_758866_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|759033_759675_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|759999_760446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|760463_760637_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|760695_761745_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|761751_762702_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|762756_763701_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|763728_764466_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|764554_764797_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|764871_766095_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|766126_766975_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|766971_768024_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|768160_768781_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|769006_770159_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|771179_772154_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|772150_772321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|773289_773886_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|773854_775015_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|775525_775867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|775970_777005_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|777001_777712_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|777844_778819_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 9
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	786979	841290	3194760	transposase,tRNA,protease	Prochlorococcus_phage(33.33%)	49	NA	NA
WP_017377942.1|786979_787486_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_155046572.1|787567_787990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|788075_788936_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|789033_789579_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|789661_790513_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|790554_793461_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|793521_793719_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|793725_794736_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|794732_795791_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|795805_796585_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|796587_797400_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|797411_798359_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|798369_799662_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|799840_800944_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|800940_801333_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|801345_802722_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|802715_804185_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|804378_804813_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|805108_805285_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|806319_807345_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_155046573.1|807807_808239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|809631_810282_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|810980_811775_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|811954_812599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|812773_813748_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|814148_814406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|816083_816761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|816994_817819_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|817912_818626_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|818715_819807_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|819878_820460_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|820465_821092_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|821188_822136_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|822482_823145_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|823315_823975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|824143_825403_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|825399_826485_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|826477_827359_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|827347_828598_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|829983_830304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|830562_830829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|831319_831538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|832523_832745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|832741_833824_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|833834_834206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|834202_834382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|837085_837361_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|838196_839654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|840081_841290_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	884970	947497	3194760	tRNA,transposase	Staphylococcus_phage(28.57%)	53	NA	NA
WP_048875904.1|884970_885846_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|886102_886540_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|886600_887233_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|887248_887896_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|887898_889962_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|890288_891581_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|891969_894180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|894196_894853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|897238_898114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|898372_898984_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|899411_902000_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|902102_902864_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|902860_903397_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|903445_904402_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|904479_907665_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|907668_908724_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|908953_909556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|909599_910262_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|910296_910644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046576.1|911112_912057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|912606_914010_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|915128_915473_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|915564_916020_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|916268_916403_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|916395_917037_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|917033_917750_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|917753_919073_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155046577.1|919754_919916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773644.1|920877_923514_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_036773645.1|923555_924641_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|924640_925324_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_017377748.1|925384_927046_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377747.1|927198_927453_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|927531_927849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|928001_928400_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|928481_929120_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|929276_930251_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|930623_930899_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|931448_931733_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|933549_934143_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|935237_936119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|936230_937910_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|938036_939287_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|939362_939824_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|939820_940969_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|940974_941649_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|941645_942302_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|942427_942901_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|942902_943325_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|943311_944331_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|944490_944670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|944888_945170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|946621_947497_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	951399	1018362	3194760	protease,tRNA,transposase	Bacillus_phage(20.0%)	56	NA	NA
WP_048876012.1|951399_952803_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|953161_953929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|954042_955446_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|955442_955604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|955919_956894_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|957134_958418_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|958484_959408_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|961603_963748_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|963769_963976_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|964036_964657_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|964697_965591_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|965676_966402_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|966463_966868_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|967030_969139_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|969262_970312_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|970308_971775_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|971917_973255_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|973322_974813_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|975041_975413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|975563_976391_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|976693_977350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|977297_978221_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|978234_979158_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376987.1|979405_980089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|981788_982016_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376989.1|982340_982889_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|982969_983245_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|983244_984294_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|984406_986344_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|986491_988204_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|988272_988992_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|988988_989591_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|989705_990593_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|990783_991131_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|991181_992021_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|992116_992863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|993059_993686_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|994001_994571_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|994714_995413_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|996119_996743_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|996852_997746_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|997852_999463_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|999459_1000755_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|1000776_1002699_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|1002809_1003112_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|1003206_1008093_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1008140_1009463_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1009587_1010682_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1010733_1011672_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1011752_1012337_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1012721_1013612_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1013814_1014306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1014445_1014937_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1015105_1015819_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065653747.1|1015881_1017222_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1017486_1018362_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	1023975	1086502	3194760	transposase	Staphylococcus_phage(33.33%)	57	NA	NA
WP_017377787.1|1023975_1024203_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1024229_1025270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1025336_1025906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1026136_1026541_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1026553_1026694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1026788_1027988_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1028008_1028620_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1028821_1029583_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1029878_1030805_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1030965_1031922_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1032066_1032336_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1032602_1033577_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1033730_1033958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1034074_1034500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1034656_1035586_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1036032_1036563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046580.1|1036947_1037190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1037667_1037979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1038318_1039485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1041672_1042644_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1043246_1043420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1043815_1044733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1044733_1045585_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1046025_1047072_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1047061_1049053_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1049162_1049537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1049790_1049973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1050234_1050936_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420709.1|1050936_1051356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619460.1|1053009_1055793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1056028_1057321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1057807_1058713_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376296.1|1059490_1060207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1060492_1061254_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1061286_1062690_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1062686_1062851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1062910_1063198_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1063942_1064671_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1064639_1065386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420708.1|1065466_1065856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1065852_1066827_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1066983_1067301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772457.1|1069776_1070085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1070160_1070433_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1072966_1073404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1074005_1075193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1075463_1077098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1077148_1077877_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1079304_1080267_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1080490_1081486_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1081513_1082449_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1082492_1082954_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1082932_1083550_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1083579_1084554_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1084608_1085076_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1085088_1085733_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1085773_1086502_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 13
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	1095202	1144770	3194760	transposase	Acinetobacter_phage(22.22%)	39	NA	NA
WP_082300708.1|1095202_1095763_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1097087_1097483_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1097491_1097848_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1097840_1098716_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1098801_1099380_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1099337_1099631_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1100591_1102103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1102350_1103754_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1103959_1104394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1104476_1105181_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1105439_1105928_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1105956_1106631_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1106871_1107747_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275340.1|1108277_1108886_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1109156_1109615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1109893_1110283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1110468_1111284_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1111506_1112412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1112575_1113337_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1113340_1114207_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1114292_1114904_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1115282_1116530_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1116681_1117383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1117680_1117854_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1118343_1118844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1119922_1120150_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774233.1|1120202_1120436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1120464_1121145_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1121167_1123342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1123587_1124658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1124654_1126058_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619408.1|1126206_1126692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1126763_1127585_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1128251_1129751_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1130054_1132748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1132744_1136146_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_048875961.1|1137733_1139137_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1140215_1140887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1143795_1144770_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 14
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	1169493	1225887	3194760	tRNA,transposase	Staphylococcus_phage(37.5%)	52	NA	NA
WP_053093677.1|1169493_1170213_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1170440_1170617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1170865_1171189_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1171277_1173296_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1173318_1174272_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1174437_1175625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1176338_1176977_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1177274_1178270_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_027242772.1|1178410_1179457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1179449_1180475_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1180541_1182572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1183878_1184106_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1185449_1185593_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1185589_1186282_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242771.1|1186548_1186866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|1187008_1187419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1187575_1187902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1188048_1189086_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1189127_1189373_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_129556541.1|1189497_1189812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1189819_1191394_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1191548_1192118_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1192427_1194230_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1194226_1195168_+	signal peptidase I	NA	NA	NA	NA	NA
WP_036771308.1|1195195_1195417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242761.1|1195579_1196254_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1196259_1197159_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1197172_1197916_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1197918_1198650_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1198646_1199030_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1199167_1200415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1200825_1201971_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1201963_1202317_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1202597_1203140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1203784_1203973_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1203992_1204967_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1205010_1205886_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1206239_1207067_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1207166_1207328_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1207978_1209319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1210370_1210598_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|1210739_1212101_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1212196_1212856_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144420701.1|1213696_1214053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1214649_1216209_-	APC family permease	NA	NA	NA	NA	NA
WP_027243001.1|1216569_1218540_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375893.1|1218737_1219808_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1219865_1220072_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1220078_1221554_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1221689_1222253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1222422_1223826_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1224792_1225887_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	1242129	1289854	3194760	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_036772169.1|1242129_1243005_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046585.1|1243074_1244178_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1244245_1244569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1244725_1245508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1245643_1246621_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1246694_1248686_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1248741_1249023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1249276_1250476_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_051929862.1|1252907_1253420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1253606_1254482_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1254518_1254683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1255891_1256305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1256315_1256651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1256795_1257914_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1258143_1258410_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1259692_1259920_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1259930_1260437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1260514_1261132_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1261263_1262496_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1262485_1263148_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1263422_1264679_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1264816_1265476_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1265550_1266252_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1266999_1267974_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1269182_1269536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1269749_1269944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1270011_1270524_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1270661_1271516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1271564_1272209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1272242_1272887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243125.1|1273409_1273703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1273801_1274584_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1274666_1275617_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1277659_1280500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1280522_1281104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1281223_1281952_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1282097_1283072_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1283187_1284093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1284691_1285438_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1285690_1286083_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1286120_1286768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1288483_1289854_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	1313673	1354883	3194760	transposase	Enterobacteria_phage(16.67%)	37	NA	NA
WP_048876023.1|1313673_1314777_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1314867_1316020_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1316433_1317285_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|1317422_1317572_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1318196_1320563_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1320610_1321807_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1322375_1324808_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1325129_1326629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1326737_1327310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1327624_1329094_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1329166_1329916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1329919_1330693_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1330791_1331742_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1331881_1333324_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1333539_1334724_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1334847_1335534_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1335669_1336254_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1336343_1336673_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1337008_1337248_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_017377970.1|1337296_1337488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1338262_1338556_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1338704_1338866_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1339380_1339920_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1340258_1340903_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1341236_1341887_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1342410_1343463_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1343480_1346561_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1346726_1346975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1347040_1347916_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1348838_1349345_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1349362_1349560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1349578_1349722_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1349789_1349963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1350167_1351481_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1351490_1351754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1351812_1352787_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1354655_1354883_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 17
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	1386100	1439833	3194760	tRNA,transposase	Bacillus_thuringiensis_phage(25.0%)	46	NA	NA
WP_036772026.1|1386100_1386976_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1387080_1390383_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1390379_1392203_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1392242_1392641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1392749_1393766_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1394200_1395655_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1395736_1398793_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_144420694.1|1399086_1399323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081329473.1|1400183_1400603_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376676.1|1400975_1401440_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1401512_1402514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1405406_1405739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1406100_1406244_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1406231_1407176_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080963606.1|1407179_1407566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1407387_1407726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1408100_1408700_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1408699_1409047_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1409197_1410181_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1411090_1411405_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1411553_1411712_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1411683_1412613_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1413527_1413944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1415072_1415789_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1416537_1416696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1416744_1417320_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1417464_1417743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1417807_1418683_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1418848_1422715_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1422870_1423680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1423729_1424551_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1424750_1425983_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1426153_1426879_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1426921_1428460_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1428466_1429852_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1430165_1431215_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1431774_1432152_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|1432343_1433219_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1434199_1434427_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1434479_1434998_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_146619432.1|1435253_1435445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420793.1|1435853_1436627_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243181.1|1436740_1437712_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376772.1|1437693_1438665_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420687.1|1439100_1439286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1439296_1439833_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	1458768	1508187	3194760	transposase	Staphylococcus_phage(23.08%)	46	NA	NA
WP_051929845.1|1458768_1459593_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1459996_1460971_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1461156_1461750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1461930_1462395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1462789_1463071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1463067_1464471_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1465122_1465503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1465742_1466399_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1466543_1466840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1466899_1467187_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_027243051.1|1467470_1467680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772296.1|1468376_1468754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1468953_1470003_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1469979_1471797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1472067_1472646_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1472673_1473138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1473174_1474632_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1474693_1476181_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1476950_1477553_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1478114_1478585_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1480232_1480976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1481127_1481559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1484196_1485543_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1485630_1487436_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1487901_1488699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1489083_1489545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1489767_1490742_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1490784_1490907_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1490978_1492934_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1493323_1493509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1493830_1494820_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1495232_1496858_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1496966_1497281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1497576_1498962_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1499126_1499354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1499494_1499953_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1500153_1500339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1500407_1501235_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1501689_1502214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376824.1|1502486_1502645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1502814_1503768_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1503962_1504937_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1505064_1506090_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1506742_1507030_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1507089_1507422_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1507626_1508187_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
>prophage 19
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	1516908	1576479	3194760	protease,transposase,integrase,tRNA	Staphylococcus_phage(25.0%)	58	1505759:1505818	1576184:1576794
1505759:1505818	attL	CCACCACGTGTCACTGATAAGTGGACGTGCGTATTCCAATTTAAACTCTGGCCGAAAGTA	NA	NA	NA	NA
WP_017376809.1|1516908_1518678_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_017376808.1|1518816_1519860_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376807.1|1519873_1520617_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_062312151.1|1520714_1521047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1521108_1521288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243094.1|1521350_1522058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420791.1|1522841_1524053_+	protein kinase	NA	NA	NA	NA	NA
WP_017376801.1|1524108_1524933_-	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_017376798.1|1526120_1526756_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017376797.1|1527037_1527397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1527670_1529956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420683.1|1529944_1530601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|1530777_1531410_+	MarC family protein	NA	NA	NA	NA	NA
WP_027243097.1|1531445_1531631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243098.1|1531696_1532842_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243099.1|1533077_1534391_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_155046588.1|1535506_1535716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420682.1|1536250_1536412_-	phosphatase	NA	NA	NA	NA	NA
WP_017376785.1|1537818_1538724_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376784.1|1538964_1539150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242578.1|1539186_1539723_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_027242577.1|1539740_1541042_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_048876008.1|1541038_1542013_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_155046589.1|1542092_1542242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1542421_1542586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1542587_1543463_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1543778_1544699_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1544714_1545098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1545424_1546381_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_144420678.1|1546648_1546927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243017.1|1547425_1548769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|1548942_1549086_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1549165_1550140_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1550287_1552159_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1552191_1552290_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1552525_1553155_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1553138_1553561_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1553567_1555307_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1555307_1556372_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1556375_1556729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1556841_1557810_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1557819_1558131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1558146_1558716_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1558979_1560308_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1560348_1561323_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1561909_1562311_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146619459.1|1562830_1565287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1565489_1566341_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1566386_1568093_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1569564_1570539_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1570901_1571147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1571510_1572539_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1572669_1572873_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420676.1|1573157_1574114_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_047927838.1|1574406_1574652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1574648_1574948_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1575170_1575641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1576251_1576479_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
1576184:1576794	attR	TACTTTCGGCCAGAGTTTAAATTGGAATACGCACGTCCACTTATCAGTGACACGTGGTGGTGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGATAGGTTAGCATTGGCTGTATGCAACCGATCATGATTGTAATATCGAATATAGGCCTCAACATCCTCCTTCATAGTATCACGGGTTAAGTGAATCACATTCAACAGCCATTCGTGCTTTAGGCTGCCAAAAAAACGCTCGACAACCGCATTGTCAACGCAAGCACCGACACTGCTCATAGAAGCGGTGATTTTATGCTTCTTCAACAGTTTTCGATATTTTTTACTGGTATACTGCGAACCACGATCACTGTGAAATAACAAGTGTTCTGTCGGCTGCCGCAAGTGAATCGCCATATCCATTGCACGACAAACTAGATTTTCGCTCATTCTCTTATTCATCGCCCAGCCAATCACTTTTCGAGAGTATAAATCAATAACGACCGCAAGATACAACCAGCCTTCAGCAGTTCTAAGGTAGGTAATGTCACCTGCCCATGAGTGATTTGCAATGACTGGATTAAACTGCTGATTCAATACGTTATCTGCAACAGC	NA	NA	NA	NA
>prophage 20
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	1581931	1624862	3194760	transposase	Staphylococcus_phage(20.0%)	41	NA	NA
WP_053856766.1|1581931_1583335_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1583522_1584380_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1584504_1585140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1585188_1585440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1585695_1586595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1586731_1587805_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1587905_1588319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1588339_1589053_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1589240_1590653_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1590862_1591831_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1592564_1592933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1592936_1593254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1593329_1594304_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1594823_1595324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1595394_1596723_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1596858_1598247_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1598394_1599705_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1600045_1601329_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1601402_1602023_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1602221_1602482_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1602684_1602831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1602806_1603400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1605263_1605482_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1606734_1607505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1607591_1607807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1607903_1609025_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1609291_1610266_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1610528_1611650_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1611942_1612230_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1612202_1612706_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1612786_1613446_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1613787_1614705_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1614834_1615008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1615673_1617032_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_144420789.1|1617223_1617670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376485.1|1617864_1619094_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1619139_1619766_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1619915_1621103_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1621111_1621804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1621925_1623078_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1623878_1624862_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 21
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	1683197	1773511	3194760	protease,tRNA,transposase	Burkholderia_phage(14.29%)	83	NA	NA
WP_036774017.1|1683197_1684073_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1684462_1684801_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1684797_1685394_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1685396_1687391_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1687454_1688393_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1688741_1689716_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1689919_1690117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1690278_1690683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1692266_1692707_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1693033_1693909_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1693921_1694164_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1694570_1694825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1696036_1697002_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1697094_1697406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1697606_1698383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1699212_1699404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1700132_1701182_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1701352_1702126_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1702186_1703776_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1703966_1705058_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1705080_1705398_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1705484_1706762_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1706783_1707620_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1707626_1709261_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1709692_1710052_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1710333_1711692_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1711717_1711960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1712453_1712633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1712888_1714145_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1714258_1714516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1714660_1715671_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1716047_1716902_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1716931_1717765_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036773204.1|1718341_1719115_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1719196_1719517_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1719735_1720641_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1720726_1721125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1721269_1721767_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047927093.1|1723427_1724531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1724629_1725007_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1725086_1726061_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1727605_1728325_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1728408_1728696_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1728980_1729853_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1729809_1730586_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1730790_1731126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1731524_1731881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1732042_1732318_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1732427_1732775_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1732792_1733572_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1733571_1734081_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1734116_1734365_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1734676_1735012_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1735311_1736562_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1736643_1738671_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1739216_1739435_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1739606_1739969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1740117_1741521_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1741802_1742978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1742995_1744993_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1744973_1745954_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1746009_1746852_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_036772544.1|1746851_1747268_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1747248_1747668_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1747690_1748320_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1748888_1751078_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1751089_1752295_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1752279_1754127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1754111_1755350_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1755336_1757205_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1757238_1758492_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1758497_1759355_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1759373_1760102_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1761240_1762032_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1762397_1762685_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|1764807_1765197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1765373_1766132_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_155046595.1|1766128_1766941_-	RNB domain-containing ribonuclease	NA	Q0GXV6	Lactococcus_phage	33.2	3.8e-24
WP_155046596.1|1766931_1768527_-	VacB/RNase II family 3'-5' exoribonuclease	NA	NA	NA	NA	NA
WP_027242812.1|1768540_1769818_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1769907_1771206_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1771403_1772297_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1772296_1773511_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 22
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	1784210	1834695	3194760	tRNA,transposase	Vibrio_phage(14.29%)	46	NA	NA
WP_069971651.1|1784210_1785086_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1785458_1785722_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1786028_1788623_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1788619_1789102_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1789079_1790120_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1790294_1790780_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1790887_1793458_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1793491_1793953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1794289_1795165_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1795442_1797203_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1797296_1797962_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1797974_1799480_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1799501_1800032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1800105_1801368_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1801554_1802427_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1802528_1803317_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1803409_1804735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1805088_1806264_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1806432_1807086_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1807241_1809182_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1809178_1809802_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1809966_1810941_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1811212_1811833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1811829_1813233_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1813300_1813717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1814124_1814622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1814618_1815593_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|1815672_1816242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1816386_1816923_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1816927_1817224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1817232_1817838_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1818023_1818422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1818612_1818816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1818960_1819116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1819240_1819693_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1819809_1821282_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1821720_1822185_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1822873_1824124_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1824233_1824704_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1824726_1825320_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1825457_1826507_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1826530_1827454_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1827470_1827932_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1828039_1828858_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1829467_1829611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1833774_1834695_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 23
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	1896987	1912303	3194760	transposase	Staphylococcus_phage(50.0%)	15	NA	NA
WP_017378288.1|1896987_1897209_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1897267_1898242_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1898440_1898605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1898601_1899237_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046602.1|1899513_1900293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1900325_1901087_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1901063_1902053_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1902188_1903064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1903082_1903742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1903983_1904430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1904426_1905830_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1905943_1906789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1906933_1908583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1908673_1909459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|1910899_1912303_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	1940976	1982733	3194760	tRNA,transposase	uncultured_Mediterranean_phage(40.0%)	38	NA	NA
WP_144420657.1|1940976_1942038_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1942749_1942911_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1943827_1944367_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1944749_1945166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1945261_1946077_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1946209_1947703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1947888_1948314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1948310_1950371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1950654_1951470_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1951570_1952389_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1952385_1952754_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1952935_1953763_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1953826_1954555_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1954957_1955686_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1956075_1956801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1956835_1960708_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1960908_1962042_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1962055_1962244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1962467_1963826_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_036773947.1|1965432_1966308_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1966819_1967455_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999981.1|1967467_1967941_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_155046603.1|1967868_1968021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929627.1|1968214_1968565_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1968624_1968912_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1968964_1969744_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376415.1|1970168_1971086_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1971137_1971893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1971960_1973235_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376412.1|1973355_1974033_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376411.1|1974233_1975658_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_016209938.1|1975632_1976271_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376410.1|1976633_1976912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376409.1|1977145_1978090_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376408.1|1978111_1979980_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376407.1|1980000_1980354_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_026063528.1|1980392_1981508_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1981692_1982733_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
>prophage 25
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	1987076	2043146	3194760	transposase,tRNA	Klosneuvirus(22.22%)	49	NA	NA
WP_017376399.1|1987076_1989848_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376398.1|1990004_1991237_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1991478_1992141_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376397.1|1992600_1994082_+	MFS transporter	NA	NA	NA	NA	NA
WP_036773116.1|1994279_1995254_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|1995777_1998504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|1999391_2000366_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|2000616_2001321_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|2002560_2003079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|2004046_2005531_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2005655_2007191_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2007213_2007543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2007439_2007655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2009638_2010838_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2011047_2011908_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2012023_2012602_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2012758_2013400_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2013438_2013660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2013652_2014636_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2015029_2015527_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2015671_2015947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2016098_2017781_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2017788_2018811_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2018979_2019981_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2020094_2020433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2020908_2022168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2022376_2022604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2022632_2022851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2022988_2023354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2023421_2023664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2023678_2024014_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2024018_2024456_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_036772812.1|2024481_2025867_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2025977_2026409_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2026514_2028026_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2028316_2029909_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2030109_2032305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772819.1|2032398_2033832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2033874_2034390_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2034389_2035337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2035320_2035986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2035982_2036711_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2036700_2037447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2037430_2038495_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2038699_2039887_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2039943_2041062_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2041509_2041767_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2042046_2042724_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2042942_2043146_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	2062846	2112381	3194760	protease,tRNA,transposase	Burkholderia_virus(20.0%)	41	NA	NA
WP_017377787.1|2062846_2063074_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2063163_2063919_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2064332_2064929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2065008_2067813_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2067793_2068747_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2068739_2070110_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2070280_2071684_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2072455_2072782_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420651.1|2072986_2073640_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_017376600.1|2073959_2074139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2074394_2075651_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2075889_2076036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2076118_2076475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2076970_2077330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2077339_2077723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2078611_2078752_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2078896_2079817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2081974_2082505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2082515_2083571_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2083586_2085626_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2085612_2086443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2086509_2090049_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2090162_2090882_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2091120_2091750_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2091869_2093273_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2093418_2095362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2095879_2096740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2097175_2098921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|2099323_2100796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2100978_2101578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2101715_2101913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2102113_2102254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2102321_2103101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2103665_2104067_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2104211_2104589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2105048_2106356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2107104_2107362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2107413_2108817_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2109057_2110767_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2110936_2111299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|2111406_2112381_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 27
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	2126950	2253788	3194760	protease,transposase,tRNA	Staphylococcus_phage(14.81%)	116	NA	NA
WP_017377892.1|2126950_2128372_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_026063687.1|2128461_2130060_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377894.1|2130216_2130843_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027242839.1|2130923_2133596_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377896.1|2134078_2135035_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_017377897.1|2135087_2135507_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_048875958.1|2135533_2136397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377899.1|2136386_2137178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2137482_2138454_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2138802_2139111_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2139107_2139764_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2139897_2140383_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2140460_2140982_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2141027_2141921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2141917_2142739_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2142933_2143083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2143310_2144141_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046606.1|2145546_2145717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2145869_2147273_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_144420645.1|2147382_2148639_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2148610_2149342_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2149353_2150631_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2150730_2151105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2151189_2152077_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2152134_2152863_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2152859_2153969_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2154120_2154549_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2154643_2155000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2154992_2156204_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2156200_2156989_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2157151_2157946_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2158395_2159136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2159139_2161638_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2161900_2162857_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2162840_2163602_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2163809_2164784_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2164892_2165648_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2165772_2166018_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2166077_2168351_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2168405_2168708_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2168948_2169242_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2169412_2169592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2169667_2170279_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2170525_2171842_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2171852_2172221_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2172251_2172914_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2173336_2173915_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2173894_2174302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2174425_2174722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2174768_2175644_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876123.1|2175713_2177894_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_017376060.1|2177997_2179347_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_036772012.1|2179420_2180110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2180242_2181430_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376055.1|2181948_2182593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2182589_2183903_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2184107_2184281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2184550_2185024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2185168_2185363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2185627_2186503_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210558.1|2186689_2187445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376051.1|2187518_2189171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376050.1|2189210_2190749_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_087910638.1|2190748_2192449_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_075275404.1|2192537_2193713_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_017376046.1|2193751_2194714_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_017376045.1|2194991_2195414_-	universal stress protein	NA	NA	NA	NA	NA
WP_017376044.1|2195719_2196361_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376043.1|2196489_2197824_+	dihydroorotase	NA	NA	NA	NA	NA
WP_048875952.1|2197938_2198574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771517.1|2199318_2200455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771498.1|2200638_2202369_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_017376037.1|2202358_2203567_+	MFS transporter	NA	NA	NA	NA	NA
WP_075275290.1|2203665_2204667_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420641.1|2204910_2205546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2205565_2206540_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875951.1|2206583_2207420_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2207565_2207985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2208261_2208942_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2208907_2209258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2209290_2210502_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2210842_2211472_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2211520_2212537_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2212783_2212999_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2213051_2213501_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2213580_2215326_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2215417_2217289_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2217733_2218450_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2219887_2220757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2220713_2220941_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2221909_2222824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2222869_2223892_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2223960_2225010_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046607.1|2225626_2225809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243219.1|2226093_2226402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2226568_2227972_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046608.1|2228064_2228229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2228550_2228775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2228785_2229997_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036774710.1|2230391_2231291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|2231464_2231866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2232112_2233156_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2233275_2233512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2234300_2235854_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2238034_2238262_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2239132_2240107_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017375736.1|2240833_2241916_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_017375735.1|2241958_2242609_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375734.1|2242831_2243203_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_027243178.1|2243313_2244675_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155046609.1|2246395_2246602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2246912_2247995_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2247991_2248303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2249348_2250323_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2251329_2252109_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2252570_2253788_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	2266637	2327605	3194760	integrase,transposase	Staphylococcus_phage(30.0%)	47	2274490:2274549	2324911:2325671
WP_144420638.1|2266637_2267720_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2267716_2268028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2269525_2270461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2271053_2272199_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2274441_2275605_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2274490:2274549	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|2275633_2275858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2277205_2278381_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2278726_2281237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2281295_2282108_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377669.1|2282548_2283253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2283302_2284277_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2284381_2285713_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2285911_2285980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2286111_2287554_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2287945_2289358_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2290047_2290494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2291088_2291937_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2292190_2293249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2293240_2294947_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2295018_2296752_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2297048_2297615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2297739_2298393_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2298419_2299880_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2299976_2300954_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2301423_2302827_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2303352_2303646_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2303872_2304637_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2304844_2305072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2305135_2305318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2305880_2306060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376902.1|2306123_2306435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2307289_2307994_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2308191_2308332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2308736_2309261_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|2309407_2310664_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2310731_2311211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2311651_2313055_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420632.1|2313469_2315785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2316357_2318250_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2318421_2319396_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2319699_2320506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2320574_2321186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2322667_2322964_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2322960_2323803_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2324193_2324979_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2324983_2326387_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2324911:2325671	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2326660_2327605_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	2348447	2376100	3194760	transposase,protease	Staphylococcus_phage(25.0%)	28	NA	NA
WP_017377305.1|2348447_2349749_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2349830_2350436_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2350548_2351853_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2352453_2353329_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2353444_2354116_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2354295_2355651_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2355771_2356509_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2356587_2357304_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2357952_2359227_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2359257_2359833_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2359877_2360843_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2361306_2362215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046610.1|2362527_2362854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2362998_2363427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2363412_2364357_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2364561_2364714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2364742_2365477_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2365571_2365832_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2366050_2367016_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|2366992_2367289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2367479_2367929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2368188_2368617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2368712_2369213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2369149_2369311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2370191_2370413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2371911_2372589_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2373903_2374242_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2375125_2376100_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 30
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	2415345	2542809	3194760	tRNA,transposase	Burkholderia_virus(25.0%)	105	NA	NA
WP_080999971.1|2415345_2416749_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2416862_2417438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2418683_2418911_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2419200_2419740_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2420049_2421537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2421588_2422014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2422232_2423636_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2423632_2424010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2423969_2424515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2424910_2426137_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2426737_2428390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2428326_2428521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963645.1|2428853_2430044_-	MFS transporter	NA	NA	NA	NA	NA
WP_027243147.1|2430292_2432965_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2433253_2434090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2434750_2435641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2436109_2437084_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876012.1|2437568_2438972_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2439117_2440521_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|2440605_2442420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2444331_2445735_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2445768_2447298_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2447333_2448794_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_027242908.1|2448768_2449728_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376200.1|2449805_2453312_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_017376201.1|2453335_2453905_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_027242907.1|2454118_2455273_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376204.1|2455291_2456065_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|2456064_2456511_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376206.1|2456528_2457578_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_017376207.1|2457688_2458222_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_036771893.1|2458302_2460720_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_027242906.1|2461004_2462072_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_017376209.1|2464274_2465339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376210.1|2465328_2466357_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376211.1|2466353_2466893_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376212.1|2467429_2469340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420622.1|2469784_2471362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|2471458_2472334_-	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_080963646.1|2472422_2473322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063514.1|2473236_2473983_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_017376216.1|2473990_2474548_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_017376217.1|2474551_2475289_-	UMP kinase	NA	NA	NA	NA	NA
WP_017376218.1|2475292_2476171_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376219.1|2476335_2477103_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376220.1|2477509_2478319_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376221.1|2478396_2481054_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|2481057_2482095_+	asparaginase	NA	NA	NA	NA	NA
WP_017376223.1|2482096_2482918_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376224.1|2483048_2483933_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_036773116.1|2484245_2485220_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2485272_2486268_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2486310_2487285_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376319.1|2487909_2488590_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017376318.1|2488589_2489399_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027242903.1|2489472_2493153_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_026063524.1|2493162_2494650_-	ribonuclease G	NA	NA	NA	NA	NA
WP_017376313.1|2494659_2495277_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_017376312.1|2495346_2495865_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376311.1|2495861_2496761_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2496776_2497820_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376309.1|2498017_2498305_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2498425_2499886_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2499965_2501402_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2501526_2502501_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2504691_2505453_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2506610_2506838_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2507791_2508004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2508021_2508339_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2508365_2509055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2509395_2509599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2509730_2510666_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2510678_2511461_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2511590_2511902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2512245_2512572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2512596_2513052_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2513041_2514094_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2514096_2515560_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2515694_2515922_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2517338_2517803_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2518059_2518875_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2519003_2521316_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2521432_2521960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2522651_2523929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2523939_2524191_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2524224_2524746_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2524915_2525902_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2525992_2526808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2527236_2527632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2527604_2527832_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_047927746.1|2528800_2529388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2529990_2530662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875918.1|2530806_2531388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420767.1|2531430_2532108_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243185.1|2532386_2533343_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_017377736.1|2533402_2534068_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017377737.1|2534101_2534647_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_155046615.1|2534926_2535088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774946.1|2535784_2536399_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_144420620.1|2536325_2537528_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875923.1|2537513_2538509_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2538512_2538917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2539884_2540112_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2541080_2541677_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046616.1|2541645_2542809_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
>prophage 31
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	2552530	2603944	3194760	tRNA,transposase	Bacillus_phage(20.0%)	55	NA	NA
WP_048876031.1|2552530_2553934_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|2554039_2554264_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2554446_2555268_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|2555413_2555668_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377841.1|2556056_2557841_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|2557929_2558649_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2558810_2559017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2559016_2559253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2559265_2559619_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2560156_2560990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2561082_2561280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2561377_2562763_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2562889_2563480_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2564511_2564799_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2564858_2565023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2565019_2566390_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2566756_2568169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2568238_2569009_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2569501_2569789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2571265_2571559_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2571516_2572338_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2572482_2572707_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155046618.1|2572961_2573489_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|2573665_2573926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2573844_2574000_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2574098_2575073_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2576401_2576551_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2576667_2576961_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2577769_2578345_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2578422_2579298_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2579362_2579983_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2579967_2581050_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2581283_2581688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2583178_2584480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2584626_2585295_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2586227_2586791_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2586847_2588044_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_017376587.1|2588168_2589533_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376586.1|2589529_2590621_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376585.1|2590875_2591526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2591718_2591913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2592020_2592173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376583.1|2592439_2593567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063543.1|2593656_2594490_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376581.1|2594493_2595144_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_017376580.1|2595133_2595973_-	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_016210074.1|2595978_2596605_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376579.1|2596765_2597308_+	septation protein A	NA	NA	NA	NA	NA
WP_017376578.1|2597391_2597694_+	YciI family protein	NA	NA	NA	NA	NA
WP_144420763.1|2597711_2597954_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376576.1|2598052_2598325_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376575.1|2598363_2599002_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376574.1|2599034_2600126_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376573.1|2600297_2602040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2602969_2603944_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 32
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	2613238	2731699	3194760	tRNA,transposase	Staphylococcus_phage(29.63%)	108	NA	NA
WP_080999966.1|2613238_2614588_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2614885_2615443_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2615536_2616043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2616547_2617243_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|2617373_2618162_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2618195_2619599_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2620022_2620997_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2621253_2621481_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2622568_2623099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2623095_2624628_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2624624_2625575_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2625995_2626628_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2626870_2627068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2627417_2627846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2627923_2628919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2629063_2629315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2629419_2630064_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2630299_2630797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2631308_2632283_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2632653_2632947_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2633759_2634095_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2634415_2635954_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2636106_2637205_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2637443_2638643_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2638673_2639300_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2639328_2640213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2640346_2640577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2640714_2641956_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_144420613.1|2642235_2642607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2644738_2644900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2645275_2646403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2646519_2647182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2647267_2647528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2647946_2648708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2650769_2651429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2651529_2652180_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2652327_2653017_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377795.1|2653039_2654203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2654407_2654659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619442.1|2655182_2655845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2655978_2656953_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376009.1|2658307_2658598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376008.1|2658920_2659958_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376007.1|2659988_2661443_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376006.1|2661452_2662637_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376005.1|2662710_2663718_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376004.1|2663786_2665790_-	transketolase	NA	NA	NA	NA	NA
WP_017376003.1|2666241_2667402_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376001.1|2667638_2668754_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376000.1|2668916_2669441_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017375999.1|2669440_2669971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2671630_2672506_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2672626_2673127_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2673123_2673390_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2673555_2674530_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2674709_2675330_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2675636_2677040_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771922.1|2677874_2679065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|2679631_2680099_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|2680600_2680855_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|2681056_2681560_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|2681776_2682382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2682542_2683226_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2683301_2684081_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|2684067_2684928_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|2685051_2685417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377271.1|2685802_2686132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2686542_2687517_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377273.1|2688051_2688291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420610.1|2688284_2689664_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	3.3e-36
WP_017377275.1|2690698_2691421_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2691412_2691781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2692043_2693345_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2693440_2693884_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2693887_2694397_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2694389_2697203_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2697699_2698632_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2698736_2699663_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2699841_2701380_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2701553_2701814_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2703088_2703697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2703743_2704472_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2704718_2704856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619438.1|2706006_2706558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2706792_2707704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2707963_2708260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2708604_2709758_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2710354_2710903_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2711006_2711570_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2711787_2712546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2713821_2714049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2714271_2714451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2714706_2715963_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2716030_2716675_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_017378393.1|2717479_2717686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378392.1|2717956_2718109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816949.1|2718686_2719085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378390.1|2719278_2720856_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378389.1|2720989_2721931_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378388.1|2721932_2722706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963621.1|2724314_2724521_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2724787_2725075_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378384.1|2725080_2727462_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|2727474_2728470_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_016210495.1|2728601_2728961_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378382.1|2729003_2729198_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|2729232_2729763_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378381.1|2729767_2731699_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
>prophage 33
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	2769477	2822506	3194760	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2769477_2770452_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2770608_2772183_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2772407_2772686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2772755_2773631_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2773640_2774801_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2774915_2776064_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2776074_2778876_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2778982_2779681_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2779693_2781457_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2781460_2781808_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2781801_2782176_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2783123_2784407_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2784816_2786112_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2786467_2787013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046622.1|2787606_2788122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2788133_2789513_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2789748_2790183_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2790179_2791532_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2791531_2792647_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2792647_2793664_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2793653_2795324_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2795343_2795679_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2795706_2797146_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2797142_2798189_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2798331_2799828_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2800123_2801125_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2801230_2801842_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2801962_2802340_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2802390_2803797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2803790_2804858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2804964_2806566_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2806814_2807732_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2807800_2809495_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2809729_2810659_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2810689_2812093_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2812323_2813028_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2813094_2813751_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2813761_2814643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2814813_2817483_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2817843_2818818_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2818897_2819869_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2819922_2820897_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2821016_2821238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2821301_2821610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2821534_2822506_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	2837072	2891333	3194760	transposase	Staphylococcus_phage(37.5%)	51	NA	NA
WP_026063658.1|2837072_2837801_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2838110_2838365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2839078_2841733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2841771_2842062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2842178_2843477_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2844047_2844536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2844516_2844819_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2845065_2845554_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2845587_2846226_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2846347_2846887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2846976_2848203_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2848815_2849073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2849159_2850059_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2850203_2850470_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2850461_2850611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2850838_2851714_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2851843_2852071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2852137_2852332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2852390_2853365_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2853402_2853591_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2853591_2855364_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2855353_2856346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2856953_2857646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2858132_2858702_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2858698_2859673_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2859712_2860216_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2860306_2861710_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2862408_2862594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2862699_2864103_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046624.1|2864149_2864680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2864713_2866141_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|2867426_2869796_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2869871_2870690_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2871041_2871587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2872069_2873308_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2873284_2874259_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017375625.1|2874351_2874579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|2874583_2875075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243039.1|2875747_2876635_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_027243038.1|2876724_2878215_-	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_017376549.1|2878238_2879120_-	ROK family protein	NA	NA	NA	NA	NA
WP_017376548.1|2879116_2879839_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376547.1|2880538_2881330_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|2881516_2881762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420598.1|2881913_2882144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376543.1|2882173_2882953_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_047927468.1|2882978_2883284_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_144420752.1|2883280_2884174_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_027243035.1|2884529_2885828_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376538.1|2888430_2889612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2889905_2891333_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	2898919	2948476	3194760	tRNA,transposase	Bodo_saltans_virus(14.29%)	44	NA	NA
WP_062312049.1|2898919_2900287_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2900779_2901259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2901438_2903502_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2903510_2904236_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2904863_2905577_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2905581_2906112_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2906346_2906580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2906692_2906941_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2907748_2909941_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2909958_2910267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2910920_2912630_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2912823_2912979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2914381_2915257_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2915582_2916344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2916568_2917300_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2917296_2917833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2917886_2918651_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2918653_2920231_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2920237_2920714_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2920689_2921121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2921153_2921909_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2922083_2922371_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2922753_2922978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2923317_2924481_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2924515_2925493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2925486_2926173_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2926111_2927227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2927506_2928112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2928349_2928829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2930651_2931305_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2931417_2931969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2932068_2933043_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2933328_2933853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2934550_2935375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2935630_2935987_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2935983_2937387_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2937506_2938067_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2938224_2938791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275260.1|2938993_2941204_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_027243087.1|2941467_2942163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2942203_2942416_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2943988_2945098_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2945153_2946635_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2947072_2948476_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP039092	Piscirickettsia salmonis strain Psal-114 chromosome, complete genome	3194760	3076152	3141401	3194760	transposase,protease	Hokovirus(14.29%)	56	NA	NA
WP_017376170.1|3076152_3077253_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3077610_3078585_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3078721_3079600_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3079607_3079838_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3079891_3080896_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3081114_3081942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3082023_3083412_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3083699_3085100_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3085194_3086121_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3086117_3087254_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3087250_3088258_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3088254_3089418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3089427_3090279_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3090310_3091483_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3091479_3092868_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3092896_3093304_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3093323_3094331_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3094327_3095200_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3095196_3096057_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3096058_3098329_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3098330_3099476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3099522_3100008_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3100047_3100671_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3106350_3107103_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155046626.1|3107705_3107873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243062.1|3108434_3109058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3109162_3109951_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3109950_3110682_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3110715_3112443_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3112456_3113518_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3113832_3115047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3115179_3115704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3116321_3117170_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3117156_3117855_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3117909_3118671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3118663_3119086_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3119215_3119767_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3119822_3120785_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3120785_3121001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3121187_3121997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3121976_3122819_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3122815_3124060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3124198_3125287_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3125304_3125805_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3125992_3126592_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3126597_3127761_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3127793_3128747_+	glutathione synthase	NA	NA	NA	NA	NA
WP_017376261.1|3129110_3130175_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3130171_3133234_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3133386_3133839_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3133870_3134227_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3134645_3135419_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376269.1|3138042_3138333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3138557_3139433_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3139429_3139987_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3139997_3141401_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039093	Piscirickettsia salmonis strain Psal-114 plasmid unnamed1, complete sequence	176237	0	118617	176237	portal,terminase,integrase,transposase	Streptococcus_phage(39.22%)	123	11253:11312	118983:120718
WP_017377655.1|1412_1658_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|1654_2041_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|2128_2857_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|2835_3456_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|3801_4488_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|5437_5800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|5802_7542_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|7943_8096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|8123_8807_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|8888_9866_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|9941_10112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|10152_10881_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
11253:11312	attL	GATGTATCTTAGCTAAATCTGTCAGCACCTTTTTAATTTTAGTATCAACAACCTGTTTTT	NA	NA	NA	NA
WP_036771293.1|11426_11693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420835.1|11988_13902_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|14308_15037_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_080999960.1|15104_15257_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|15673_15838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|15858_17145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|17327_18056_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|18183_19161_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046631.1|19235_19886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046632.1|21895_22045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126795.1|22517_22778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|22781_23054_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|23129_23858_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|24427_25399_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|26263_27091_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|27944_28415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|29308_29452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212068.1|30431_30635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|30658_31258_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|31611_32388_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|32748_33477_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|33546_33747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|33665_34637_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027242938.1|35050_35419_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017375972.1|35420_35729_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017375841.1|36173_36383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|36689_36908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242936.1|36904_37357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420845.1|37484_37715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876207.1|38220_39696_-	response regulator	NA	NA	NA	NA	NA
WP_017375966.1|39696_40263_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_146619519.1|40407_40845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|40876_41302_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_036817204.1|41572_42568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817201.1|42871_43279_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017375960.1|43386_44430_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_017375959.1|44731_44965_+	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_146619517.1|45102_45255_-	phosphatase	NA	NA	NA	NA	NA
WP_081078123.1|45284_45647_+	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
WP_036773116.1|46088_47063_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_026063496.1|47631_47997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242932.1|48129_48357_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242931.1|48365_48773_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242930.1|48918_50301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375952.1|50490_50694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242929.1|50889_51273_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|51359_51842_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|51844_53176_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_155046635.1|53284_53815_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.6e-26
WP_087910668.1|53901_54288_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|54325_55060_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|55106_55820_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_144420848.1|57198_57384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243190.1|57387_60732_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017377509.1|60912_61641_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|61734_62709_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|63022_63385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|63424_63934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|64165_65146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|65611_66589_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|67069_68047_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|68061_68223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|68440_68695_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|68684_68972_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_036771347.1|69466_70444_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|71444_71657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|71814_72792_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_075317322.1|72778_74293_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_047927782.1|75088_75478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|75393_76371_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_048876196.1|76400_77549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243215.1|79362_80385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|80867_81596_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_048876194.1|82835_83369_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|83549_83891_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|84071_84338_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|84410_86276_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|86443_86728_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|87071_87800_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|87881_88373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|89105_89333_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|90884_91313_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|91248_91635_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|91664_92393_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|92404_92554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|92800_93529_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|94906_95869_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|95892_96222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|96288_97329_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|97342_97534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|97738_98308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|98350_98650_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155046638.1|98646_99111_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|99384_100113_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|100286_101060_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|101773_102709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|102983_103712_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046639.1|103877_104081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|104180_107522_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|107679_108408_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|108701_109097_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|109149_109878_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|110361_111090_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|111260_111830_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|111834_112518_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|112669_113398_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_080963627.1|113416_113635_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774644.1|114614_115676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|116184_116931_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|116931_117336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|117642_118617_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
118983:120718	attR	GATGTATCTTAGCTAAATCTGTCAGCACCTTTTTAATTTTAGTATCAACAACCTGTTTTTTAGGTTGATACCGATAAACTGATCGGCCAATACGGCACATCTTGCATGCTTTATTCCCGCTCAATGCATGAGCTTTGACAGCATAATCAACTAAGTCACGCCGACTCGCTGCGGTTATAGCTTTTTTTCAACAATATCCTTGAGCACTTTGTGCTCTAGGCTAATGTCTGCGTACATCTGTTTCAAACGACGGTTTTCGTCTTCAAACTCTTTTAAACGCTGTAGATCTGAAACGCCCATGCCTTGATATTTGGATCTGAGTTTGTAGTAGCTGCTTTTAGCAATACCATACTGGCGACAAATATCTTCAACTTTAACACCCGCTTGGCCTTCATTAAGCATGGCTACAATTTGTGATTCTGTTAGTTTTGATCGTTTCATCTTCTCTCTCCTGGCTAAGTTAATTTAACAGAAGATTCCACTTATCACTTGTACTATTTTAAGGGAGGGTTACCGAGTTATGTGAGAGCACAGTAGTGGAGTGTGCCGATTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTTGCGACAGAACCCTCCTTGGTTCGCAGCGCCAACATCATATCATTAAATCAAATTGCGACAGAACCATTATAGCTCATCATCTTCATATCTTGTATGTTTAGGATCATTACAAACATACCATCCACTAGAACTAGAATTTGTACATACCCCATACCTTTTAGATAAATCAAAGTACATAGTTGTGCTAGAAGGAGATTGTGATGATTTAGCATCAAAAAGTGAGCCAAAATGATTGTAAGTCGTGACATATAAATTACTTTTATCTGAATTTTTAATATATATTGCGCTGACAGGATCATTTACTCTACTTTCTAAAAACCATTTTAAATTATTAGGTACGTTATCCATAAATGGATCACACTGTTTGAAATAAACCCAATCCCAATCCGTCGTTTTTCCAGCAATATTAGAAGTTAAACAGCTTAAAAACCAACCATCAGATGAAAATGCACGGCCATATAGTGAAAGCATCAATATTCTAGAATTTTTCATATCATAGTATGTTCTATTCAAATAATTTGAATTATACGAACCTGAATACATAGGATAGTAATTATTATCAGATTTATCATAAAACCTCATACCAATTTCATACCAAAATGTATTTACTTTTGATGGTGTTTTAAAAAAGTATTTAGACATTTTATTTGCATCTAAAACAATATTAGTTCCACTTGATTTTGAAATAATTCCATAGTTGCCATACCATTGAATAGATAGATCTTTATTTAAACGAGGTTTTAATTTTCCATCTCTTACATCCCATTTTTGATAAGGGTTATAAATATCACAAGGCCAAAACTCTACATAATCCCATTTATCATCACCTTTGATGACATTTTCTGGTGCAGTCATACATAGAGGGATTCCAAATTGAGATTTAGAGAAAGCAACTCTGCCAAGAGTATCATAAATAGCTTTTTGACTTTCTACATTAGAACATGTTTGAGCGTATAAATAAGATCGAGACGTTTTCATAGAAGAGTCTCTTGATTGAGTTGGAGCTAAACAGTAACCTCCCTGAGTTGTAATTAACTGGCTTGGTATTGTAGGTAAATCTTTAAAT	NA	NA	NA	NA
>prophage 2
NZ_CP039093	Piscirickettsia salmonis strain Psal-114 plasmid unnamed1, complete sequence	176237	124564	126186	176237	transposase	Acinetobacter_phage(50.0%)	3	NA	NA
WP_017375632.1|124564_124900_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|125094_125298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|125391_126186_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
>prophage 3
NZ_CP039093	Piscirickettsia salmonis strain Psal-114 plasmid unnamed1, complete sequence	176237	132556	134974	176237	portal,transposase	unidentified_phage(50.0%)	2	NA	NA
WP_048875857.1|132556_133531_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|134518_134974_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
>prophage 4
NZ_CP039093	Piscirickettsia salmonis strain Psal-114 plasmid unnamed1, complete sequence	176237	139692	146660	176237	transposase	Streptococcus_phage(100.0%)	7	NA	NA
WP_017377509.1|139692_140421_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|140562_141495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|141524_142253_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|142255_142528_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|143378_144107_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|144162_144783_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|145931_146660_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 5
NZ_CP039093	Piscirickettsia salmonis strain Psal-114 plasmid unnamed1, complete sequence	176237	152695	161352	176237	transposase	Streptococcus_phage(75.0%)	8	NA	NA
WP_027243210.1|152695_153430_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.9e-36
WP_017377526.1|153759_154620_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377525.1|155021_155819_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_075275471.1|156359_157334_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_155046640.1|157969_158137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876214.1|158105_158834_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_017377521.1|159342_159696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|160623_161352_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 6
NZ_CP039093	Piscirickettsia salmonis strain Psal-114 plasmid unnamed1, complete sequence	176237	167716	173619	176237	transposase	Staphylococcus_phage(28.57%)	9	NA	NA
WP_075275473.1|167716_167893_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|168009_168717_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|168670_169549_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243193.1|169579_170122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|170393_171098_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|171109_171838_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|171867_172257_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|172279_173008_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|173010_173619_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
>prophage 1
NZ_CP039095	Piscirickettsia salmonis strain Psal-114 plasmid unnamed3, complete sequence	50691	5715	19511	50691	tail,capsid,head,transposase	Moraxella_phage(18.18%)	18	NA	NA
WP_036771639.1|5715_6690_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|6739_7279_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|7292_7877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|8261_8573_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|8569_8995_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|9173_9569_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|9565_9916_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|9915_10338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|10339_10663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|10719_10986_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|10989_13068_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|13060_13402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|13398_14070_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|13999_14785_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|14774_15332_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|15328_18019_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|18077_18506_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|18533_19511_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 1
NZ_CP039096	Piscirickettsia salmonis strain Psal-114 plasmid unnamed4, complete sequence	33468	3315	19337	33468	head,capsid,tail,transposase,integrase,terminase	unidentified_phage(35.71%)	21	NA	NA
WP_036771330.1|3315_4290_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4825_5416_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5646_5907_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5899_6253_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6429_7404_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|7936_8302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|8446_8701_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8684_9041_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|9138_10113_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|10738_11605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|11817_12201_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|12287_12770_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|12772_12958_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|12977_13952_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|14048_14441_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|14476_15058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|15438_16413_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|16486_16702_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|17505_18021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|18366_18924_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|18920_19337_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
