The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	31805	91594	3195216	tRNA,transposase	Staphylococcus_phage(28.57%)	53	NA	NA
WP_036772169.1|31805_32681_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33039_34395_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34486_34993_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34989_35358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36760_38545_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39025_40153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40225_40981_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|41017_43711_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43742_44294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44401_45415_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45535_45760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46115_46877_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47019_47814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|47958_48711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49022_50549_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50687_51761_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|51800_53108_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53082_54252_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54306_55032_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55497_57603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|57817_58282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58301_58811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59195_60137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60418_61870_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155051387.1|61983_62139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773655.1|62336_62741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63301_64276_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|65010_65388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|65977_66952_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773242.1|66991_67546_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|67726_68626_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|68630_69257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|69201_71523_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|71669_72149_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|72145_73297_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|73431_73935_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|74028_75003_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|74992_76306_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|76346_77726_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|77732_79184_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|79209_79578_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378407.1|79596_80664_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|80696_81593_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|81589_82426_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|82561_83014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|83152_83899_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|83879_84443_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|84451_84967_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|85108_87187_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|87186_88137_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|89004_89403_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|89628_89958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|90574_91594_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	123070	241147	3195216	tRNA,transposase,protease	Staphylococcus_phage(12.5%)	105	NA	NA
WP_075278722.1|123070_123946_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|124386_124680_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|124680_124935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|124951_127444_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|127436_128120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|128119_129163_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|129162_130392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|130393_130723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|130719_131919_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|132031_132421_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|132420_133365_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|133484_134882_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|135207_135729_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|135852_136161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|136175_141398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|141788_143795_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|143925_146256_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|146431_147262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|147378_147774_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|147770_148304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|148300_148702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|149096_149417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|149426_150383_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|150892_151417_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|151517_152516_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|152604_153501_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|153574_154861_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|155320_156637_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|156750_156921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|156940_157915_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|158041_158302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|158569_158860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|161398_162439_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|162541_163513_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|163635_164484_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|164635_164923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|165233_165605_+	isochorismatase	NA	NA	NA	NA	NA
WP_017377540.1|166656_166890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|167027_167165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|167178_167391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|167914_168739_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|168877_170011_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|170070_171480_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|171627_173208_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|173974_174970_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|174975_177042_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|177099_178050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|178244_178571_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|178793_180053_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|180312_181188_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|181226_182189_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|187883_188228_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|188324_189248_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|189747_190236_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|190338_191139_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|191149_192901_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|193790_194033_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|194036_194435_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|194666_195542_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|196260_196719_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|196900_197086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|197801_199616_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|200026_200695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|200704_202021_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|202180_203143_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|203223_203379_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|203392_203629_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|203821_205039_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|205016_205475_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|205502_206882_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|206918_207137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|207456_208752_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|208956_209148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|209346_210222_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|210409_211675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|211708_212584_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|212705_213164_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|213187_214108_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|214235_215018_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|215108_216608_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|216921_218805_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|219064_219727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|219793_220903_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|220914_221559_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|221577_222564_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|222648_223725_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|223926_224751_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|225053_226019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|226337_227390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|227448_228423_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|228758_229187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|229423_229906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|229961_231212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|231314_231533_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|232004_232859_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|232913_233384_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|233680_233917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|234063_234444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|234502_235378_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|236144_237056_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|237172_238021_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|238087_239098_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|239121_239445_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375571.1|239455_239857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|240127_241147_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	314959	357318	3195216	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|314959_315835_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|315915_316548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|316501_317947_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|317981_318401_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|319174_319543_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|319552_320092_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|320252_320684_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|320687_321386_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|321633_322140_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|322182_322551_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|322821_326898_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|326961_331170_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|331331_331706_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|331810_332284_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|332299_334411_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|334438_335629_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|335635_335947_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|336069_336708_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|336723_337341_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|337337_337634_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|337648_338473_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|338489_338765_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|338770_339103_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|339115_339850_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|339863_340277_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|340276_340477_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|340476_340734_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|340855_341224_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|341241_341553_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|341568_342111_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|342123_342429_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|342457_342850_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|342862_343396_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|343405_343759_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|343769_344270_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|344275_344458_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|344460_344895_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|344895_346218_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|346274_346388_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|346531_346888_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|346913_347303_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|347312_347933_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|347954_348932_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|348980_349379_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|349491_350739_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|350725_351382_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|351466_351745_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|351987_352215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|352347_353142_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|353450_354665_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|355062_355242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|355210_355864_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|356239_356488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|356577_357318_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	375336	425307	3195216	tRNA,transposase	Staphylococcus_phage(25.0%)	57	NA	NA
WP_017376964.1|375336_377817_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|377903_378383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|378355_379396_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|379332_380049_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|380061_380397_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|380433_380904_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|380946_382782_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|382826_383915_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|383936_384998_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|385075_385591_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|385631_386909_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|386923_387775_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|387803_388451_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|388447_389407_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_036774534.1|389498_389924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875861.1|389928_390798_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|390942_391197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|391341_391908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|392013_392454_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_027242664.1|392965_394168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|394451_395426_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046562.1|395607_395751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046563.1|395895_396033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|396049_396265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|396469_397081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|397077_397335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155051391.1|397415_397562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155051393.1|397685_397820_-	phosphatase	NA	NA	NA	NA	NA
WP_017376942.1|397873_398266_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|398395_398944_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|398943_399771_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|399820_401506_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|401583_402045_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|402081_402645_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|402871_403201_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|403181_403406_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|403550_404141_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|404165_405437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|405454_406708_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|406704_407349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|407421_408471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|408572_410210_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|410244_410574_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|410730_411018_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376927.1|411444_411582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046565.1|411544_411838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|412087_413308_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|413366_416165_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|416470_417637_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|417735_418272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|418333_418666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|418923_419826_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|419895_420393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|420538_421942_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|422142_422871_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963630.1|423040_423898_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_048875864.1|424281_425307_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	451379	499518	3195216	transposase	Staphylococcus_phage(100.0%)	42	NA	NA
WP_036774259.1|451379_452354_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377364.1|452503_453340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|453459_454863_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242658.1|456205_457669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856768.1|457744_458539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242656.1|458830_459649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|459666_460260_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376894.1|460476_460710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242655.1|460933_461830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155050372.1|462125_462905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376891.1|463074_463977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|463973_465197_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_027242653.1|465214_466141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|466156_467197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242651.1|467311_467722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376888.1|467774_468278_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_017376887.1|468270_469017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376886.1|469019_470150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|470154_470394_+	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_027242650.1|472883_473372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|473374_474451_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_017376878.1|474443_475097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875870.1|475103_475529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|475565_478565_+	ATPase AAA	NA	NA	NA	NA	NA
WP_027242646.1|478626_480129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|480580_482200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|482241_484545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376870.1|484821_485718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|485720_489047_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_144420818.1|489248_489437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|489448_489925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|489967_490195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|490376_490910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|490940_491282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772347.1|491284_491701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876253.1|491862_492519_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036771639.1|492515_493490_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|493931_494195_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|494622_495597_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_087910671.1|495984_496449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910670.1|496542_496728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|498543_499518_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 6
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	504322	559005	3195216	transposase	Streptococcus_phage(22.22%)	52	NA	NA
WP_048875872.1|504322_505606_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|505778_505916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|505912_507316_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|507429_507867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|507987_508416_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|508663_509101_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|509532_510921_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|511367_512861_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|513055_513811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|514310_514541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|515645_516656_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|516652_516874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|517592_518534_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|519061_519460_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|519399_520254_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|520345_520627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|520712_521390_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|521435_522716_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|522891_523941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|524019_524820_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|524833_525628_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|525730_526750_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|526796_527408_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|527411_528098_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|528094_528637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|528929_530117_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|530361_531087_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|531272_532061_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|532057_532453_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|532845_533886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|533882_535286_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|537701_537959_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|537998_539384_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155050374.1|539701_540811_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.6e-49
WP_017377120.1|540844_542095_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|542095_542728_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|543017_543470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|543515_544358_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|544392_544884_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|545079_547047_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|547274_547679_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|547656_548685_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|548671_549460_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|549886_551290_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377110.1|551491_552502_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_075275363.1|552514_552982_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377107.1|553311_554682_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_017377106.1|554984_555455_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377105.1|555732_556008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|556018_557422_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069971661.1|557596_558034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|558030_559005_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 7
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	590796	724190	3195216	tRNA,transposase,plate	Staphylococcus_phage(13.64%)	111	NA	NA
WP_036772726.1|590796_591345_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|592097_593477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|593836_595300_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|595483_596296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|596760_598755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|599149_600529_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|600566_601004_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|601046_601763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|603309_603840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|603906_605727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|606291_606798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|606882_608286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|608400_608655_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|608807_609080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|609655_609838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|609954_610530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377063.1|610526_610697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|611597_611840_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|612142_613234_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|613214_614168_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|614391_615876_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|615915_616419_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|616678_617854_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|618001_618406_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|618562_619438_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|619472_619826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|623155_623581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|623811_624948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|624934_626257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|626249_627368_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|627488_628022_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|628160_629798_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|629802_630024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|630132_631146_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|631417_633646_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_026063593.1|633626_634331_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|634565_634895_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|636295_636514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|636572_637448_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|637440_638307_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|638374_639694_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|640163_640724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|641042_641969_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|642864_643773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|647469_648309_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|648495_648711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|648759_649335_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|649331_649670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|649838_650828_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|651817_652720_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875883.1|652979_653516_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|653660_654578_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|655012_656023_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|656830_657367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|658579_658927_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|659071_660031_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|660132_660915_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|661047_662007_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|662031_662436_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|662464_663139_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|663238_664954_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|664950_665313_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|665327_666482_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|666485_667493_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|667495_668512_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|668727_669813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|669919_670312_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|670444_671728_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|671743_673045_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|673062_674865_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|674869_675862_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|675942_677019_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|677116_678091_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|678158_679130_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|679313_679583_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|680184_681471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|681535_682216_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376024.1|687871_688120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375775.1|688197_688392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275355.1|688439_689414_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_027242570.1|689627_690767_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|690975_692346_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|692724_693717_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|693720_694236_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|694232_695072_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|695104_696655_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|696762_697134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|698354_698516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|699096_700500_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|700534_700972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|700995_701970_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|702028_702457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|702644_703451_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|703525_703918_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|703962_704784_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|704796_705780_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|705781_707050_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|707056_709561_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|709691_710717_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|710713_711424_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|711348_712179_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|712328_712712_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|712746_713646_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|713691_714363_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|714445_715021_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|715119_715920_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|716061_716919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|717781_718918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|718984_722155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|722167_722878_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|722882_724190_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	732832	779149	3195216	transposase,plate	Staphylococcus_phage(21.43%)	51	NA	NA
WP_017376356.1|732832_733231_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|733227_734916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|734897_735854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|735896_736412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|736516_737449_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|737668_738055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|738072_738717_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|738867_739707_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|739782_740385_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|740385_741240_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|741597_741909_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|741933_743322_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|743477_744209_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|744205_744733_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|744764_745322_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|745327_746308_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|746447_747248_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|747251_748019_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|748015_748480_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|748502_749156_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|749159_749507_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|749540_749792_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|749869_751138_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|751140_751899_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|751960_752851_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|752901_753585_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|753594_753942_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_027242846.1|754214_756335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|756326_757199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|757366_759196_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|759363_760005_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|760329_760776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|760793_760967_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|761025_762075_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|762081_763032_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|763086_764031_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|764058_764796_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|764884_765127_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|765201_766425_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|766456_767305_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|767301_768354_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|768490_769111_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|769336_770489_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|771509_772484_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|772480_772651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|773619_774216_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|774184_775345_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|775855_776197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|776300_777335_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|777331_778042_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|778174_779149_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 9
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	787309	841620	3195216	tRNA,protease,transposase	Prochlorococcus_phage(33.33%)	49	NA	NA
WP_017377942.1|787309_787816_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_155048031.1|787897_788263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|788405_789266_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|789363_789909_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|789991_790843_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|790884_793791_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|793851_794049_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|794055_795066_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|795062_796121_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|796135_796915_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|796917_797730_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|797741_798689_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|798699_799992_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|800170_801274_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|801270_801663_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|801675_803052_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|803045_804515_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|804708_805143_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|805438_805615_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|806649_807675_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_155046573.1|808137_808569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|809961_810612_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|811310_812105_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|812284_812929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|813103_814078_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|814478_814736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|816413_817091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|817324_818149_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|818242_818956_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|819045_820137_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|820208_820790_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|820795_821422_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|821518_822466_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|822812_823475_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|823645_824305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|824473_825733_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|825729_826815_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|826807_827689_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|827677_828928_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|830313_830634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|830892_831159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|831649_831868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|832853_833075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|833071_834154_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|834164_834536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|834532_834712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|837415_837691_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|838526_839984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|840411_841620_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	885300	947813	3195216	tRNA,transposase	Staphylococcus_phage(28.57%)	53	NA	NA
WP_048875904.1|885300_886176_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|886432_886870_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|886930_887563_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|887578_888226_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|888228_890292_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|890618_891911_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|892299_894510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|894526_895183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|897568_898444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|898702_899314_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|899741_902330_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|902432_903194_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|903190_903727_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|903775_904732_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|904809_907995_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|907998_909054_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|909283_909886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|909929_910592_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|910626_910974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046576.1|911442_912387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|912936_914340_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|915458_915803_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|915894_916350_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|916598_916733_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|916725_917367_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|917363_918080_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|918083_919403_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155051395.1|920084_920228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773644.1|921207_923844_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_036773645.1|923885_924971_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|924970_925654_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_017377748.1|925714_927376_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377747.1|927528_927783_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|927861_928179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|928331_928730_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|928811_929450_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|929606_930581_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|930953_931229_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|931778_932063_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|933879_934473_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|935553_936435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|936546_938226_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|938352_939603_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|939678_940140_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|940136_941285_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|941290_941965_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|941961_942618_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|942743_943217_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|943218_943641_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|943627_944647_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|944806_944986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|945204_945486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|946937_947813_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	951715	1018678	3195216	tRNA,transposase,protease	Bacillus_phage(20.0%)	57	NA	NA
WP_048876012.1|951715_953119_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|953477_954245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|954358_955762_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|955758_955920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|956235_957210_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|957450_958734_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|958800_959724_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|961919_964064_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|964085_964292_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|964352_964973_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|965013_965907_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|965992_966718_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|966779_967184_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|967346_969455_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|969578_970628_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|970624_972091_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|972233_973571_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|973638_975129_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|975357_975729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|975879_976707_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|977009_977666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|977613_978537_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|978550_979474_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376987.1|979721_980405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|982104_982332_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_016210338.1|982399_982537_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376989.1|982656_983205_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|983285_983561_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|983560_984610_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|984722_986660_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|986807_988520_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|988588_989308_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|989304_989907_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|990021_990909_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|991099_991447_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|991497_992337_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|992432_993179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|993375_994002_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|994317_994887_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|995030_995729_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|996435_997059_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|997168_998062_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|998168_999779_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|999775_1001071_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|1001092_1003015_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|1003125_1003428_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|1003522_1008409_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1008456_1009779_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1009903_1010998_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1011049_1011988_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1012068_1012653_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1013037_1013928_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1014130_1014622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1014761_1015253_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1015421_1016135_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065653747.1|1016197_1017538_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1017802_1018678_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	1024291	1086818	3195216	transposase	Staphylococcus_phage(33.33%)	57	NA	NA
WP_017377787.1|1024291_1024519_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1024545_1025586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1025652_1026222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1026452_1026857_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1026869_1027010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1027104_1028304_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1028324_1028936_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1029137_1029899_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1030194_1031121_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1031281_1032238_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1032382_1032652_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1032918_1033893_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1034046_1034274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1034390_1034816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1034972_1035902_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1036348_1036879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046580.1|1037263_1037506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1037983_1038295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1038634_1039801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1041988_1042960_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1043562_1043736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1044131_1045049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1045049_1045901_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1046341_1047388_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1047377_1049369_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1049478_1049853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1050106_1050289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1050550_1051252_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420709.1|1051252_1051672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619460.1|1053325_1056109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1056344_1057637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1058123_1059029_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376296.1|1059806_1060523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1060808_1061570_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1061602_1063006_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1063002_1063167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1063226_1063514_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1064258_1064987_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1064955_1065702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046685.1|1065752_1066172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1066168_1067143_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1067299_1067617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772457.1|1070092_1070401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1070476_1070749_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1073282_1073720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1074321_1075509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1075779_1077414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1077464_1078193_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1079620_1080583_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1080806_1081802_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1081829_1082765_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1082808_1083270_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1083248_1083866_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1083895_1084870_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1084924_1085392_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1085404_1086049_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1086089_1086818_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 13
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	1095518	1145086	3195216	transposase	Acinetobacter_phage(22.22%)	39	NA	NA
WP_082300708.1|1095518_1096079_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1097403_1097799_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1097807_1098164_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1098156_1099032_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1099117_1099696_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1099653_1099947_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1100907_1102419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1102666_1104070_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1104275_1104710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1104792_1105497_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1105755_1106244_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1106272_1106947_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1107187_1108063_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275340.1|1108593_1109202_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1109472_1109931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1110209_1110599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1110784_1111600_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1111822_1112728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1112891_1113653_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1113656_1114523_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1114608_1115220_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1115598_1116846_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1116997_1117699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1117996_1118170_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1118659_1119160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1120238_1120466_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774233.1|1120518_1120752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1120780_1121461_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1121483_1123658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1123903_1124974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1124970_1126374_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155049741.1|1126564_1127008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1127079_1127901_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1128567_1130067_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1130370_1133064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1133060_1136462_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_048875961.1|1138049_1139453_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1140531_1141203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1144111_1145086_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 14
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	1169809	1226203	3195216	tRNA,transposase	Staphylococcus_phage(37.5%)	52	NA	NA
WP_053093677.1|1169809_1170529_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1170756_1170933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1171181_1171505_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1171593_1173612_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1173634_1174588_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1174753_1175941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1176654_1177293_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1177590_1178586_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_027242772.1|1178726_1179773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1179765_1180791_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1180857_1182888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1184194_1184422_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1185765_1185909_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1185905_1186598_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242771.1|1186864_1187182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|1187324_1187735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1187891_1188218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1188364_1189402_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1189443_1189689_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_129556541.1|1189813_1190128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1190135_1191710_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1191864_1192434_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1192743_1194546_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1194542_1195484_+	signal peptidase I	NA	NA	NA	NA	NA
WP_036771308.1|1195511_1195733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242761.1|1195895_1196570_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1196575_1197475_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1197488_1198232_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1198234_1198966_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1198962_1199346_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1199483_1200731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1201141_1202287_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1202279_1202633_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1202913_1203456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1204100_1204289_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1204308_1205283_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1205326_1206202_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1206555_1207383_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1207482_1207644_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1208294_1209635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1210686_1210914_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|1211055_1212417_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1212512_1213172_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144420701.1|1214012_1214369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1214965_1216525_-	APC family permease	NA	NA	NA	NA	NA
WP_027243001.1|1216885_1218856_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375893.1|1219053_1220124_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1220181_1220388_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1220394_1221870_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1222005_1222569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1222738_1224142_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1225108_1226203_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	1242445	1290170	3195216	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_036772169.1|1242445_1243321_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1243390_1244494_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1244561_1244885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1245041_1245824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1245959_1246937_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1247010_1249002_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1249057_1249339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1249592_1250792_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_051929862.1|1253223_1253736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1253922_1254798_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1254834_1254999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1256207_1256621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1256631_1256967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1257111_1258230_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1258459_1258726_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1260008_1260236_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1260246_1260753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1260830_1261448_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1261579_1262812_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1262801_1263464_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1263738_1264995_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1265132_1265792_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1265866_1266568_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1267315_1268290_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1269498_1269852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1270065_1270260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1270327_1270840_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1270977_1271832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1271880_1272525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1272558_1273203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243125.1|1273725_1274019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1274117_1274900_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1274982_1275933_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1277975_1280816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1280838_1281420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1281539_1282268_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1282413_1283388_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1283503_1284409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1285007_1285754_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1286006_1286399_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1286436_1287084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1288799_1290170_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	1313989	1355199	3195216	transposase	Enterobacteria_phage(16.67%)	37	NA	NA
WP_048876023.1|1313989_1315093_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1315183_1316336_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1316749_1317601_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|1317738_1317888_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1318512_1320879_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1320926_1322123_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1322691_1325124_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1325445_1326945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1327053_1327626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1327940_1329410_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1329482_1330232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1330235_1331009_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1331107_1332058_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1332197_1333640_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1333855_1335040_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1335163_1335850_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1335985_1336570_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1336659_1336989_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1337324_1337564_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_017377970.1|1337612_1337804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1338578_1338872_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1339020_1339182_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1339696_1340236_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1340574_1341219_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1341552_1342203_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1342726_1343779_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1343796_1346877_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1347042_1347291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1347356_1348232_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1349154_1349661_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1349678_1349876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1349894_1350038_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1350105_1350279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1350483_1351797_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1351806_1352070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1352128_1353103_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1354971_1355199_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 17
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	1386416	1435315	3195216	tRNA,transposase	Bacillus_thuringiensis_phage(25.0%)	40	NA	NA
WP_036772026.1|1386416_1387292_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1387396_1390699_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1390695_1392519_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1392558_1392957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1393065_1394082_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1394516_1395971_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1396052_1399109_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_144420694.1|1399402_1399639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081329473.1|1400499_1400919_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376676.1|1401291_1401756_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1401828_1402830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1405722_1406055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1406416_1406560_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1406547_1407492_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080963606.1|1407495_1407882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1407703_1408042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1408416_1409016_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1409015_1409363_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1409513_1410497_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1411406_1411721_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1411869_1412028_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1411999_1412929_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1413843_1414260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1415388_1416105_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1416853_1417012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1417060_1417636_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1417780_1418059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1418123_1418999_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1419164_1423031_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1423186_1423996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1424045_1424867_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1425066_1426299_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1426469_1427195_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1427237_1428776_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1428782_1430168_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1430481_1431531_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1432090_1432468_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|1432659_1433535_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1434516_1434744_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1434796_1435315_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	1439613	1508504	3195216	transposase	Staphylococcus_phage(20.0%)	60	NA	NA
WP_048875984.1|1439613_1440150_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876016.1|1440294_1440705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375877.1|1440975_1441224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|1441584_1441920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375878.1|1442257_1442530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243180.1|1442601_1443861_-	phosphoesterase	NA	NA	NA	NA	NA
WP_017375881.1|1443945_1445211_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_026063485.1|1445369_1445852_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_036772592.1|1445929_1447390_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_155046587.1|1447512_1447653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|1448066_1448567_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_017375698.1|1454681_1455875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243221.1|1456218_1457847_+	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_027243222.1|1457862_1459011_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_051929845.1|1459085_1459910_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1460313_1461288_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1461473_1462067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1462247_1462712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1463106_1463388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1463384_1464788_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1465439_1465820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1466059_1466716_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1466860_1467157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1467216_1467504_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_027243051.1|1467787_1467997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772296.1|1468693_1469071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1469270_1470320_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1470296_1472114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1472384_1472963_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1472990_1473455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1473491_1474949_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1475010_1476498_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1477267_1477870_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1478431_1478902_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1480549_1481293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1481444_1481876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1484513_1485860_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1485947_1487753_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1488218_1489016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1489400_1489862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1490084_1491059_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1491101_1491224_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1491295_1493251_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1493640_1493826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1494147_1495137_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1495549_1497175_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1497283_1497598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1497893_1499279_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1499443_1499671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1499811_1500270_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1500470_1500656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1500724_1501552_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1502006_1502531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420684.1|1502713_1502962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1503131_1504085_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1504279_1505254_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1505381_1506407_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1507059_1507347_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1507406_1507739_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1507943_1508504_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
>prophage 19
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	1517225	1625179	3195216	integrase,tRNA,transposase,protease	Staphylococcus_phage(21.74%)	104	1506076:1506135	1576501:1577111
1506076:1506135	attL	CCACCACGTGTCACTGATAAGTGGACGTGCGTATTCCAATTTAAACTCTGGCCGAAAGTA	NA	NA	NA	NA
WP_017376809.1|1517225_1518995_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_017376808.1|1519133_1520177_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376807.1|1520190_1520934_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_062312151.1|1521031_1521364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1521425_1521605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243094.1|1521667_1522375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420791.1|1523158_1524370_+	protein kinase	NA	NA	NA	NA	NA
WP_017376801.1|1524425_1525250_-	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_017376798.1|1526437_1527073_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017376797.1|1527354_1527714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1527987_1530273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420683.1|1530261_1530918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|1531094_1531727_+	MarC family protein	NA	NA	NA	NA	NA
WP_155049745.1|1531762_1531939_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_027243098.1|1532013_1533159_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243099.1|1533394_1534708_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_155046588.1|1535823_1536033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420682.1|1536567_1536729_-	phosphatase	NA	NA	NA	NA	NA
WP_017376785.1|1538135_1539041_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376784.1|1539281_1539467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242578.1|1539503_1540040_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_027242577.1|1540057_1541359_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_048876008.1|1541355_1542330_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_155046589.1|1542409_1542559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1542738_1542903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1542904_1543780_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1544095_1545016_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1545031_1545415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1545741_1546698_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_144420678.1|1546965_1547244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243017.1|1547742_1549086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|1549259_1549403_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1549482_1550457_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1550604_1552476_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1552508_1552607_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1552842_1553472_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1553455_1553878_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1553884_1555624_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1555624_1556689_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1556692_1557046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1557158_1558127_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1558136_1558448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1558463_1559033_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1559296_1560625_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1560665_1561640_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1562226_1562628_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146619459.1|1563147_1565604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1565806_1566658_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1566703_1568410_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1569881_1570856_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1571218_1571464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1571827_1572856_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1572986_1573190_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420676.1|1573474_1574431_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_047927838.1|1574723_1574969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1574965_1575265_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1575487_1575958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1576568_1576796_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036772851.1|1578018_1578336_+	hypothetical protein	NA	NA	NA	NA	NA
1576501:1577111	attR	TACTTTCGGCCAGAGTTTAAATTGGAATACGCACGTCCACTTATCAGTGACACGTGGTGGTGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGATAGGTTAGCATTGGCTGTATGCAACCGATCATGATTGTAATATCGAATATAGGCCTCAACATCCTCCTTCATAGTATCACGGGTTAAGTGAATCACATTCAACAGCCATTCGTGCTTTAGGCTGCCAAAAAAACGCTCGACAACCGCATTGTCAACGCAAGCACCGACACTGCTCATAGAAGCGGTGATTTTATGCTTCTTCAACAGTTTTCGATATTTTTTACTGGTATACTGCGAACCACGATCACTGTGAAATAACAAGTGTTCTGTCGGCTGCCGCAAGTGAATCGCCATATCCATTGCACGACAAACTAGATTTTCGCTCATTCTCTTATTCATCGCCCAGCCAATCACTTTTCGAGAGTATAAATCAATAACGACCGCAAGATACAACCAGCCTTCAGCAGTTCTAAGGTAGGTAATGTCACCTGCCCATGAGTGATTTGCAATGACTGGATTAAACTGCTGATTCAATACGTTATCTGCAACAGC	NA	NA	NA	NA
WP_027243023.1|1578329_1578572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243024.1|1578922_1580023_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_017377328.1|1580191_1581493_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_047927520.1|1581569_1582073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|1582248_1583652_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1583839_1584697_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1584821_1585457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1585505_1585757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1586012_1586912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1587048_1588122_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1588222_1588636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1588656_1589370_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1589557_1590970_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1591179_1592148_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1592881_1593250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1593253_1593571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1593646_1594621_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1595140_1595641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1595711_1597040_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1597175_1598564_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1598711_1600022_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1600362_1601646_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1601719_1602340_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1602538_1602799_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1603001_1603148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1603123_1603717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1605580_1605799_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1607051_1607822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1607908_1608124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1608220_1609342_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1609608_1610583_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1610845_1611967_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1612259_1612547_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1612519_1613023_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1613103_1613763_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1614104_1615022_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1615151_1615325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1615990_1617349_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_144420789.1|1617540_1617987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376485.1|1618181_1619411_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1619456_1620083_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1620232_1621420_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1621428_1622121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1622242_1623395_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1624195_1625179_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 20
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	1683514	1773829	3195216	tRNA,transposase,protease	Burkholderia_phage(14.29%)	82	NA	NA
WP_036774017.1|1683514_1684390_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1684779_1685118_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1685114_1685711_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1685713_1687708_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1687771_1688710_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1689058_1690033_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1690236_1690434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1690595_1691000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1692583_1693024_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1693350_1694226_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1694238_1694481_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1694887_1695142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1696353_1697319_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1697411_1697723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1697923_1698700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1699529_1699721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1700449_1701499_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1701669_1702443_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1702503_1704093_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1704283_1705375_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1705397_1705715_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1705801_1707079_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1707100_1707937_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1707943_1709578_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1710009_1710369_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1710650_1712009_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1712034_1712277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1712770_1712950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1713205_1714462_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1714575_1714833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1714977_1715988_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1716364_1717219_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1717248_1718082_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036773204.1|1718658_1719432_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1719513_1719834_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1720052_1720958_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1721043_1721442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1721586_1722084_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047927093.1|1723744_1724848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1724946_1725324_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1725403_1726378_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1727922_1728642_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1728725_1729013_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1729297_1730170_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1730126_1730903_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1731107_1731443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1731841_1732198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1732359_1732635_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1732744_1733092_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1733109_1733889_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1733888_1734398_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1734433_1734682_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1734993_1735329_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1735628_1736879_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1736960_1738988_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1739533_1739752_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1739923_1740286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1740434_1741838_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1742119_1743295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1743312_1745310_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1745290_1746271_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1746326_1747169_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_036772544.1|1747168_1747585_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1747565_1747985_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1748007_1748637_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1749205_1751395_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1751406_1752612_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1752596_1754444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1754428_1755667_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1755653_1757522_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1757555_1758809_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1758814_1759672_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1759690_1760419_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1761557_1762349_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1762714_1763002_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|1765124_1765514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1765690_1766449_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1766445_1768845_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1768858_1770136_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1770225_1771524_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1771721_1772615_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1772614_1773829_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 21
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	1784528	1835013	3195216	tRNA,transposase	Vibrio_phage(14.29%)	46	NA	NA
WP_069971651.1|1784528_1785404_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1785776_1786040_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1786346_1788941_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1788937_1789420_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1789397_1790438_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1790612_1791098_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1791205_1793776_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1793809_1794271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1794607_1795483_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1795760_1797521_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1797614_1798280_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1798292_1799798_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1799819_1800350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1800423_1801686_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1801872_1802745_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1802846_1803635_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1803727_1805053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1805406_1806582_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1806750_1807404_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1807559_1809500_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1809496_1810120_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1810284_1811259_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1811530_1812151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1812147_1813551_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1813618_1814035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1814442_1814940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1814936_1815911_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|1815990_1816560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1816704_1817241_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1817245_1817542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1817550_1818156_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1818341_1818740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1818930_1819134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1819278_1819434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1819558_1820011_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1820127_1821600_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1822038_1822503_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1823191_1824442_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1824551_1825022_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1825044_1825638_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1825775_1826825_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1826848_1827772_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1827788_1828250_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1828357_1829176_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1829785_1829929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1834092_1835013_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 22
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	1897335	1912651	3195216	transposase	Staphylococcus_phage(50.0%)	16	NA	NA
WP_017378288.1|1897335_1897557_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1897615_1898590_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1898788_1898953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1898949_1899585_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046602.1|1899861_1900641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1900673_1901435_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1901411_1902401_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1902536_1903412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1903430_1904090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148037443.1|1904116_1904326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1904331_1904778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1904774_1906178_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1906291_1907137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1907281_1908931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1909021_1909807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|1911247_1912651_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	1941324	1983081	3195216	tRNA,transposase	uncultured_Mediterranean_phage(40.0%)	38	NA	NA
WP_144420657.1|1941324_1942386_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1943097_1943259_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1944175_1944715_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1945097_1945514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1945609_1946425_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1946557_1948051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1948236_1948662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1948658_1950719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1951002_1951818_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1951918_1952737_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1952733_1953102_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1953283_1954111_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1954174_1954903_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1955305_1956034_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1956423_1957149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1957183_1961056_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1961256_1962390_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1962403_1962592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1962815_1964174_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_036773947.1|1965780_1966656_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1967167_1967803_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999981.1|1967815_1968289_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_155046603.1|1968216_1968369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929627.1|1968562_1968913_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1968972_1969260_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1969312_1970092_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376415.1|1970516_1971434_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1971485_1972241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1972308_1973583_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376412.1|1973703_1974381_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376411.1|1974581_1976006_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_016209938.1|1975980_1976619_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376410.1|1976981_1977260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376409.1|1977493_1978438_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376408.1|1978459_1980328_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376407.1|1980348_1980702_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_026063528.1|1980740_1981856_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1982040_1983081_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
>prophage 24
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	1987424	2043494	3195216	tRNA,transposase	Klosneuvirus(22.22%)	49	NA	NA
WP_017376399.1|1987424_1990196_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376398.1|1990352_1991585_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1991826_1992489_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376397.1|1992948_1994430_+	MFS transporter	NA	NA	NA	NA	NA
WP_036773116.1|1994627_1995602_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|1996125_1998852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|1999739_2000714_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|2000964_2001669_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|2002908_2003427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|2004394_2005879_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2006003_2007539_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2007561_2007891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2007787_2008003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2009986_2011186_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2011395_2012256_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2012371_2012950_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2013106_2013748_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2013786_2014008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2014000_2014984_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2015377_2015875_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2016019_2016295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2016446_2018129_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2018136_2019159_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2019327_2020329_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2020442_2020781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2021256_2022516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2022724_2022952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2022980_2023199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2023336_2023702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2023769_2024012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2024026_2024362_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2024366_2024804_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_036772812.1|2024829_2026215_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2026325_2026757_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2026862_2028374_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2028664_2030257_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2030457_2032653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772819.1|2032746_2034180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2034222_2034738_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2034737_2035685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2035668_2036334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2036330_2037059_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2037048_2037795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2037778_2038843_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2039047_2040235_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2040291_2041410_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2041857_2042115_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2042394_2043072_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2043290_2043494_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	2063194	2112729	3195216	tRNA,protease,transposase	Burkholderia_virus(20.0%)	41	NA	NA
WP_017377787.1|2063194_2063422_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2063511_2064267_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2064680_2065277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2065356_2068161_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2068141_2069095_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2069087_2070458_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2070628_2072032_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2072803_2073130_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420651.1|2073334_2073988_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_017376600.1|2074307_2074487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2074742_2075999_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2076237_2076384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2076466_2076823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2077318_2077678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2077687_2078071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2078959_2079100_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2079244_2080165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2082322_2082853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2082863_2083919_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2083934_2085974_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2085960_2086791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2086857_2090397_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2090510_2091230_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2091468_2092098_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2092217_2093621_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2093766_2095710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2096227_2097088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2097523_2099269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771696.1|2099683_2101144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2101326_2101926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2102063_2102261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2102461_2102602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2102669_2103449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2104013_2104415_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2104559_2104937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2105396_2106704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2107452_2107710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2107761_2109165_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2109405_2111115_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2111284_2111647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|2111754_2112729_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 26
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	2127298	2254136	3195216	tRNA,transposase,protease	Staphylococcus_phage(14.81%)	117	NA	NA
WP_017377892.1|2127298_2128720_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_026063687.1|2128809_2130408_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377894.1|2130564_2131191_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027242839.1|2131271_2133944_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377896.1|2134426_2135383_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_017377897.1|2135435_2135855_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_048875958.1|2135881_2136745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377899.1|2136734_2137526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2137830_2138802_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2139150_2139459_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2139455_2140112_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2140245_2140731_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2140808_2141330_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2141375_2142269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2142265_2143087_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2143281_2143431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2143658_2144489_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046606.1|2145894_2146065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2146217_2147621_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_048875956.1|2147730_2148972_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2148958_2149690_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2149701_2150979_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2151078_2151453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2151537_2152425_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2152482_2153211_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2153207_2154317_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2154468_2154897_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2154991_2155348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2155340_2156552_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2156548_2157337_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2157499_2158294_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2158743_2159484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2159487_2161986_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2162248_2163205_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2163188_2163950_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2164157_2165132_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2165240_2165996_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2166120_2166366_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2166425_2168699_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2168753_2169056_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2169296_2169590_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2169760_2169940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2170015_2170627_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2170873_2172190_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2172200_2172569_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2172599_2173262_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2173684_2174263_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2174242_2174650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2174773_2175070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2175116_2175992_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876123.1|2176061_2178242_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_017376060.1|2178345_2179695_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_036772012.1|2179768_2180458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2180590_2181778_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376055.1|2182296_2182941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2182937_2184251_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2184455_2184629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2184898_2185372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2185516_2185711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2185975_2186851_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210558.1|2187037_2187793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376051.1|2187866_2189519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376050.1|2189558_2191097_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_087910638.1|2191096_2192797_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_075275404.1|2192885_2194061_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_017376046.1|2194099_2195062_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_017376045.1|2195339_2195762_-	universal stress protein	NA	NA	NA	NA	NA
WP_017376044.1|2196067_2196709_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376043.1|2196837_2198172_+	dihydroorotase	NA	NA	NA	NA	NA
WP_048875952.1|2198286_2198922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771517.1|2199666_2200803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771498.1|2200986_2202717_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_017376037.1|2202706_2203915_+	MFS transporter	NA	NA	NA	NA	NA
WP_075275290.1|2204013_2205015_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420641.1|2205258_2205894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2205913_2206888_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875951.1|2206931_2207768_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2207913_2208333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2208609_2209290_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2209255_2209606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2209638_2210850_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2211190_2211820_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2211868_2212885_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2213131_2213347_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2213399_2213849_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2213928_2215674_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2215765_2217637_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2218081_2218798_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2220235_2221105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2221061_2221289_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2222257_2223172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2223217_2224240_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2224308_2225358_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155051404.1|2225763_2225934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046607.1|2225974_2226157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243219.1|2226441_2226750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2226916_2228320_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046608.1|2228412_2228577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2228898_2229123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2229133_2230345_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036774710.1|2230739_2231639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|2231812_2232214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2232460_2233504_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2233623_2233860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2234648_2236202_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2238382_2238610_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2239480_2240455_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017375736.1|2241181_2242264_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_017375735.1|2242306_2242957_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375734.1|2243179_2243551_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_027243178.1|2243661_2245023_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155046609.1|2246743_2246950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2247260_2248343_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2248339_2248651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2249696_2250671_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2251677_2252457_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2252918_2254136_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	2266985	2327953	3195216	integrase,transposase	Staphylococcus_phage(30.0%)	47	2274838:2274897	2325259:2326019
WP_144420638.1|2266985_2268068_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2268064_2268376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2269873_2270809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2271401_2272547_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2274789_2275953_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2274838:2274897	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|2275981_2276206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2277553_2278729_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2279074_2281585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2281643_2282456_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377669.1|2282896_2283601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2283650_2284625_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2284729_2286061_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2286259_2286328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2286459_2287902_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2288293_2289706_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2290395_2290842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2291436_2292285_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2292538_2293597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2293588_2295295_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2295366_2297100_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2297396_2297963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2298087_2298741_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2298767_2300228_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2300324_2301302_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2301771_2303175_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2303700_2303994_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2304220_2304985_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2305192_2305420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2305483_2305666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2306228_2306408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376902.1|2306471_2306783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2307637_2308342_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2308539_2308680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2309084_2309609_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|2309755_2311012_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2311079_2311559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2311999_2313403_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420632.1|2313817_2316133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2316705_2318598_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2318769_2319744_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2320047_2320854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2320922_2321534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2323015_2323312_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2323308_2324151_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2324541_2325327_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2325331_2326735_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2325259:2326019	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2327008_2327953_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	2348795	2376448	3195216	protease,transposase	Staphylococcus_phage(25.0%)	28	NA	NA
WP_017377305.1|2348795_2350097_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2350178_2350784_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2350896_2352201_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2352801_2353677_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2353792_2354464_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2354643_2355999_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2356119_2356857_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2356935_2357652_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2358300_2359575_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2359605_2360181_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2360225_2361191_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2361654_2362563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046610.1|2362875_2363202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2363346_2363775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2363760_2364705_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2364909_2365062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2365090_2365825_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2365919_2366180_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2366398_2367364_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|2367340_2367637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2367827_2368277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2368536_2368965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2369060_2369561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2369497_2369659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2370539_2370761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2372259_2372937_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2374251_2374590_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2375473_2376448_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 29
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	2415693	2449142	3195216	tRNA,transposase	Burkholderia_virus(33.33%)	23	NA	NA
WP_080999971.1|2415693_2417097_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2417210_2417786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2419031_2419259_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2419548_2420088_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2420397_2421885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2421936_2422362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2422580_2423984_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2423980_2424358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2424317_2424863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2425258_2426485_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2427085_2428738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2428674_2428869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963645.1|2429201_2430392_-	MFS transporter	NA	NA	NA	NA	NA
WP_027243147.1|2430640_2433313_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2433601_2434438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2435098_2435989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2436457_2437432_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876012.1|2437916_2439320_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2439465_2440869_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155051406.1|2440953_2442735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2444679_2446083_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2446116_2447646_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2447681_2449142_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 30
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	2484593	2543157	3195216	tRNA,transposase	Burkholderia_virus(28.57%)	55	NA	NA
WP_036773116.1|2484593_2485568_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2485620_2486616_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2486658_2487633_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376319.1|2488257_2488938_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017376318.1|2488937_2489747_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027242903.1|2489820_2493501_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_026063524.1|2493510_2494998_-	ribonuclease G	NA	NA	NA	NA	NA
WP_017376313.1|2495007_2495625_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_017376312.1|2495694_2496213_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376311.1|2496209_2497109_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2497124_2498168_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376309.1|2498365_2498653_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2498773_2500234_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2500313_2501750_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2501874_2502849_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2505039_2505801_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2506958_2507186_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2508139_2508352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2508369_2508687_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2508713_2509403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2509743_2509947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2510078_2511014_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2511026_2511809_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2511938_2512250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2512593_2512920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2512944_2513400_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2513389_2514442_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2514444_2515908_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2516042_2516270_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2517686_2518151_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2518407_2519223_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2519351_2521664_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2521780_2522308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2522999_2524277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2524287_2524539_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2524572_2525094_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2525263_2526250_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2526340_2527156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2527584_2527980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2527952_2528180_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_047927746.1|2529148_2529736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2530338_2531010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875918.1|2531154_2531736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420767.1|2531778_2532456_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243185.1|2532734_2533691_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_017377736.1|2533750_2534416_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017377737.1|2534449_2534995_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_155046615.1|2535274_2535436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774946.1|2536132_2536747_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_144420620.1|2536673_2537876_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875923.1|2537861_2538857_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2538860_2539265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2540232_2540460_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2541428_2542025_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046616.1|2541993_2543157_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
>prophage 31
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	2552878	2604292	3195216	tRNA,transposase	Bacillus_phage(20.0%)	55	NA	NA
WP_048876031.1|2552878_2554282_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|2554387_2554612_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2554794_2555616_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|2555761_2556016_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377841.1|2556404_2558189_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|2558277_2558997_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2559158_2559365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2559364_2559601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2559613_2559967_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2560504_2561338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2561430_2561628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2561725_2563111_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2563237_2563828_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2564859_2565147_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2565206_2565371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2565367_2566738_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2567104_2568517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2568586_2569357_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2569849_2570137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2571613_2571907_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2571864_2572686_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2572830_2573055_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155046618.1|2573309_2573837_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|2574013_2574274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2574192_2574348_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2574446_2575421_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2576749_2576899_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2577015_2577309_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2578117_2578693_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2578770_2579646_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2579710_2580331_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2580315_2581398_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2581631_2582036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2583526_2584828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2584974_2585643_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2586575_2587139_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2587195_2588392_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_017376587.1|2588516_2589881_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376586.1|2589877_2590969_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376585.1|2591223_2591874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2592066_2592261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2592368_2592521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376583.1|2592787_2593915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063543.1|2594004_2594838_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376581.1|2594841_2595492_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_017376580.1|2595481_2596321_-	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_016210074.1|2596326_2596953_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376579.1|2597113_2597656_+	septation protein A	NA	NA	NA	NA	NA
WP_017376578.1|2597739_2598042_+	YciI family protein	NA	NA	NA	NA	NA
WP_144420763.1|2598059_2598302_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376576.1|2598400_2598673_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376575.1|2598711_2599350_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376574.1|2599382_2600474_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376573.1|2600645_2602388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2603317_2604292_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 32
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	2613586	2657301	3195216	tRNA,transposase	Staphylococcus_phage(30.0%)	41	NA	NA
WP_080999966.1|2613586_2614936_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2615233_2615791_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2615884_2616391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2616895_2617591_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_155051409.1|2617709_2618510_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2618543_2619947_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2620370_2621345_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2621601_2621829_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2622916_2623447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2623443_2624976_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2624972_2625923_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2626343_2626976_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2627218_2627416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2627765_2628194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2628271_2629267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2629411_2629663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2629767_2630412_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2630647_2631145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2631656_2632631_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2633001_2633295_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2634107_2634443_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2634763_2636302_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2636454_2637553_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2637791_2638991_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2639021_2639648_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2639676_2640561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2640694_2640925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155051411.1|2641062_2642352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420613.1|2642583_2642955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2645086_2645248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2645623_2646751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2646867_2647530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2647615_2647876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2648294_2649056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2651117_2651777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2651877_2652528_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2652675_2653365_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377795.1|2653387_2654551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2654755_2655007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619442.1|2655530_2656193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2656326_2657301_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 33
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	2671978	2732047	3195216	tRNA,transposase	Staphylococcus_phage(26.67%)	57	NA	NA
WP_048875904.1|2671978_2672854_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2672974_2673475_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2673471_2673738_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2673903_2674878_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2675057_2675678_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2675984_2677388_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771922.1|2678222_2679413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|2679979_2680447_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|2680948_2681203_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|2681404_2681908_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|2682124_2682730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2682890_2683574_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2683649_2684429_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|2684415_2685276_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|2685399_2685765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377271.1|2686150_2686480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2686890_2687865_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377273.1|2688399_2688639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377274.1|2688632_2689985_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	3.2e-36
WP_017377275.1|2691046_2691769_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2691760_2692129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2692391_2693693_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2693788_2694232_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2694235_2694745_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2694737_2697551_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2698047_2698980_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2699084_2700011_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2700189_2701728_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2701901_2702162_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2703436_2704045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2704091_2704820_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2705066_2705204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619438.1|2706354_2706906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2707140_2708052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2708311_2708608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2708952_2710106_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2710702_2711251_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2711354_2711918_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2712135_2712894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2714169_2714397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2714619_2714799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2715054_2716311_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2716378_2717023_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_017378393.1|2717827_2718034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378392.1|2718304_2718457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816949.1|2719034_2719433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378390.1|2719626_2721204_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378389.1|2721337_2722279_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378388.1|2722280_2723054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963621.1|2724662_2724869_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2725135_2725423_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378384.1|2725428_2727810_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|2727822_2728818_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_016210495.1|2728949_2729309_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378382.1|2729351_2729546_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|2729580_2730111_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378381.1|2730115_2732047_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
>prophage 34
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	2769825	2822854	3195216	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2769825_2770800_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2770956_2772531_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2772755_2773034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2773103_2773979_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2773988_2775149_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2775263_2776412_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2776422_2779224_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2779330_2780029_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2780041_2781805_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2781808_2782156_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2782149_2782524_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2783471_2784755_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2785164_2786460_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2786815_2787361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242732.1|2787948_2788470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2788481_2789861_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2790096_2790531_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2790527_2791880_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2791879_2792995_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2792995_2794012_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2794001_2795672_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2795691_2796027_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2796054_2797494_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2797490_2798537_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2798679_2800176_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2800471_2801473_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2801578_2802190_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2802310_2802688_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2802738_2804145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2804138_2805206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2805312_2806914_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2807162_2808080_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2808148_2809843_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2810077_2811007_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2811037_2812441_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2812671_2813376_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2813442_2814099_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2814109_2814991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2815161_2817831_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2818191_2819166_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2819245_2820217_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2820270_2821245_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2821364_2821586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2821649_2821958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2821882_2822854_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	2837420	2891681	3195216	transposase	Staphylococcus_phage(37.5%)	51	NA	NA
WP_026063658.1|2837420_2838149_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2838458_2838713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2839426_2842081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2842119_2842410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2842526_2843825_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2844395_2844884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2844864_2845167_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2845413_2845902_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2845935_2846574_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2846695_2847235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2847324_2848551_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2849163_2849421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2849507_2850407_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2850551_2850818_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2850809_2850959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2851186_2852062_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2852191_2852419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2852485_2852680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2852738_2853713_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2853750_2853939_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2853939_2855712_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2855701_2856694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2857301_2857994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2858480_2859050_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2859046_2860021_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2860060_2860564_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2860654_2862058_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2862756_2862942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2863047_2864451_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046624.1|2864497_2865028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2865061_2866489_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|2867774_2870144_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2870219_2871038_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2871389_2871935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2872417_2873656_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2873632_2874607_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017375625.1|2874699_2874927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|2874931_2875423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243039.1|2876095_2876983_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_027243038.1|2877072_2878563_-	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_017376549.1|2878586_2879468_-	ROK family protein	NA	NA	NA	NA	NA
WP_017376548.1|2879464_2880187_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376547.1|2880886_2881678_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|2881864_2882110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420598.1|2882261_2882492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376543.1|2882521_2883301_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_047927468.1|2883326_2883632_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_144420752.1|2883628_2884522_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_027243035.1|2884877_2886176_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376538.1|2888778_2889960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2890253_2891681_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	2899267	2948926	3195216	tRNA,transposase	Bodo_saltans_virus(14.29%)	43	NA	NA
WP_062312049.1|2899267_2900635_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2901127_2901607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2901786_2903850_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2903858_2904584_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2905211_2905925_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2905929_2906460_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2906694_2906928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2907040_2907289_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2908096_2910289_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2910306_2910615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2911268_2912978_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2913171_2913327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2914729_2915605_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2915930_2916692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2916916_2917648_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2917644_2918181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2918234_2918999_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2919001_2920579_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2920585_2921062_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2921037_2921469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2921501_2922257_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2922431_2922719_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2923101_2923326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2923665_2924829_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2924863_2925841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2925834_2926521_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2926459_2927575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2927854_2928460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2928697_2929177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2930999_2931653_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2931765_2932317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2932416_2933391_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2933676_2934201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2934898_2935723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2935978_2936335_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2936331_2937735_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2937854_2938415_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2938572_2939139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243087.1|2941917_2942613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2942653_2942866_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2944438_2945548_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2945603_2947085_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2947522_2948926_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP039087	Piscirickettsia salmonis strain Psal-111 chromosome, complete genome	3195216	3076608	3141857	3195216	protease,transposase	Hokovirus(14.29%)	56	NA	NA
WP_017376170.1|3076608_3077709_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3078066_3079041_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3079177_3080056_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3080063_3080294_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3080347_3081352_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3081570_3082398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3082479_3083868_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3084155_3085556_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3085650_3086577_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3086573_3087710_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3087706_3088714_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3088710_3089874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3089883_3090735_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3090766_3091939_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3091935_3093324_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3093352_3093760_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3093779_3094787_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3094783_3095656_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3095652_3096513_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3096514_3098785_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3098786_3099932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3099978_3100464_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3100503_3101127_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3106806_3107559_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155046626.1|3108161_3108329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243062.1|3108890_3109514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3109618_3110407_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3110406_3111138_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3111171_3112899_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3112912_3113974_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3114288_3115503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3115635_3116160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3116777_3117626_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3117612_3118311_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3118365_3119127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3119119_3119542_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3119671_3120223_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3120278_3121241_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3121241_3121457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3121643_3122453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3122432_3123275_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3123271_3124516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3124654_3125743_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3125760_3126261_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3126448_3127048_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3127053_3128217_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3128249_3129203_+	glutathione synthase	NA	NA	NA	NA	NA
WP_017376261.1|3129566_3130631_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3130627_3133690_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3133842_3134295_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3134326_3134683_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3135101_3135875_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376269.1|3138498_3138789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3139013_3139889_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3139885_3140443_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3140453_3141857_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039088	Piscirickettsia salmonis strain Psal-111 plasmid unnamed1, complete sequence	176710	0	117223	176710	terminase,portal,integrase,transposase	Streptococcus_phage(40.0%)	121	11253:11312	119456:121191
WP_017377655.1|1412_1658_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|1654_2041_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|2128_2857_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|2835_3456_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|3801_4488_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|5437_5800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|5802_7542_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|7943_8096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|8123_8807_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|8888_9866_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|9941_10112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|10152_10881_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
11253:11312	attL	GATGTATCTTAGCTAAATCTGTCAGCACCTTTTTAATTTTAGTATCAACAACCTGTTTTT	NA	NA	NA	NA
WP_036771293.1|11426_11693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772437.1|11988_13887_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|14308_15037_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420842.1|15098_15257_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|15673_15838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|15858_17145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|17327_18056_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|18183_19161_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046631.1|19235_19886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046632.1|21895_22045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126795.1|22517_22778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|22781_23054_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|23129_23858_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|24427_25399_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|26263_27091_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|27944_28415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|29308_29452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|30658_31258_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|31611_32388_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|32748_33477_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|33546_33747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|33665_34637_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027242938.1|35050_35419_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017375972.1|35420_35729_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017375841.1|36173_36383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|36689_36908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242936.1|36904_37357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242935.1|37499_37715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876207.1|38220_39696_-	response regulator	NA	NA	NA	NA	NA
WP_017375966.1|39696_40263_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_146619519.1|40407_40845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|40876_41302_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_036817204.1|41572_42568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817201.1|42871_43279_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017375960.1|43386_44430_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_017375959.1|44731_44965_+	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_146619517.1|45102_45255_-	phosphatase	NA	NA	NA	NA	NA
WP_081078123.1|45284_45647_+	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
WP_026063496.1|46525_46891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242932.1|47023_47251_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242931.1|47259_47667_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242930.1|47812_49195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375952.1|49384_49588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242929.1|49783_50167_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|50253_50736_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|50738_52070_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|52274_52709_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|52795_53182_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|53219_53954_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|54000_54714_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_144420848.1|56092_56278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243190.1|56281_59626_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017377509.1|59806_60535_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|60628_61603_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|61916_62279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|62318_62828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|63059_64040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|64505_65483_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|65963_66941_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|66955_67117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|67334_67589_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|67578_67866_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_036771347.1|68360_69338_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|70338_70551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|70708_71686_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_075317322.1|71672_73187_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_047927782.1|73982_74372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|74287_75265_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_048876196.1|75294_76443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243215.1|78256_79279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|79761_80490_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_048876194.1|81729_82263_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|82443_82785_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|82965_83232_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|83304_85170_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|85337_85622_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|85965_86694_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|86775_87267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|87999_88227_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|89778_90207_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|90142_90529_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|90558_91287_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|91298_91448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|91694_92423_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|93800_94763_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|94786_95116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|95182_96223_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|96236_96428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|96632_97202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|97244_97544_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155046638.1|97540_98005_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|98278_99007_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|99180_99954_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|100667_101603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|101877_102606_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046639.1|102771_102975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|103074_106416_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|106573_107302_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|107595_107991_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|108043_108772_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|109255_109984_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|110154_110724_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|110728_111412_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|111563_112292_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_080963627.1|112310_112529_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774644.1|113508_114570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|115078_115825_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|115825_116230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155051425.1|116536_117223_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	1.6e-10
119456:121191	attR	GATGTATCTTAGCTAAATCTGTCAGCACCTTTTTAATTTTAGTATCAACAACCTGTTTTTTAGGTTGATACCGATAAACTGATCGGCCAATACGGCACATCTTGCATGCTTTATTCCCGCTCAATGCATGAGCTTTGACAGCATAATCAACTAAGTCACGCCGACTCGCTGCGGTTATAGCTTTTTTTCAACAATATCCTTGAGCACTTTGTGCTCTAGGCTAATGTCTGCGTACATCTGTTTCAAACGACGGTTTTCGTCTTCAAACTCTTTTAAACGCTGTAGATCTGAAACGCCCATGCCTTGATATTTGGATCTGAGTTTGTAGTAGCTGCTTTTAGCAATACCATACTGGCGACAAATATCTTCAACTTTAACACCCGCTTGGCCTTCATTAAGCATGGCTACAATTTGTGATTCTGTTAGTTTTGATCGTTTCATCTTCTCTCTCCTGGCTAAGTTAATTTAACAGAAGATTCCACTTATCACTTGTACTATTTTAAGGGAGGGTTACCGAGTTATGTGAGAGCACAGTAGTGGAGTGTGCCGATTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTTGCGACAGAACCCTCCTTGGTTCGCAGCGCCAACATCATATCATTAAATCAAATTGCGACAGAACCATTATAGCTCATCATCTTCATATCTTGTATGTTTAGGATCATTACAAACATACCATCCACTAGAACTAGAATTTGTACATACCCCATACCTTTTAGATAAATCAAAGTACATAGTTGTGCTAGAAGGAGATTGTGATGATTTAGCATCAAAAAGTGAGCCAAAATGATTGTAAGTCGTGACATATAAATTACTTTTATCTGAATTTTTAATATATATTGCGCTGACAGGATCATTTACTCTACTTTCTAAAAACCATTTTAAATTATTAGGTACGTTATCCATAAATGGATCACACTGTTTGAAATAAACCCAATCCCAATCCGTCGTTTTTCCAGCAATATTAGAAGTTAAACAGCTTAAAAACCAACCATCAGATGAAAATGCACGGCCATATAGTGAAAGCATCAATATTCTAGAATTTTTCATATCATAGTATGTTCTATTCAAATAATTTGAATTATACGAACCTGAATACATAGGATAGTAATTATTATCAGATTTATCATAAAACCTCATACCAATTTCATACCAAAATGTATTTACTTTTGATGGTGTTTTAAAAAAGTATTTAGACATTTTATTTGCATCTAAAACAATATTAGTTCCACTTGATTTTGAAATAATTCCATAGTTGCCATACCATTGAATAGATAGATCTTTATTTAAACGAGGTTTTAATTTTCCATCTCTTACATCCCATTTTTGATAAGGGTTATAAATATCACAAGGCCAAAACTCTACATAATCCCATTTATCATCACCTTTGATGACATTTTCTGGTGCAGTCATACATAGAGGGATTCCAAATTGAGATTTAGAGAAAGCAACTCTGCCAAGAGTATCATAAATAGCTTTTTGACTTTCTACATTAGAACATGTTTGAGCGTATAAATAAGATCGAGACGTTTTCATAGAAGAGTCTCTTGATTGAGTTGGAGCTAAACAGTAACCTCCCTGAGTTGTAATTAACTGGCTTGGTATTGTAGGTAAATCTTTAAAT	NA	NA	NA	NA
>prophage 2
NZ_CP039088	Piscirickettsia salmonis strain Psal-111 plasmid unnamed1, complete sequence	176710	125037	126659	176710	transposase	Acinetobacter_phage(50.0%)	3	NA	NA
WP_017375632.1|125037_125373_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|125567_125771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|125864_126659_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
>prophage 3
NZ_CP039088	Piscirickettsia salmonis strain Psal-111 plasmid unnamed1, complete sequence	176710	133029	135447	176710	portal,transposase	unidentified_phage(50.0%)	2	NA	NA
WP_048875857.1|133029_134004_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|134991_135447_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
>prophage 4
NZ_CP039088	Piscirickettsia salmonis strain Psal-111 plasmid unnamed1, complete sequence	176710	140165	147133	176710	transposase	Streptococcus_phage(100.0%)	7	NA	NA
WP_017377509.1|140165_140894_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|141035_141968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|141997_142726_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|142728_143001_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|143851_144580_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|144635_145256_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|146404_147133_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 5
NZ_CP039088	Piscirickettsia salmonis strain Psal-111 plasmid unnamed1, complete sequence	176710	153168	161825	176710	transposase	Streptococcus_phage(75.0%)	8	NA	NA
WP_027243210.1|153168_153903_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.9e-36
WP_017377526.1|154232_155093_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377525.1|155494_156292_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_075275471.1|156832_157807_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_155046640.1|158442_158610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876214.1|158578_159307_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_017377521.1|159815_160169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|161096_161825_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 6
NZ_CP039088	Piscirickettsia salmonis strain Psal-111 plasmid unnamed1, complete sequence	176710	168189	174092	176710	transposase	Staphylococcus_phage(28.57%)	9	NA	NA
WP_075275473.1|168189_168366_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|168482_169190_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|169143_170022_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243193.1|170052_170595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|170866_171571_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|171582_172311_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|172340_172730_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|172752_173481_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|173483_174092_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
>prophage 1
NZ_CP039090	Piscirickettsia salmonis strain Psal-111 plasmid unnamed3, complete sequence	50691	5715	19511	50691	tail,transposase,head,capsid	Moraxella_phage(18.18%)	18	NA	NA
WP_036771639.1|5715_6690_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|6739_7279_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|7292_7877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|8261_8573_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|8569_8995_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|9173_9569_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|9565_9916_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|9915_10338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|10339_10663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|10719_10986_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|10989_13068_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|13060_13402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|13398_14070_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|13999_14785_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|14774_15332_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|15328_18019_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|18077_18506_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|18533_19511_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 1
NZ_CP039091	Piscirickettsia salmonis strain Psal-111 plasmid unnamed4, complete sequence	33555	3402	10200	33555	transposase,integrase	unidentified_phage(50.0%)	9	NA	NA
WP_036771330.1|3402_4377_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4912_5503_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5733_5994_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5986_6340_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6516_7491_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|8023_8389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|8533_8788_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8771_9128_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036773116.1|9225_10200_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
>prophage 2
NZ_CP039091	Piscirickettsia salmonis strain Psal-111 plasmid unnamed4, complete sequence	33555	14343	27224	33555	tail,transposase,terminase,capsid,head	unidentified_phage(40.0%)	17	NA	NA
WP_027242943.1|14343_14760_-	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
WP_027242944.1|14756_15314_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242945.1|15659_16175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420855.1|16978_17194_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_036771330.1|17267_18242_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242946.1|18622_19204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275490.1|19239_19632_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_036771330.1|19728_20703_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242948.1|20722_20908_-	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_027242949.1|20910_21393_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242950.1|21479_21863_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242951.1|22075_22942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|23567_24542_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_048876242.1|25026_25404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242941.1|25415_26069_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_155046645.1|26068_26230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|26249_27224_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
