The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	31805	91582	3194930	transposase,tRNA	Staphylococcus_phage(28.57%)	52	NA	NA
WP_036772169.1|31805_32681_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33039_34395_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34486_34993_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34989_35358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36760_38545_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39025_40153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40225_40981_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_155046559.1|41017_43699_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43730_44282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44389_45403_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45523_45748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46103_46865_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47007_47802_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|47946_48699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49010_50537_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50675_51749_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|51788_53096_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53070_54240_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54294_55020_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55485_57591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|57805_58270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58289_58799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59183_60125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60406_61858_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773655.1|62324_62729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63289_64264_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|64998_65376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|65965_66940_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773242.1|66979_67534_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|67714_68614_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|68618_69245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|69189_71511_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|71657_72137_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|72133_73285_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|73419_73923_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|74016_74991_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|74980_76294_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|76334_77714_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|77720_79172_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|79197_79566_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378407.1|79584_80652_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|80684_81581_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|81577_82414_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|82549_83002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|83140_83887_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|83867_84431_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|84439_84955_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|85096_87175_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|87174_88125_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|88992_89391_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|89616_89946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|90562_91582_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	123064	241132	3194930	transposase,tRNA,protease	Staphylococcus_phage(12.5%)	105	NA	NA
WP_075278722.1|123064_123940_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|124380_124674_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|124674_124929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|124945_127438_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|127430_128114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|128113_129157_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|129156_130386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|130387_130717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|130713_131913_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|132025_132415_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|132414_133359_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|133478_134876_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|135201_135723_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|135846_136155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|136169_141392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|141782_143789_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|143919_146250_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|146425_147256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|147372_147768_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|147764_148298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|148294_148696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|149090_149411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|149420_150377_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|150886_151411_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|151511_152510_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|152598_153495_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|153568_154855_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|155314_156631_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|156744_156915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|156934_157909_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|158035_158296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|158563_158854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|161392_162433_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|162535_163507_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|163629_164478_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|164629_164917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|165227_165599_+	isochorismatase	NA	NA	NA	NA	NA
WP_017377540.1|166650_166884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|167021_167159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|167172_167385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|167908_168733_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|168871_170005_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|170064_171474_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|171621_173202_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|173959_174955_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|174960_177027_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|177084_178035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|178229_178556_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|178778_180038_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|180297_181173_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|181211_182174_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|187868_188213_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|188309_189233_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|189732_190221_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|190323_191124_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|191134_192886_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|193775_194018_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|194021_194420_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|194651_195527_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|196245_196704_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|196885_197071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|197786_199601_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|200011_200680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|200689_202006_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|202165_203128_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|203208_203364_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|203377_203614_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|203806_205024_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|205001_205460_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|205487_206867_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|206903_207122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|207441_208737_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|208941_209133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|209331_210207_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|210394_211660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|211693_212569_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|212690_213149_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|213172_214093_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|214220_215003_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|215093_216593_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|216906_218790_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|219049_219712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|219778_220888_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|220899_221544_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|221562_222549_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|222633_223710_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|223911_224736_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|225038_226004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|226322_227375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|227433_228408_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|228743_229172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|229408_229891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|229946_231197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|231299_231518_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|231989_232844_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|232898_233369_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|233665_233902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|234048_234429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|234487_235363_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|236129_237041_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|237157_238006_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|238072_239083_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|239106_239430_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375571.1|239440_239842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|240112_241132_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	314935	357294	3194930	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|314935_315811_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|315891_316524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|316477_317923_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|317957_318377_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|319150_319519_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|319528_320068_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|320228_320660_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|320663_321362_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|321609_322116_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|322158_322527_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|322797_326874_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|326937_331146_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|331307_331682_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|331786_332260_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|332275_334387_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|334414_335605_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|335611_335923_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|336045_336684_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|336699_337317_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|337313_337610_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|337624_338449_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|338465_338741_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|338746_339079_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|339091_339826_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|339839_340253_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|340252_340453_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|340452_340710_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|340831_341200_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|341217_341529_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|341544_342087_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|342099_342405_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|342433_342826_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|342838_343372_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|343381_343735_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|343745_344246_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|344251_344434_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|344436_344871_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|344871_346194_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|346250_346364_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|346507_346864_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|346889_347279_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|347288_347909_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|347930_348908_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|348956_349355_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|349467_350715_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|350701_351358_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|351442_351721_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|351963_352191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|352323_353118_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|353426_354641_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|355038_355218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|355186_355840_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|356215_356464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|356553_357294_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	366717	421630	3194930	tRNA,protease,transposase	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_017376975.1|366717_367269_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_017376974.1|367279_368647_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376973.1|368797_369034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376972.1|369092_369836_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_027242667.1|369835_370477_+	lipoprotein	NA	NA	NA	NA	NA
WP_017376970.1|370476_372141_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_017376969.1|372169_372505_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_027242666.1|372669_374268_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376966.1|374327_374618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772765.1|374818_375250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|375312_377793_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|377879_378359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|378331_379372_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|379308_380025_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|380037_380373_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|380409_380880_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|380922_382758_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|382802_383891_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|383912_384974_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|385051_385567_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|385607_386885_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|386899_387751_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|387779_388427_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|388423_389383_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_048875861.1|389904_390774_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|390918_391173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|391317_391884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|391989_392430_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_027242664.1|392941_394144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|394427_395402_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046562.1|395583_395727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046563.1|395871_396009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|396025_396241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|396445_397057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|397053_397311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|397561_397954_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|398083_398632_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|398631_399459_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|399508_401194_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|401271_401733_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|401769_402333_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|402559_402889_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|402869_403094_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|403238_403829_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|403853_405125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|405142_406396_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|406392_407037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|407109_408159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|408260_409898_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|409932_410262_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|410418_410706_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_155046565.1|411232_411526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|411775_412996_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|413054_415853_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|416158_417325_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|417423_417960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|418021_418354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|418611_419514_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|419583_420081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|420226_421630_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	451067	499206	3194930	transposase	Staphylococcus_phage(100.0%)	42	NA	NA
WP_036774259.1|451067_452042_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377364.1|452191_453028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|453147_454551_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242658.1|455893_457357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856768.1|457432_458227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242656.1|458518_459337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|459354_459948_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376894.1|460164_460398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155062807.1|460642_461518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155050372.1|461813_462593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376891.1|462762_463665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|463661_464885_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_027242653.1|464902_465829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|465844_466885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242651.1|466999_467410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376888.1|467462_467966_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_017376887.1|467958_468705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376886.1|468707_469838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|469842_470082_+	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_027242650.1|472571_473060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|473062_474139_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_017376878.1|474131_474785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875870.1|474791_475217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|475253_478253_+	ATPase AAA	NA	NA	NA	NA	NA
WP_027242646.1|478314_479817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|480268_481888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|481929_484233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376870.1|484509_485406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|485408_488735_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_144420818.1|488936_489125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|489136_489613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|489655_489883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|490064_490598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|490628_490970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772347.1|490972_491389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876253.1|491550_492207_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036771639.1|492203_493178_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|493619_493883_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|494310_495285_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_087910671.1|495672_496137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910670.1|496230_496416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|498231_499206_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 6
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	504010	558693	3194930	transposase	Streptococcus_phage(22.22%)	52	NA	NA
WP_048875872.1|504010_505294_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|505466_505604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|505600_507004_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|507117_507555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|507675_508104_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|508351_508789_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|509220_510609_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|511055_512549_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|512743_513499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|513998_514229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|515333_516344_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|516340_516562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|517280_518222_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|518749_519148_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|519087_519942_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|520033_520315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|520400_521078_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|521123_522404_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|522579_523629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|523707_524508_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|524521_525316_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|525418_526438_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|526484_527096_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|527099_527786_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|527782_528325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|528617_529805_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|530049_530775_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|530960_531749_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|531745_532141_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|532533_533574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|533570_534974_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|537389_537647_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|537686_539072_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155050374.1|539389_540499_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.6e-49
WP_017377120.1|540532_541783_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|541783_542416_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|542705_543158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|543203_544046_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|544080_544572_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|544767_546735_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|546962_547367_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|547344_548373_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|548359_549148_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|549574_550978_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377110.1|551179_552190_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_075275363.1|552202_552670_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377107.1|552999_554370_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_017377106.1|554672_555143_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377105.1|555420_555696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|555706_557110_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069971661.1|557284_557722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|557718_558693_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 7
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	590484	723878	3194930	transposase,tRNA,plate	Staphylococcus_phage(13.64%)	110	NA	NA
WP_036772726.1|590484_591033_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|591785_593165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|593524_594988_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|595171_595984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|596448_598443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|598837_600217_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|600254_600692_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|600734_601451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|602997_603528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|603594_605415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|605979_606486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|606570_607974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|608088_608343_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|608495_608768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|609642_610218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377063.1|610214_610385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|611285_611528_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|611830_612922_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|612902_613856_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|614079_615564_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|615603_616107_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|616366_617542_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|617689_618094_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|618250_619126_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|619160_619514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|622843_623269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|623499_624636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|624622_625945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|625937_627056_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|627176_627710_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|627848_629486_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|629490_629712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|629820_630834_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|631105_633334_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_026063593.1|633314_634019_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|634253_634583_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|635983_636202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|636260_637136_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|637128_637995_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|638062_639382_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|639851_640412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|640730_641657_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|642552_643461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|647157_647997_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|648183_648399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|648447_649023_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|649019_649358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|649526_650516_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|651505_652408_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875883.1|652667_653204_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|653348_654266_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|654700_655711_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|656518_657055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|658267_658615_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|658759_659719_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|659820_660603_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|660735_661695_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|661719_662124_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|662152_662827_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|662926_664642_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|664638_665001_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|665015_666170_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|666173_667181_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|667183_668200_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|668415_669501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|669607_670000_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|670132_671416_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|671431_672733_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|672750_674553_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|674557_675550_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|675630_676707_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|676804_677779_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|677846_678818_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|679001_679271_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|679872_681159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|681223_681904_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376024.1|687559_687808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375775.1|687885_688080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275355.1|688127_689102_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_027242570.1|689315_690455_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|690663_692034_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|692412_693405_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|693408_693924_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|693920_694760_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|694792_696343_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|696450_696822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|698042_698204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|698784_700188_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|700222_700660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|700683_701658_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|701716_702145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|702332_703139_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|703213_703606_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|703650_704472_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|704484_705468_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|705469_706738_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|706744_709249_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|709379_710405_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|710401_711112_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|711036_711867_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|712016_712400_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|712434_713334_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|713379_714051_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|714133_714709_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|714807_715608_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|715749_716607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|717469_718606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|718672_721843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|721855_722566_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|722570_723878_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	732520	778836	3194930	transposase,plate	Staphylococcus_phage(21.43%)	51	NA	NA
WP_017376356.1|732520_732919_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|732915_734604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|734585_735542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|735584_736100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|736204_737137_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|737356_737743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|737760_738405_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|738555_739395_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|739470_740073_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|740073_740928_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|741285_741597_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|741621_743010_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|743165_743897_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|743893_744421_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|744452_745010_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|745015_745996_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|746135_746936_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|746939_747707_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|747703_748168_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|748190_748844_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|748847_749195_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|749228_749480_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|749556_750825_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|750827_751586_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|751647_752538_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|752588_753272_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|753281_753629_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155062809.1|753898_756022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|756013_756886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|757053_758883_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|759050_759692_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|760016_760463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|760480_760654_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|760712_761762_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|761768_762719_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|762773_763718_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|763745_764483_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|764571_764814_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|764888_766112_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|766143_766992_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|766988_768041_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|768177_768798_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|769023_770176_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|771196_772171_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|772167_772338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|773306_773903_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|773871_775032_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|775542_775884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|775987_777022_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|777018_777729_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|777861_778836_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 9
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	786996	841307	3194930	transposase,protease,tRNA	Prochlorococcus_phage(33.33%)	49	NA	NA
WP_017377942.1|786996_787503_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_155048031.1|787584_787950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|788092_788953_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|789050_789596_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|789678_790530_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|790571_793478_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|793538_793736_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|793742_794753_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|794749_795808_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|795822_796602_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|796604_797417_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|797428_798376_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|798386_799679_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|799857_800961_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|800957_801350_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|801362_802739_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|802732_804202_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|804395_804830_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|805125_805302_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|806336_807362_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_155046573.1|807824_808256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|809648_810299_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|810997_811792_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|811971_812616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|812790_813765_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|814165_814423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|816100_816778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|817011_817836_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|817929_818643_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|818732_819824_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|819895_820477_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|820482_821109_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|821205_822153_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|822499_823162_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|823332_823992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|824160_825420_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|825416_826502_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|826494_827376_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|827364_828615_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|830000_830321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|830579_830846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|831336_831555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|832540_832762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|832758_833841_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|833851_834223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|834219_834399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|837102_837378_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|838213_839671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|840098_841307_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	884987	947514	3194930	transposase,tRNA	Staphylococcus_phage(28.57%)	53	NA	NA
WP_048875904.1|884987_885863_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|886119_886557_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|886617_887250_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|887265_887913_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|887915_889979_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|890305_891598_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|891986_894197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|894213_894870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|897255_898131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|898389_899001_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|899428_902017_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|902119_902881_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|902877_903414_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|903462_904419_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|904496_907682_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|907685_908741_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|908970_909573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|909616_910279_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|910313_910661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046576.1|911129_912074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|912623_914027_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|915145_915490_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|915581_916037_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|916285_916420_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|916412_917054_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|917050_917767_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|917770_919090_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155046577.1|919771_919933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773644.1|920894_923531_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_036773645.1|923572_924658_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|924657_925341_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_017377748.1|925401_927063_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377747.1|927215_927470_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|927548_927866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|928018_928417_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|928498_929137_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|929293_930268_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|930640_930916_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|931465_931750_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|933566_934160_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|935254_936136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|936247_937927_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|938053_939304_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|939379_939841_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|939837_940986_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|940991_941666_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|941662_942319_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|942444_942918_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|942919_943342_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|943328_944348_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|944507_944687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|944905_945187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|946638_947514_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	951416	1018379	3194930	transposase,tRNA,protease	Bacillus_phage(20.0%)	56	NA	NA
WP_048876012.1|951416_952820_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|953178_953946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|954059_955463_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|955459_955621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|955936_956911_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|957151_958435_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|958501_959425_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|961620_963765_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|963786_963993_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|964053_964674_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|964714_965608_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|965693_966419_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|966480_966885_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|967047_969156_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|969279_970329_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|970325_971792_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|971934_973272_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|973339_974830_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|975058_975430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|975580_976408_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|976710_977367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|977314_978238_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|978251_979175_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376987.1|979422_980106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|981805_982033_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376989.1|982357_982906_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|982986_983262_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|983261_984311_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|984423_986361_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|986508_988221_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|988289_989009_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|989005_989608_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|989722_990610_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|990800_991148_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|991198_992038_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|992133_992880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|993076_993703_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|994018_994588_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|994731_995430_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|996136_996760_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|996869_997763_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|997869_999480_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|999476_1000772_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|1000793_1002716_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|1002826_1003129_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|1003223_1008110_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1008157_1009480_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1009604_1010699_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1010750_1011689_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1011769_1012354_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1012738_1013629_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1013831_1014323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1014462_1014954_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1015122_1015836_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065653747.1|1015898_1017239_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1017503_1018379_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	1023992	1086519	3194930	transposase	Staphylococcus_phage(33.33%)	57	NA	NA
WP_017377787.1|1023992_1024220_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1024246_1025287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1025353_1025923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1026153_1026558_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1026570_1026711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1026805_1028005_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1028025_1028637_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1028838_1029600_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1029895_1030822_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1030982_1031939_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1032083_1032353_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1032619_1033594_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1033747_1033975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1034091_1034517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1034673_1035603_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1036049_1036580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|1036901_1037207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1037684_1037996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1038335_1039502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1041689_1042661_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1043263_1043437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1043832_1044750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1044750_1045602_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1046042_1047089_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1047078_1049070_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1049179_1049554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1049807_1049990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1050251_1050953_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420709.1|1050953_1051373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619460.1|1053026_1055810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1056045_1057338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1057824_1058730_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376296.1|1059507_1060224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1060509_1061271_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1061303_1062707_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1062703_1062868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1062927_1063215_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1063959_1064688_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1064656_1065403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046685.1|1065453_1065873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1065869_1066844_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1067000_1067318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772457.1|1069793_1070102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1070177_1070450_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1072983_1073421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1074022_1075210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1075480_1077115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1077165_1077894_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1079321_1080284_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1080507_1081503_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1081530_1082466_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1082509_1082971_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1082949_1083567_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1083596_1084571_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1084625_1085093_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1085105_1085750_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1085790_1086519_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 13
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	1095219	1144787	3194930	transposase	Acinetobacter_phage(22.22%)	39	NA	NA
WP_082300708.1|1095219_1095780_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1097104_1097500_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1097508_1097865_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1097857_1098733_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1098818_1099397_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1099354_1099648_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1100608_1102120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1102367_1103771_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1103976_1104411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1104493_1105198_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1105456_1105945_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1105973_1106648_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1106888_1107764_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275340.1|1108294_1108903_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1109173_1109632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1109910_1110300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1110485_1111301_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1111523_1112429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1112592_1113354_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1113357_1114224_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1114309_1114921_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1115299_1116547_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1116698_1117400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1117697_1117871_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1118360_1118861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1119939_1120167_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774233.1|1120219_1120453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1120481_1121162_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1121184_1123359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1123604_1124675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1124671_1126075_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619408.1|1126223_1126709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1126780_1127602_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1128268_1129768_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1130071_1132765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1132761_1136163_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_048875961.1|1137750_1139154_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1140232_1140904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1143812_1144787_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 14
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	1169510	1225904	3194930	transposase,tRNA	Staphylococcus_phage(37.5%)	52	NA	NA
WP_053093677.1|1169510_1170230_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1170457_1170634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1170882_1171206_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1171294_1173313_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1173335_1174289_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1174454_1175642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1176355_1176994_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1177291_1178287_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_027242772.1|1178427_1179474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1179466_1180492_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1180558_1182589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1183895_1184123_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1185466_1185610_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1185606_1186299_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242771.1|1186565_1186883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|1187025_1187436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1187592_1187919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1188065_1189103_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1189144_1189390_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_129556541.1|1189514_1189829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1189836_1191411_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1191565_1192135_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1192444_1194247_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1194243_1195185_+	signal peptidase I	NA	NA	NA	NA	NA
WP_036771308.1|1195212_1195434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242761.1|1195596_1196271_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1196276_1197176_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1197189_1197933_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1197935_1198667_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1198663_1199047_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1199184_1200432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1200842_1201988_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1201980_1202334_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1202614_1203157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1203801_1203990_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1204009_1204984_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1205027_1205903_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1206256_1207084_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1207183_1207345_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1207995_1209336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1210387_1210615_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|1210756_1212118_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1212213_1212873_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144420701.1|1213713_1214070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1214666_1216226_-	APC family permease	NA	NA	NA	NA	NA
WP_027243001.1|1216586_1218557_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375893.1|1218754_1219825_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1219882_1220089_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1220095_1221571_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1221706_1222270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1222439_1223843_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1224809_1225904_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	1242146	1289871	3194930	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_036772169.1|1242146_1243022_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046585.1|1243091_1244195_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1244262_1244586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1244742_1245525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1245660_1246638_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1246711_1248703_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1248758_1249040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1249293_1250493_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_051929862.1|1252924_1253437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1253623_1254499_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1254535_1254700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1255908_1256322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1256332_1256668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1256812_1257931_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1258160_1258427_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1259709_1259937_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1259947_1260454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1260531_1261149_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1261280_1262513_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1262502_1263165_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1263439_1264696_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1264833_1265493_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1265567_1266269_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1267016_1267991_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1269199_1269553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1269766_1269961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1270028_1270541_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1270678_1271533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1271581_1272226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1272259_1272904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653744.1|1273444_1273720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1273818_1274601_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1274683_1275634_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1277676_1280517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1280539_1281121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1281240_1281969_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1282114_1283089_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1283204_1284110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1284708_1285455_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1285707_1286100_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1286137_1286785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1288500_1289871_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	1313690	1354900	3194930	transposase	Enterobacteria_phage(16.67%)	37	NA	NA
WP_048876023.1|1313690_1314794_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1314884_1316037_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1316450_1317302_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|1317439_1317589_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1318213_1320580_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1320627_1321824_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1322392_1324825_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1325146_1326646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1326754_1327327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1327641_1329111_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1329183_1329933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1329936_1330710_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1330808_1331759_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1331898_1333341_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1333556_1334741_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1334864_1335551_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1335686_1336271_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1336360_1336690_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1337025_1337265_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_017377970.1|1337313_1337505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1338279_1338573_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1338721_1338883_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1339397_1339937_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1340275_1340920_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1341253_1341904_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1342427_1343480_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1343497_1346578_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1346743_1346992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1347057_1347933_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1348855_1349362_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1349379_1349577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1349595_1349739_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1349806_1349980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1350184_1351498_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1351507_1351771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1351829_1352804_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1354672_1354900_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 17
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	1386117	1439851	3194930	transposase,tRNA	Bacillus_thuringiensis_phage(25.0%)	46	NA	NA
WP_036772026.1|1386117_1386993_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1387097_1390400_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1390396_1392220_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1392259_1392658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1392766_1393783_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1394217_1395672_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1395753_1398810_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_144420694.1|1399103_1399340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081329473.1|1400200_1400620_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376676.1|1400992_1401457_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1401529_1402531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1405423_1405756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1406117_1406261_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1406248_1407193_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080963606.1|1407196_1407583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1407404_1407743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1408117_1408717_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1408716_1409064_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1409214_1410198_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1411107_1411422_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1411570_1411729_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1411700_1412630_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1413544_1413961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1415089_1415806_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1416554_1416713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1416761_1417337_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1417481_1417760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1417824_1418700_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1418865_1422732_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1422887_1423697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1423746_1424568_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1424767_1426000_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1426170_1426896_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1426938_1428477_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1428483_1429869_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1430182_1431232_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1431791_1432169_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|1432360_1433236_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1434217_1434445_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1434497_1435016_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_146619432.1|1435271_1435463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420793.1|1435871_1436645_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243181.1|1436758_1437730_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376772.1|1437711_1438683_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420687.1|1439118_1439304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1439314_1439851_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	1458786	1508205	3194930	transposase	Staphylococcus_phage(23.08%)	46	NA	NA
WP_051929845.1|1458786_1459611_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1460014_1460989_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1461174_1461768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1461948_1462413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1462807_1463089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1463085_1464489_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1465140_1465521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1465760_1466417_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1466561_1466858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1466917_1467205_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_027243051.1|1467488_1467698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772296.1|1468394_1468772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1468971_1470021_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1469997_1471815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1472085_1472664_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1472691_1473156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1473192_1474650_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1474711_1476199_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1476968_1477571_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1478132_1478603_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1480250_1480994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1481145_1481577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1484214_1485561_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1485648_1487454_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1487919_1488717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1489101_1489563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1489785_1490760_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1490802_1490925_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1490996_1492952_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1493341_1493527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1493848_1494838_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1495250_1496876_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1496984_1497299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1497594_1498980_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1499144_1499372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1499512_1499971_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1500171_1500357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1500425_1501253_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1501707_1502232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420684.1|1502414_1502663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1502832_1503786_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1503980_1504955_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1505082_1506108_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1506760_1507048_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1507107_1507440_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1507644_1508205_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
>prophage 19
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	1516926	1576497	3194930	tRNA,protease,transposase,integrase	Staphylococcus_phage(25.0%)	57	1505777:1505836	1576202:1576812
1505777:1505836	attL	CCACCACGTGTCACTGATAAGTGGACGTGCGTATTCCAATTTAAACTCTGGCCGAAAGTA	NA	NA	NA	NA
WP_017376809.1|1516926_1518696_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_017376808.1|1518834_1519878_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376807.1|1519891_1520635_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_027243093.1|1520747_1521065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243094.1|1521368_1522076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420791.1|1522859_1524071_+	protein kinase	NA	NA	NA	NA	NA
WP_017376801.1|1524126_1524951_-	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_017376798.1|1526138_1526774_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017376797.1|1527055_1527415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1527688_1529974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420683.1|1529962_1530619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|1530795_1531428_+	MarC family protein	NA	NA	NA	NA	NA
WP_027243097.1|1531463_1531649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243098.1|1531714_1532860_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243099.1|1533095_1534409_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_155046588.1|1535524_1535734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420682.1|1536268_1536430_-	phosphatase	NA	NA	NA	NA	NA
WP_017376785.1|1537836_1538742_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376784.1|1538982_1539168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242578.1|1539204_1539741_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_027242577.1|1539758_1541060_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_048876008.1|1541056_1542031_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_155046589.1|1542110_1542260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1542439_1542604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1542605_1543481_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1543796_1544717_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1544732_1545116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1545442_1546399_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_144420678.1|1546666_1546945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243017.1|1547443_1548787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|1548960_1549104_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1549183_1550158_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1550305_1552177_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1552209_1552308_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1552543_1553173_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1553156_1553579_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1553585_1555325_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1555325_1556390_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1556393_1556747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1556859_1557828_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1557837_1558149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1558164_1558734_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1558997_1560326_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1560366_1561341_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1561927_1562329_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146619459.1|1562848_1565305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1565507_1566359_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1566404_1568111_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1569582_1570557_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1570919_1571165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1571528_1572557_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1572687_1572891_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420676.1|1573175_1574132_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_047927838.1|1574424_1574670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1574666_1574966_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1575188_1575659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1576269_1576497_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
1576202:1576812	attR	TACTTTCGGCCAGAGTTTAAATTGGAATACGCACGTCCACTTATCAGTGACACGTGGTGGTGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGATAGGTTAGCATTGGCTGTATGCAACCGATCATGATTGTAATATCGAATATAGGCCTCAACATCCTCCTTCATAGTATCACGGGTTAAGTGAATCACATTCAACAGCCATTCGTGCTTTAGGCTGCCAAAAAAACGCTCGACAACCGCATTGTCAACGCAAGCACCGACACTGCTCATAGAAGCGGTGATTTTATGCTTCTTCAACAGTTTTCGATATTTTTTACTGGTATACTGCGAACCACGATCACTGTGAAATAACAAGTGTTCTGTCGGCTGCCGCAAGTGAATCGCCATATCCATTGCACGACAAACTAGATTTTCGCTCATTCTCTTATTCATCGCCCAGCCAATCACTTTTCGAGAGTATAAATCAATAACGACCGCAAGATACAACCAGCCTTCAGCAGTTCTAAGGTAGGTAATGTCACCTGCCCATGAGTGATTTGCAATGACTGGATTAAACTGCTGATTCAATACGTTATCTGCAACAGC	NA	NA	NA	NA
>prophage 20
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	1581949	1624880	3194930	transposase	Staphylococcus_phage(20.0%)	41	NA	NA
WP_053856766.1|1581949_1583353_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1583540_1584398_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1584522_1585158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1585206_1585458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1585713_1586613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1586749_1587823_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1587923_1588337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1588357_1589071_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1589258_1590671_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1590880_1591849_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1592582_1592951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1592954_1593272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1593347_1594322_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1594841_1595342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1595412_1596741_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1596876_1598265_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1598412_1599723_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1600063_1601347_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1601420_1602041_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1602239_1602500_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1602702_1602849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1602824_1603418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1605281_1605500_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1606752_1607523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1607609_1607825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1607921_1609043_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1609309_1610284_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1610546_1611668_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1611960_1612248_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1612220_1612724_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1612804_1613464_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1613805_1614723_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1614852_1615026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1615691_1617050_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_144420789.1|1617241_1617688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376485.1|1617882_1619112_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1619157_1619784_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1619933_1621121_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1621129_1621822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1621943_1623096_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1623896_1624880_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 21
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	1683215	1773530	3194930	transposase,tRNA,protease	Burkholderia_phage(14.29%)	82	NA	NA
WP_036774017.1|1683215_1684091_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1684480_1684819_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1684815_1685412_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1685414_1687409_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1687472_1688411_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1688759_1689734_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1689937_1690135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1690296_1690701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1692284_1692725_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1693051_1693927_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1693939_1694182_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1694588_1694843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1696054_1697020_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1697112_1697424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1697624_1698401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1699230_1699422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1700150_1701200_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1701370_1702144_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1702204_1703794_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1703984_1705076_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1705098_1705416_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1705502_1706780_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1706801_1707638_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1707644_1709279_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1709710_1710070_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1710351_1711710_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1711735_1711978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1712471_1712651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1712906_1714163_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1714276_1714534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1714678_1715689_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1716065_1716920_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1716949_1717783_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036773204.1|1718359_1719133_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1719214_1719535_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1719753_1720659_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1720744_1721143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1721287_1721785_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047927093.1|1723445_1724549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1724647_1725025_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1725104_1726079_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1727623_1728343_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1728426_1728714_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1728998_1729871_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1729827_1730604_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1730808_1731144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1731542_1731899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1732060_1732336_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1732445_1732793_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1732810_1733590_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1733589_1734099_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1734134_1734383_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1734694_1735030_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1735329_1736580_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1736661_1738689_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1739234_1739453_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1739624_1739987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1740135_1741539_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1741820_1742996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1743013_1745011_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1744991_1745972_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1746027_1746870_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_036772544.1|1746869_1747286_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1747266_1747686_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1747708_1748338_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1748906_1751096_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1751107_1752313_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1752297_1754145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1754129_1755368_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1755354_1757223_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1757256_1758510_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1758515_1759373_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1759391_1760120_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1761258_1762050_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1762415_1762703_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|1764825_1765215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1765391_1766150_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1766146_1768546_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1768559_1769837_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1769926_1771225_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1771422_1772316_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1772315_1773530_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 22
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	1784229	1834714	3194930	transposase,tRNA	Vibrio_phage(14.29%)	46	NA	NA
WP_069971651.1|1784229_1785105_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1785477_1785741_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1786047_1788642_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1788638_1789121_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1789098_1790139_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1790313_1790799_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1790906_1793477_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1793510_1793972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1794308_1795184_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1795461_1797222_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1797315_1797981_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1797993_1799499_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1799520_1800051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1800124_1801387_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1801573_1802446_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1802547_1803336_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1803428_1804754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1805107_1806283_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1806451_1807105_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1807260_1809201_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1809197_1809821_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1809985_1810960_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1811231_1811852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1811848_1813252_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1813319_1813736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1814143_1814641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1814637_1815612_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|1815691_1816261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1816405_1816942_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1816946_1817243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1817251_1817857_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1818042_1818441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1818631_1818835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1818979_1819135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1819259_1819712_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1819828_1821301_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1821739_1822204_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1822892_1824143_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1824252_1824723_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1824745_1825339_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1825476_1826526_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1826549_1827473_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1827489_1827951_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1828058_1828877_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1829486_1829630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1833793_1834714_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 23
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	1897007	1912323	3194930	transposase	Staphylococcus_phage(50.0%)	15	NA	NA
WP_017378288.1|1897007_1897229_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1897287_1898262_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1898460_1898625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1898621_1899257_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046602.1|1899533_1900313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1900345_1901107_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1901083_1902073_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1902208_1903084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1903102_1903762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1904003_1904450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1904446_1905850_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1905963_1906809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1906953_1908603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1908693_1909479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|1910919_1912323_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	1940996	1989868	3194930	transposase,tRNA	uncultured_Mediterranean_phage(33.33%)	43	NA	NA
WP_144420657.1|1940996_1942058_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1942769_1942931_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1943847_1944387_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1944769_1945186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1945281_1946097_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1946229_1947723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1947908_1948334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1948330_1950391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1950674_1951490_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1951590_1952409_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1952405_1952774_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1952955_1953783_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1953846_1954575_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1954977_1955706_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1956095_1956821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1956855_1960728_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1960928_1962062_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1962075_1962264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1962487_1963846_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_036773947.1|1965452_1966328_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1966839_1967475_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999981.1|1967487_1967961_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_155046603.1|1967888_1968041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929627.1|1968234_1968585_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1968644_1968932_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1968984_1969764_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376415.1|1970188_1971106_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1971157_1971913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1971980_1973255_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376412.1|1973375_1974053_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376411.1|1974253_1975678_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_016209938.1|1975652_1976291_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376410.1|1976653_1976932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376409.1|1977165_1978110_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376408.1|1978131_1980000_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376407.1|1980020_1980374_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_026063528.1|1980412_1981528_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1981712_1982753_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_027242800.1|1982755_1983790_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376402.1|1983786_1984848_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_017376401.1|1984959_1986432_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376400.1|1986584_1987028_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376399.1|1987096_1989868_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
>prophage 25
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	1994299	2043166	3194930	transposase	Staphylococcus_phage(25.0%)	45	NA	NA
WP_036773116.1|1994299_1995274_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|1995797_1998524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|1999411_2000386_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|2000636_2001341_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|2002580_2003099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|2004066_2005551_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2005675_2007211_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2007233_2007563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2007459_2007675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2009658_2010858_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2011067_2011928_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2012043_2012622_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2012778_2013420_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2013458_2013680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2013672_2014656_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2015049_2015547_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2015691_2015967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2016118_2017801_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2017808_2018831_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2018999_2020001_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2020114_2020453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2020928_2022188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2022396_2022624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2022652_2022871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2023008_2023374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2023441_2023684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2023698_2024034_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2024038_2024476_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_036772812.1|2024501_2025887_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2025997_2026429_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2026534_2028046_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2028336_2029929_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2030129_2032325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772819.1|2032418_2033852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2033894_2034410_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2034409_2035357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2035340_2036006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2036002_2036731_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2036720_2037467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2037450_2038515_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2038719_2039907_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2039963_2041082_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2041529_2041787_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2042066_2042744_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2042962_2043166_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	2062866	2112401	3194930	transposase,protease,tRNA	Burkholderia_virus(20.0%)	41	NA	NA
WP_017377787.1|2062866_2063094_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2063183_2063939_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2064352_2064949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2065028_2067833_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2067813_2068767_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2068759_2070130_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2070300_2071704_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2072475_2072802_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420651.1|2073006_2073660_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_017376600.1|2073979_2074159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2074414_2075671_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2075909_2076056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2076138_2076495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2076990_2077350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2077359_2077743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2078631_2078772_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2078916_2079837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2081994_2082525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2082535_2083591_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2083606_2085646_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2085632_2086463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2086529_2090069_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2090182_2090902_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2091140_2091770_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2091889_2093293_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2093438_2095382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2095899_2096760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2097195_2098941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771696.1|2099355_2100816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2100998_2101598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2101735_2101933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2102133_2102274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2102341_2103121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2103685_2104087_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2104231_2104609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2105068_2106376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2107124_2107382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2107433_2108837_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2109077_2110787_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2110956_2111319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|2111426_2112401_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 27
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	2126970	2186523	3194930	tRNA,protease,transposase	unidentified_phage(14.29%)	60	NA	NA
WP_017377892.1|2126970_2128392_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_026063687.1|2128481_2130080_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377894.1|2130236_2130863_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027242839.1|2130943_2133616_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377896.1|2134098_2135055_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_017377897.1|2135107_2135527_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_048875958.1|2135553_2136417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377899.1|2136406_2137198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2137502_2138474_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2138822_2139131_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2139127_2139784_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2139917_2140403_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2140480_2141002_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2141047_2141941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2141937_2142759_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2142953_2143103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2143330_2144161_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046606.1|2145566_2145737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2145889_2147293_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_144420645.1|2147402_2148659_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2148630_2149362_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2149373_2150651_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2150750_2151125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2151209_2152097_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2152154_2152883_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2152879_2153989_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2154140_2154569_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2154663_2155020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2155012_2156224_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2156220_2157009_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2157171_2157966_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2158415_2159156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2159159_2161658_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2161920_2162877_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2162860_2163622_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2163829_2164804_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2164912_2165668_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2165792_2166038_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2166097_2168371_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2168425_2168728_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2168968_2169262_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2169432_2169612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2169687_2170299_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2170545_2171862_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2171872_2172241_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2172271_2172934_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2173356_2173935_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2173914_2174322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2174445_2174742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2174788_2175664_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876123.1|2175733_2177914_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_017376060.1|2178017_2179367_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_036772012.1|2179440_2180130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2180262_2181450_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376055.1|2181968_2182613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2182609_2183923_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2184127_2184301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2184570_2185044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2185188_2185383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2185647_2186523_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	2205585	2253808	3194930	transposase,tRNA	Staphylococcus_phage(16.67%)	42	NA	NA
WP_036771639.1|2205585_2206560_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875951.1|2206603_2207440_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2207585_2208005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2208281_2208962_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2208927_2209278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2209310_2210522_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2210862_2211492_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2211540_2212557_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2212803_2213019_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2213071_2213521_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2213600_2215346_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2215437_2217309_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2217753_2218470_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2219907_2220777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2220733_2220961_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2221929_2222844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2222889_2223912_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2223980_2225030_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155051404.1|2225435_2225606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046607.1|2225646_2225829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243219.1|2226113_2226422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2226588_2227992_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046608.1|2228084_2228249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2228570_2228795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2228805_2230017_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036774710.1|2230411_2231311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|2231484_2231886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2232132_2233176_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2233295_2233532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2234320_2235874_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2238054_2238282_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2239152_2240127_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017375736.1|2240853_2241936_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_017375735.1|2241978_2242629_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375734.1|2242851_2243223_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_027243178.1|2243333_2244695_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155046609.1|2246415_2246622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2246932_2248015_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2248011_2248323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2249368_2250343_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2251349_2252129_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2252590_2253808_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	2266657	2327625	3194930	transposase,integrase	Staphylococcus_phage(30.0%)	47	2274510:2274569	2324931:2325691
WP_144420638.1|2266657_2267740_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2267736_2268048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2269545_2270481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2271073_2272219_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2274461_2275625_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2274510:2274569	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|2275653_2275878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2277225_2278401_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2278746_2281257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2281315_2282128_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377669.1|2282568_2283273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2283322_2284297_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2284401_2285733_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2285931_2286000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2286131_2287574_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2287965_2289378_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2290067_2290514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2291108_2291957_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2292210_2293269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2293260_2294967_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2295038_2296772_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2297068_2297635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2297759_2298413_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2298439_2299900_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2299996_2300974_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2301443_2302847_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2303372_2303666_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2303892_2304657_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2304864_2305092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2305155_2305338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2305900_2306080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376902.1|2306143_2306455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2307309_2308014_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2308211_2308352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2308756_2309281_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|2309427_2310684_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2310751_2311231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2311671_2313075_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420632.1|2313489_2315805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2316377_2318270_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2318441_2319416_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2319719_2320526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2320594_2321206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2322687_2322984_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2322980_2323823_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2324213_2324999_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2325003_2326407_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2324931:2325691	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2326680_2327625_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	2348467	2376120	3194930	transposase,protease	Staphylococcus_phage(25.0%)	28	NA	NA
WP_017377305.1|2348467_2349769_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2349850_2350456_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2350568_2351873_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2352473_2353349_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2353464_2354136_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2354315_2355671_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2355791_2356529_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2356607_2357324_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2357972_2359247_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2359277_2359853_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2359897_2360863_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2361326_2362235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046610.1|2362547_2362874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2363018_2363447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2363432_2364377_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2364581_2364734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2364762_2365497_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2365591_2365852_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2366070_2367036_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|2367012_2367309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2367499_2367949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2368208_2368637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2368732_2369233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2369169_2369331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2370211_2370433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2371931_2372609_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2373923_2374262_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2375145_2376120_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 31
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	2415365	2542829	3194930	transposase,tRNA	Burkholderia_virus(25.0%)	106	NA	NA
WP_080999971.1|2415365_2416769_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2416882_2417458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2418703_2418931_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2419220_2419760_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2420069_2421557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2421608_2422034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2422252_2423656_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2423652_2424030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2423989_2424535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2424930_2426157_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2426757_2428410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2428346_2428541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963645.1|2428873_2430064_-	MFS transporter	NA	NA	NA	NA	NA
WP_027243147.1|2430312_2432985_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2433273_2434110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2434770_2435661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2436129_2437104_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876012.1|2437588_2438992_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2439137_2440541_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|2440625_2442440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2444351_2445755_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2445788_2447318_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2447353_2448814_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_027242908.1|2448788_2449748_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376200.1|2449825_2453332_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_017376201.1|2453355_2453925_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_027242907.1|2454138_2455293_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376204.1|2455311_2456085_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|2456084_2456531_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376206.1|2456548_2457598_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_017376207.1|2457708_2458242_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_036771893.1|2458322_2460740_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_027242906.1|2461024_2462092_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_017376209.1|2464294_2465359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376210.1|2465348_2466377_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376211.1|2466373_2466913_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376212.1|2467449_2469360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420623.1|2469407_2469605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420622.1|2469804_2471382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|2471478_2472354_-	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_080963646.1|2472442_2473342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063514.1|2473256_2474003_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_017376216.1|2474010_2474568_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_017376217.1|2474571_2475309_-	UMP kinase	NA	NA	NA	NA	NA
WP_017376218.1|2475312_2476191_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376219.1|2476355_2477123_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376220.1|2477529_2478339_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376221.1|2478416_2481074_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|2481077_2482115_+	asparaginase	NA	NA	NA	NA	NA
WP_017376223.1|2482116_2482938_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376224.1|2483068_2483953_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_036773116.1|2484265_2485240_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2485292_2486288_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2486330_2487305_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376319.1|2487929_2488610_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017376318.1|2488609_2489419_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027242903.1|2489492_2493173_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_026063524.1|2493182_2494670_-	ribonuclease G	NA	NA	NA	NA	NA
WP_017376313.1|2494679_2495297_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_017376312.1|2495366_2495885_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376311.1|2495881_2496781_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2496796_2497840_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376309.1|2498037_2498325_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2498445_2499906_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2499985_2501422_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2501546_2502521_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2504711_2505473_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2506630_2506858_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2507811_2508024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2508041_2508359_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2508385_2509075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2509415_2509619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2509750_2510686_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2510698_2511481_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2511610_2511922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2512265_2512592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2512616_2513072_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2513061_2514114_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2514116_2515580_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2515714_2515942_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2517358_2517823_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2518079_2518895_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2519023_2521336_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2521452_2521980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2522671_2523949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2523959_2524211_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2524244_2524766_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2524935_2525922_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2526012_2526828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2527256_2527652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2527624_2527852_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_047927746.1|2528820_2529408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2530010_2530682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875918.1|2530826_2531408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420767.1|2531450_2532128_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243185.1|2532406_2533363_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_017377736.1|2533422_2534088_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017377737.1|2534121_2534667_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_155046615.1|2534946_2535108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774946.1|2535804_2536419_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_144420620.1|2536345_2537548_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875923.1|2537533_2538529_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2538532_2538937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2539904_2540132_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2541100_2541697_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046616.1|2541665_2542829_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
>prophage 32
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	2552550	2603964	3194930	transposase,tRNA	Bacillus_phage(20.0%)	55	NA	NA
WP_048876031.1|2552550_2553954_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|2554059_2554284_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2554466_2555288_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|2555433_2555688_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377841.1|2556076_2557861_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|2557949_2558669_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2558830_2559037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2559036_2559273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2559285_2559639_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2560176_2561010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2561102_2561300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2561397_2562783_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2562909_2563500_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2564531_2564819_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2564878_2565043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2565039_2566410_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2566776_2568189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2568258_2569029_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2569521_2569809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2571285_2571579_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2571536_2572358_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2572502_2572727_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155046618.1|2572981_2573509_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|2573685_2573946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2573864_2574020_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2574118_2575093_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2576421_2576571_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2576687_2576981_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2577789_2578365_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2578442_2579318_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2579382_2580003_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2579987_2581070_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2581303_2581708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2583198_2584500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2584646_2585315_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2586247_2586811_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2586867_2588064_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_017376587.1|2588188_2589553_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376586.1|2589549_2590641_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376585.1|2590895_2591546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2591738_2591933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2592040_2592193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376583.1|2592459_2593587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063543.1|2593676_2594510_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376581.1|2594513_2595164_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_017376580.1|2595153_2595993_-	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_016210074.1|2595998_2596625_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376579.1|2596785_2597328_+	septation protein A	NA	NA	NA	NA	NA
WP_017376578.1|2597411_2597714_+	YciI family protein	NA	NA	NA	NA	NA
WP_144420763.1|2597731_2597974_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376576.1|2598072_2598345_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376575.1|2598383_2599022_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376574.1|2599054_2600146_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376573.1|2600317_2602060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2602989_2603964_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 33
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	2613258	2731719	3194930	transposase,tRNA	Staphylococcus_phage(29.63%)	108	NA	NA
WP_080999966.1|2613258_2614608_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2614905_2615463_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2615556_2616063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2616567_2617263_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|2617393_2618182_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2618215_2619619_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2620042_2621017_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2621273_2621501_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2622588_2623119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2623115_2624648_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2624644_2625595_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2626015_2626648_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2626890_2627088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2627437_2627866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2627943_2628939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2629083_2629335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2629439_2630084_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2630319_2630817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2631328_2632303_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2632673_2632967_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2633779_2634115_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2634435_2635974_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2636126_2637225_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2637463_2638663_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2638693_2639320_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2639348_2640233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2640366_2640597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2640734_2641976_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_144420613.1|2642255_2642627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2644758_2644920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2645295_2646423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2646539_2647202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2647287_2647548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2647966_2648728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2650789_2651449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2651549_2652200_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2652347_2653037_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377795.1|2653059_2654223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2654427_2654679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619442.1|2655202_2655865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2655998_2656973_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376009.1|2658327_2658618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376008.1|2658940_2659978_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376007.1|2660008_2661463_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376006.1|2661472_2662657_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376005.1|2662730_2663738_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376004.1|2663806_2665810_-	transketolase	NA	NA	NA	NA	NA
WP_017376003.1|2666261_2667422_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376001.1|2667658_2668774_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376000.1|2668936_2669461_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017375999.1|2669460_2669991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2671650_2672526_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2672646_2673147_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2673143_2673410_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2673575_2674550_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2674729_2675350_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2675656_2677060_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771922.1|2677894_2679085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|2679651_2680119_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|2680620_2680875_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|2681076_2681580_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|2681796_2682402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2682562_2683246_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2683321_2684101_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|2684087_2684948_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|2685071_2685437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377271.1|2685822_2686152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2686562_2687537_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_144420611.1|2688071_2688272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420610.1|2688304_2689684_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	3.3e-36
WP_017377275.1|2690718_2691441_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2691432_2691801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2692063_2693365_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2693460_2693904_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2693907_2694417_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2694409_2697223_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2697719_2698652_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2698756_2699683_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2699861_2701400_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2701573_2701834_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2703108_2703717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2703763_2704492_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2704738_2704876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619438.1|2706026_2706578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2706812_2707724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2707983_2708280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2708624_2709778_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2710374_2710923_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2711026_2711590_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2711807_2712566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2713841_2714069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2714291_2714471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2714726_2715983_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2716050_2716695_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_017378393.1|2717499_2717706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378392.1|2717976_2718129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816949.1|2718706_2719105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378390.1|2719298_2720876_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378389.1|2721009_2721951_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378388.1|2721952_2722726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963621.1|2724334_2724541_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2724807_2725095_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378384.1|2725100_2727482_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|2727494_2728490_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_016210495.1|2728621_2728981_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378382.1|2729023_2729218_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|2729252_2729783_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378381.1|2729787_2731719_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
>prophage 34
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	2769497	2822526	3194930	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2769497_2770472_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2770628_2772203_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2772427_2772706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2772775_2773651_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2773660_2774821_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2774935_2776084_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2776094_2778896_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2779002_2779701_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2779713_2781477_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2781480_2781828_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2781821_2782196_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2783143_2784427_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2784836_2786132_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2786487_2787033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046622.1|2787626_2788142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2788153_2789533_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2789768_2790203_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2790199_2791552_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2791551_2792667_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2792667_2793684_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2793673_2795344_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2795363_2795699_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2795726_2797166_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2797162_2798209_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2798351_2799848_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2800143_2801145_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2801250_2801862_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2801982_2802360_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2802410_2803817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2803810_2804878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2804984_2806586_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2806834_2807752_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2807820_2809515_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2809749_2810679_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2810709_2812113_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2812343_2813048_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2813114_2813771_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2813781_2814663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2814833_2817503_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2817863_2818838_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2818917_2819889_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2819942_2820917_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2821036_2821258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2821321_2821630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2821554_2822526_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	2837092	2891353	3194930	transposase	Staphylococcus_phage(37.5%)	51	NA	NA
WP_026063658.1|2837092_2837821_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2838130_2838385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2839098_2841753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2841791_2842082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2842198_2843497_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2844067_2844556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2844536_2844839_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2845085_2845574_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2845607_2846246_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2846367_2846907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2846996_2848223_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2848835_2849093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2849179_2850079_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2850223_2850490_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2850481_2850631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2850858_2851734_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2851863_2852091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2852157_2852352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2852410_2853385_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2853422_2853611_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2853611_2855384_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2855373_2856366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2856973_2857666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2858152_2858722_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2858718_2859693_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2859732_2860236_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2860326_2861730_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2862428_2862614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2862719_2864123_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046624.1|2864169_2864700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2864733_2866161_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|2867446_2869816_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2869891_2870710_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2871061_2871607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2872089_2873328_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2873304_2874279_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017375625.1|2874371_2874599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|2874603_2875095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243039.1|2875767_2876655_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_027243038.1|2876744_2878235_-	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_017376549.1|2878258_2879140_-	ROK family protein	NA	NA	NA	NA	NA
WP_017376548.1|2879136_2879859_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376547.1|2880558_2881350_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|2881536_2881782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420598.1|2881933_2882164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376543.1|2882193_2882973_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_047927468.1|2882998_2883304_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_144420752.1|2883300_2884194_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_027243035.1|2884549_2885848_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376538.1|2888450_2889632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2889925_2891353_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	2898939	2948640	3194930	transposase,tRNA	Bodo_saltans_virus(14.29%)	43	NA	NA
WP_062312049.1|2898939_2900307_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2900799_2901279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2901458_2903522_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2903530_2904256_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2904883_2905597_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2905601_2906132_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2906366_2906600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2906712_2906961_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2907768_2909961_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2909978_2910287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2910940_2912650_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2912843_2912999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2914401_2915277_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2915602_2916364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2916588_2917320_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2917316_2917853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2917906_2918671_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2918673_2920251_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2920257_2920734_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2920709_2921141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2921173_2921929_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2922103_2922391_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2922773_2922998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2923337_2924501_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2924535_2925513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2925506_2926193_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2926131_2927247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2927526_2928132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2928369_2928849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2930671_2931325_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2931437_2931989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2932088_2933063_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2933348_2933873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2934570_2935395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2935650_2936007_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2936003_2937407_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2937526_2938087_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2938244_2938811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243087.1|2941631_2942327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2942367_2942580_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2944152_2945262_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2945317_2946799_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2947236_2948640_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP039076	Piscirickettsia salmonis strain Psal-109 chromosome, complete genome	3194930	3076322	3141571	3194930	transposase,protease	Hokovirus(14.29%)	58	NA	NA
WP_017376170.1|3076322_3077423_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3077780_3078755_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3078891_3079770_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3079777_3080008_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3080061_3081066_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3081284_3082112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3082193_3083582_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3083869_3085270_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3085364_3086291_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3086287_3087424_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3087420_3088428_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3088424_3089588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3089597_3090449_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3090480_3091653_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3091649_3093038_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3093066_3093474_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3093493_3094501_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3094497_3095370_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3095366_3096227_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3096228_3098499_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3098500_3099646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3099692_3100178_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3100217_3100841_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3106520_3107273_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155046626.1|3107875_3108043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243062.1|3108604_3109228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3109332_3110121_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3110120_3110852_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3110885_3112613_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3112626_3113688_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3114002_3115217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3115349_3115874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3116491_3117340_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3117326_3118025_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3118079_3118841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3118833_3119256_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3119385_3119937_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3119992_3120955_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3120955_3121171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3121357_3122167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3122146_3122989_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3122985_3124230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3124368_3125457_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3125474_3125975_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3126162_3126762_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3126767_3127931_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3127963_3128917_+	glutathione synthase	NA	NA	NA	NA	NA
WP_155048072.1|3129061_3129217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376261.1|3129280_3130345_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3130341_3133404_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3133556_3134009_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3134040_3134397_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3134815_3135589_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243067.1|3136148_3136331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376269.1|3138212_3138503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3138727_3139603_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3139599_3140157_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3140167_3141571_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039078	Piscirickettsia salmonis strain Psal-109 plasmid unnamed2, complete sequence	176236	0	118616	176236	transposase,terminase,integrase,portal	Streptococcus_phage(39.22%)	122	11253:11312	118982:120717
WP_017377655.1|1412_1658_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|1654_2041_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|2128_2857_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|2835_3456_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|3801_4488_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|5437_5800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|5802_7542_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|7943_8096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|8123_8807_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|8888_9866_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|9941_10112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|10152_10881_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
11253:11312	attL	GATGTATCTTAGCTAAATCTGTCAGCACCTTTTTAATTTTAGTATCAACAACCTGTTTTT	NA	NA	NA	NA
WP_036771293.1|11426_11693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772437.1|11988_13887_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|14308_15037_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_080999960.1|15104_15257_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|15673_15838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|15858_17145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|17327_18056_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|18183_19161_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046631.1|19235_19886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046632.1|21895_22045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126795.1|22517_22778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|22781_23054_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|23129_23858_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|24426_25398_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|26262_27090_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|27943_28414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|29307_29451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|30657_31257_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|31610_32387_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|32747_33476_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|33545_33746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|33664_34636_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027242938.1|35049_35418_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017375972.1|35419_35728_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017375841.1|36172_36382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|36688_36907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242936.1|36903_37356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420845.1|37483_37714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876207.1|38219_39695_-	response regulator	NA	NA	NA	NA	NA
WP_017375966.1|39695_40262_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_146619519.1|40406_40844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|40875_41301_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_036817204.1|41571_42567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817201.1|42870_43278_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017375960.1|43385_44429_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_017375959.1|44730_44964_+	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_146619517.1|45101_45254_-	phosphatase	NA	NA	NA	NA	NA
WP_081078123.1|45283_45646_+	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
WP_036773116.1|46087_47062_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_026063496.1|47630_47996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242932.1|48128_48356_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242931.1|48364_48772_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242930.1|48917_50300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375952.1|50489_50693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242929.1|50888_51272_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|51358_51841_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|51843_53175_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|53379_53814_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|53900_54287_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|54324_55059_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|55105_55819_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_144420848.1|57197_57383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243190.1|57386_60731_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017377509.1|60911_61640_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|61733_62708_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|63021_63384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|63423_63933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|64164_65145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|65610_66588_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|67068_68046_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|68060_68222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|68439_68694_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|68683_68971_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_036771347.1|69465_70443_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|71443_71656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|71813_72791_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_075317322.1|72777_74292_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_047927782.1|75087_75477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|75392_76370_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_048876196.1|76399_77548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243215.1|79361_80384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|80866_81595_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_048876194.1|82834_83368_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|83548_83890_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|84070_84337_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|84409_86275_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|86442_86727_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|87070_87799_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|87880_88372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|89104_89332_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|90883_91312_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|91247_91634_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|91663_92392_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|92403_92553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|92799_93528_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|94905_95868_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|95891_96221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|96287_97328_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|97341_97533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|97737_98307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|98349_98649_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155046638.1|98645_99110_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|99383_100112_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|100285_101059_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|101772_102708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|102982_103711_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046639.1|103876_104080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|104179_107521_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|107678_108407_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|108700_109096_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|109148_109877_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|110360_111089_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|111259_111829_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|111833_112517_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|112668_113397_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_080963627.1|113415_113634_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774644.1|114613_115675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|116183_116930_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|116930_117335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|117641_118616_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
118982:120717	attR	GATGTATCTTAGCTAAATCTGTCAGCACCTTTTTAATTTTAGTATCAACAACCTGTTTTTTAGGTTGATACCGATAAACTGATCGGCCAATACGGCACATCTTGCATGCTTTATTCCCGCTCAATGCATGAGCTTTGACAGCATAATCAACTAAGTCACGCCGACTCGCTGCGGTTATAGCTTTTTTTCAACAATATCCTTGAGCACTTTGTGCTCTAGGCTAATGTCTGCGTACATCTGTTTCAAACGACGGTTTTCGTCTTCAAACTCTTTTAAACGCTGTAGATCTGAAACGCCCATGCCTTGATATTTGGATCTGAGTTTGTAGTAGCTGCTTTTAGCAATACCATACTGGCGACAAATATCTTCAACTTTAACACCCGCTTGGCCTTCATTAAGCATGGCTACAATTTGTGATTCTGTTAGTTTTGATCGTTTCATCTTCTCTCTCCTGGCTAAGTTAATTTAACAGAAGATTCCACTTATCACTTGTACTATTTTAAGGGAGGGTTACCGAGTTATGTGAGAGCACAGTAGTGGAGTGTGCCGATTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTTGCGACAGAACCCTCCTTGGTTCGCAGCGCCAACATCATATCATTAAATCAAATTGCGACAGAACCATTATAGCTCATCATCTTCATATCTTGTATGTTTAGGATCATTACAAACATACCATCCACTAGAACTAGAATTTGTACATACCCCATACCTTTTAGATAAATCAAAGTACATAGTTGTGCTAGAAGGAGATTGTGATGATTTAGCATCAAAAAGTGAGCCAAAATGATTGTAAGTCGTGACATATAAATTACTTTTATCTGAATTTTTAATATATATTGCGCTGACAGGATCATTTACTCTACTTTCTAAAAACCATTTTAAATTATTAGGTACGTTATCCATAAATGGATCACACTGTTTGAAATAAACCCAATCCCAATCCGTCGTTTTTCCAGCAATATTAGAAGTTAAACAGCTTAAAAACCAACCATCAGATGAAAATGCACGGCCATATAGTGAAAGCATCAATATTCTAGAATTTTTCATATCATAGTATGTTCTATTCAAATAATTTGAATTATACGAACCTGAATACATAGGATAGTAATTATTATCAGATTTATCATAAAACCTCATACCAATTTCATACCAAAATGTATTTACTTTTGATGGTGTTTTAAAAAAGTATTTAGACATTTTATTTGCATCTAAAACAATATTAGTTCCACTTGATTTTGAAATAATTCCATAGTTGCCATACCATTGAATAGATAGATCTTTATTTAAACGAGGTTTTAATTTTCCATCTCTTACATCCCATTTTTGATAAGGGTTATAAATATCACAAGGCCAAAACTCTACATAATCCCATTTATCATCACCTTTGATGACATTTTCTGGTGCAGTCATACATAGAGGGATTCCAAATTGAGATTTAGAGAAAGCAACTCTGCCAAGAGTATCATAAATAGCTTTTTGACTTTCTACATTAGAACATGTTTGAGCGTATAAATAAGATCGAGACGTTTTCATAGAAGAGTCTCTTGATTGAGTTGGAGCTAAACAGTAACCTCCCTGAGTTGTAATTAACTGGCTTGGTATTGTAGGTAAATCTTTAAAT	NA	NA	NA	NA
>prophage 2
NZ_CP039078	Piscirickettsia salmonis strain Psal-109 plasmid unnamed2, complete sequence	176236	124563	126185	176236	transposase	Acinetobacter_phage(50.0%)	3	NA	NA
WP_017375632.1|124563_124899_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|125093_125297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|125390_126185_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
>prophage 3
NZ_CP039078	Piscirickettsia salmonis strain Psal-109 plasmid unnamed2, complete sequence	176236	132555	134973	176236	transposase,portal	unidentified_phage(50.0%)	2	NA	NA
WP_048875857.1|132555_133530_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|134517_134973_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
>prophage 4
NZ_CP039078	Piscirickettsia salmonis strain Psal-109 plasmid unnamed2, complete sequence	176236	139691	146659	176236	transposase	Streptococcus_phage(100.0%)	7	NA	NA
WP_017377509.1|139691_140420_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|140561_141494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|141523_142252_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|142254_142527_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|143377_144106_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|144161_144782_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|145930_146659_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 5
NZ_CP039078	Piscirickettsia salmonis strain Psal-109 plasmid unnamed2, complete sequence	176236	152694	161351	176236	transposase	Streptococcus_phage(75.0%)	8	NA	NA
WP_027243210.1|152694_153429_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.9e-36
WP_017377526.1|153758_154619_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377525.1|155020_155818_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_075275471.1|156358_157333_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_155046640.1|157968_158136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876214.1|158104_158833_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_017377521.1|159341_159695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|160622_161351_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 6
NZ_CP039078	Piscirickettsia salmonis strain Psal-109 plasmid unnamed2, complete sequence	176236	167715	173618	176236	transposase	Staphylococcus_phage(28.57%)	9	NA	NA
WP_075275473.1|167715_167892_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|168008_168716_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|168669_169548_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243193.1|169578_170121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|170392_171097_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|171108_171837_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|171866_172256_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|172278_173007_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|173009_173618_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
>prophage 1
NZ_CP039079	Piscirickettsia salmonis strain Psal-109 plasmid unnamed3, complete sequence	50691	32440	46236	50691	tail,capsid,head,transposase	Moraxella_phage(18.18%)	18	NA	NA
WP_036771639.1|32440_33415_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|33464_34004_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|34017_34602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|34986_35298_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|35294_35720_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|35898_36294_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|36290_36641_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|36640_37063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|37064_37388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|37444_37711_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|37714_39793_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|39785_40127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|40123_40795_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|40724_41510_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|41499_42057_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|42053_44744_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|44802_45231_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|45258_46236_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 1
NZ_CP039080	Piscirickettsia salmonis strain Psal-109 plasmid unnamed4, complete sequence	33555	3402	19424	33555	capsid,transposase,integrase,terminase,tail,head	unidentified_phage(35.71%)	21	NA	NA
WP_036771330.1|3402_4377_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4912_5503_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5733_5994_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5986_6340_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6516_7491_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|8023_8389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|8533_8788_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8771_9128_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|9225_10200_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|10825_11692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|11904_12288_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|12374_12857_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|12859_13045_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|13064_14039_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|14135_14528_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|14563_15145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|15525_16500_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|16573_16789_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|17592_18108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|18453_19011_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|19007_19424_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
