The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	31805	91594	3194859	transposase,tRNA	Staphylococcus_phage(28.57%)	52	NA	NA
WP_036772169.1|31805_32681_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33039_34395_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34486_34993_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34989_35358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36760_38545_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39025_40153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40225_40981_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|41017_43711_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43742_44294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44401_45415_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45535_45760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46115_46877_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47019_47814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|47958_48711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49022_50549_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50687_51761_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|51800_53108_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53082_54252_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54306_55032_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55497_57603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|57817_58282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58301_58811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59195_60137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60418_61870_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773655.1|62336_62741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63301_64276_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|65010_65388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|65977_66952_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773242.1|66991_67546_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|67726_68626_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|68630_69257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|69201_71523_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|71669_72149_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|72145_73297_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|73431_73935_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|74028_75003_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|74992_76306_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|76346_77726_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|77732_79184_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|79209_79578_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378407.1|79596_80664_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|80696_81593_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|81589_82426_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|82561_83014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|83152_83899_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|83879_84443_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|84451_84967_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|85108_87187_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|87186_88137_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|89004_89403_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|89628_89958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|90574_91594_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	123076	241144	3194859	transposase,tRNA,protease	Staphylococcus_phage(12.5%)	106	NA	NA
WP_075278722.1|123076_123952_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|124392_124686_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|124686_124941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|124957_127450_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|127442_128126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|128125_129169_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|129168_130398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|130399_130729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|130725_131925_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|132037_132427_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|132426_133371_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|133490_134888_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|135213_135735_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|135858_136167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|136181_141404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|141794_143801_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|143931_146262_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|146437_147268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|147384_147780_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|147776_148310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|148306_148708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|149102_149423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|149432_150389_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|150898_151423_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|151523_152522_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|152610_153507_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|153580_154867_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|155326_156643_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|156756_156927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|156946_157921_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|158047_158308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|158575_158866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|161404_162445_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|162547_163519_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|163641_164490_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|164641_164929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|165239_165611_+	isochorismatase	NA	NA	NA	NA	NA
WP_017377540.1|166662_166896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|167033_167171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|167184_167397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242723.1|167393_167693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|167920_168745_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|168883_170017_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|170076_171486_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|171633_173214_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|173971_174967_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|174972_177039_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|177096_178047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|178241_178568_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|178790_180050_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|180309_181185_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|181223_182186_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|187880_188225_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|188321_189245_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|189744_190233_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|190335_191136_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|191146_192898_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|193787_194030_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|194033_194432_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|194663_195539_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|196257_196716_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|196897_197083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|197798_199613_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|200023_200692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|200701_202018_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|202177_203140_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|203220_203376_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|203389_203626_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|203818_205036_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|205013_205472_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|205499_206879_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|206915_207134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|207453_208749_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|208953_209145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|209343_210219_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|210406_211672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|211705_212581_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|212702_213161_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|213184_214105_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|214232_215015_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|215105_216605_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|216918_218802_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|219061_219724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|219790_220900_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|220911_221556_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|221574_222561_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|222645_223722_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|223923_224748_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|225050_226016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|226334_227387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|227445_228420_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|228755_229184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|229420_229903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|229958_231209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|231311_231530_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|232001_232856_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|232910_233381_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|233677_233914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|234060_234441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|234499_235375_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|236141_237053_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|237169_238018_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|238084_239095_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|239118_239442_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375569.1|239452_239848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|240124_241144_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	314947	357306	3194859	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|314947_315823_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|315903_316536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|316489_317935_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|317969_318389_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|319162_319531_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|319540_320080_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|320240_320672_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|320675_321374_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|321621_322128_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|322170_322539_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|322809_326886_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|326949_331158_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|331319_331694_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|331798_332272_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|332287_334399_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|334426_335617_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|335623_335935_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|336057_336696_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|336711_337329_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|337325_337622_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|337636_338461_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|338477_338753_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|338758_339091_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|339103_339838_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|339851_340265_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|340264_340465_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|340464_340722_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|340843_341212_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|341229_341541_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|341556_342099_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|342111_342417_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|342445_342838_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|342850_343384_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|343393_343747_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|343757_344258_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|344263_344446_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|344448_344883_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|344883_346206_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|346262_346376_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|346519_346876_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|346901_347291_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|347300_347921_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|347942_348920_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|348968_349367_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|349479_350727_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|350713_351370_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|351454_351733_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|351975_352203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|352335_353130_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|353438_354653_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|355050_355230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|355198_355852_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|356227_356476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|356565_357306_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	375324	425007	3194859	transposase,tRNA	Staphylococcus_phage(25.0%)	54	NA	NA
WP_017376964.1|375324_377805_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|377891_378371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|378343_379384_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|379320_380037_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|380049_380385_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|380421_380892_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|380934_382770_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|382814_383903_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|383924_384986_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|385063_385579_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|385619_386897_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|386911_387763_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|387791_388439_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|388435_389395_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_048875861.1|389916_390786_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|390930_391185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|391329_391896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|392001_392442_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_051929598.1|392399_392657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242664.1|392953_394156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|394439_395414_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046563.1|395883_396021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|396037_396253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|396457_397069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|397065_397323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|397573_397966_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|398095_398644_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|398643_399471_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|399520_401206_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|401283_401745_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|401781_402345_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|402571_402901_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|402881_403106_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|403250_403841_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|403865_405137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|405154_406408_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|406404_407049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|407121_408171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|408272_409910_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|409944_410274_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|410430_410718_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376927.1|411144_411282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046565.1|411244_411538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|411787_413008_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|413066_415865_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|416170_417337_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|417435_417972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|418033_418366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|418623_419526_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|419595_420093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|420238_421642_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|421842_422571_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963630.1|422740_423598_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_048875864.1|423981_425007_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	451079	499218	3194859	transposase	Staphylococcus_phage(100.0%)	42	NA	NA
WP_036774259.1|451079_452054_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377364.1|452203_453040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|453159_454563_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242658.1|455905_457369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856768.1|457444_458239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242656.1|458530_459349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|459366_459960_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376894.1|460176_460410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242655.1|460633_461530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155050372.1|461825_462605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376891.1|462774_463677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|463673_464897_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_027242653.1|464914_465841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|465856_466897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242651.1|467011_467422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376888.1|467474_467978_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_017376887.1|467970_468717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376886.1|468719_469850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|469854_470094_+	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_027242650.1|472583_473072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|473074_474151_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_017376878.1|474143_474797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875870.1|474803_475229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|475265_478265_+	ATPase AAA	NA	NA	NA	NA	NA
WP_027242646.1|478326_479829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|480280_481900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|481941_484245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376870.1|484521_485418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|485420_488747_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_144420818.1|488948_489137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|489148_489625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|489667_489895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|490076_490610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|490640_490982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772347.1|490984_491401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876253.1|491562_492219_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036771639.1|492215_493190_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|493631_493895_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|494322_495297_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_087910671.1|495684_496149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910670.1|496242_496428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|498243_499218_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 6
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	504022	558705	3194859	transposase	Streptococcus_phage(22.22%)	52	NA	NA
WP_048875872.1|504022_505306_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|505478_505616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|505612_507016_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|507129_507567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|507687_508116_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|508363_508801_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|509232_510621_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|511067_512561_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|512755_513511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|514010_514241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|515345_516356_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|516352_516574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|517292_518234_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|518761_519160_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|519099_519954_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|520045_520327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|520412_521090_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|521135_522416_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|522591_523641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|523719_524520_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|524533_525328_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|525430_526450_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|526496_527108_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|527111_527798_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|527794_528337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|528629_529817_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|530061_530787_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|530972_531761_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|531757_532153_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|532545_533586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|533582_534986_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|537401_537659_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|537698_539084_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242633.1|539413_540511_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_017377120.1|540544_541795_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|541795_542428_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|542717_543170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|543215_544058_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|544092_544584_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|544779_546747_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|546974_547379_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|547356_548385_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|548371_549160_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|549586_550990_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377110.1|551191_552202_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_075275363.1|552214_552682_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377107.1|553011_554382_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_017377106.1|554684_555155_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377105.1|555432_555708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|555718_557122_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069971661.1|557296_557734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|557730_558705_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 7
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	590496	723890	3194859	transposase,tRNA,plate	Staphylococcus_phage(13.64%)	111	NA	NA
WP_036772726.1|590496_591045_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|591797_593177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|593536_595000_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|595183_595996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|596460_598455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|598849_600229_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|600266_600704_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|600746_601463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|603009_603540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|603606_605427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|605991_606498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|606582_607986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|608100_608355_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|608507_608780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|609355_609538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|609654_610230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377063.1|610226_610397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|611297_611540_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|611842_612934_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|612914_613868_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|614091_615576_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|615615_616119_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|616378_617554_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|617701_618106_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|618262_619138_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|619172_619526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|622855_623281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|623511_624648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|624634_625957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|625949_627068_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|627188_627722_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|627860_629498_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|629502_629724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|629832_630846_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|631117_633346_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_026063593.1|633326_634031_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|634265_634595_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|635995_636214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|636272_637148_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|637140_638007_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|638074_639394_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|639863_640424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|640742_641669_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|642564_643473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|647169_648009_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|648195_648411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|648459_649035_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|649031_649370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|649538_650528_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|651517_652420_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875883.1|652679_653216_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|653360_654278_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|654712_655723_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|656530_657067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|658279_658627_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|658771_659731_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|659832_660615_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|660747_661707_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|661731_662136_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|662164_662839_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|662938_664654_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|664650_665013_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|665027_666182_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|666185_667193_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|667195_668212_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|668427_669513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|669619_670012_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|670144_671428_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|671443_672745_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|672762_674565_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|674569_675562_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|675642_676719_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|676816_677791_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|677858_678830_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|679013_679283_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|679884_681171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|681235_681916_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376024.1|687571_687820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816881.1|687897_688116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275355.1|688139_689114_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_027242570.1|689327_690467_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|690675_692046_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|692424_693417_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|693420_693936_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|693932_694772_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|694804_696355_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|696462_696834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|698054_698216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|698796_700200_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|700234_700672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|700695_701670_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|701728_702157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|702344_703151_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|703225_703618_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|703662_704484_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|704496_705480_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|705481_706750_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|706756_709261_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|709391_710417_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|710413_711124_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|711048_711879_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|712028_712412_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|712446_713346_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|713391_714063_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|714145_714721_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|714819_715620_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|715761_716619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|717481_718618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|718684_721855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|721867_722578_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|722582_723890_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	732532	778849	3194859	transposase,plate	Staphylococcus_phage(21.43%)	51	NA	NA
WP_017376356.1|732532_732931_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|732927_734616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|734597_735554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|735596_736112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|736216_737149_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|737368_737755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|737772_738417_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|738567_739407_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|739482_740085_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|740085_740940_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|741297_741609_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|741633_743022_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|743177_743909_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|743905_744433_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|744464_745022_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|745027_746008_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|746147_746948_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|746951_747719_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|747715_748180_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|748202_748856_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|748859_749207_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|749240_749492_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|749569_750838_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|750840_751599_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|751660_752551_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|752601_753285_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|753294_753642_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155062809.1|753911_756035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|756026_756899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|757066_758896_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|759063_759705_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|760029_760476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|760493_760667_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|760725_761775_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|761781_762732_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|762786_763731_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|763758_764496_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|764584_764827_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|764901_766125_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|766156_767005_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|767001_768054_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|768190_768811_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|769036_770189_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|771209_772184_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|772180_772351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|773319_773916_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|773884_775045_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|775555_775897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|776000_777035_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|777031_777742_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|777874_778849_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 9
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	787009	841320	3194859	transposase,tRNA,protease	Prochlorococcus_phage(33.33%)	49	NA	NA
WP_017377942.1|787009_787516_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243058.1|787597_788014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|788105_788966_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|789063_789609_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|789691_790543_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|790584_793491_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|793551_793749_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|793755_794766_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|794762_795821_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|795835_796615_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|796617_797430_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|797441_798389_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|798399_799692_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|799870_800974_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|800970_801363_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|801375_802752_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|802745_804215_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|804408_804843_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|805138_805315_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|806349_807375_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_017377925.1|807876_808269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|809661_810312_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|811010_811805_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|811984_812629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|812803_813778_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|814178_814436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|816113_816791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|817024_817849_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|817942_818656_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|818745_819837_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|819908_820490_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|820495_821122_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|821218_822166_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|822512_823175_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|823345_824005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|824173_825433_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|825429_826515_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|826507_827389_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|827377_828628_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|830013_830334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|830592_830859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|831349_831568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|832553_832775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|832771_833854_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|833864_834236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|834232_834412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|837115_837391_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|838226_839684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|840111_841320_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	885000	947520	3194859	transposase,tRNA	Staphylococcus_phage(28.57%)	53	NA	NA
WP_048875904.1|885000_885876_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|886132_886570_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|886630_887263_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|887278_887926_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|887928_889992_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|890318_891611_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|891999_894210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|894226_894883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|897268_898144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|898402_899014_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|899441_902030_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|902132_902894_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|902890_903427_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|903475_904432_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|904509_907695_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|907698_908754_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|908983_909586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|909629_910292_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|910326_910674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375702.1|911142_912174_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|912636_914040_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|915158_915503_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|915594_916050_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|916298_916433_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|916425_917067_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|917063_917780_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|917783_919103_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155051395.1|919784_919928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773644.1|920907_923544_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_036773645.1|923585_924671_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|924670_925354_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_017377748.1|925414_927076_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377747.1|927228_927483_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|927561_927879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|928031_928430_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|928511_929150_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|929306_930281_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|930653_930929_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|931478_931763_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|933579_934173_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|935260_936142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|936253_937933_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|938059_939310_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|939385_939847_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|939843_940992_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|940997_941672_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|941668_942325_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|942450_942924_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|942925_943348_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|943334_944354_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|944513_944693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|944911_945193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|946644_947520_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	951422	1018385	3194859	transposase,tRNA,protease	Bacillus_phage(20.0%)	56	NA	NA
WP_048876012.1|951422_952826_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|953184_953952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|954065_955469_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|955465_955627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|955942_956917_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|957157_958441_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|958507_959431_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|961626_963771_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|963792_963999_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|964059_964680_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|964720_965614_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|965699_966425_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|966486_966891_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|967053_969162_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|969285_970335_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|970331_971798_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|971940_973278_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|973345_974836_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|975064_975436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|975586_976414_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|976716_977373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|977320_978244_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|978257_979181_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027243109.1|979455_980112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|981811_982039_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376989.1|982363_982912_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|982992_983268_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|983267_984317_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|984429_986367_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|986514_988227_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|988295_989015_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|989011_989614_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|989728_990616_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|990806_991154_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|991204_992044_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|992139_992886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|993082_993709_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|994024_994594_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|994737_995436_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|996142_996766_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|996875_997769_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|997875_999486_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|999482_1000778_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|1000799_1002722_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|1002832_1003135_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|1003229_1008116_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1008163_1009486_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1009610_1010705_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1010756_1011695_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1011775_1012360_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1012744_1013635_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1013837_1014329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1014468_1014960_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1015128_1015842_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065653747.1|1015904_1017245_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1017509_1018385_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	1023998	1086525	3194859	transposase	Staphylococcus_phage(33.33%)	57	NA	NA
WP_017377787.1|1023998_1024226_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1024252_1025293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1025359_1025929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1026159_1026564_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1026576_1026717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1026811_1028011_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1028031_1028643_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1028844_1029606_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1029901_1030828_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1030988_1031945_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1032089_1032359_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1032625_1033600_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1033753_1033981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1034097_1034523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1034679_1035609_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1036055_1036586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|1036907_1037213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1037690_1038002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1038341_1039508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1041695_1042667_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1043269_1043443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1043838_1044756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1044756_1045608_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1046048_1047095_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1047084_1049076_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1049185_1049560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1049813_1049996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1050257_1050959_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420709.1|1050959_1051379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376293.1|1053065_1055816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1056051_1057344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1057830_1058736_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376296.1|1059513_1060230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1060515_1061277_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1061309_1062713_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1062709_1062874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1062933_1063221_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1063965_1064694_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1064662_1065409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420708.1|1065489_1065879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1065875_1066850_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1067006_1067324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772457.1|1069799_1070108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1070183_1070456_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1072989_1073427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1074028_1075216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1075486_1077121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1077171_1077900_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1079327_1080290_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1080513_1081509_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1081536_1082472_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1082515_1082977_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1082955_1083573_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1083602_1084577_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1084631_1085099_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1085111_1085756_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1085796_1086525_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 13
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	1095225	1144793	3194859	transposase	Acinetobacter_phage(22.22%)	39	NA	NA
WP_082300708.1|1095225_1095786_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1097110_1097506_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1097514_1097871_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1097863_1098739_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1098824_1099403_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1099360_1099654_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1100614_1102126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1102373_1103777_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1103982_1104417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1104499_1105204_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1105462_1105951_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1105979_1106654_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1106894_1107770_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275340.1|1108300_1108909_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1109179_1109638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1109916_1110306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1110491_1111307_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1111529_1112435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1112598_1113360_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1113363_1114230_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1114315_1114927_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1115305_1116553_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1116704_1117406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1117703_1117877_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1118366_1118867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1119945_1120173_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774233.1|1120225_1120459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1120487_1121168_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1121190_1123365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1123610_1124681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1124677_1126081_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619408.1|1126229_1126715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1126786_1127608_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1128274_1129774_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1130077_1132771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1132767_1136169_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_048875961.1|1137756_1139160_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1140238_1140910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1143818_1144793_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 14
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	1169516	1225926	3194859	transposase,tRNA	Staphylococcus_phage(28.57%)	51	NA	NA
WP_053093677.1|1169516_1170236_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1170463_1170640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1170888_1171212_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1171300_1173319_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1173341_1174295_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1174460_1175648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1176361_1177000_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1177297_1178293_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_027242772.1|1178433_1179480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1179472_1180498_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1180564_1182595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1183901_1184129_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1185472_1185616_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1185612_1186305_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242771.1|1186571_1186889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|1187031_1187442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1187598_1187925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1188071_1189109_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1189150_1189396_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_155082170.1|1189493_1189835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1189842_1191417_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1191571_1192141_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1192450_1194253_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1194249_1195191_+	signal peptidase I	NA	NA	NA	NA	NA
WP_027242761.1|1195602_1196277_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1196282_1197182_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1197195_1197939_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1197941_1198673_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1198669_1199053_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1199190_1200438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1200848_1201994_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1201986_1202340_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1202620_1203163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1203807_1203996_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1204015_1204990_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1205033_1205909_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1206262_1207090_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1207189_1207351_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1208001_1209342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1210393_1210621_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|1210762_1212124_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1212219_1212879_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144420701.1|1213719_1214076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1214672_1216232_-	APC family permease	NA	NA	NA	NA	NA
WP_017375893.1|1218776_1219847_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1219904_1220111_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1220117_1221593_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1221728_1222292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1222461_1223865_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243000.1|1224253_1224613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242999.1|1224831_1225926_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	1242168	1289893	3194859	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_036772169.1|1242168_1243044_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1243113_1244217_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1244284_1244608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1244764_1245547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1245682_1246660_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1246733_1248725_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1248780_1249062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1249315_1250515_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_155048042.1|1252910_1253459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1253645_1254521_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1254557_1254722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1255930_1256344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1256354_1256690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1256834_1257953_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1258182_1258449_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1259731_1259959_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1259969_1260476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1260553_1261171_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1261302_1262535_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1262524_1263187_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1263461_1264718_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1264855_1265515_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1265589_1266291_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1267038_1268013_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1269221_1269575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1269788_1269983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1270050_1270563_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1270700_1271555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1271603_1272248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1272281_1272926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243125.1|1273448_1273742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1273840_1274623_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1274705_1275656_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1277698_1280539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1280561_1281143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1281262_1281991_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1282136_1283111_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1283226_1284132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1284730_1285477_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1285729_1286122_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1286159_1286807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1288522_1289893_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	1313712	1354922	3194859	transposase	Enterobacteria_phage(16.67%)	37	NA	NA
WP_048876023.1|1313712_1314816_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1314906_1316059_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1316472_1317324_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|1317461_1317611_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1318235_1320602_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1320649_1321846_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1322414_1324847_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1325168_1326668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1326776_1327349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1327663_1329133_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1329205_1329955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1329958_1330732_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1330830_1331781_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1331920_1333363_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1333578_1334763_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1334886_1335573_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1335708_1336293_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1336382_1336712_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1337047_1337287_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_155046686.1|1337380_1337527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1338301_1338595_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1338743_1338905_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1339419_1339959_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1340297_1340942_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1341275_1341926_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1342449_1343502_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1343519_1346600_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1346765_1347014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1347079_1347955_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1348877_1349384_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1349401_1349599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1349617_1349761_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1349828_1350002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1350206_1351520_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1351529_1351793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1351851_1352826_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1354694_1354922_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 17
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	1386139	1439873	3194859	transposase,tRNA	Bacillus_thuringiensis_phage(25.0%)	46	NA	NA
WP_036772026.1|1386139_1387015_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1387119_1390422_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1390418_1392242_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1392281_1392680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1392788_1393805_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1394239_1395694_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1395775_1398832_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_144420694.1|1399125_1399362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081329473.1|1400222_1400642_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376676.1|1401014_1401479_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1401551_1402553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1405445_1405778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1406139_1406283_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1406270_1407215_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080963606.1|1407218_1407605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1407426_1407765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1408139_1408739_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1408738_1409086_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1409236_1410220_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1411129_1411444_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1411592_1411751_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1411722_1412652_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1413566_1413983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1415111_1415828_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1416576_1416735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1416783_1417359_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1417503_1417782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1417846_1418722_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1418887_1422754_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1422909_1423719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1423768_1424590_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1424789_1426022_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1426192_1426918_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1426960_1428499_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1428505_1429891_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1430204_1431254_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1431813_1432191_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155082171.1|1432379_1433258_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1434239_1434467_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_155082172.1|1434519_1435047_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_146619432.1|1435293_1435485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420793.1|1435893_1436667_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243181.1|1436780_1437752_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376772.1|1437733_1438705_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420687.1|1439140_1439326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1439336_1439873_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	1458808	1518718	3194859	transposase,tRNA	Staphylococcus_phage(17.65%)	49	NA	NA
WP_051929845.1|1458808_1459633_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1460036_1461011_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1461196_1461790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1461970_1462435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1462829_1463111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1463107_1464511_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1465162_1465543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1465782_1466439_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1466583_1466880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1466939_1467227_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036772296.1|1468416_1468794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1468993_1470043_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1470019_1471837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1472107_1472686_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1472713_1473178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1473214_1474672_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1474733_1476221_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1476990_1477593_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1478154_1478625_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1480272_1481016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1481167_1481599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1484236_1485583_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1485670_1487476_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1487941_1488739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1489123_1489585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1489807_1490782_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1490824_1490947_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1491018_1492974_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1493363_1493549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1493870_1494860_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1495272_1496898_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1497006_1497321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1497616_1499002_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1499166_1499394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1499534_1499993_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1500193_1500379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1500447_1501275_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1501729_1502254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376824.1|1502526_1502685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1502854_1503808_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1504002_1504977_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1505104_1506130_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1506782_1507070_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1507129_1507462_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1507666_1508227_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_017376814.1|1510821_1511547_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_026063564.1|1511921_1514741_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_048876146.1|1515590_1516724_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_017376809.1|1516948_1518718_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
>prophage 19
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	1541078	1576519	3194859	transposase,protease,integrase	Staphylococcus_phage(33.33%)	36	1562419:1562478	1572880:1573170
WP_048876008.1|1541078_1542053_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_144420681.1|1542096_1542282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1542461_1542626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1542627_1543503_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1543818_1544739_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1544754_1545138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1545464_1546421_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_144420678.1|1546688_1546967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243017.1|1547465_1548809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|1548982_1549126_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1549205_1550180_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1550327_1552199_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1552231_1552330_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1552565_1553195_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1553178_1553601_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1553607_1555347_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1555347_1556412_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1556415_1556769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1556881_1557850_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1557859_1558171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1558186_1558756_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1559019_1560348_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1560388_1561363_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1561949_1562351_-|transposase	transposase	transposase	NA	NA	NA	NA
1562419:1562478	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_146619459.1|1562870_1565327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1565529_1566381_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1566426_1568133_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1569604_1570579_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1570941_1571187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1571550_1572579_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1572709_1572913_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420676.1|1573197_1574154_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
1572880:1573170	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGGCCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTAGTGGAGTGTGCCGCTTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTCT	NA	NA	NA	NA
WP_047927838.1|1574446_1574692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1574688_1574988_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1575210_1575681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1576291_1576519_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 20
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	1581971	1624901	3194859	transposase	Staphylococcus_phage(20.0%)	42	NA	NA
WP_053856766.1|1581971_1583375_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1583562_1584420_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1584544_1585180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1585228_1585480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1585735_1586635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1586771_1587845_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1587945_1588359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1588379_1589093_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1589280_1590693_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1590902_1591871_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1592604_1592973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1592976_1593294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1593369_1594344_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1594863_1595364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1595434_1596763_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1596898_1598287_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1598434_1599745_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1600085_1601369_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1601442_1602063_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1602261_1602522_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1602724_1602871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774659.1|1602846_1603140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075286720.1|1603199_1603439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1605302_1605521_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1606773_1607544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1607630_1607846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1607942_1609064_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1609330_1610305_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1610567_1611689_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1611981_1612269_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1612241_1612745_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1612825_1613485_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1613826_1614744_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1614873_1615047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1615712_1617071_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_017376486.1|1617145_1617709_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376485.1|1617903_1619133_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1619178_1619805_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1619954_1621142_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1621150_1621843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1621964_1623117_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1623917_1624901_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 21
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	1683236	1773551	3194859	transposase,tRNA,protease	Burkholderia_phage(14.29%)	83	NA	NA
WP_036774017.1|1683236_1684112_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036774639.1|1684244_1684466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377182.1|1684501_1684840_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1684836_1685433_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1685435_1687430_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1687493_1688432_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1688780_1689755_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1689958_1690156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1690317_1690722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1692305_1692746_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1693072_1693948_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1693960_1694203_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1694609_1694864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1696075_1697041_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1697133_1697445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1697645_1698422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1699251_1699443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1700171_1701221_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1701391_1702165_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1702225_1703815_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1704005_1705097_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1705119_1705437_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1705523_1706801_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1706822_1707659_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1707665_1709300_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1709731_1710091_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1710372_1711731_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1711756_1711999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1712492_1712672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1712927_1714184_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1714297_1714555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1714699_1715710_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1716086_1716941_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1716970_1717804_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420666.1|1718377_1719154_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1719235_1719556_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1719774_1720680_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1720765_1721164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1721308_1721806_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047927093.1|1723466_1724570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1724668_1725046_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1725125_1726100_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1727644_1728364_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1728447_1728735_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1729019_1729892_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1729848_1730625_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1730829_1731165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1731563_1731920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1732081_1732357_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1732466_1732814_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1732831_1733611_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1733610_1734120_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1734155_1734404_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1734715_1735051_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1735350_1736601_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1736682_1738710_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1739255_1739474_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1739645_1740008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1740156_1741560_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1741841_1743017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1743034_1745032_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1745012_1745993_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1746048_1746891_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_036772544.1|1746890_1747307_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1747287_1747707_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1747729_1748359_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1748927_1751117_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1751128_1752334_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1752318_1754166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1754150_1755389_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1755375_1757244_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1757277_1758531_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1758536_1759394_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1759412_1760141_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1761279_1762071_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1762436_1762724_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|1764846_1765236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1765412_1766171_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1766167_1768567_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1768580_1769858_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1769947_1771246_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1771443_1772337_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1772336_1773551_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 22
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	1784250	1834735	3194859	transposase,tRNA	Vibrio_phage(14.29%)	47	NA	NA
WP_069971651.1|1784250_1785126_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1785498_1785762_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1786068_1788663_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1788659_1789142_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1789119_1790160_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1790334_1790820_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1790927_1793498_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1793531_1793993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1794329_1795205_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1795482_1797243_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1797336_1798002_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1798014_1799520_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1799541_1800072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1800145_1801408_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1801594_1802467_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1802568_1803357_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1803449_1804775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1805128_1806304_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1806472_1807126_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1807281_1809222_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1809218_1809842_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1810006_1810981_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1811252_1811873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1811869_1813273_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1813340_1813757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1814164_1814662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1814658_1815633_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|1815712_1816282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1816426_1816963_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1816967_1817264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1817272_1817878_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1818063_1818462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1818652_1818856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1819000_1819156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1819280_1819733_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1819849_1821322_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1821760_1822225_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1822913_1824164_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1824273_1824744_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1824766_1825360_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1825497_1826547_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1826570_1827494_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1827510_1827972_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1828079_1828898_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1829507_1829651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048048.1|1833229_1833763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1833814_1834735_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 23
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	1897033	1912349	3194859	transposase	Staphylococcus_phage(50.0%)	15	NA	NA
WP_017378288.1|1897033_1897255_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1897313_1898288_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1898486_1898651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1898647_1899283_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046602.1|1899559_1900339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1900371_1901133_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1901109_1902099_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1902234_1903110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1903128_1903788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1904029_1904476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1904472_1905876_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1905989_1906835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1906979_1908629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1908719_1909505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|1910945_1912349_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	1941022	1982779	3194859	transposase,tRNA	uncultured_Mediterranean_phage(40.0%)	38	NA	NA
WP_144420657.1|1941022_1942084_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1942795_1942957_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1943873_1944413_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1944795_1945212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1945307_1946123_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1946255_1947749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1947934_1948360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1948356_1950417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1950700_1951516_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1951616_1952435_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1952431_1952800_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1952981_1953809_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1953872_1954601_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1955003_1955732_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1956121_1956847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1956881_1960754_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1960954_1962088_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1962101_1962290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1962513_1963872_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_036773947.1|1965478_1966354_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1966865_1967501_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999981.1|1967513_1967987_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_155046603.1|1967914_1968067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929627.1|1968260_1968611_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1968670_1968958_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1969010_1969790_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376415.1|1970214_1971132_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1971183_1971939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1972006_1973281_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376412.1|1973401_1974079_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376411.1|1974279_1975704_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_016209938.1|1975678_1976317_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376410.1|1976679_1976958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376409.1|1977191_1978136_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376408.1|1978157_1980026_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376407.1|1980046_1980400_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_026063528.1|1980438_1981554_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1981738_1982779_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
>prophage 25
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	1987122	2043192	3194859	transposase,tRNA	Klosneuvirus(22.22%)	49	NA	NA
WP_017376399.1|1987122_1989894_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376398.1|1990050_1991283_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1991524_1992187_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376397.1|1992646_1994128_+	MFS transporter	NA	NA	NA	NA	NA
WP_036773116.1|1994325_1995300_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|1995823_1998550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|1999437_2000412_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|2000662_2001367_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|2002606_2003125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|2004092_2005577_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2005701_2007237_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2007259_2007589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2007485_2007701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2009684_2010884_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2011093_2011954_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2012069_2012648_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2012804_2013446_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2013484_2013706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2013698_2014682_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2015075_2015573_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2015717_2015993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2016144_2017827_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2017834_2018857_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2019025_2020027_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2020140_2020479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2020954_2022214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2022422_2022650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2022678_2022897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2023034_2023400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2023467_2023710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2023724_2024060_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2024064_2024502_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_036772812.1|2024527_2025913_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2026023_2026455_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2026560_2028072_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2028362_2029955_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2030155_2032351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772819.1|2032444_2033878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2033920_2034436_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2034435_2035383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2035366_2036032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2036028_2036757_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2036746_2037493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2037476_2038541_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2038745_2039933_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2039989_2041108_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2041555_2041813_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2042092_2042770_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2042988_2043192_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	2062892	2112427	3194859	transposase,tRNA,protease	Burkholderia_virus(20.0%)	42	NA	NA
WP_017377787.1|2062892_2063120_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2063209_2063965_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2064378_2064975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2065054_2067859_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2067839_2068793_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2068785_2070156_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2070326_2071730_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2072501_2072828_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420651.1|2073032_2073686_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_017376600.1|2074005_2074185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2074440_2075697_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2075935_2076082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2076164_2076521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2077016_2077376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2077385_2077769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2078657_2078798_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2078942_2079863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2082020_2082551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2082561_2083617_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2083632_2085672_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2085658_2086489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2086555_2090095_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2090208_2090928_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2091166_2091796_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2091915_2093319_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2093464_2095408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2095925_2096786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2097221_2098967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|2099369_2100842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2101024_2101624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2101761_2101959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2102159_2102300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2102367_2103147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2103711_2104113_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2104257_2104635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2105094_2106402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275406.1|2106742_2106946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2107150_2107408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2107459_2108863_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2109103_2110813_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2110982_2111345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|2111452_2112427_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 27
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	2126996	2253834	3194859	transposase,tRNA,protease	Staphylococcus_phage(14.81%)	116	NA	NA
WP_017377892.1|2126996_2128418_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_026063687.1|2128507_2130106_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377894.1|2130262_2130889_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027242839.1|2130969_2133642_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377896.1|2134124_2135081_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_017377897.1|2135133_2135553_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_048875958.1|2135579_2136443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377899.1|2136432_2137224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2137528_2138500_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2138848_2139157_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2139153_2139810_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2139943_2140429_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2140506_2141028_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2141073_2141967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2141963_2142785_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2142979_2143129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2143356_2144187_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155074372.1|2145442_2145763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2145915_2147319_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_048875956.1|2147428_2148670_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2148656_2149388_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2149399_2150677_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2150776_2151151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2151235_2152123_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2152180_2152909_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2152905_2154015_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2154166_2154595_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2154689_2155046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2155038_2156250_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2156246_2157035_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2157197_2157992_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2158441_2159182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2159185_2161684_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2161946_2162903_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2162886_2163648_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2163855_2164830_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2164938_2165694_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2165818_2166064_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2166123_2168397_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2168451_2168754_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2168994_2169288_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2169458_2169638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2169713_2170325_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2170571_2171888_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2171898_2172267_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2172297_2172960_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2173382_2173961_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2173940_2174348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2174471_2174768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2174814_2175690_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876123.1|2175759_2177940_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_017376060.1|2178043_2179393_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_036772012.1|2179466_2180156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2180288_2181476_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376055.1|2181994_2182639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2182635_2183949_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2184153_2184327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2184596_2185070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2185214_2185409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2185673_2186549_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210558.1|2186735_2187491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376051.1|2187564_2189217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376050.1|2189256_2190795_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_087910638.1|2190794_2192495_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_075275404.1|2192583_2193759_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_017376046.1|2193797_2194760_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_017376045.1|2195037_2195460_-	universal stress protein	NA	NA	NA	NA	NA
WP_017376044.1|2195765_2196407_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376043.1|2196535_2197870_+	dihydroorotase	NA	NA	NA	NA	NA
WP_048875952.1|2197984_2198620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771517.1|2199364_2200501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771498.1|2200684_2202415_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_017376037.1|2202404_2203613_+	MFS transporter	NA	NA	NA	NA	NA
WP_075275290.1|2203711_2204713_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420641.1|2204956_2205592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2205611_2206586_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875951.1|2206629_2207466_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2207611_2208031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2208307_2208988_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2208953_2209304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2209336_2210548_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2210888_2211518_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2211566_2212583_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2212829_2213045_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2213097_2213547_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2213626_2215372_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2215463_2217335_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2217779_2218496_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2219933_2220803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2220759_2220987_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2221955_2222870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2222915_2223938_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2224006_2225056_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375595.1|2225681_2225855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420639.1|2226139_2226430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2226614_2228018_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046608.1|2228110_2228275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2228596_2228821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2228831_2230043_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036774710.1|2230437_2231337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|2231510_2231912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2232158_2233202_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2233321_2233558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2234346_2235900_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2238080_2238308_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2239178_2240153_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017375736.1|2240879_2241962_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_017375735.1|2242004_2242655_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375734.1|2242877_2243249_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_027243178.1|2243359_2244721_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155046609.1|2246441_2246648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2246958_2248041_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2248037_2248349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2249394_2250369_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2251375_2252155_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2252616_2253834_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	2266683	2327651	3194859	transposase,integrase	Staphylococcus_phage(30.0%)	47	2274536:2274595	2324957:2325717
WP_144420638.1|2266683_2267766_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2267762_2268074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2269571_2270507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2271099_2272245_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2274487_2275651_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2274536:2274595	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|2275679_2275904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2277251_2278427_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2278772_2281283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2281341_2282154_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275283.1|2282594_2283206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2283348_2284323_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2284427_2285759_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2285957_2286026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2286157_2287600_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2287991_2289404_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2290093_2290540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2291134_2291983_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2292236_2293295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2293286_2294993_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2295064_2296798_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2297094_2297661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2297785_2298439_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2298465_2299926_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2300022_2301000_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2301469_2302873_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2303398_2303692_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2303918_2304683_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2304890_2305118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2305181_2305364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2305926_2306106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376902.1|2306169_2306481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2307335_2308040_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2308237_2308378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2308782_2309307_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|2309453_2310710_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2310777_2311257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2311697_2313101_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420632.1|2313515_2315831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2316403_2318296_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2318467_2319442_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2319745_2320552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2320620_2321232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2322713_2323010_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2323006_2323849_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2324239_2325025_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2325029_2326433_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2324957:2325717	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2326706_2327651_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	2348493	2376146	3194859	transposase,protease	Staphylococcus_phage(25.0%)	28	NA	NA
WP_017377305.1|2348493_2349795_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2349876_2350482_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2350594_2351899_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2352499_2353375_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2353490_2354162_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2354341_2355697_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2355817_2356555_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2356633_2357350_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2357998_2359273_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2359303_2359879_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2359923_2360889_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2361352_2362261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|2362648_2362900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2363044_2363473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2363458_2364403_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2364607_2364760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2364788_2365523_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2365617_2365878_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2366096_2367062_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|2367038_2367335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2367525_2367975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2368234_2368663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2368758_2369259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2369195_2369357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2370237_2370459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2371957_2372635_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2373949_2374288_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2375171_2376146_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 30
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	2415390	2448839	3194859	transposase,tRNA	Burkholderia_virus(33.33%)	23	NA	NA
WP_080999971.1|2415390_2416794_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2416907_2417483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2418728_2418956_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2419245_2419785_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2420094_2421582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2421633_2422059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2422277_2423681_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2423677_2424055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2424014_2424560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2424955_2426182_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2426782_2428435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2428371_2428566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963645.1|2428898_2430089_-	MFS transporter	NA	NA	NA	NA	NA
WP_027243147.1|2430337_2433010_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2433298_2434135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2434795_2435686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2436154_2437129_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876012.1|2437613_2439017_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2439162_2440566_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155051406.1|2440650_2442432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2444376_2445780_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2445813_2447343_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2447378_2448839_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 31
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	2484290	2542854	3194859	transposase,tRNA	Burkholderia_virus(28.57%)	55	NA	NA
WP_036773116.1|2484290_2485265_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2485317_2486313_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2486355_2487330_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376319.1|2487954_2488635_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017376318.1|2488634_2489444_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027242903.1|2489517_2493198_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_026063524.1|2493207_2494695_-	ribonuclease G	NA	NA	NA	NA	NA
WP_017376313.1|2494704_2495322_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_017376312.1|2495391_2495910_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376311.1|2495906_2496806_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2496821_2497865_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376309.1|2498062_2498350_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2498470_2499931_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2500010_2501447_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2501571_2502546_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2504736_2505498_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2506655_2506883_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2507836_2508049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2508066_2508384_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2508410_2509100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2509440_2509644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2509775_2510711_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2510723_2511506_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2511635_2511947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2512290_2512617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2512641_2513097_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2513086_2514139_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2514141_2515605_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2515739_2515967_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2517383_2517848_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2518104_2518920_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2519048_2521361_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2521477_2522005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2522696_2523974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2523984_2524236_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2524269_2524791_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2524960_2525947_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2526037_2526853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2527281_2527677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2527649_2527877_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_047927746.1|2528845_2529433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2530035_2530707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875918.1|2530851_2531433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420767.1|2531475_2532153_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243185.1|2532431_2533388_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_017377736.1|2533447_2534113_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017377737.1|2534146_2534692_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_155046615.1|2534971_2535133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774946.1|2535829_2536444_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_144420620.1|2536370_2537573_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875923.1|2537558_2538554_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2538557_2538962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2539929_2540157_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2541125_2541722_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046616.1|2541690_2542854_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
>prophage 32
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	2552575	2603989	3194859	transposase,tRNA	Bacillus_phage(20.0%)	56	NA	NA
WP_048876031.1|2552575_2553979_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|2554084_2554309_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2554491_2555313_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|2555458_2555713_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377841.1|2556101_2557886_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|2557974_2558694_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2558855_2559062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2559061_2559298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2559310_2559664_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2560201_2561035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2561127_2561325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2561422_2562808_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2562934_2563525_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2564556_2564844_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2564903_2565068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2565064_2566435_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2566801_2568214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2568283_2569054_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2569546_2569834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2571310_2571604_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2571561_2572383_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2572527_2572752_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_080999969.1|2573006_2573480_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.4e-33
WP_155082175.1|2573572_2573743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999968.1|2573710_2573971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2573889_2574045_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2574143_2575118_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2576446_2576596_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2576712_2577006_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2577814_2578390_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2578467_2579343_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2579407_2580028_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2580012_2581095_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2581328_2581733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2583223_2584525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2584671_2585340_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2586272_2586836_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2586892_2588089_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_017376587.1|2588213_2589578_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376586.1|2589574_2590666_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376585.1|2590920_2591571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2591763_2591958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2592065_2592218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376583.1|2592484_2593612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063543.1|2593701_2594535_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376581.1|2594538_2595189_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_017376580.1|2595178_2596018_-	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_016210074.1|2596023_2596650_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376579.1|2596810_2597353_+	septation protein A	NA	NA	NA	NA	NA
WP_017376578.1|2597436_2597739_+	YciI family protein	NA	NA	NA	NA	NA
WP_144420763.1|2597756_2597999_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376576.1|2598097_2598370_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376575.1|2598408_2599047_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376574.1|2599079_2600171_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376573.1|2600342_2602085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2603014_2603989_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 33
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	2613283	2656998	3194859	transposase,tRNA	Staphylococcus_phage(30.0%)	41	NA	NA
WP_080999966.1|2613283_2614633_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2614930_2615488_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2615581_2616088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2616592_2617288_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_155051409.1|2617406_2618207_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2618240_2619644_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2620067_2621042_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2621298_2621526_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2622613_2623144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2623140_2624673_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2624669_2625620_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2626040_2626673_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2626915_2627113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2627462_2627891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2627968_2628964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2629108_2629360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2629464_2630109_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2630344_2630842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2631353_2632328_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2632698_2632992_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2633804_2634140_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2634460_2635999_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2636151_2637250_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2637488_2638688_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2638718_2639345_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2639373_2640258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2640391_2640622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155051411.1|2640759_2642049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420613.1|2642280_2642652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2644783_2644945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2645320_2646448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2646564_2647227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2647312_2647573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2647991_2648753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2650814_2651474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2651574_2652225_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2652372_2653062_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377795.1|2653084_2654248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2654452_2654704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155082176.1|2655227_2655899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2656023_2656998_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 34
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	2671675	2731744	3194859	transposase,tRNA	Staphylococcus_phage(26.67%)	57	NA	NA
WP_048875904.1|2671675_2672551_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2672671_2673172_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2673168_2673435_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2673600_2674575_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2674754_2675375_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2675681_2677085_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771922.1|2677919_2679110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|2679676_2680144_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|2680645_2680900_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|2681101_2681605_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|2681821_2682427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2682587_2683271_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2683346_2684126_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|2684112_2684973_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|2685096_2685462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377271.1|2685847_2686177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2686587_2687562_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377273.1|2688096_2688336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420610.1|2688329_2689709_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	3.3e-36
WP_017377275.1|2690743_2691466_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2691457_2691826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2692088_2693390_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2693485_2693929_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2693932_2694442_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2694434_2697248_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2697744_2698677_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2698781_2699708_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2699886_2701425_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2701598_2701859_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2703133_2703742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2703788_2704517_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2704763_2704901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619438.1|2706051_2706603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2706837_2707749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2708008_2708305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2708649_2709803_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2710399_2710948_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2711051_2711615_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2711832_2712591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2713866_2714094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2714316_2714496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2714751_2716008_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2716075_2716720_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_017378393.1|2717524_2717731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378392.1|2718001_2718154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816949.1|2718731_2719130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378390.1|2719323_2720901_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378389.1|2721034_2721976_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378388.1|2721977_2722751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963621.1|2724359_2724566_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2724832_2725120_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378384.1|2725125_2727507_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|2727519_2728515_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_016210495.1|2728646_2729006_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378382.1|2729048_2729243_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|2729277_2729808_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378381.1|2729812_2731744_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
>prophage 35
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	2769522	2822551	3194859	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2769522_2770497_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2770653_2772228_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2772452_2772731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2772800_2773676_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2773685_2774846_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2774960_2776109_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2776119_2778921_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2779027_2779726_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2779738_2781502_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2781505_2781853_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2781846_2782221_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2783168_2784452_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2784861_2786157_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2786512_2787058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242732.1|2787645_2788167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2788178_2789558_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2789793_2790228_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2790224_2791577_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2791576_2792692_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2792692_2793709_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2793698_2795369_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2795388_2795724_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2795751_2797191_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2797187_2798234_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2798376_2799873_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2800168_2801170_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2801275_2801887_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2802007_2802385_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2802435_2803842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2803835_2804903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2805009_2806611_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2806859_2807777_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2807845_2809540_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2809774_2810704_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2810734_2812138_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2812368_2813073_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2813139_2813796_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2813806_2814688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2814858_2817528_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2817888_2818863_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2818942_2819914_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2819967_2820942_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2821061_2821283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2821346_2821655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2821579_2822551_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	2837117	2874304	3194859	transposase	Staphylococcus_phage(50.0%)	37	NA	NA
WP_026063658.1|2837117_2837846_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2838155_2838410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2839123_2841778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2841816_2842107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2842223_2843522_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2844092_2844581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2844561_2844864_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2845110_2845599_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2845632_2846271_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2846392_2846932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2847021_2848248_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2848860_2849118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2849204_2850104_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2850248_2850515_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2850506_2850656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2850883_2851759_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2851888_2852116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2852182_2852377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2852435_2853410_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2853447_2853636_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2853636_2855409_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2855398_2856391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2856998_2857691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2858177_2858747_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2858743_2859718_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2859757_2860261_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2860351_2861755_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2862453_2862639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2862744_2864148_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420599.1|2864152_2864725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2864758_2866186_-	amino acid permease	NA	NA	NA	NA	NA
WP_155048066.1|2866809_2866998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772717.1|2867471_2869841_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2869916_2870735_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2871086_2871632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2872114_2873353_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2873329_2874304_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 37
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	2889950	2948569	3194859	transposase,tRNA	Lake_Baikal_phage(12.5%)	52	NA	NA
WP_080999962.1|2889950_2891378_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376537.1|2892101_2893727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376536.1|2893896_2894256_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376535.1|2894468_2894900_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017376534.1|2894911_2895091_-	rubredoxin	NA	NA	NA	NA	NA
WP_144420597.1|2895207_2896194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243034.1|2896374_2897664_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_017376531.1|2897775_2898573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|2898964_2900332_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2900824_2901304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2901483_2903547_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2903555_2904281_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2904908_2905622_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2905626_2906157_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2906391_2906625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2906737_2906986_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2907793_2909986_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2910003_2910312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2910965_2912675_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2912868_2913024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2914426_2915302_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2915627_2916389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2916613_2917345_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2917341_2917878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2917931_2918696_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2918698_2920276_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2920282_2920759_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2920734_2921166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2921198_2921954_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2922128_2922416_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2922798_2923023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2923362_2924526_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2924560_2925538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2925531_2926218_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2926156_2927272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243080.1|2927551_2928199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2928394_2928874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2930696_2931350_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2931462_2932014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2932113_2933088_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2933373_2933898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2934595_2935420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2935675_2936032_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2936028_2937432_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2937551_2938112_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2938269_2938836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155062829.1|2939038_2941297_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_027243087.1|2941560_2942256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2942296_2942509_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2944081_2945191_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2945246_2946728_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2947165_2948569_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 38
NZ_CP039070	Piscirickettsia salmonis strain Psal-108 chromosome, complete genome	3194859	3076251	3141500	3194859	transposase,protease	Hokovirus(14.29%)	56	NA	NA
WP_017376170.1|3076251_3077352_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3077709_3078684_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3078820_3079699_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3079706_3079937_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3079990_3080995_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3081213_3082041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3082122_3083511_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3083798_3085199_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3085293_3086220_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3086216_3087353_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3087349_3088357_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3088353_3089517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3089526_3090378_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3090409_3091582_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3091578_3092967_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3092995_3093403_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3093422_3094430_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3094426_3095299_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3095295_3096156_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3096157_3098428_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3098429_3099575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3099621_3100107_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3100146_3100770_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3106449_3107202_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155046626.1|3107804_3107972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243062.1|3108533_3109157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3109261_3110050_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3110049_3110781_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3110814_3112542_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3112555_3113617_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3113931_3115146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3115278_3115803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3116420_3117269_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3117255_3117954_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3118008_3118770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3118762_3119185_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3119314_3119866_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3119921_3120884_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3120884_3121100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3121286_3122096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3122075_3122918_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3122914_3124159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3124297_3125386_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3125403_3125904_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3126091_3126691_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3126696_3127860_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3127892_3128846_+	glutathione synthase	NA	NA	NA	NA	NA
WP_017376261.1|3129209_3130274_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3130270_3133333_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3133485_3133938_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3133969_3134326_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3134744_3135518_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376269.1|3138141_3138432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3138656_3139532_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3139528_3140086_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3140096_3141500_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039071	Piscirickettsia salmonis strain Psal-108 plasmid unnamed1, complete sequence	185794	0	52409	185794	terminase,transposase,portal	Streptococcus_phage(47.37%)	58	NA	NA
WP_017377655.1|1412_1658_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|1654_2041_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|2128_2857_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|2835_3456_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|3801_4488_+	Fic family protein	NA	NA	NA	NA	NA
WP_155082177.1|5437_5656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|5802_7542_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|7943_8096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|8123_8807_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|8888_9866_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|9941_10112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|10152_10881_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_036771293.1|11426_11693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772437.1|11988_13887_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|14308_15037_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420842.1|15098_15257_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|15673_15838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|15858_17145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|17327_18056_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|18183_19161_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046631.1|19235_19886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126795.1|22517_22778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|22781_23054_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|23129_23858_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|24427_25399_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|26263_27091_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|27944_28415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|29308_29452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|30658_31258_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|31611_32388_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|32748_33477_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|33546_33747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|33665_34637_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027242938.1|35050_35419_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017375972.1|35420_35729_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017375841.1|36173_36383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|36689_36908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242936.1|36904_37357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242935.1|37499_37715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876207.1|38220_39696_-	response regulator	NA	NA	NA	NA	NA
WP_017375966.1|39696_40263_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_144420846.1|40407_40872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|40876_41302_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_144420847.1|41572_42625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619517.1|42797_42950_-	phosphatase	NA	NA	NA	NA	NA
WP_081078123.1|42979_43342_+	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
WP_026063496.1|44220_44586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242932.1|44718_44946_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242931.1|44954_45362_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242930.1|45507_46890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375952.1|47079_47283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242929.1|47478_47862_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|47948_48431_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|48433_49765_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|49969_50404_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|50490_50877_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|50914_51649_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|51695_52409_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
>prophage 2
NZ_CP039071	Piscirickettsia salmonis strain Psal-108 plasmid unnamed1, complete sequence	185794	57501	183176	185794	integrase,tail,head,capsid,transposase,portal	Streptococcus_phage(31.67%)	120	70525:70584	122790:123304
WP_017377509.1|57501_58230_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|58323_59298_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|59611_59974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|60013_60523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|60754_61735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|62200_63178_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|63658_64636_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|64650_64812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|65029_65284_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|65273_65561_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_036771347.1|66055_67033_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_027243215.1|67144_68167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|68649_69378_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
70525:70584	attL	CGTATAGCGAAAATCTCGGGGGATTGCCCCCGTGATGGGCATTGTGGTTCTGTCGCAATT	NA	NA	NA	NA
WP_048876194.1|70617_71151_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|71331_71673_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|71853_72120_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|72192_74058_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|74225_74510_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|74853_75582_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243207.1|75663_76215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|76887_77115_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|78666_79095_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|79030_79417_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|79446_80175_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|80186_80336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|80582_81311_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|82688_83651_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|83674_84004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|84070_85111_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|85124_85316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|85520_86090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|86132_86432_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774376.1|86428_86857_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|87166_87895_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|88068_88842_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|89555_90491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|90765_91494_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243201.1|91659_91899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|91962_95304_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|95461_96190_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|96483_96879_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|96931_97660_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|98143_98872_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|99042_99612_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|99616_100300_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|100451_101180_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_080963627.1|101198_101417_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774644.1|102396_103458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|103966_104713_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|104713_105118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|105424_106399_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_036771293.1|106938_107205_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771296.1|107500_109396_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_048876182.1|109751_111647_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017375632.1|112346_112682_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|112876_113080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|113173_113968_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
WP_080999971.1|118018_119422_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000017.1|119686_119938_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_048875857.1|120338_121313_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|122300_122756_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
WP_016212398.1|122850_123312_-	hypothetical protein	NA	NA	NA	NA	NA
122790:123304	attR	AATTGCGACAGAACCACAATGCCCATCACGGGGGCAATCCCCCGAGATTTTCGCTATACGGTTAAAAAATAATTTTTTCTTTAGAAAAGAAATTATTATTGCTAACTACTCTAAAGTCATAATAATGACCGTACATTCCTCCACCATTATCTCCCTGTCTATGAGCTAAATATGCAGGATCTTCTGCTTTTGCACTTTTATCGATTTTTTGACATATTTTATCAATAGCGTTCATTTGACTTTGACTAACATCATAATAGTTATCTTTGCCTCCAACATTATTTATATAAATAACATTTACAAGGCGAGCTGGATGATATGCACATGTGAAGCCTTCAGGTGCTTGTCCATCAGAACATCGCGCTGAATAATAAGATGTTTGATCAAAAGGATCTCCTCCTCCTTCAGGATAGACTTTATGCGTTGCTCCTCCACAAACAATCCAAGGACTCCAGGCAACTGCCCAGCCACTTGATATAACACTTAACACAATCACTCCAATAGTTTTTTTTATA	NA	NA	NA	NA
WP_036773695.1|125372_127445_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_017377509.1|127474_128203_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|128344_129277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|129306_130035_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|130037_130310_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|131160_131889_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|131944_132565_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|133713_134442_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155082178.1|134634_135564_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377667.1|136233_136404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377666.1|136548_136806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815609.1|138706_139162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816769.1|139405_139804_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_047927763.1|139800_140064_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048876259.1|140555_141572_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027243195.1|141897_142944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|143309_144284_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_017375692.1|144427_144661_+	hypothetical protein	NA	Q7Y5W4	Haemophilus_phage	42.6	1.3e-06
WP_017375691.1|144684_145386_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.6	9.6e-32
WP_036773107.1|145369_145687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|145974_146949_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242588.1|147287_147641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771953.1|147657_149937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|150399_151374_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|151423_151963_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|151976_152561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|152945_153257_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|153253_153679_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|153857_154253_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|154249_154600_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|154599_155022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|155023_155347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|155403_155670_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|155673_157752_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|157744_158086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|158082_158754_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|158683_159469_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|159458_160016_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|160012_162703_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|162761_163190_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|163217_164195_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017377525.1|164578_165376_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_075275471.1|165916_166891_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_155046640.1|167526_167694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876214.1|167662_168391_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_017377521.1|168899_169253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|170180_170909_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243190.1|171491_174836_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_048876213.1|175144_176035_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275473.1|177273_177450_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|177566_178274_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|178227_179106_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243193.1|179136_179679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|179950_180655_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|180666_181395_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|181424_181814_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|181836_182565_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|182567_183176_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
>prophage 1
NZ_CP039073	Piscirickettsia salmonis strain Psal-108 plasmid unnamed3, complete sequence	50691	32440	46236	50691	transposase,tail,capsid,head	Moraxella_phage(18.18%)	18	NA	NA
WP_036771639.1|32440_33415_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|33464_34004_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|34017_34602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|34986_35298_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|35294_35720_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|35898_36294_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|36290_36641_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|36640_37063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|37064_37388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|37444_37711_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|37714_39793_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|39785_40127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|40123_40795_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|40724_41510_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|41499_42057_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|42053_44744_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|44802_45231_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|45258_46236_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 1
NZ_CP039074	Piscirickettsia salmonis strain Psal-108 plasmid unnamed4, complete sequence	33555	0	29135	33555	head,integrase,tail,capsid,transposase,terminase	unidentified_phage(44.44%)	32	2570:2629	16743:17034
WP_016211499.1|831_1815_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
2570:2629	attL	CAAACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGT	NA	NA	NA	NA
WP_036771330.1|3240_4215_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4750_5341_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5571_5832_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5824_6178_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6354_7329_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|7861_8227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|8371_8626_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8609_8966_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|9063_10038_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|10663_11530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|11742_12126_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|12212_12695_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|12697_12883_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|12902_13877_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|13973_14366_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|14401_14983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|15363_16338_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|16411_16627_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|17430_17946_-	hypothetical protein	NA	NA	NA	NA	NA
16743:17034	attR	ACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTTGCATTGATCCTACTCAGCTTATTGATACGCCGACCGGTACGATACTGATACATTCTCACCCTGATGGCACGGTTGAGCCGTCACTCGCGGATATGGTGGGTCAACGCGATACTGGATTATTATGGGGGATTGTTGCACTCAATCAACACGCTGTGACGGATGCCATTGTTTTTGGTGAGCAGTTATTCACCCAGCAATTACTCGAGCGGCCGTTTTTGCATGGTATTTTTGAT	NA	NA	NA	NA
WP_027242944.1|18291_18849_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|18845_19262_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
WP_048876241.1|19532_21509_+	host specificity protein J	NA	C7BGD4	Burkholderia_phage	37.8	3.7e-89
WP_062365785.1|21653_22709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242942.1|22708_23386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|23405_24380_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_048876242.1|24864_25242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242941.1|25253_25907_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_155046645.1|25906_26068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|26087_27062_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420852.1|27452_27593_+	phosphatase	NA	NA	NA	NA	NA
WP_036771332.1|28160_29135_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	2.2e-26
