The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	45582	58682	3052624	transposase	Moraxella_phage(25.0%)	17	NA	NA
WP_075273371.1|45582_46158_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46103_46469_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46667_47429_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_036779326.1|47730_49257_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49628_50468_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50507_51815_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51789_52959_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|53013_53739_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54017_54407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54594_55500_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55547_55691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273385.1|55738_56542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007063.1|56569_57055_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	52.0	1.3e-40
WP_032126362.1|57092_57458_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|57403_57979_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007062.1|57942_58272_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.0	7.7e-08
WP_017377700.1|58388_58682_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
>prophage 2
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	152596	201593	3052624	transposase,protease	Bacillus_phage(50.0%)	57	NA	NA
WP_054300545.1|152596_153658_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|154052_154448_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|154469_154835_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154891_155056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|155045_155345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300544.1|155435_155882_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|156377_156944_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|156955_157741_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|158372_159296_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|159347_160343_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|160374_160869_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|160960_161218_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|161307_161730_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|162048_162765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|162808_163060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300543.1|163064_164501_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|164528_165971_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|166058_166397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|166481_167012_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|167072_169265_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|169307_169793_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|170062_170494_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036778324.1|170511_171342_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|171356_171500_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|171530_172415_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|172386_172608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|172781_173060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300542.1|173740_173977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|174002_174908_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556686.1|175338_176220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|176453_177029_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|176974_177340_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300541.1|177667_178447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126848.1|178980_179781_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016211858.1|179999_180758_+	ion transporter	NA	NA	NA	NA	NA
WP_016211859.1|180834_181122_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_075273327.1|181125_181701_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|181646_182012_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|182075_182348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300540.1|182615_182840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300539.1|183855_185199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|185491_186085_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|186053_186707_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|186884_187856_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|187878_188775_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|188933_189380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779493.1|189376_190018_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|190127_190706_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|191181_191619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|191943_193284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|193547_194942_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_054300538.1|196390_197458_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|197510_197933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|198173_198617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|198671_198929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|198906_199533_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|199610_201593_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
>prophage 3
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	217478	271377	3052624	tRNA,tail,transposase	Acinetobacter_phage(50.0%)	44	NA	NA
WP_016209854.1|217478_218465_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|218457_218700_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|218821_220366_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|220412_221699_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|221741_223136_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|223159_223339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|223335_223911_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|223856_224222_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210079.1|227227_227725_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|227895_228591_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|228693_230256_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|230571_232365_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|232450_232723_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|232728_233355_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|233341_234772_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|235104_236160_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|236128_236806_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|236795_237632_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|237791_238085_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|238191_238998_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|239302_240157_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_016210082.1|240311_241361_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_054300536.1|241411_242068_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|242085_243366_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|243639_245001_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_155046933.1|245274_245952_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016211802.1|251384_252656_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036778206.1|252712_253696_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|253692_254478_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_032126362.1|255174_255540_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|255485_256061_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300535.1|256064_256784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|256928_257129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|257176_257638_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|258061_259543_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|259605_260715_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|260812_262774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|263303_263708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|263760_264822_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046934.1|265185_265356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|265729_266812_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_105962623.1|268314_269467_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046935.1|269509_269932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270224_271377_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 4
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	434936	547188	3052624	tRNA,transposase,protease	Escherichia_phage(32.14%)	105	NA	NA
WP_054300513.1|434936_435800_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|436016_437576_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|437597_438632_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|438680_439250_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|439385_440357_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|440368_441946_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|442011_442998_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054300512.1|443329_444439_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|444544_445729_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|445806_447795_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|448003_448159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|448416_448716_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300510.1|448986_449169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|449225_449591_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|450507_451914_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|451931_452918_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|452920_454075_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|454071_454767_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|454901_456392_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|456412_457462_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|457528_458923_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|459801_461733_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|461737_462268_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|462302_462497_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|462539_462899_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|463318_464314_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_036777440.1|464326_466708_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|466713_467001_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|467272_467749_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|467893_468091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|468215_469190_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|470090_470189_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300507.1|470673_471963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|472199_472892_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|472933_473707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|473708_474650_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|474782_476360_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|476569_478327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|478875_479634_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|479841_480414_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|480517_481066_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|481367_481613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|481641_481938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|482205_483129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300506.1|483607_484015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|484086_484815_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126799.1|484895_485708_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_129556452.1|486828_487176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|487178_488918_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046941.1|489319_489583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300500.1|490254_490983_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_054300502.1|491012_491690_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.8	2.9e-09
WP_016212477.1|491862_492108_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_032126794.1|492104_492497_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_054300501.1|492508_493237_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_016212066.1|493597_494374_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016212069.1|494585_494753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212070.1|494727_495327_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_054300500.1|495736_496465_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_017375910.1|496993_497722_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|498620_499349_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211714.1|499423_502768_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|503384_504113_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155046942.1|505045_505932_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|506317_507046_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016212268.1|507202_507787_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|507790_508474_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|508955_509684_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211759.1|510015_511203_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016211756.1|511448_512174_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_032126312.1|512352_513147_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_129556590.1|513143_513539_-	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_129556490.1|514222_515108_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046943.1|516878_517019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275117.1|517051_517474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211905.1|517717_518128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|518458_519034_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|518979_519345_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300493.1|519406_519619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300492.1|519777_520788_-	protein kinase	NA	NA	NA	NA	NA
WP_016210676.1|521091_523173_-	kinase domain protein	NA	NA	NA	NA	NA
WP_016210671.1|523628_524888_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_036778297.1|525020_525494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210672.1|525502_526885_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_016210677.1|526877_527492_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_016210675.1|527571_528288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210679.1|528455_530780_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.9	2.0e-17
WP_054300491.1|531455_533216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126421.1|533419_534511_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210055.1|534778_535417_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016210070.1|535455_535728_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_032126423.1|535821_536085_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210060.1|536081_536384_-	YciI family protein	NA	NA	NA	NA	NA
WP_016210053.1|536467_537010_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|537171_537798_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_036778098.1|537803_538643_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.3	1.4e-08
WP_016210061.1|538632_539277_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.8e-19
WP_032126424.1|539289_540114_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_016210057.1|540122_540632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210065.1|540772_541432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210075.1|541685_542777_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_016210064.1|542773_544138_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_016210052.1|544262_545459_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
WP_032126425.1|545479_546076_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210066.1|546519_547188_-|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
>prophage 5
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	555662	602551	3052624	transposase,integrase	Escherichia_phage(27.27%)	44	560102:560161	572090:572377
WP_032126790.1|555662_556568_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211874.1|556611_558330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046945.1|558648_559722_-	hypothetical protein	NA	NA	NA	NA	NA
560102:560161	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_155046749.1|560272_560560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300489.1|560623_561226_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_155046946.1|561228_561504_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032126389.1|562905_563094_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212230.1|564627_566076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|566131_567285_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_081007057.1|567342_567759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007056.1|569083_569293_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375841.1|569594_569804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|570110_570329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776735.1|570325_570778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212294.1|570791_571136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046947.1|571565_571733_+	phosphatase	NA	NA	NA	NA	NA
WP_016212659.1|571870_572116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|572260_572410_-	hypothetical protein	NA	NA	NA	NA	NA
572090:572377	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACG	NA	NA	NA	NA
WP_054300484.1|572634_573582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300483.1|574078_574633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211322.1|575168_575759_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211325.1|575821_577342_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211323.1|577331_578429_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_081007055.1|578602_579610_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211722.1|579855_583158_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_036780093.1|583167_583989_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_054300201.1|584092_584821_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_054300482.1|584850_586140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007054.1|586655_587888_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_080664881.1|588050_588257_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300481.1|588346_589075_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_081007053.1|589176_590037_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_016210616.1|590271_593082_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_016210625.1|593330_594077_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_129556587.1|594135_595038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|595137_595503_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|595448_596024_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_051307334.1|596040_596820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210618.1|597086_598136_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_016210617.1|598200_599625_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_036777984.1|599845_600295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210624.1|600313_600553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|600598_601069_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_075273327.1|601975_602551_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	618645	651832	3052624	tRNA,transposase	Escherichia_phage(57.14%)	34	NA	NA
WP_054300202.1|618645_619374_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_036780855.1|619985_620483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212214.1|620457_620958_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054300202.1|621116_621845_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019359.1|621989_622187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300478.1|622348_624085_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_054300477.1|624364_625093_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211623.1|625815_627456_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_036779883.1|627568_628918_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211625.1|628914_629784_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_054300475.1|630267_630996_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016212196.1|631404_631650_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016212195.1|631646_632033_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212193.1|632100_632439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|632561_633290_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211949.1|633429_634680_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_016211951.1|634713_635811_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_054300202.1|635987_636716_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_032126570.1|636932_637232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211816.1|637244_637598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|637639_639253_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_054300202.1|639458_640187_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|640674_641286_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_036779399.1|641642_641897_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|641995_643780_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779389.1|643868_644588_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|644770_644977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210948.1|644976_645213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|645225_645603_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|646109_646928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210947.1|647021_647219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|647313_648699_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|648825_649416_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_054300202.1|651103_651832_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 7
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	699599	774652	3052624	tRNA,transposase	Staphylococcus_phage(18.18%)	60	NA	NA
WP_054300468.1|699599_700256_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.4	3.1e-08
WP_016211761.1|700671_702663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211760.1|702769_704149_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300467.1|704186_704567_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|704563_705538_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016211615.1|705772_706489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211620.1|708032_708557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211619.1|708624_710445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210267.1|711299_711806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210259.1|711869_713288_+	asmA-like family protein	NA	NA	NA	NA	NA
WP_016210248.1|713408_713663_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_016210257.1|713809_714082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777860.1|714653_715229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210251.1|716299_716542_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_036777864.1|716628_717720_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210258.1|717700_718654_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	4.9e-31
WP_016210253.1|718877_720362_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	3.8e-46
WP_032126416.1|720402_720906_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.6	2.8e-09
WP_016210254.1|721165_722341_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_016210252.1|723249_723621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210260.1|726135_726564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556655.1|726791_727796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300466.1|727899_729237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300465.1|729229_730009_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_081007050.1|730230_730758_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|730814_731180_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211061.1|731241_731595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211058.1|731715_732249_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_032126660.1|732387_734025_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.2	5.8e-88
WP_016211065.1|734029_734251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211066.1|734348_735362_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_016211063.1|735524_737753_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
WP_032126658.1|737733_738438_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|738672_739002_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_054300464.1|740082_741144_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126663.1|741170_741413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126664.1|742131_742815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212048.1|743008_743566_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_054300173.1|744329_745391_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664847.1|745463_746417_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_016210879.1|749748_750108_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210871.1|750104_750422_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210872.1|750438_751548_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210882.1|751574_752660_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210874.1|752782_753823_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210873.1|753837_754488_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210876.1|754555_755398_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_054300462.1|755863_756781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|757799_757994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036794860.1|758070_758364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|758631_759549_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_016211373.1|760099_760246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211374.1|760300_761491_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211370.1|761623_762067_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211369.1|762109_763153_-	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211368.1|763199_764591_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211371.1|764787_765711_+	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211372.1|765697_766555_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016212287.1|772366_773512_-|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_054300173.1|773590_774652_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	841885	873648	3052624	tRNA,transposase	Catovirus(20.0%)	31	NA	NA
WP_016211428.1|841885_843949_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
WP_054300173.1|844219_845281_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300457.1|845441_846731_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300148.1|846918_847980_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273329.1|848027_849329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300455.1|849289_849655_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|849669_850176_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300454.1|850165_850516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|850617_850983_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|850928_851504_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046950.1|851493_851748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300452.1|851797_852859_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210196.1|852816_853170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779341.1|853523_855734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|855734_856421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210198.1|856732_857284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|857300_857702_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210190.1|857892_858768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126472.1|858987_859638_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_036778866.1|860100_862689_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.9	3.3e-122
WP_016210199.1|862794_863556_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_016210206.1|863552_864089_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210205.1|864137_865094_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210187.1|865174_868360_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210201.1|868363_869419_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_036778872.1|869648_870254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778869.1|870297_870960_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_016210194.1|870994_871342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|871398_871560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210192.1|871931_872450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|872762_873648_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	879568	925375	3052624	transposase	Staphylococcus_phage(41.67%)	44	NA	NA
WP_081007004.1|879568_880024_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|879983_880322_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300449.1|880451_881231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|881250_882225_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_054300448.1|882268_884638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|884827_885889_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300447.1|886301_888938_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_080664849.1|888986_890075_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016210997.1|890074_890758_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_032126469.1|890817_892479_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210998.1|892632_892887_+	LapA family protein	NA	NA	NA	NA	NA
WP_016211001.1|892964_893270_+	competence protein ComEA	NA	NA	NA	NA	NA
WP_016211002.1|893433_893832_+	VOC family protein	NA	NA	NA	NA	NA
WP_155046951.1|893913_894177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781250.1|894983_895769_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300446.1|895864_896599_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	1.1e-09
WP_016210826.1|898029_898896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210824.1|899005_900685_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210830.1|900811_902062_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_032126465.1|902137_902599_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210835.1|902595_903744_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_016210836.1|903749_904424_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_052133275.1|904453_905077_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210828.1|905192_905666_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_016210832.1|905667_906090_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210829.1|906076_907096_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_054300445.1|907365_907917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|908011_909073_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212318.1|909601_910033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|910034_910361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781320.1|910347_910575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|911421_912867_-	MFS transporter	NA	NA	NA	NA	NA
WP_016212205.1|913006_913186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046952.1|914871_915033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|915205_915379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212179.1|915801_915954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|916374_917436_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|917393_917642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300443.1|917694_917973_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211538.1|918211_919135_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_054300442.1|919829_921926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300441.1|922207_922570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300440.1|922714_923926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|924222_925375_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 10
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	960774	997872	3052624	tRNA,transposase,protease	Bacillus_phage(33.33%)	35	NA	NA
WP_026063519.1|960774_961191_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300357.1|961239_962115_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|962665_963250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212526.1|964581_965115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273603.1|965238_965415_-	phosphatase	NA	NA	NA	NA	NA
WP_105962625.1|965494_966380_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_059372667.1|967450_968164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122940402.1|968372_968996_+	porin family protein	NA	NA	NA	NA	NA
WP_016209896.1|969310_969880_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016209891.1|970026_970725_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_036777115.1|970866_971067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209884.1|971143_971767_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052104600.1|971876_972770_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209898.1|972876_974487_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_016209888.1|974483_975779_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209876.1|975800_977723_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209881.1|977833_978136_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209893.1|978228_983118_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_052104599.1|983172_984489_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.1	3.2e-65
WP_036777110.1|984613_985708_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_016209878.1|985759_986698_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_080664826.1|986778_987378_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209877.1|987544_988435_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_016209887.1|988637_989129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209894.1|989272_989764_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|989932_990646_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556650.1|991074_992049_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_054300433.1|992378_992609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007045.1|992908_993538_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211960.1|993859_994387_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_054300573.1|994650_995784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|995811_996393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|996962_997148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300431.1|997292_997595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007044.1|997554_997872_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	1000994	1044919	3052624	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_129556499.1|1000994_1002148_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_155046705.1|1002253_1002421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|1002366_1002942_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|1002982_1003591_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032126790.1|1003759_1004665_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556560.1|1004634_1005171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556559.1|1005251_1005680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212093.1|1005836_1006766_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_075273313.1|1006978_1007317_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1007276_1007732_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212654.1|1007723_1008008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212100.1|1008418_1009339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212098.1|1009339_1010191_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1010911_1011958_+	glutathione synthase	NA	NA	NA	NA	NA
WP_032126840.1|1011941_1013939_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_122941967.1|1014117_1014423_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|1014652_1014859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|1015119_1015821_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046955.1|1016062_1016242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046956.1|1016763_1016928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300430.1|1017397_1020154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|1020389_1021682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300429.1|1021735_1021996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300428.1|1022296_1022860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211709.1|1023004_1023151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|1025410_1027447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007043.1|1028170_1029913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300426.1|1029872_1031507_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|1031519_1032563_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|1032541_1033003_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_016211081.1|1033043_1033979_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211087.1|1034006_1035002_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_054300425.1|1035209_1036172_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126778.1|1036350_1036545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046957.1|1036759_1037611_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_052047048.1|1037666_1038167_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212611.1|1038263_1038584_+	histidine kinase	NA	NA	NA	NA	NA
WP_054300423.1|1038631_1039693_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212519.1|1039767_1040148_+	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300422.1|1040418_1040856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300421.1|1040906_1041752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274673.1|1041729_1042728_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1042688_1043054_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046958.1|1042999_1043560_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300417.1|1043944_1044919_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 12
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	1057588	1122478	3052624	tRNA,transposase	Bacillus_phage(30.0%)	59	NA	NA
WP_016210280.1|1057588_1058683_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_016210284.1|1058764_1059286_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210276.1|1059340_1059817_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210275.1|1059872_1060175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210273.1|1060239_1060947_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210274.1|1061319_1061718_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_032126334.1|1061757_1062189_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210271.1|1062199_1062883_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1062949_1065145_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_129556492.1|1065242_1065986_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210283.1|1066013_1066799_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_016210272.1|1066838_1067549_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210279.1|1067536_1068703_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210277.1|1068756_1069590_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210270.1|1069659_1072647_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210281.1|1072688_1074080_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_075273303.1|1074093_1074810_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016211367.1|1074965_1075748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126330.1|1075895_1076855_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_036779263.1|1076909_1078919_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_016211366.1|1078974_1079262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126332.1|1079514_1080714_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_075273298.1|1081360_1081936_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300410.1|1081881_1082247_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|1082380_1083244_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1083474_1083768_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_144019383.1|1084175_1084394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126328.1|1084748_1085000_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211589.1|1085128_1086361_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_016211592.1|1086350_1087013_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_129556496.1|1087287_1088526_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_032126329.1|1088711_1089341_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211588.1|1089416_1090118_+	cyclase family protein	NA	NA	NA	NA	NA
WP_129556499.1|1090285_1091438_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016212343.1|1091677_1092484_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_016209808.1|1093788_1094157_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016209824.1|1094153_1094972_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209813.1|1095072_1095888_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_016209801.1|1096172_1098227_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_032126324.1|1098226_1098649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209805.1|1098827_1100321_-	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_016209818.1|1100453_1101269_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209799.1|1101364_1101781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209815.1|1102167_1102707_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_054300409.1|1103024_1104737_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	4.3e-25
WP_016209812.1|1105183_1107007_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_016209821.1|1107096_1107429_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209800.1|1107459_1108056_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_036777933.1|1108052_1109177_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_016209822.1|1109312_1109960_+	methyltransferase domain protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_016209810.1|1110016_1111930_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209803.1|1112134_1113172_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209820.1|1113230_1116530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|1117231_1118200_-	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209809.1|1118306_1118795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209823.1|1119219_1119663_+	response regulator	NA	NA	NA	NA	NA
WP_075273327.1|1120884_1121460_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1121405_1121771_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300408.1|1121821_1122478_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
>prophage 13
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	1131016	1196828	3052624	tRNA,transposase	uncultured_Mediterranean_phage(28.57%)	52	NA	NA
WP_155046942.1|1131016_1131902_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273597.1|1131892_1133737_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|1134008_1134983_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556498.1|1135162_1135771_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036778626.1|1135767_1137708_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_016210594.1|1137843_1138497_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210595.1|1138673_1139852_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210588.1|1140219_1141545_+	fimV domain protein	NA	NA	NA	NA	NA
WP_032126176.1|1141635_1142418_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210587.1|1142519_1143380_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_016210590.1|1143554_1144817_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210593.1|1144896_1145427_+	colicin V production protein	NA	NA	NA	NA	NA
WP_016210586.1|1145448_1146954_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210592.1|1146966_1147623_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016212005.1|1148012_1149773_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_105962623.1|1150673_1151826_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126856.1|1152131_1152473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1152533_1153595_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300406.1|1153895_1156631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|1158930_1159746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273595.1|1160154_1161525_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.6e-12
WP_054300405.1|1161580_1162081_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209947.1|1162602_1163265_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_036777555.1|1163291_1164521_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209940.1|1164677_1167449_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_052104625.1|1167524_1167968_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209931.1|1168120_1169593_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209926.1|1169704_1170766_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209945.1|1170762_1171797_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209932.1|1171799_1172840_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_036777579.1|1173022_1174138_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209930.1|1174176_1174530_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777561.1|1174550_1176419_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209935.1|1176440_1177385_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_016209925.1|1177618_1177897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1178106_1178745_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209944.1|1178719_1180147_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209927.1|1180347_1181025_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209939.1|1181159_1182434_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209943.1|1182501_1183257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209948.1|1183308_1184226_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_054300404.1|1184334_1185228_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075273594.1|1185300_1186671_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300403.1|1186710_1187685_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.0e-27
WP_016211771.1|1187977_1188166_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_016211770.1|1188179_1189313_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_054300402.1|1189512_1193658_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211823.1|1193692_1193881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300401.1|1194260_1194542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1194873_1195227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1195440_1195635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1196300_1196828_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	1250250	1287547	3052624	transposase	Bacillus_phage(50.0%)	35	NA	NA
WP_032126790.1|1250250_1251156_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1251384_1252656_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_054300386.1|1252680_1253418_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1253670_1254813_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1254829_1256431_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1256942_1257080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1257076_1258354_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1258703_1258886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273583.1|1259432_1259714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1260045_1260951_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1261179_1262451_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_054300386.1|1262475_1263213_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1263465_1264608_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1264624_1266226_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1266737_1266875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1266871_1268149_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1268498_1268681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273583.1|1269227_1269509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1269840_1270746_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1270974_1272246_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_054300386.1|1272270_1273008_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1273260_1274403_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1274419_1276021_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1276532_1276670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1276666_1277944_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1278293_1278476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273583.1|1279022_1279304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046960.1|1279430_1280084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212251.1|1280245_1280782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300384.1|1280943_1281759_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273581.1|1282167_1283535_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.6e-11
WP_052133287.1|1283590_1283989_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212039.1|1284177_1284735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212040.1|1284911_1286261_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_054300162.1|1286464_1287547_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 15
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	1294303	1349894	3052624	tRNA,transposase	Vibrio_phage(18.18%)	51	NA	NA
WP_032126139.1|1294303_1295233_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_054300383.1|1295328_1297809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300382.1|1298079_1298502_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300380.1|1298772_1299429_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1299632_1299998_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|1300012_1300519_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211414.1|1300734_1301553_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|1301660_1302122_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211415.1|1302138_1303062_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211417.1|1303085_1304135_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_051307357.1|1304271_1304865_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211422.1|1304887_1305358_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032126143.1|1305446_1306718_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_054300250.1|1306817_1307477_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_075273327.1|1307466_1308042_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1307987_1308353_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211838.1|1309062_1309236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211840.1|1309706_1310171_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211839.1|1310329_1311802_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211841.1|1311919_1312372_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|1313231_1314293_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1314595_1315678_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300381.1|1315688_1316336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300380.1|1316799_1317456_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962623.1|1317784_1318937_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016211470.1|1319539_1320193_+	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|1320252_1322238_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_032126343.1|1322368_1323181_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_032126344.1|1323301_1324390_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_016211467.1|1324392_1324959_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_081007013.1|1325033_1325333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1326751_1327117_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046961.1|1327284_1327689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032127044.1|1327808_1328009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212482.1|1328223_1328367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1328910_1330063_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_054300378.1|1330072_1331770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|1333625_1334174_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_075273576.1|1334301_1335030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1335089_1338587_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_016210514.1|1338644_1339898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210515.1|1340006_1340909_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210512.1|1340962_1342000_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210506.1|1342135_1343374_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210510.1|1343366_1344095_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_081007040.1|1344125_1344782_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211831.1|1344919_1346647_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|1346947_1347301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1347716_1348217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046962.1|1348868_1349315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1349318_1349894_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	1370680	1411138	3052624	tRNA,transposase,protease	Klosneuvirus(25.0%)	34	NA	NA
WP_016210928.1|1370680_1370986_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_054300375.1|1371200_1371401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728346.1|1372207_1372540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1372557_1373421_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556556.1|1373453_1374029_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1373974_1374340_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211651.1|1374573_1376109_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016211650.1|1376233_1377718_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211648.1|1378377_1378917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|1380120_1380327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126642.1|1380396_1380858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300374.1|1380893_1383464_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	5.1e-30
WP_016209840.1|1383571_1384057_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_016209844.1|1384229_1385270_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209835.1|1385247_1385730_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209848.1|1385726_1388321_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209832.1|1388627_1388891_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209831.1|1389169_1389868_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|1390087_1390282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209827.1|1390357_1391917_-	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_129556633.1|1392235_1393132_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|1393348_1394824_-	APC family permease	NA	NA	NA	NA	NA
WP_016209826.1|1395346_1396369_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209830.1|1396699_1398067_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209846.1|1398302_1398557_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126639.1|1398572_1399859_+	GTPase HflX	NA	NA	NA	NA	NA
WP_016209836.1|1399878_1401093_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_016209838.1|1401092_1401986_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209839.1|1402183_1403482_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209829.1|1404861_1407261_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209834.1|1407257_1408016_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209842.1|1408192_1408582_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_054300373.1|1409309_1410167_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|1410163_1411138_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 17
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	1439059	1618013	3052624	tRNA,protease,transposase,integrase	Staphylococcus_phage(17.5%)	158	1480366:1480425	1560823:1561788
WP_016211285.1|1439059_1439839_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211286.1|1439856_1440204_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211289.1|1440315_1440588_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211767.1|1442204_1443014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211764.1|1443564_1444386_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126803.1|1444586_1445819_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_032126804.1|1445941_1446817_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211806.1|1446981_1447707_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_081007037.1|1447749_1449288_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211804.1|1449294_1450680_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_036780332.1|1451374_1452718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1453357_1454041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273555.1|1454318_1454852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210332.1|1454982_1455726_-	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_016210330.1|1455823_1456207_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210333.1|1456410_1457040_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_032126607.1|1457113_1458397_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_054300368.1|1458736_1460035_+	ankryin	NA	NA	NA	NA	NA
WP_016210325.1|1460188_1461565_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210327.1|1461700_1463032_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_054300367.1|1463092_1463611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210321.1|1463659_1464628_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_129556511.1|1464824_1466261_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300568.1|1466443_1467154_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.3	4.1e-38
WP_054300366.1|1467174_1467588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210320.1|1467737_1468811_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_016210322.1|1468947_1469844_-	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016211334.1|1470173_1470362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211336.1|1470410_1471025_+	chorismate mutase	NA	NA	NA	NA	NA
WP_032126265.1|1471090_1472008_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_052104656.1|1472331_1472835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082827.1|1472911_1474213_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_016211330.1|1474387_1475488_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_032126267.1|1476123_1476366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300365.1|1476359_1476677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300364.1|1476786_1477665_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075273553.1|1477838_1478765_+	MFS transporter	NA	NA	NA	NA	NA
WP_155046964.1|1478754_1479330_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300363.1|1479275_1479623_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212589.1|1480046_1480484_+	MFS transporter	NA	NA	NA	NA	NA
1480366:1480425	attL	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAG	NA	NA	NA	NA
WP_129556637.1|1480958_1481738_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1480366:1480425	attL	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAG	NA	NA	NA	NA
WP_016210843.1|1482352_1482583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210844.1|1482669_1483797_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_129556513.1|1483972_1485718_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_032126340.1|1485798_1486560_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_155046965.1|1486839_1489296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1489447_1490221_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016210841.1|1490279_1490651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1490864_1491839_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211148.1|1492043_1493372_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1493635_1494205_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211151.1|1494220_1494532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1494541_1495498_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1495610_1495964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211153.1|1495967_1497032_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211145.1|1497032_1498772_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_036779218.1|1498778_1499201_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211144.1|1499184_1499814_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_054300271.1|1500370_1501345_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007035.1|1501384_1502050_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273651.1|1502875_1503913_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300359.1|1504271_1504844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664876.1|1505067_1506930_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_081377865.1|1507288_1507573_+|transposase	transposase	transposase	NA	NA	NA	NA
1507026:1507315	attR	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_032126362.1|1508932_1509298_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1507026:1507315	attR	TACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_129556638.1|1509876_1510557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273551.1|1510556_1510859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211974.1|1510958_1512080_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_054300357.1|1512362_1513238_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212011.1|1513471_1514593_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_016212013.1|1514814_1515198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|1515213_1515891_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300276.1|1515934_1516909_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016211994.1|1518387_1518924_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_032126537.1|1518960_1519146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211991.1|1519386_1520292_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126538.1|1521200_1522619_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_081007034.1|1522883_1523168_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_080728343.1|1523149_1523290_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_052104693.1|1523371_1527238_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_016211564.1|1527403_1528279_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211563.1|1528311_1528473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300355.1|1528683_1528869_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|1528858_1529434_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1529379_1529745_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046966.1|1529705_1530086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1530158_1531133_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046967.1|1531271_1531886_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	40.1	1.5e-33
WP_054300353.1|1531936_1532164_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300565.1|1538190_1538691_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_016210112.1|1539384_1540812_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_122943012.1|1540928_1541384_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210108.1|1541569_1542835_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_016210114.1|1542927_1544187_+	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210107.1|1544258_1544531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210101.1|1544820_1546317_-	flagellin domain protein	NA	NA	NA	NA	NA
WP_016210113.1|1547947_1548997_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210110.1|1549184_1549940_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_036777611.1|1550000_1551590_-	APC family permease	NA	NA	NA	NA	NA
WP_016210106.1|1551772_1552864_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210105.1|1552883_1553204_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210099.1|1553287_1554565_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_017377579.1|1554586_1555423_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210111.1|1555429_1557064_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_054300275.1|1557368_1558244_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210117.1|1558479_1558839_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210103.1|1559120_1560479_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_075273327.1|1560831_1561407_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1561352_1561718_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046968.1|1562226_1563379_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.4	2.2e-57
WP_155066176.1|1563388_1563658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1563920_1564286_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1564231_1564807_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211627.1|1564970_1565135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211632.1|1565360_1566215_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_054300351.1|1566250_1567072_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211631.1|1567327_1568134_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_155046729.1|1568392_1569439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1569656_1570809_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046942.1|1571194_1572081_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300349.1|1573232_1574957_-	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_032126825.1|1575508_1576822_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_016211481.1|1577054_1578197_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_098082850.1|1578271_1578448_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_052104609.1|1578483_1579116_-	MarC family protein	NA	NA	NA	NA	NA
WP_032126823.1|1579226_1579949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211482.1|1579937_1582211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1582346_1582685_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1582644_1583100_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212267.1|1583266_1583626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1583906_1584554_+	LysE family translocator	NA	NA	NA	NA	NA
WP_155046730.1|1584821_1584962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300161.1|1585180_1586242_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211733.1|1586856_1587681_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_054300347.1|1587736_1589128_-	protein kinase	NA	NA	NA	NA	NA
WP_016211732.1|1589549_1590248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126682.1|1590564_1590891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211399.1|1590998_1591742_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211403.1|1591755_1592799_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211405.1|1592934_1594707_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_129556522.1|1594913_1596146_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_054300271.1|1597456_1598431_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211669.1|1599255_1599606_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211666.1|1599760_1602580_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211664.1|1602952_1603681_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211555.1|1603931_1605290_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_032126677.1|1605364_1605928_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211557.1|1606122_1607352_-	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_016211554.1|1607397_1608024_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_032126678.1|1608350_1609361_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_054300346.1|1609371_1610247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1610393_1611476_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300345.1|1611557_1612637_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1612773_1613139_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1613084_1613660_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1614350_1615325_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1615879_1616941_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1617038_1618013_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 18
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	1646559	1690949	3052624	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_105962625.1|1646559_1647445_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300343.1|1647449_1647677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007030.1|1647712_1648684_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307341.1|1649377_1650976_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_016210848.1|1651142_1652327_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1652910_1653465_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210850.1|1653713_1654967_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210851.1|1654951_1655623_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210847.1|1655645_1656650_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210849.1|1656678_1658127_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210855.1|1658244_1659222_+	DMT family transporter	NA	NA	NA	NA	NA
WP_155046969.1|1659375_1660192_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1660212_1661187_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273543.1|1661226_1661469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776661.1|1662453_1662783_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_032126448.1|1662814_1663195_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211178.1|1663285_1664314_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016211180.1|1664376_1664841_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_032126449.1|1664861_1665785_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_081007029.1|1665851_1666460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776658.1|1666572_1668567_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211177.1|1668958_1670179_+	amino acid permease	NA	NA	NA	NA	NA
WP_155046970.1|1671603_1671852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211739.1|1671968_1672475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126783.1|1672585_1673827_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211741.1|1673972_1674749_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126790.1|1675912_1676818_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1677807_1678146_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1678105_1678561_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126602.1|1678713_1680021_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211857.1|1680271_1681150_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016211855.1|1681146_1681614_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|1681740_1681926_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_054300339.1|1682141_1683113_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.2e-25
WP_129556640.1|1683670_1684897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211351.1|1684972_1685311_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_032127067.1|1685307_1685910_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211349.1|1685906_1687901_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211350.1|1687964_1688903_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211352.1|1689581_1690022_+	universal stress protein	NA	NA	NA	NA	NA
WP_075273313.1|1690195_1690534_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007028.1|1690493_1690949_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	1701249	1770104	3052624	tRNA,transposase	Cedratvirus(14.29%)	58	NA	NA
WP_036779544.1|1701249_1702257_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1702256_1702514_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046972.1|1702773_1703364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300334.1|1704887_1705376_-	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_051307365.1|1705395_1705656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211834.1|1705913_1706228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|1709601_1710591_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1710924_1711110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046973.1|1711466_1711625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1711791_1713747_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016210749.1|1714045_1714507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210752.1|1714676_1715474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556641.1|1717850_1719113_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016211454.1|1723067_1723538_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_016211452.1|1724288_1725776_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211455.1|1725837_1727295_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_122942091.1|1727400_1727796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1727823_1728402_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_054300330.1|1729023_1730085_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274658.1|1730134_1731340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046974.1|1731491_1731653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300328.1|1731763_1732540_+	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_016212459.1|1732677_1733058_-	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_155046975.1|1733177_1733627_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_054300326.1|1734040_1734505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1734606_1734879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273534.1|1735072_1735954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|1736316_1737342_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300323.1|1737585_1738179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300322.1|1738566_1740501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1740539_1741454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1743024_1743291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1743367_1744024_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212446.1|1744058_1744820_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.1	1.2e-48
WP_016212445.1|1745182_1745449_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1745694_1746150_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1746109_1746448_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556531.1|1746410_1746608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211752.1|1746812_1747958_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211748.1|1747973_1749578_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211749.1|1749657_1750851_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_032126540.1|1751059_1751923_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300321.1|1753097_1753469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300320.1|1753686_1754286_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047087.1|1754263_1754482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|1754932_1755958_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300318.1|1756105_1757083_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211465.1|1757710_1758694_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211464.1|1758844_1759192_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_032126752.1|1759188_1759791_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211466.1|1759878_1761399_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126753.1|1761468_1761933_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_054300317.1|1762889_1763423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046976.1|1763719_1763857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007073.1|1763922_1764093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777066.1|1764075_1767132_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209619.1|1767218_1768667_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209621.1|1769099_1770104_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 20
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	1798677	1842450	3052624	transposase	Escherichia_phage(33.33%)	40	NA	NA
WP_054300202.1|1798677_1799406_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_081007021.1|1799398_1799965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126786.1|1800263_1803344_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016211319.1|1803361_1804414_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211316.1|1804946_1805597_+	porin family protein	NA	NA	NA	NA	NA
WP_016211315.1|1805931_1806576_+	porin family protein	NA	NA	NA	NA	NA
WP_054300314.1|1806763_1807099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273532.1|1807059_1807647_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126997.1|1807864_1808104_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_032126998.1|1808425_1808773_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_036774554.1|1808871_1809150_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1809202_1809490_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1809493_1810380_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923708.1|1812842_1813718_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211346.1|1814249_1814891_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_016211340.1|1814918_1815140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211347.1|1815132_1816116_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211344.1|1816329_1817148_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_054300313.1|1817308_1818991_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	1.6e-32
WP_054300312.1|1818998_1820021_-	YHYH protein	NA	NA	NA	NA	NA
WP_016211341.1|1820219_1820390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1820534_1821509_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211940.1|1821622_1821955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1822075_1823335_-	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_054300310.1|1825136_1825661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211210.1|1825763_1827245_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_052104715.1|1827251_1827458_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211211.1|1827506_1828586_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211215.1|1828777_1830748_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_054300309.1|1831108_1832668_+	APC family permease	NA	NA	NA	NA	NA
WP_054300308.1|1832962_1833193_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300307.1|1833222_1833951_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300306.1|1834053_1834278_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016211983.1|1834525_1835185_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556643.1|1835280_1836645_+	histidine kinase	NA	NA	NA	NA	NA
WP_016212551.1|1837102_1837597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211946.1|1838952_1839708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556540.1|1839926_1840322_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211947.1|1840314_1841460_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_033923708.1|1841574_1842450_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	1886854	1905636	3052624	transposase	Staphylococcus_phage(50.0%)	17	NA	NA
WP_032126540.1|1886854_1887718_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300189.1|1887851_1888217_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1888273_1888438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046980.1|1888427_1888727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046981.1|1888716_1888893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300299.1|1888982_1890065_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|1892266_1893817_-	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_075273524.1|1893972_1894938_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1894978_1895953_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_098082828.1|1896317_1896575_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1896574_1897582_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212247.1|1897948_1898704_+	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1899331_1900306_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300162.1|1900645_1901728_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212246.1|1901831_1902488_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300297.1|1903423_1904491_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1904553_1905636_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 22
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	1950147	1960495	3052624	transposase	Acinetobacter_phage(50.0%)	15	NA	NA
WP_054300294.1|1950147_1951209_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300293.1|1951480_1951846_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1951902_1952067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|1952056_1952230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|1952202_1952355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300292.1|1952810_1953812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779544.1|1954066_1955074_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1955073_1955331_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007015.1|1955542_1955968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1956460_1957613_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_054300288.1|1957622_1958312_-	hypothetical protein	NA	A0A0N7AE80	Bacillus_phage	28.2	3.2e-08
WP_054300287.1|1958720_1959050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1959071_1959437_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1959382_1959958_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300285.1|1959958_1960495_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	2026530	2081445	3052624	tRNA,transposase,protease	Orpheovirus(16.67%)	56	NA	NA
WP_016209434.1|2026530_2027952_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_129556553.1|2028041_2029634_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_016209439.1|2029797_2030424_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_054300277.1|2030504_2033186_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_016209445.1|2033668_2034625_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_016209435.1|2034725_2035097_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_016209404.1|2035123_2035987_+	chemotaxis phosphatase CheX family protein	NA	NA	NA	NA	NA
WP_016209416.1|2035976_2036762_-	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209413.1|2037050_2037536_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_016209443.1|2037610_2038132_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016209405.1|2038177_2039071_-	cheW-like domain protein	NA	NA	NA	NA	NA
WP_016209406.1|2039067_2039889_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.2	5.0e-16
WP_016209408.1|2040203_2040374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209427.1|2040527_2041931_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_052047073.1|2042024_2043275_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080664816.1|2043261_2043993_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_016209424.1|2044004_2045282_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209433.1|2045381_2045756_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209412.1|2045840_2046728_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209436.1|2046785_2047514_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_129556555.1|2047510_2048641_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209444.1|2048771_2049200_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_032126508.1|2049294_2049654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209447.1|2049643_2050855_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016209421.1|2050851_2051640_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209411.1|2051802_2052597_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_054300276.1|2052802_2053777_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_155049809.1|2053951_2055247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2055250_2055550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2055539_2055704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2055760_2056126_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211553.1|2056465_2057206_-	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_016211549.1|2057209_2059714_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211548.1|2059976_2060933_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211550.1|2060916_2061678_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_054300275.1|2061755_2062631_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2062755_2063001_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016211262.1|2063060_2065334_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_075273504.1|2065388_2065742_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|2065931_2066225_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_032126515.1|2066397_2066577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307354.1|2066652_2067228_-	DedA family protein	NA	NA	NA	NA	NA
WP_032126514.1|2067510_2068827_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2068837_2069206_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016211265.1|2069236_2069899_-	adenylate kinase	NA	NA	NA	NA	NA
WP_054300274.1|2070073_2070439_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2070384_2070960_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126519.1|2071127_2071847_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_016211478.1|2071826_2072642_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126518.1|2072658_2074860_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211474.1|2074942_2076292_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_016211473.1|2076366_2076966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211476.1|2076949_2077159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777061.1|2077476_2078664_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211932.1|2078859_2080149_+	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_129556478.1|2080559_2081445_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	2093981	2135795	3052624	tRNA,transposase	Moraxella_phage(16.67%)	39	NA	NA
WP_054300173.1|2093981_2095043_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776407.1|2095291_2096428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211446.1|2096611_2098339_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_016211448.1|2098328_2099537_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211450.1|2099635_2100658_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155047009.1|2101433_2101607_+	phosphatase	NA	NA	NA	NA	NA
WP_052104774.1|2101751_2102384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2102431_2103493_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126170.1|2103656_2103929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211040.1|2104156_2105368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211037.1|2105718_2106348_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211042.1|2106396_2107413_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211035.1|2107659_2107875_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211043.1|2107927_2108377_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211039.1|2108456_2110202_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211036.1|2110293_2112165_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_054300271.1|2112512_2113487_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273494.1|2113506_2114067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|2115131_2117612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2117686_2118592_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016210899.1|2119091_2120975_-	APC family permease	NA	NA	NA	NA	NA
WP_016210896.1|2121028_2122111_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210904.1|2122153_2122804_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210903.1|2123024_2123396_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_129556487.1|2123514_2124852_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_054300270.1|2124930_2125908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210894.1|2126248_2126551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|2127025_2127316_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210898.1|2127404_2127755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300269.1|2128666_2129035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2129056_2129422_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2129478_2129643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007012.1|2129632_2129803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|2129797_2130859_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273492.1|2130967_2131087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556486.1|2131177_2131525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556630.1|2131610_2132960_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211781.1|2133269_2134517_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_054300173.1|2134733_2135795_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	2156653	2284218	3052624	tRNA,protease,transposase,integrase	Staphylococcus_phage(12.5%)	117	2184846:2184905	2214074:2214663
WP_075273313.1|2156653_2156992_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|2156951_2157212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300264.1|2157356_2157695_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300263.1|2157682_2158123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2158194_2159169_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212461.1|2159544_2159919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2159922_2160498_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2160443_2160809_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051307332.1|2161017_2161224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300262.1|2161271_2161562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104721.1|2161553_2163260_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_051307331.1|2163331_2165110_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_016210552.1|2165464_2166031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210553.1|2166155_2166809_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_054300261.1|2166835_2168278_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210545.1|2168374_2169352_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_129556482.1|2169500_2170106_+	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_026063577.1|2170177_2170471_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556629.1|2170697_2171444_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_017376905.1|2171674_2171902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|2171966_2172149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|2172585_2173140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046716.1|2173837_2173984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046984.1|2174405_2175524_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047108.1|2176335_2176734_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273488.1|2176789_2177425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2177509_2177875_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2177820_2178396_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211578.1|2178465_2178810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|2178825_2179020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|2179086_2179440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300258.1|2179537_2180317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211585.1|2180378_2180936_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_075273486.1|2181170_2182145_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.2e-29
WP_054300257.1|2182121_2182931_-	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.6	1.8e-29
WP_016211583.1|2183207_2184116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211579.1|2184183_2184669_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
2184846:2184905	attL	TGTAAAACTCCAGATATGATCTGACAAGCTTAAATCATCTGACAACATTTGTCTGATTGA	NA	NA	NA	NA
WP_054300162.1|2184879_2185962_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781361.1|2186232_2186622_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_054300237.1|2186641_2187703_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046986.1|2187891_2188778_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212302.1|2188962_2189262_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_081007067.1|2189482_2194957_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_036780532.1|2195468_2196509_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_054300162.1|2196611_2197694_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781387.1|2197786_2198059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|2198051_2198330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126152.1|2198532_2199123_+|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016211531.1|2199186_2199867_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300254.1|2200220_2201117_+	Abi family protein	NA	A3QSC6	Clostridium_virus	31.6	6.9e-35
WP_016211534.1|2201122_2201632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300253.1|2201618_2202569_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	34.7	6.9e-09
WP_016211528.1|2204423_2204729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664862.1|2204709_2205408_-	P-loop NTPase	NA	NA	NA	NA	NA
WP_032126157.1|2206271_2206676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|2206962_2208855_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_036780074.1|2209197_2210004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307360.1|2211095_2212025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2212113_2213019_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046987.1|2214109_2214793_-|transposase	transposase	transposase	NA	NA	NA	NA
2214074:2214663	attR	TCAATCAGACAAATGTTGTCAGATGATTTAAGCTTGTCAGATCATATCTGGAGTTTTACACCTAAGCTCTTCAAAAGCTATTTGATTTGACCGCACAAGTAATTTATATTTGAGTGCAAAGTGGTTAAGTTGTGCTTTTACACTCAATGTTTCTAGTTTACAAAATGCCACGATTGATGCAAAAATATGATTGCATTGTGACCGAACAGTTTTAGTCGGTGATTTTGCTAAACTTGCATTTTGTTTAATCGACTTATGATATTCTTCAATTTTCCATCGTTTTTGATAGATTTTGTAAAGCCCATCACCATCCGTCTCTAAATCATTTGTTATTAAATAGAGGTGACCTGTTGACCCGTCTTCGTTTGTGAAGATCTTTTTCATTAATCGCACTGGGAAATTAATTCCCTGAAGATATACATCTATGGCCTCACTATCTTTTAAATCAAGAGATTTGACTGGCTGGTAATTTCTATTGATTTTATCATCTAAACTGCAAGCAACTGTTCGATTAGATTTTATTCCTAAAATAAACAACTTATTTAACTTGGCATGAATATAATTCATGTTTTCTTTTGAACTGAACCAGT	NA	NA	NA	NA
WP_155046988.1|2214808_2215177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372266.1|2215509_2215995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300251.1|2216084_2217599_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209659.1|2217725_2218754_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_016209654.1|2218818_2219961_+	galactokinase	NA	NA	NA	NA	NA
WP_016209656.1|2220079_2221783_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209642.1|2221779_2223900_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209652.1|2223896_2225246_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209662.1|2225217_2227365_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209657.1|2227792_2228188_+	CrcB family protein	NA	NA	NA	NA	NA
WP_016209643.1|2228196_2229081_-	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_075273480.1|2229112_2231011_-	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209655.1|2231093_2231366_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_032126161.1|2231469_2233902_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209663.1|2233969_2235271_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_016209647.1|2235352_2235958_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209645.1|2236070_2237375_-	trigger factor	NA	NA	NA	NA	NA
WP_016209661.1|2237978_2238854_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_075273478.1|2238969_2239641_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209658.1|2239817_2241173_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_016209641.1|2241293_2242031_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032126159.1|2242110_2242824_-	aldolase	NA	NA	NA	NA	NA
WP_016209651.1|2243469_2244744_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2244774_2245350_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209649.1|2245394_2246360_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209640.1|2246818_2247838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300250.1|2248256_2248916_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_129556449.1|2248905_2249412_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|2249426_2249792_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046989.1|2250282_2251347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300248.1|2251579_2252554_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	3.1e-28
WP_155046989.1|2252646_2253711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|2253943_2254918_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_129556476.1|2255215_2256226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211684.1|2256770_2257346_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016211685.1|2257369_2259175_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211687.1|2259205_2259850_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_054300245.1|2260105_2260981_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556628.1|2261185_2262001_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.5e-32
WP_016210297.1|2262086_2263466_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_032126463.1|2263522_2264779_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_032126458.1|2264859_2266386_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_054300244.1|2266391_2267390_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_016210290.1|2267630_2268425_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210287.1|2268513_2269377_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_036777321.1|2269497_2270778_-	membrane protein	NA	NA	NA	NA	NA
WP_032126457.1|2271822_2272242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126460.1|2273149_2273587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210301.1|2273763_2274591_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_075273633.1|2274640_2275267_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_016210294.1|2275404_2275749_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_051307327.1|2276066_2277098_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.7e-35
WP_016210303.1|2277373_2277613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2277662_2278724_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210741.1|2279409_2279733_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_016210746.1|2279739_2283636_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_054300242.1|2283681_2284218_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 26
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	2291027	2362188	3052624	tRNA,transposase	Staphylococcus_phage(42.86%)	56	NA	NA
WP_054300271.1|2291027_2292002_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212172.1|2292021_2293494_-	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|2293796_2294771_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300240.1|2295070_2295274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|2295530_2296415_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036777316.1|2296724_2297138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211818.1|2297494_2298751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|2298953_2299454_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_054300238.1|2299750_2300029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|2300569_2301631_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2301657_2302233_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2302178_2302544_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300559.1|2303259_2303808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2304688_2305144_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273456.1|2305103_2305403_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300276.1|2305525_2306500_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016209398.1|2307082_2308309_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|2308907_2310614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007011.1|2310781_2312002_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209395.1|2312250_2314941_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_016209384.1|2315232_2316048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300234.1|2316398_2317340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300233.1|2317881_2319525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209368.1|2320100_2321630_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_054300232.1|2321665_2323117_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209366.1|2323091_2324051_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_016209365.1|2324128_2327635_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.5	4.9e-193
WP_032126583.1|2327658_2328228_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	42.9	5.7e-27
WP_054300231.1|2328440_2329595_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_016209377.1|2329613_2330387_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_016209390.1|2330386_2330824_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_016209391.1|2330850_2331900_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_016209381.1|2331951_2332485_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_129556472.1|2332565_2334959_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_051307309.1|2335297_2336338_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_016209394.1|2338540_2339605_+	GHMP kinase	NA	NA	NA	NA	NA
WP_016209364.1|2339594_2340623_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_016209393.1|2340619_2341159_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_016209400.1|2341703_2343665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300230.1|2344102_2345734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209397.1|2345854_2346730_-	bacterial lipid A biosynthesis acyltransferase family protein	NA	NA	NA	NA	NA
WP_016209379.1|2346817_2347624_-	cytidylyltransferase	NA	NA	NA	NA	NA
WP_032126580.1|2347631_2348369_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.5	7.2e-22
WP_016209396.1|2348385_2348943_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_016209399.1|2348946_2349684_-	UMP kinase	NA	NA	NA	NA	NA
WP_016209372.1|2349687_2350566_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_032126579.1|2350740_2351508_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_016209375.1|2351930_2352740_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_054300229.1|2352817_2355475_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_016209389.1|2355475_2356513_+	asparaginase	NA	NA	NA	NA	NA
WP_016209373.1|2356514_2357336_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_016209387.1|2357465_2358350_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2358487_2359063_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2359008_2359374_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300228.1|2360279_2361533_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_155046990.1|2361510_2362188_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	2367052	2413563	3052624	tRNA,transposase,protease	Prochlorococcus_phage(33.33%)	48	NA	NA
WP_016210607.1|2367052_2368312_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210598.1|2368480_2369140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556471.1|2369281_2369953_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210609.1|2370312_2371248_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_016210606.1|2371344_2371971_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_054300226.1|2371976_2372558_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210601.1|2372629_2373721_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210599.1|2373803_2374517_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_122940948.1|2374610_2375315_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300148.1|2375637_2376699_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126800.1|2376823_2377558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046954.1|2377784_2377958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|2378064_2378484_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|2379446_2379692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|2379991_2380877_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300223.1|2381114_2382086_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_016209900.1|2382277_2383747_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209924.1|2383740_2385117_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209906.1|2385128_2385521_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209919.1|2385517_2386621_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_032126654.1|2386799_2388101_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209907.1|2388108_2389056_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_016209913.1|2389067_2389886_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_032126655.1|2389888_2390689_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209910.1|2390682_2391741_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_016209903.1|2391737_2392748_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|2392754_2392952_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_054300222.1|2393012_2395919_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209918.1|2395960_2396815_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_032126652.1|2396847_2397414_-	chorismate lyase	NA	NA	NA	NA	NA
WP_016209915.1|2397496_2398357_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016209922.1|2398448_2398865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300221.1|2398924_2399422_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_054300220.1|2399467_2402422_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209901.1|2402451_2402784_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209923.1|2402901_2403420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209908.1|2403894_2404605_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209899.1|2404601_2405636_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_032126651.1|2405739_2405925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2406045_2406411_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2406356_2406932_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212369.1|2406935_2407382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212599.1|2408616_2408826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2408875_2409937_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2409983_2410889_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2411681_2412020_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2411979_2412435_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2412588_2413563_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 28
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	2482396	2524838	3052624	tRNA,transposase	Synechococcus_phage(50.0%)	47	NA	NA
WP_081007066.1|2482396_2482735_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300215.1|2482729_2483224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|2484027_2484318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007010.1|2484367_2484988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210530.1|2485828_2486509_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_016210535.1|2486505_2487318_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_054300212.1|2487391_2491072_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_036776217.1|2491081_2492569_-	ribonuclease G	NA	NA	NA	NA	NA
WP_054300211.1|2492578_2493196_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016210528.1|2493265_2493784_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210536.1|2493780_2494680_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2494695_2495739_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210537.1|2495928_2496216_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210532.1|2496327_2497779_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_032126195.1|2497820_2499257_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_155046713.1|2499551_2499716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300210.1|2499853_2500042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007009.1|2499998_2500169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2500158_2500323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2500379_2500745_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212074.1|2500771_2500993_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_142396463.1|2501079_2501196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047032.1|2501306_2501540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212075.1|2501752_2501950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779278.1|2502063_2503017_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300148.1|2503136_2504198_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300208.1|2504175_2504967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|2505096_2505408_+	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_155046991.1|2505755_2506079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779281.1|2506103_2506559_-	arginine repressor	NA	NA	NA	NA	NA
WP_016211489.1|2506548_2507601_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211493.1|2507603_2509067_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211491.1|2509349_2509646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2509906_2510968_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210915.1|2511097_2511562_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_032126715.1|2511759_2512575_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210906.1|2512703_2515016_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_051307343.1|2515135_2515663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210909.1|2516355_2517633_+	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_016210914.1|2517638_2517890_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210913.1|2517923_2518445_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_032126716.1|2518615_2519599_-	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210908.1|2519689_2520505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2521716_2522778_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212580.1|2523513_2523864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2523951_2524317_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273438.1|2524262_2524838_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	2529334	2576887	3052624	transposase,integrase	Escherichia_phage(47.06%)	53	2539215:2539274	2551950:2552210
WP_054300202.1|2529334_2530063_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211244.1|2530464_2531160_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_016211242.1|2531113_2532082_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_129556456.1|2532125_2532875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211238.1|2533076_2534570_-	amino acid permease	NA	NA	NA	NA	NA
WP_129556626.1|2535012_2536401_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211235.1|2536830_2537268_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300202.1|2537762_2538491_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300206.1|2538776_2539013_+	hypothetical protein	NA	NA	NA	NA	NA
2539215:2539274	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_155046992.1|2539479_2540019_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	30.5	8.7e-09
WP_032126362.1|2539979_2540345_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2540290_2540866_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300203.1|2541348_2541807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|2541811_2542414_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211642.1|2542714_2543068_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_016211646.1|2543060_2543300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211918.1|2543671_2544640_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_051307368.1|2544639_2545920_-	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_054300202.1|2546626_2547355_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_075273432.1|2547665_2548400_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_016212023.1|2548396_2549389_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_054300201.1|2549784_2550513_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_054300200.1|2550814_2551393_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	3.9e-47
WP_155046993.1|2551385_2551748_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	37.6	1.3e-13
WP_016212024.1|2551892_2552141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|2552137_2552737_-	AAA family ATPase	NA	NA	NA	NA	NA
2551950:2552210	attR	TGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGAGCTTGGTCACGTATTGGATAACGTCCTTTTTTGGAGCCTTCTAACAGTTGTTGAATTTCAGGAGTAGTTAGAAAATCCCGATCTCGCTCATGACCATCACATGCCAGAGAATGTTCTACTTCAACACTCATCGCTGCAAACCTTTTTTCAGCTCAAACCCTAAGTTAACTCCTTTTAGCCATTGAGGGAGTGATTTACTC	NA	NA	NA	NA
WP_016212022.1|2552736_2552955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|2553184_2553913_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300198.1|2554324_2554654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2554804_2555533_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016210935.1|2555919_2556462_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2556458_2557145_-	acireductone synthase	NA	NA	NA	NA	NA
WP_036778484.1|2557148_2557760_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2557806_2558826_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2558927_2559722_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2559743_2560550_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2560628_2561678_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2561875_2563135_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2563181_2563859_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2563944_2564226_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_155046994.1|2564317_2565472_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.6	2.1e-20
WP_016210820.1|2565741_2566683_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2567186_2567411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2567702_2568407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300196.1|2568821_2569460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2569794_2570325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300195.1|2570321_2571854_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2571850_2572801_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2573221_2573854_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2574096_2574294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2574643_2575072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300194.1|2575149_2575848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2575825_2576887_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	2580099	2632309	3052624	tRNA,transposase	Staphylococcus_phage(22.22%)	52	NA	NA
WP_081007004.1|2580099_2580555_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2580514_2580853_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036778253.1|2580910_2582449_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_098082804.1|2582560_2583659_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2583896_2585096_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2585125_2585764_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|2585779_2587963_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|2588200_2588545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|2589590_2589797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|2589961_2590420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|2591007_2592135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2592258_2592921_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2593012_2593258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2594331_2594991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2595092_2595743_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|2595855_2596176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2596234_2597209_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2597459_2597681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300192.1|2597703_2597925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300191.1|2597969_2598926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300190.1|2599420_2600383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046995.1|2600509_2601395_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210162.1|2602080_2603118_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_032126295.1|2603148_2604603_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_016210181.1|2604612_2605797_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_016210176.1|2605870_2606878_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210183.1|2606946_2608950_-	transketolase	NA	NA	NA	NA	NA
WP_016210174.1|2609400_2610561_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	8.2e-121
WP_036776947.1|2610797_2611913_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210172.1|2612075_2612600_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.6	6.9e-51
WP_016210163.1|2612599_2613130_+	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_016210178.1|2613219_2613687_-	DoxX family protein	NA	NA	NA	NA	NA
WP_016210161.1|2614188_2614443_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210179.1|2614643_2615147_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_129556592.1|2615437_2615968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2616128_2616812_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|2616887_2617667_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_032126297.1|2617653_2618514_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210177.1|2618638_2619004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210175.1|2619389_2619719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300188.1|2620032_2621592_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	9.9e-37
WP_054300148.1|2621837_2622899_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211784.1|2623452_2624175_+	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_016211783.1|2624166_2624532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|2624812_2626090_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211782.1|2626689_2626872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2626933_2627299_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273426.1|2627244_2627820_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273424.1|2627834_2628458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210766.1|2628546_2628990_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_032126291.1|2628993_2629503_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210756.1|2629495_2632309_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
>prophage 31
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	2662375	2698704	3052624	tRNA,transposase,protease	Stx2-converting_phage(20.0%)	37	NA	NA
WP_054300173.1|2662375_2663437_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2663527_2664274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300186.1|2664542_2665262_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2665505_2665868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273422.1|2666054_2666582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2666726_2667143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2669225_2670137_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2670188_2671037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2671481_2672192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2672283_2673252_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2673239_2673887_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036779767.1|2673915_2674767_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2674781_2676059_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2676099_2676615_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_054300183.1|2676693_2677755_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2677776_2678865_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_036777788.1|2678909_2680745_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2680787_2681258_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2681294_2681630_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2681642_2682359_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2682295_2683312_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2683308_2683788_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2683871_2686352_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2686414_2686780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273418.1|2687118_2687457_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2687416_2687872_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2687886_2688177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777784.1|2688242_2689841_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2689971_2690307_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777781.1|2690334_2691999_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210581.1|2691995_2692640_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2692639_2693383_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2693441_2693681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2693831_2695199_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2695209_2695761_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2695841_2696825_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2696946_2698704_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 32
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	2848940	2914512	3052624	transposase	Erwinia_phage(18.18%)	55	NA	NA
WP_054300168.1|2848940_2849804_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2850100_2851153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300167.1|2851501_2851849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2852062_2852554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2852609_2853860_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2853962_2854181_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_036777591.1|2854638_2855493_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016210728.1|2855547_2856018_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2856342_2857722_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2857749_2858208_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2858185_2859403_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2859594_2859831_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2859844_2860000_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2860080_2861043_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2861202_2862519_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2862528_2863197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2863559_2865374_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_054300166.1|2865491_2866280_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211543.1|2866860_2868612_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|2868622_2869423_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|2869525_2870014_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_017375799.1|2871522_2871867_+	DMT family protein	NA	NA	NA	NA	NA
WP_016210038.1|2877560_2878523_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|2878709_2879969_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|2880192_2880519_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|2880713_2881664_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|2881721_2883788_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|2883793_2884789_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|2885374_2886955_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|2887111_2888521_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|2888580_2889714_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|2889853_2890678_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|2890905_2891535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|2891871_2892243_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|2892546_2892834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|2892985_2893834_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|2893961_2895002_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_129556667.1|2895074_2896652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|2897295_2897955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2898109_2899084_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2899159_2900179_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047000.1|2900226_2900373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556602.1|2900577_2900787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2901661_2902744_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300161.1|2902791_2903853_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|2903933_2904242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|2904356_2905673_-	MFS transporter	NA	NA	NA	NA	NA
WP_081007001.1|2906134_2907421_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|2907493_2908390_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|2908476_2909475_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|2909583_2910108_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|2910355_2911594_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|2912141_2912615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|2912611_2913007_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2913936_2914512_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP039065	Piscirickettsia salmonis strain Psal-107 chromosome, complete genome	3052624	2924640	3025512	3052624	tRNA,transposase	Staphylococcus_phage(35.71%)	103	NA	NA
WP_081007000.1|2924640_2925729_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300157.1|2925952_2927233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2928065_2928431_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2928376_2928952_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2929234_2929600_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047002.1|2929614_2930220_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036776867.1|2930590_2931988_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_051307313.1|2932107_2933055_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|2933051_2933567_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|2933553_2934753_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|2934749_2935073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|2935074_2936304_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|2936303_2937347_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|2937346_2938030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|2938026_2940516_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|2940532_2940787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|2940787_2941144_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|2941923_2943087_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|2943106_2946214_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|2946215_2947721_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|2947748_2948030_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|2948178_2948520_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|2948639_2950520_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_075274705.1|2950604_2952203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|2952220_2953336_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|2953463_2954462_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|2954465_2955224_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|2955225_2956425_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|2956408_2957080_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|2957101_2957878_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|2957881_2958880_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|2958881_2959460_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|2959456_2960926_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|2960969_2961257_-	trp operon repressor	NA	NA	NA	NA	NA
WP_054300271.1|2961388_2962363_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209699.1|2962563_2963160_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300152.1|2963186_2963552_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|2963608_2963764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273401.1|2963908_2964361_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300151.1|2964398_2964731_+	DMT family transporter	NA	NA	NA	NA	NA
WP_155047003.1|2966219_2967105_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|2967291_2967513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|2967628_2968261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2968238_2969300_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776841.1|2969739_2970279_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|2970363_2970900_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|2971551_2971854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|2972303_2972612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|2972932_2973382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|2973664_2974375_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|2974601_2975000_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|2975867_2976818_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|2976817_2978896_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|2979043_2979559_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|2979567_2980131_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|2980111_2980858_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|2980997_2981450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|2981585_2982422_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|2982418_2983315_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|2983347_2984415_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|2984433_2984802_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|2984827_2986276_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|2986285_2987665_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|2987705_2989037_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|2989008_2989968_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|2990060_2990564_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|2990698_2991850_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|2991846_2992326_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|2992472_2994794_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|2994738_2995365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|2995369_2996269_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|2996341_2996920_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|2997220_2997478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081006999.1|2997486_2997858_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.2	3.4e-20
WP_081006998.1|2998062_2998518_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	1.3e-21
WP_032126637.1|2998634_2998928_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155046758.1|2999776_2999908_+	phosphatase	NA	NA	NA	NA	NA
WP_016212051.1|3000535_3001309_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126148.1|3001850_3002033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3002636_3003611_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3004705_3005044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007065.1|3005060_3005900_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_155047004.1|3006112_3006619_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300144.1|3006633_3006999_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3008303_3008999_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3008995_3010423_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3010448_3010712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3010784_3011759_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047005.1|3011817_3012668_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|3012866_3013841_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007064.1|3013880_3014156_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3014152_3014989_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3014989_3015331_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3015332_3015938_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3015934_3017929_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3017948_3018890_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052104719.1|3019117_3020542_+	MFS transporter	NA	NA	NA	NA	NA
WP_155047006.1|3020948_3021089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3021342_3022317_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3022375_3023032_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126480.1|3023078_3023762_-	methyltransferase	NA	NA	NA	NA	NA
WP_080664873.1|3024307_3024622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144019150.1|3024531_3025512_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039066	Piscirickettsia salmonis strain Psal-107 plasmid unnamed1, complete sequence	158207	2231	115203	158207	tail,capsid,integrase,head,protease,transposase	Streptococcus_phage(25.0%)	118	49319:49378	119962:120600
WP_054300202.1|2231_2960_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|3163_5740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047021.1|6034_6190_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300202.1|6213_6942_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273830.1|6971_7304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047014.1|7374_7716_-	hypothetical protein	NA	A0A1B1IQX9	uncultured_Mediterranean_phage	60.3	1.7e-21
WP_054300202.1|7871_8600_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273834.1|8806_9373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273836.1|9715_10777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|10806_11889_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300202.1|12008_12737_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046765.1|13623_13818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047015.1|14198_14522_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212122.1|15398_16100_+	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_016212121.1|16053_16977_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_105962625.1|17410_18296_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.7	4.5e-10
WP_054300271.1|18940_19915_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212151.1|20005_20968_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|20991_21306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|21369_22344_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_033923686.1|22468_23518_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|23626_24667_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|24680_25310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|25400_25700_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211886.1|25696_26125_-	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_052104769.1|27122_28046_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_129556707.1|28360_29380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|29761_30915_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300202.1|30981_31710_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|31807_32221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047016.1|32624_32852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927838.1|32881_33127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|33123_33423_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016212019.1|33579_34275_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_081377351.1|35088_35868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|35951_36104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|36056_36389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|36553_36931_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|37237_37621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273842.1|38090_38819_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	5.4e-38
WP_036781349.1|38934_39261_-	potassium ABC transporter ATPase	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.1e-11
WP_016212365.1|39262_39505_-	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_155047017.1|40858_41038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273844.1|41516_43151_+	protein kinase	NA	NA	NA	NA	NA
WP_129556709.1|43362_43452_+	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_129556710.1|43532_44003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273857.1|44156_44891_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	8.4e-39
WP_016212404.1|45667_45901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273881.1|46021_48208_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.2	9.2e-73
WP_036779532.1|48217_48619_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_016212456.1|48615_48903_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_054300271.1|48946_49921_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
49319:49378	attL	AGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAA	NA	NA	NA	NA
WP_016212579.1|50520_50718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|52223_52424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212061.1|53193_55236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|56428_56794_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274751.1|56739_57315_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.1e-08
WP_075274752.1|57311_57611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047018.1|57646_58450_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.9e-55
WP_129556718.1|58483_59669_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_075273741.1|59878_60613_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046767.1|60943_61105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|61104_61605_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273747.1|61866_62457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273741.1|62586_63321_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273749.1|63542_64268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047019.1|64757_64910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273751.1|64922_66653_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300477.1|66812_67541_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	7.1e-38
WP_155047020.1|67697_68621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273755.1|68861_69518_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.2	2.9e-30
WP_016211955.1|69654_70635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211956.1|71091_71820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556703.1|71877_72366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377344.1|73479_74607_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273757.1|74846_75296_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273760.1|75639_78042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210338.1|78144_78282_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273592.1|78380_79355_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_081377345.1|79351_79876_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.5	1.4e-27
WP_032126637.1|79992_80286_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_075273762.1|80351_81623_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.3	1.1e-22
WP_052047108.1|81678_82077_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273764.1|82132_82501_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_016210655.1|82514_83111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273766.1|83561_84623_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066177.1|84626_84896_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.3	2.9e-05
WP_016210667.1|84892_85216_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210658.1|85208_85604_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210651.1|85600_85951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210664.1|85950_86373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210669.1|86374_86698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|87051_88077_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273770.1|88196_88481_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075273774.1|90682_91840_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_087910645.1|92002_93156_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_032126362.1|93228_93594_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273438.1|93539_94115_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.0	1.3e-07
WP_032126790.1|94585_95491_+|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_129556697.1|95875_96268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211776.1|96750_98088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|98395_99421_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016211775.1|99715_100084_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211773.1|100185_100860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126360.1|101446_102181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|102303_103362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|103870_104617_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|104617_105022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377346.1|105415_106132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047010.1|106276_106519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|107051_108077_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_052104629.1|108898_109924_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212298.1|110203_110530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|110770_111247_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_155047011.1|111361_112514_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	9.8e-58
WP_075273780.1|112523_113231_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_052104629.1|113369_114395_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273782.1|114774_115203_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.0	3.0e-12
119962:120600	attR	AGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
