The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	31805	91608	3196457	transposase,tRNA	Staphylococcus_phage(28.57%)	52	NA	NA
WP_036772169.1|31805_32681_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33039_34395_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34486_34993_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34989_35358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36760_38545_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39025_40153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40225_40981_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|41017_43711_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43742_44294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44401_45415_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45535_45760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46115_46877_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47019_47814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|47958_48711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49022_50549_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50687_51761_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|51800_53108_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53082_54252_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54306_55032_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55497_57603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|57817_58282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58301_58811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59195_60137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60418_61870_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773655.1|62336_62741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63301_64276_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|65010_65388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|65977_66952_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773242.1|66991_67546_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|67740_68640_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|68644_69271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|69215_71537_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|71683_72163_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|72159_73311_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|73445_73949_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|74042_75017_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|75006_76320_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|76360_77740_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|77746_79198_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|79223_79592_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378407.1|79610_80678_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|80710_81607_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|81603_82440_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|82575_83028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|83166_83913_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|83893_84457_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|84465_84981_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|85122_87201_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|87200_88151_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|89018_89417_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|89642_89972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|90588_91608_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	123090	241158	3196457	protease,transposase,tRNA	Staphylococcus_phage(12.5%)	105	NA	NA
WP_075278722.1|123090_123966_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|124406_124700_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|124700_124955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|124971_127464_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|127456_128140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|128139_129183_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|129182_130412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|130413_130743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|130739_131939_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|132051_132441_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|132440_133385_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|133504_134902_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|135227_135749_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|135872_136181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|136195_141418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|141808_143815_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|143945_146276_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|146451_147282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|147398_147794_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|147790_148324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|148320_148722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|149116_149437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|149446_150403_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|150912_151437_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|151537_152536_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|152624_153521_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|153594_154881_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|155340_156657_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|156770_156941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|156960_157935_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|158061_158322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|158589_158880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|161418_162459_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|162561_163533_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|163655_164504_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|164655_164943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|165253_165625_+	isochorismatase	NA	NA	NA	NA	NA
WP_017377540.1|166676_166910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|167047_167185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|167198_167411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|167934_168759_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|168897_170031_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|170090_171500_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|171647_173228_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|173985_174981_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|174986_177053_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|177110_178061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|178255_178582_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|178804_180064_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|180323_181199_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|181237_182200_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|187894_188239_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|188335_189259_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|189758_190247_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|190349_191150_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|191160_192912_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|193801_194044_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|194047_194446_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|194677_195553_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|196271_196730_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|196911_197097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|197812_199627_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|200037_200706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|200715_202032_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|202191_203154_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|203234_203390_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|203403_203640_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|203832_205050_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|205027_205486_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|205513_206893_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|206929_207148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|207467_208763_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|208967_209159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|209357_210233_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|210420_211686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|211719_212595_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|212716_213175_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|213198_214119_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|214246_215029_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|215119_216619_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|216932_218816_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|219075_219738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|219804_220914_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|220925_221570_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|221588_222575_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|222659_223736_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|223937_224762_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|225064_226030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|226348_227401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|227459_228434_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|228769_229198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|229434_229917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|229972_231223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|231325_231544_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|232015_232870_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|232924_233395_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|233691_233928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|234074_234455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|234513_235389_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|236155_237067_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|237183_238032_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|238098_239109_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|239132_239456_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375571.1|239466_239868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|240138_241158_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	314961	357320	3196457	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|314961_315837_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|315917_316550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|316503_317949_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|317983_318403_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|319176_319545_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|319554_320094_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|320254_320686_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|320689_321388_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|321635_322142_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|322184_322553_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|322823_326900_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|326963_331172_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|331333_331708_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|331812_332286_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|332301_334413_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|334440_335631_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|335637_335949_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|336071_336710_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|336725_337343_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|337339_337636_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|337650_338475_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|338491_338767_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|338772_339105_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|339117_339852_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|339865_340279_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|340278_340479_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|340478_340736_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|340857_341226_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|341243_341555_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|341570_342113_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|342125_342431_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|342459_342852_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|342864_343398_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|343407_343761_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|343771_344272_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|344277_344460_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|344462_344897_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|344897_346220_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|346276_346390_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|346533_346890_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|346915_347305_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|347314_347935_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|347956_348934_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|348982_349381_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|349493_350741_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|350727_351384_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|351468_351747_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|351989_352217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|352349_353144_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|353452_354667_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|355064_355244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|355212_355866_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|356241_356490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|356579_357320_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	375338	425021	3196457	transposase,tRNA	Staphylococcus_phage(25.0%)	54	NA	NA
WP_017376964.1|375338_377819_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|377905_378385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|378357_379398_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|379334_380051_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|380063_380399_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|380435_380906_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|380948_382784_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|382828_383917_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|383938_385000_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|385077_385593_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|385633_386911_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|386925_387777_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|387805_388453_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|388449_389409_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_048875861.1|389930_390800_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|390944_391199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|391343_391910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|392015_392456_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_027242664.1|392967_394170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|394453_395428_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046562.1|395609_395753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046563.1|395897_396035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|396051_396267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|396471_397083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|397079_397337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|397587_397980_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|398109_398658_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|398657_399485_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|399534_401220_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|401297_401759_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|401795_402359_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|402585_402915_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|402895_403120_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|403264_403855_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|403879_405151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|405168_406422_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|406418_407063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|407135_408185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|408286_409924_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|409958_410288_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|410444_410732_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376927.1|411158_411296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046565.1|411258_411552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|411801_413022_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|413080_415879_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|416184_417351_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|417449_417986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|418047_418380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|418637_419540_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|419609_420107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|420252_421656_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|421856_422585_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963630.1|422754_423612_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_048875864.1|423995_425021_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	451093	499232	3196457	transposase	Staphylococcus_phage(100.0%)	42	NA	NA
WP_036774259.1|451093_452068_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377364.1|452217_453054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|453173_454577_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242658.1|455919_457383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856768.1|457458_458253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242656.1|458544_459363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|459380_459974_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376894.1|460190_460424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242655.1|460647_461544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155050372.1|461839_462619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376891.1|462788_463691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|463687_464911_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_027242653.1|464928_465855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|465870_466911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242651.1|467025_467436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376888.1|467488_467992_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_017376887.1|467984_468731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376886.1|468733_469864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|469868_470108_+	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_027242650.1|472597_473086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|473088_474165_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_017376878.1|474157_474811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875870.1|474817_475243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|475279_478279_+	ATPase AAA	NA	NA	NA	NA	NA
WP_027242646.1|478340_479843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|480294_481914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|481955_484259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376870.1|484535_485432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|485434_488761_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_144420818.1|488962_489151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|489162_489639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|489681_489909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|490090_490624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|490654_490996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772347.1|490998_491415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876253.1|491576_492233_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036771639.1|492229_493204_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|493645_493909_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|494336_495311_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_087910671.1|495698_496163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910670.1|496256_496442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|498257_499232_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 6
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	504036	558719	3196457	transposase	Streptococcus_phage(22.22%)	52	NA	NA
WP_048875872.1|504036_505320_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|505492_505630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|505626_507030_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|507143_507581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|507701_508130_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|508377_508815_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|509246_510635_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|511081_512575_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|512769_513525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|514024_514255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|515359_516370_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|516366_516588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|517306_518248_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|518775_519174_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|519113_519968_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|520059_520341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|520426_521104_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|521149_522430_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|522605_523655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|523733_524534_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|524547_525342_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|525444_526464_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|526510_527122_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|527125_527812_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|527808_528351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|528643_529831_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|530075_530801_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|530986_531775_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|531771_532167_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|532559_533600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|533596_535000_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|537415_537673_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|537712_539098_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155050374.1|539415_540525_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.6e-49
WP_017377120.1|540558_541809_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|541809_542442_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|542731_543184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|543229_544072_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|544106_544598_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|544793_546761_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|546988_547393_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|547370_548399_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|548385_549174_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|549600_551004_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377110.1|551205_552216_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_075275363.1|552228_552696_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377107.1|553025_554396_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_017377106.1|554698_555169_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377105.1|555446_555722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|555732_557136_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069971661.1|557310_557748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|557744_558719_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 7
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	590510	723904	3196457	transposase,tRNA,plate	Staphylococcus_phage(13.64%)	110	NA	NA
WP_036772726.1|590510_591059_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|591811_593191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|593550_595014_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|595197_596010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|596474_598469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|598863_600243_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|600280_600718_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|600760_601477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|603023_603554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|603620_605441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|606005_606512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|606596_608000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|608114_608369_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|608521_608794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|609668_610244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377063.1|610240_610411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|611311_611554_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|611856_612948_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|612928_613882_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|614105_615590_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|615629_616133_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|616392_617568_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|617715_618120_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|618276_619152_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|619186_619540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|622869_623295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|623525_624662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|624648_625971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|625963_627082_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|627202_627736_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|627874_629512_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|629516_629738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|629846_630860_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|631131_633360_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_026063593.1|633340_634045_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|634279_634609_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|636009_636228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|636286_637162_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|637154_638021_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|638088_639408_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|639877_640438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|640756_641683_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|642578_643487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|647183_648023_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|648209_648425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|648473_649049_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|649045_649384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|649552_650542_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|651531_652434_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875883.1|652693_653230_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|653374_654292_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|654726_655737_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|656544_657081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|658293_658641_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|658785_659745_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|659846_660629_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|660761_661721_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|661745_662150_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|662178_662853_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|662952_664668_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|664664_665027_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|665041_666196_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|666199_667207_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|667209_668226_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|668441_669527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|669633_670026_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|670158_671442_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|671457_672759_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|672776_674579_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|674583_675576_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|675656_676733_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|676830_677805_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|677872_678844_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|679027_679297_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|679898_681185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|681249_681930_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376024.1|687585_687834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375775.1|687911_688106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275355.1|688153_689128_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_027242570.1|689341_690481_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|690689_692060_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|692438_693431_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|693434_693950_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|693946_694786_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|694818_696369_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|696476_696848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|698068_698230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|698810_700214_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|700248_700686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|700709_701684_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|701742_702171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|702358_703165_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|703239_703632_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|703676_704498_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|704510_705494_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|705495_706764_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|706770_709275_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|709405_710431_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|710427_711138_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|711062_711893_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|712042_712426_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|712460_713360_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|713405_714077_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|714159_714735_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|714833_715634_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|715775_716633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|717495_718632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|718698_721869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|721881_722592_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|722596_723904_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	732546	778861	3196457	transposase,plate	Staphylococcus_phage(21.43%)	52	NA	NA
WP_017376356.1|732546_732945_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|732941_734630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|734611_735568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|735610_736126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|736230_737163_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|737382_737769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|737786_738431_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|738581_739421_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|739496_740099_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|740099_740954_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|741311_741623_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|741647_743036_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|743191_743923_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|743919_744447_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|744478_745036_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|745041_746022_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|746161_746962_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|746965_747733_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|747729_748194_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|748216_748870_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|748873_749221_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|749254_749506_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|749582_750851_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|750853_751612_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|751673_752564_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|752614_753298_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|753307_753655_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155046683.1|753924_755658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556468.1|755744_756047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|756038_756911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|757078_758908_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|759075_759717_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|760041_760488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|760505_760679_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|760737_761787_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|761793_762744_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|762798_763743_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|763770_764508_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|764596_764839_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|764913_766137_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|766168_767017_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|767013_768066_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|768202_768823_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|769048_770201_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|771221_772196_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|772192_772363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|773331_773928_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|773896_775057_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|775567_775909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|776012_777047_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|777043_777754_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|777886_778861_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 9
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	787021	841332	3196457	protease,transposase,tRNA	Prochlorococcus_phage(33.33%)	49	NA	NA
WP_017377942.1|787021_787528_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_155048031.1|787609_787975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|788117_788978_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|789075_789621_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|789703_790555_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|790596_793503_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|793563_793761_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|793767_794778_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|794774_795833_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|795847_796627_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|796629_797442_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|797453_798401_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|798411_799704_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|799882_800986_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|800982_801375_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|801387_802764_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|802757_804227_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|804420_804855_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|805150_805327_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|806361_807387_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_155046573.1|807849_808281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|809673_810324_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|811022_811817_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|811996_812641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|812815_813790_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|814190_814448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|816125_816803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|817036_817861_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|817954_818668_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|818757_819849_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|819920_820502_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|820507_821134_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|821230_822178_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|822524_823187_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|823357_824017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|824185_825445_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|825441_826527_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|826519_827401_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|827389_828640_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|830025_830346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|830604_830871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|831361_831580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|832565_832787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|832783_833866_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|833876_834248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|834244_834424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|837127_837403_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|838238_839696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|840123_841332_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	885012	947553	3196457	transposase,tRNA	Staphylococcus_phage(28.57%)	53	NA	NA
WP_048875904.1|885012_885888_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|886144_886582_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|886642_887275_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|887290_887938_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|887940_890004_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|890330_891623_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|892011_894222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|894238_894895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|897280_898156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|898414_899026_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|899453_902042_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|902144_902906_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|902902_903439_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|903487_904444_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|904521_907707_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|907710_908766_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|908995_909598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|909641_910304_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|910338_910686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046576.1|911154_912099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|912648_914052_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|915170_915515_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|915606_916062_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|916310_916445_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|916437_917079_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|917075_917792_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|917795_919115_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155046577.1|919796_919958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773644.1|920919_923556_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_036773645.1|923597_924683_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|924682_925366_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_017377748.1|925426_927088_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377747.1|927240_927495_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|927573_927891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|928043_928442_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|928523_929162_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|929318_930293_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|930665_930941_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|931490_931775_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|933591_934185_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|935293_936175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|936286_937966_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|938092_939343_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|939418_939880_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|939876_941025_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|941030_941705_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|941701_942358_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|942483_942957_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|942958_943381_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|943367_944387_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|944546_944726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|944944_945226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|946677_947553_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	951455	1018418	3196457	protease,transposase,tRNA	Bacillus_phage(20.0%)	56	NA	NA
WP_048876012.1|951455_952859_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|953217_953985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|954098_955502_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|955498_955660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|955975_956950_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|957190_958474_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|958540_959464_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|961659_963804_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|963825_964032_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|964092_964713_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|964753_965647_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|965732_966458_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|966519_966924_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|967086_969195_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|969318_970368_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|970364_971831_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|971973_973311_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|973378_974869_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|975097_975469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|975619_976447_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|976749_977406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|977353_978277_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|978290_979214_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376987.1|979461_980145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|981844_982072_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376989.1|982396_982945_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|983025_983301_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|983300_984350_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|984462_986400_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|986547_988260_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|988328_989048_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|989044_989647_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|989761_990649_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|990839_991187_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|991237_992077_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|992172_992919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|993115_993742_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|994057_994627_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|994770_995469_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|996175_996799_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|996908_997802_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|997908_999519_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|999515_1000811_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|1000832_1002755_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|1002865_1003168_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|1003262_1008149_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1008196_1009519_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1009643_1010738_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1010789_1011728_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1011808_1012393_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1012777_1013668_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1013870_1014362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1014501_1014993_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1015161_1015875_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065653747.1|1015937_1017278_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1017542_1018418_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	1024031	1086558	3196457	transposase	Staphylococcus_phage(33.33%)	57	NA	NA
WP_017377787.1|1024031_1024259_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1024285_1025326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1025392_1025962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1026192_1026597_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1026609_1026750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1026844_1028044_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1028064_1028676_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1028877_1029639_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1029934_1030861_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1031021_1031978_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1032122_1032392_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1032658_1033633_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1033786_1034014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1034130_1034556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1034712_1035642_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1036088_1036619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046580.1|1037003_1037246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1037723_1038035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1038374_1039541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1041728_1042700_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1043302_1043476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1043871_1044789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1044789_1045641_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1046081_1047128_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1047117_1049109_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1049218_1049593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1049846_1050029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1050290_1050992_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420709.1|1050992_1051412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619460.1|1053065_1055849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1056084_1057377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1057863_1058769_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376296.1|1059546_1060263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1060548_1061310_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1061342_1062746_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1062742_1062907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1062966_1063254_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1063998_1064727_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1064695_1065442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420708.1|1065522_1065912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1065908_1066883_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1067039_1067357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772457.1|1069832_1070141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1070216_1070489_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1073022_1073460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1074061_1075249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1075519_1077154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1077204_1077933_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1079360_1080323_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1080546_1081542_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1081569_1082505_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1082548_1083010_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1082988_1083606_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1083635_1084610_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1084664_1085132_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1085144_1085789_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1085829_1086558_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 13
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	1095258	1144826	3196457	transposase	Acinetobacter_phage(22.22%)	39	NA	NA
WP_082300708.1|1095258_1095819_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1097143_1097539_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1097547_1097904_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1097896_1098772_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1098857_1099436_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1099393_1099687_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1100647_1102159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1102406_1103810_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1104015_1104450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1104532_1105237_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1105495_1105984_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1106012_1106687_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1106927_1107803_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275340.1|1108333_1108942_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1109212_1109671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1109949_1110339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1110524_1111340_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1111562_1112468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1112631_1113393_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1113396_1114263_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1114348_1114960_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1115338_1116586_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1116737_1117439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1117736_1117910_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1118399_1118900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1119978_1120206_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774233.1|1120258_1120492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1120520_1121201_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1121223_1123398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1123643_1124714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1124710_1126114_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619408.1|1126262_1126748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1126819_1127641_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1128307_1129807_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1130110_1132804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1132800_1136202_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_048875961.1|1137789_1139193_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1140271_1140943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1143851_1144826_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 14
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	1169549	1227522	3196457	transposase,tRNA	Staphylococcus_phage(37.5%)	53	NA	NA
WP_053093677.1|1169549_1170269_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1170496_1170673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1170921_1171245_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1171333_1173352_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1173374_1174328_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1174493_1175681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1176394_1177033_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1177330_1178326_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_036774189.1|1179086_1180094_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1180093_1180351_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375767.1|1181084_1182110_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1182176_1184207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1185513_1185741_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1187084_1187228_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1187224_1187917_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420703.1|1188177_1188501_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_027242770.1|1188643_1189054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1189210_1189537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1189683_1190721_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1190762_1191008_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_129556541.1|1191132_1191447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1191454_1193029_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1193183_1193753_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1194062_1195865_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1195861_1196803_+	signal peptidase I	NA	NA	NA	NA	NA
WP_036771308.1|1196830_1197052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242761.1|1197214_1197889_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1197894_1198794_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1198807_1199551_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1199553_1200285_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1200281_1200665_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1200802_1202050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1202460_1203606_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1203598_1203952_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1204232_1204775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1205419_1205608_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1205627_1206602_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1206645_1207521_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1207874_1208702_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1208801_1208963_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1209613_1210954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1212005_1212233_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|1212374_1213736_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1213831_1214491_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144420701.1|1215331_1215688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1216284_1217844_-	APC family permease	NA	NA	NA	NA	NA
WP_027243001.1|1218204_1220175_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375893.1|1220372_1221443_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1221500_1221707_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1221713_1223189_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1223324_1223888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1224057_1225461_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1226427_1227522_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	1243764	1291489	3196457	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_036772169.1|1243764_1244640_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1244709_1245813_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1245880_1246204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1246360_1247143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1247278_1248256_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1248329_1250321_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1250376_1250658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1250911_1252111_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_051929862.1|1254542_1255055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1255241_1256117_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1256153_1256318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1257526_1257940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1257950_1258286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1258430_1259549_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1259778_1260045_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1261327_1261555_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1261565_1262072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1262149_1262767_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1262898_1264131_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1264120_1264783_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1265057_1266314_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1266451_1267111_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1267185_1267887_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1268634_1269609_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1270817_1271171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1271384_1271579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1271646_1272159_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1272296_1273151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1273199_1273844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1273877_1274522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243125.1|1275044_1275338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1275436_1276219_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1276301_1277252_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1279294_1282135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1282157_1282739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1282858_1283587_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1283732_1284707_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1284822_1285728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1286326_1287073_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1287325_1287718_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1287755_1288403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1290118_1291489_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	1315308	1356518	3196457	transposase	Enterobacteria_phage(16.67%)	37	NA	NA
WP_048876023.1|1315308_1316412_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1316502_1317655_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1318068_1318920_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|1319057_1319207_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1319831_1322198_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1322245_1323442_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1324010_1326443_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1326764_1328264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1328372_1328945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1329259_1330729_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1330801_1331551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1331554_1332328_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1332426_1333377_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1333516_1334959_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1335174_1336359_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1336482_1337169_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1337304_1337889_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1337978_1338308_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1338643_1338883_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_155046686.1|1338976_1339123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1339897_1340191_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1340339_1340501_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1341015_1341555_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1341893_1342538_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1342871_1343522_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1344045_1345098_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1345115_1348196_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1348361_1348610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1348675_1349551_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1350473_1350980_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1350997_1351195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1351213_1351357_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1351424_1351598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1351802_1353116_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1353125_1353389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1353447_1354422_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1356290_1356518_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 17
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	1387735	1441468	3196457	transposase,tRNA	Bacillus_thuringiensis_phage(25.0%)	45	NA	NA
WP_036772026.1|1387735_1388611_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1388715_1392018_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1392014_1393838_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1393877_1394276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1394384_1395401_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1395835_1397290_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1397371_1400428_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_144420694.1|1400721_1400958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081329473.1|1401818_1402238_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376676.1|1402610_1403075_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1403147_1404149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1407041_1407374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1407735_1407879_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1407866_1408811_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080963606.1|1408814_1409201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1409022_1409361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1409735_1410335_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1410334_1410682_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1410832_1411816_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1412725_1413040_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1413188_1413347_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1413318_1414248_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1415162_1415579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1416707_1417424_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1418172_1418331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1418379_1418955_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1419099_1419378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1419442_1420318_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1420483_1424350_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376104.1|1425363_1426185_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1426384_1427617_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1427787_1428513_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1428555_1430094_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1430100_1431486_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1431799_1432849_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1433408_1433786_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|1433977_1434853_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1435834_1436062_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1436114_1436633_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_146619432.1|1436888_1437080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420793.1|1437488_1438262_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243181.1|1438375_1439347_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376772.1|1439328_1440300_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420687.1|1440735_1440921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1440931_1441468_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	1460403	1509822	3196457	transposase	Staphylococcus_phage(23.08%)	46	NA	NA
WP_051929845.1|1460403_1461228_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1461631_1462606_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1462791_1463385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1463565_1464030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1464424_1464706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1464702_1466106_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1466757_1467138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1467377_1468034_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1468178_1468475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1468534_1468822_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_027243051.1|1469105_1469315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772296.1|1470011_1470389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1470588_1471638_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1471614_1473432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1473702_1474281_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1474308_1474773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1474809_1476267_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1476328_1477816_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1478585_1479188_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1479749_1480220_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1481867_1482611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1482762_1483194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1485831_1487178_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1487265_1489071_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1489536_1490334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1490718_1491180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1491402_1492377_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1492419_1492542_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1492613_1494569_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1494958_1495144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1495465_1496455_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1496867_1498493_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1498601_1498916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1499211_1500597_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1500761_1500989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1501129_1501588_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1501788_1501974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1502042_1502870_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1503324_1503849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420684.1|1504031_1504280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1504449_1505403_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1505597_1506572_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1506699_1507725_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1508377_1508665_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1508724_1509057_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1509261_1509822_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
>prophage 19
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	1518543	1578114	3196457	integrase,protease,transposase,tRNA	Staphylococcus_phage(25.0%)	58	1507394:1507453	1577819:1578429
1507394:1507453	attL	CCACCACGTGTCACTGATAAGTGGACGTGCGTATTCCAATTTAAACTCTGGCCGAAAGTA	NA	NA	NA	NA
WP_017376809.1|1518543_1520313_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_017376808.1|1520451_1521495_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376807.1|1521508_1522252_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_027243093.1|1522364_1522682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1522743_1522923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243094.1|1522985_1523693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420791.1|1524476_1525688_+	protein kinase	NA	NA	NA	NA	NA
WP_017376801.1|1525743_1526568_-	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_017376798.1|1527755_1528391_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017376797.1|1528672_1529032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1529305_1531591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420683.1|1531579_1532236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|1532412_1533045_+	MarC family protein	NA	NA	NA	NA	NA
WP_027243097.1|1533080_1533266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243098.1|1533331_1534477_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243099.1|1534712_1536026_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_155046588.1|1537141_1537351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420682.1|1537885_1538047_-	phosphatase	NA	NA	NA	NA	NA
WP_017376785.1|1539453_1540359_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376784.1|1540599_1540785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242578.1|1540821_1541358_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_027242577.1|1541375_1542677_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_048876008.1|1542673_1543648_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_155046589.1|1543727_1543877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1544056_1544221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1544222_1545098_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1545413_1546334_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1546349_1546733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1547059_1548016_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_144420678.1|1548283_1548562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243017.1|1549060_1550404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|1550577_1550721_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1550800_1551775_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1551922_1553794_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1553826_1553925_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1554160_1554790_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1554773_1555196_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1555202_1556942_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1556942_1558007_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1558010_1558364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1558476_1559445_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1559454_1559766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1559781_1560351_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1560614_1561943_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1561983_1562958_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1563544_1563946_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146619459.1|1564465_1566922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1567124_1567976_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1568021_1569728_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1571199_1572174_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1572536_1572782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1573145_1574174_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1574304_1574508_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420676.1|1574792_1575749_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_047927838.1|1576041_1576287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1576283_1576583_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1576805_1577276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1577886_1578114_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
1577819:1578429	attR	TACTTTCGGCCAGAGTTTAAATTGGAATACGCACGTCCACTTATCAGTGACACGTGGTGGTGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGATAGGTTAGCATTGGCTGTATGCAACCGATCATGATTGTAATATCGAATATAGGCCTCAACATCCTCCTTCATAGTATCACGGGTTAAGTGAATCACATTCAACAGCCATTCGTGCTTTAGGCTGCCAAAAAAACGCTCGACAACCGCATTGTCAACGCAAGCACCGACACTGCTCATAGAAGCGGTGATTTTATGCTTCTTCAACAGTTTTCGATATTTTTTACTGGTATACTGCGAACCACGATCACTGTGAAATAACAAGTGTTCTGTCGGCTGCCGCAAGTGAATCGCCATATCCATTGCACGACAAACTAGATTTTCGCTCATTCTCTTATTCATCGCCCAGCCAATCACTTTTCGAGAGTATAAATCAATAACGACCGCAAGATACAACCAGCCTTCAGCAGTTCTAAGGTAGGTAATGTCACCTGCCCATGAGTGATTTGCAATGACTGGATTAAACTGCTGATTCAATACGTTATCTGCAACAGC	NA	NA	NA	NA
>prophage 20
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	1583566	1626497	3196457	transposase	Staphylococcus_phage(20.0%)	41	NA	NA
WP_053856766.1|1583566_1584970_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1585157_1586015_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1586139_1586775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1586823_1587075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1587330_1588230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1588366_1589440_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1589540_1589954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1589974_1590688_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1590875_1592288_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1592497_1593466_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1594199_1594568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1594571_1594889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1594964_1595939_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1596458_1596959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1597029_1598358_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1598493_1599882_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1600029_1601340_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1601680_1602964_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1603037_1603658_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1603856_1604117_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1604319_1604466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1604441_1605035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1606898_1607117_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1608369_1609140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1609226_1609442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1609538_1610660_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1610926_1611901_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1612163_1613285_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1613577_1613865_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1613837_1614341_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1614421_1615081_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1615422_1616340_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1616469_1616643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1617308_1618667_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_144420789.1|1618858_1619305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376485.1|1619499_1620729_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1620774_1621401_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1621550_1622738_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1622746_1623439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1623560_1624713_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1625513_1626497_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 21
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	1684832	1775147	3196457	protease,transposase,tRNA	Burkholderia_phage(14.29%)	82	NA	NA
WP_036774017.1|1684832_1685708_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1686097_1686436_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1686432_1687029_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1687031_1689026_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1689089_1690028_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1690376_1691351_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1691554_1691752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1691913_1692318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1693901_1694342_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1694668_1695544_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1695556_1695799_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1696205_1696460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1697671_1698637_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1698729_1699041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1699241_1700018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1700847_1701039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1701767_1702817_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1702987_1703761_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1703821_1705411_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1705601_1706693_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1706715_1707033_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1707119_1708397_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1708418_1709255_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1709261_1710896_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1711327_1711687_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1711968_1713327_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1713352_1713595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1714088_1714268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1714523_1715780_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1715893_1716151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1716295_1717306_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1717682_1718537_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1718566_1719400_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036773204.1|1719976_1720750_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1720831_1721152_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1721370_1722276_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1722361_1722760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1722904_1723402_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047927093.1|1725062_1726166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1726264_1726642_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1726721_1727696_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1729240_1729960_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1730043_1730331_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1730615_1731488_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1731444_1732221_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1732425_1732761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1733159_1733516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1733677_1733953_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1734062_1734410_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1734427_1735207_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1735206_1735716_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1735751_1736000_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1736311_1736647_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1736946_1738197_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1738278_1740306_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1740851_1741070_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1741241_1741604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1741752_1743156_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1743437_1744613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1744630_1746628_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1746608_1747589_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1747644_1748487_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_036772544.1|1748486_1748903_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1748883_1749303_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1749325_1749955_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1750523_1752713_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1752724_1753930_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1753914_1755762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1755746_1756985_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1756971_1758840_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1758873_1760127_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1760132_1760990_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1761008_1761737_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1762875_1763667_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1764032_1764320_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|1766442_1766832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1767008_1767767_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1767763_1770163_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1770176_1771454_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1771543_1772842_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1773039_1773933_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1773932_1775147_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 22
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	1785846	1836331	3196457	transposase,tRNA	Vibrio_phage(14.29%)	46	NA	NA
WP_069971651.1|1785846_1786722_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1787094_1787358_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1787664_1790259_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1790255_1790738_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1790715_1791756_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1791930_1792416_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1792523_1795094_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1795127_1795589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1795925_1796801_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1797078_1798839_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1798932_1799598_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1799610_1801116_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1801137_1801668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1801741_1803004_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1803190_1804063_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1804164_1804953_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1805045_1806371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1806724_1807900_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1808068_1808722_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1808877_1810818_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1810814_1811438_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1811602_1812577_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1812848_1813469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1813465_1814869_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1814936_1815353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1815760_1816258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1816254_1817229_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|1817308_1817878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1818022_1818559_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1818563_1818860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1818868_1819474_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1819659_1820058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1820248_1820452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1820596_1820752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1820876_1821329_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1821445_1822918_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1823356_1823821_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1824509_1825760_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1825869_1826340_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1826362_1826956_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1827093_1828143_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1828166_1829090_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1829106_1829568_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1829675_1830494_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1831103_1831247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1835410_1836331_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 23
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	1898564	1913880	3196457	transposase	Staphylococcus_phage(50.0%)	15	NA	NA
WP_017378288.1|1898564_1898786_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1898844_1899819_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1900017_1900182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1900178_1900814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046602.1|1901090_1901870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1901902_1902664_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1902640_1903630_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1903765_1904641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1904659_1905319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1905560_1906007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1906003_1907407_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1907520_1908366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1908510_1910160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1910250_1911036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|1912476_1913880_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	1942553	1991425	3196457	transposase,tRNA	uncultured_Mediterranean_phage(33.33%)	43	NA	NA
WP_144420657.1|1942553_1943615_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1944326_1944488_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1945404_1945944_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1946326_1946743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1946838_1947654_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1947786_1949280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1949465_1949891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1949887_1951948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1952231_1953047_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1953147_1953966_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1953962_1954331_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1954512_1955340_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1955403_1956132_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1956534_1957263_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1957652_1958378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1958412_1962285_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1962485_1963619_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1963632_1963821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1964044_1965403_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_036773947.1|1967009_1967885_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1968396_1969032_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999981.1|1969044_1969518_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_155046603.1|1969445_1969598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929627.1|1969791_1970142_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1970201_1970489_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1970541_1971321_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376415.1|1971745_1972663_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1972714_1973470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1973537_1974812_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376412.1|1974932_1975610_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376411.1|1975810_1977235_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_016209938.1|1977209_1977848_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376410.1|1978210_1978489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376409.1|1978722_1979667_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376408.1|1979688_1981557_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376407.1|1981577_1981931_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_026063528.1|1981969_1983085_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1983269_1984310_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_027242800.1|1984312_1985347_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376402.1|1985343_1986405_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_017376401.1|1986516_1987989_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376400.1|1988141_1988585_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376399.1|1988653_1991425_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
>prophage 25
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	1995856	2044723	3196457	transposase	Staphylococcus_phage(25.0%)	45	NA	NA
WP_036773116.1|1995856_1996831_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|1997354_2000081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|2000968_2001943_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|2002193_2002898_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|2004137_2004656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|2005623_2007108_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2007232_2008768_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2008790_2009120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2009016_2009232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2011215_2012415_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2012624_2013485_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2013600_2014179_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2014335_2014977_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2015015_2015237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2015229_2016213_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2016606_2017104_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2017248_2017524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2017675_2019358_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2019365_2020388_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2020556_2021558_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2021671_2022010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2022485_2023745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2023953_2024181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2024209_2024428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2024565_2024931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2024998_2025241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2025255_2025591_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2025595_2026033_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_036772812.1|2026058_2027444_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2027554_2027986_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2028091_2029603_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2029893_2031486_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2031686_2033882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772819.1|2033975_2035409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2035451_2035967_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2035966_2036914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2036897_2037563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2037559_2038288_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2038277_2039024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2039007_2040072_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2040276_2041464_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2041520_2042639_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2043086_2043344_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2043623_2044301_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2044519_2044723_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	2064423	2113958	3196457	protease,transposase,tRNA	Burkholderia_virus(20.0%)	41	NA	NA
WP_017377787.1|2064423_2064651_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2064740_2065496_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2065909_2066506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2066585_2069390_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2069370_2070324_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2070316_2071687_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2071857_2073261_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2074032_2074359_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420651.1|2074563_2075217_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_017376600.1|2075536_2075716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2075971_2077228_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2077466_2077613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2077695_2078052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2078547_2078907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2078916_2079300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2080188_2080329_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2080473_2081394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2083551_2084082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2084092_2085148_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2085163_2087203_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2087189_2088020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2088086_2091626_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2091739_2092459_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2092697_2093327_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2093446_2094850_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2094995_2096939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2097456_2098317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2098752_2100498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771696.1|2100912_2102373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2102555_2103155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2103292_2103490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2103690_2103831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2103898_2104678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2105242_2105644_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2105788_2106166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2106625_2107933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2108681_2108939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2108990_2110394_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2110634_2112344_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2112513_2112876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|2112983_2113958_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 27
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	2128527	2188080	3196457	protease,transposase,tRNA	unidentified_phage(14.29%)	60	NA	NA
WP_017377892.1|2128527_2129949_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_026063687.1|2130038_2131637_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377894.1|2131793_2132420_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027242839.1|2132500_2135173_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377896.1|2135655_2136612_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_017377897.1|2136664_2137084_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_048875958.1|2137110_2137974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377899.1|2137963_2138755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2139059_2140031_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2140379_2140688_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2140684_2141341_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2141474_2141960_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2142037_2142559_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2142604_2143498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2143494_2144316_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2144510_2144660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2144887_2145718_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046606.1|2147123_2147294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2147446_2148850_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_144420645.1|2148959_2150216_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2150187_2150919_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2150930_2152208_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2152307_2152682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2152766_2153654_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2153711_2154440_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2154436_2155546_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2155697_2156126_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2156220_2156577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2156569_2157781_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2157777_2158566_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2158728_2159523_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2159972_2160713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2160716_2163215_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2163477_2164434_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2164417_2165179_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2165386_2166361_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2166469_2167225_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2167349_2167595_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2167654_2169928_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2169982_2170285_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2170525_2170819_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2170989_2171169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2171244_2171856_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2172102_2173419_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2173429_2173798_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2173828_2174491_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2174913_2175492_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2175471_2175879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2176002_2176299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2176345_2177221_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876123.1|2177290_2179471_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_017376060.1|2179574_2180924_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_036772012.1|2180997_2181687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2181819_2183007_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376055.1|2183525_2184170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2184166_2185480_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2185684_2185858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2186127_2186601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2186745_2186940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2187204_2188080_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	2207142	2255365	3196457	transposase,tRNA	Staphylococcus_phage(16.67%)	41	NA	NA
WP_036771639.1|2207142_2208117_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875951.1|2208160_2208997_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2209142_2209562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2209838_2210519_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2210484_2210835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2210867_2212079_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2212419_2213049_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2213097_2214114_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2214360_2214576_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2214628_2215078_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2215157_2216903_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2216994_2218866_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2219310_2220027_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2221464_2222334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2222290_2222518_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2223486_2224401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2224446_2225469_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2225537_2226587_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046607.1|2227203_2227386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243219.1|2227670_2227979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2228145_2229549_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046608.1|2229641_2229806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2230127_2230352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2230362_2231574_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036774710.1|2231968_2232868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|2233041_2233443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2233689_2234733_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2234852_2235089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2235877_2237431_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2239611_2239839_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2240709_2241684_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017375736.1|2242410_2243493_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_017375735.1|2243535_2244186_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375734.1|2244408_2244780_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_027243178.1|2244890_2246252_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155046609.1|2247972_2248179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2248489_2249572_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2249568_2249880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2250925_2251900_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2252906_2253686_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2254147_2255365_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	2268214	2329182	3196457	integrase,transposase	Staphylococcus_phage(30.0%)	47	2276067:2276126	2326488:2327248
WP_144420638.1|2268214_2269297_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2269293_2269605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2271102_2272038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2272630_2273776_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2276018_2277182_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2276067:2276126	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|2277210_2277435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2278782_2279958_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2280303_2282814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2282872_2283685_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377669.1|2284125_2284830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2284879_2285854_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2285958_2287290_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2287488_2287557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2287688_2289131_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2289522_2290935_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2291624_2292071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2292665_2293514_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2293767_2294826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2294817_2296524_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2296595_2298329_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2298625_2299192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2299316_2299970_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2299996_2301457_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2301553_2302531_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2303000_2304404_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2304929_2305223_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2305449_2306214_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2306421_2306649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2306712_2306895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2307457_2307637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376902.1|2307700_2308012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2308866_2309571_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2309768_2309909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2310313_2310838_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|2310984_2312241_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2312308_2312788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2313228_2314632_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420632.1|2315046_2317362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2317934_2319827_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2319998_2320973_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2321276_2322083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2322151_2322763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2324244_2324541_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2324537_2325380_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2325770_2326556_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2326560_2327964_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2326488:2327248	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2328237_2329182_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	2350024	2377677	3196457	protease,transposase	Staphylococcus_phage(25.0%)	28	NA	NA
WP_017377305.1|2350024_2351326_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2351407_2352013_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2352125_2353430_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2354030_2354906_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2355021_2355693_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2355872_2357228_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2357348_2358086_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2358164_2358881_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2359529_2360804_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2360834_2361410_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2361454_2362420_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2362883_2363792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|2364179_2364431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2364575_2365004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2364989_2365934_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2366138_2366291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2366319_2367054_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2367148_2367409_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2367627_2368593_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|2368569_2368866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2369056_2369506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2369765_2370194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2370289_2370790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2370726_2370888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2371768_2371990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2373488_2374166_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2375480_2375819_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2376702_2377677_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 31
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	2416724	2488664	3196457	transposase,tRNA	Staphylococcus_phage(37.5%)	54	NA	NA
WP_080999971.1|2416724_2418128_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2418241_2418817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2420062_2420290_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2420579_2421119_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2421428_2422916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2422967_2423393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2423611_2425015_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2425011_2425389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2425348_2425894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2426289_2427516_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2428116_2429769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2429705_2429900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963645.1|2430232_2431423_-	MFS transporter	NA	NA	NA	NA	NA
WP_027243147.1|2431671_2434344_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2434632_2435469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2436129_2437020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2437488_2438463_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876012.1|2438947_2440351_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2440496_2441900_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|2441984_2443799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2445710_2447114_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2447147_2448677_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2448712_2450173_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_027242908.1|2450147_2451107_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376200.1|2451184_2454691_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_017376201.1|2454714_2455284_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_027242907.1|2455497_2456652_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376204.1|2456670_2457444_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|2457443_2457890_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376206.1|2457907_2458957_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_017376207.1|2459067_2459601_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_036771893.1|2459681_2462099_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_027242906.1|2462383_2463451_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_017376209.1|2465653_2466718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376210.1|2466707_2467736_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376211.1|2467732_2468272_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376212.1|2468808_2470719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420623.1|2470766_2470964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420622.1|2471163_2472741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|2472837_2473713_-	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_080963646.1|2473801_2474701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063514.1|2474615_2475362_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_017376216.1|2475369_2475927_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_017376217.1|2475930_2476668_-	UMP kinase	NA	NA	NA	NA	NA
WP_017376218.1|2476671_2477550_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376219.1|2477714_2478482_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376220.1|2478888_2479698_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376221.1|2479775_2482433_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|2482436_2483474_+	asparaginase	NA	NA	NA	NA	NA
WP_017376223.1|2483475_2484297_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376224.1|2484427_2485312_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_036773116.1|2485624_2486599_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2486651_2487647_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2487689_2488664_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 32
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	2499396	2544188	3196457	transposase,tRNA	Burkholderia_virus(33.33%)	44	NA	NA
WP_017376309.1|2499396_2499684_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2499804_2501265_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2501344_2502781_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2502905_2503880_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2506070_2506832_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2507989_2508217_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2509170_2509383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2509400_2509718_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2509744_2510434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2510774_2510978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2511109_2512045_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2512057_2512840_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2512969_2513281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2513624_2513951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2513975_2514431_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2514420_2515473_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2515475_2516939_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2517073_2517301_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2518717_2519182_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2519438_2520254_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2520382_2522695_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2522811_2523339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2524030_2525308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2525318_2525570_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2525603_2526125_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2526294_2527281_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2527371_2528187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2528615_2529011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2528983_2529211_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_047927746.1|2530179_2530767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2531369_2532041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875918.1|2532185_2532767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420767.1|2532809_2533487_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243185.1|2533765_2534722_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_017377736.1|2534781_2535447_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017377737.1|2535480_2536026_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_155046615.1|2536305_2536467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774946.1|2537163_2537778_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_144420620.1|2537704_2538907_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875923.1|2538892_2539888_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2539891_2540296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2541263_2541491_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2542459_2543056_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046616.1|2543024_2544188_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
>prophage 33
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	2553909	2605323	3196457	transposase,tRNA	Bacillus_phage(20.0%)	55	NA	NA
WP_048876031.1|2553909_2555313_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|2555418_2555643_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2555825_2556647_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|2556792_2557047_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377841.1|2557435_2559220_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|2559308_2560028_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2560189_2560396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2560395_2560632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2560644_2560998_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2561535_2562369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2562461_2562659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2562756_2564142_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2564268_2564859_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2565890_2566178_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2566237_2566402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2566398_2567769_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2568135_2569548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2569617_2570388_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2570880_2571168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2572644_2572938_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2572895_2573717_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2573861_2574086_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155046618.1|2574340_2574868_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|2575044_2575305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2575223_2575379_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2575477_2576452_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2577780_2577930_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2578046_2578340_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2579148_2579724_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2579801_2580677_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2580741_2581362_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2581346_2582429_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2582662_2583067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2584557_2585859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2586005_2586674_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2587606_2588170_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2588226_2589423_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_017376587.1|2589547_2590912_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376586.1|2590908_2592000_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376585.1|2592254_2592905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2593097_2593292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2593399_2593552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376583.1|2593818_2594946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063543.1|2595035_2595869_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376581.1|2595872_2596523_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_017376580.1|2596512_2597352_-	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_016210074.1|2597357_2597984_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376579.1|2598144_2598687_+	septation protein A	NA	NA	NA	NA	NA
WP_017376578.1|2598770_2599073_+	YciI family protein	NA	NA	NA	NA	NA
WP_144420763.1|2599090_2599333_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376576.1|2599431_2599704_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376575.1|2599742_2600381_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376574.1|2600413_2601505_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376573.1|2601676_2603419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2604348_2605323_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 34
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	2614617	2733078	3196457	transposase,tRNA	Staphylococcus_phage(29.63%)	108	NA	NA
WP_080999966.1|2614617_2615967_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2616264_2616822_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2616915_2617422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2617926_2618622_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|2618752_2619541_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2619574_2620978_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2621401_2622376_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2622632_2622860_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2623947_2624478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2624474_2626007_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2626003_2626954_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2627374_2628007_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2628249_2628447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2628796_2629225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2629302_2630298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2630442_2630694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2630798_2631443_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2631678_2632176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2632687_2633662_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2634032_2634326_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2635138_2635474_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2635794_2637333_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2637485_2638584_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2638822_2640022_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2640052_2640679_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2640707_2641592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2641725_2641956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2642093_2643335_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_144420613.1|2643614_2643986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2646117_2646279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2646654_2647782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2647898_2648561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2648646_2648907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2649325_2650087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2652148_2652808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2652908_2653559_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2653706_2654396_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377795.1|2654418_2655582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2655786_2656038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619442.1|2656561_2657224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2657357_2658332_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376009.1|2659686_2659977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376008.1|2660299_2661337_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376007.1|2661367_2662822_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376006.1|2662831_2664016_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376005.1|2664089_2665097_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376004.1|2665165_2667169_-	transketolase	NA	NA	NA	NA	NA
WP_017376003.1|2667620_2668781_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376001.1|2669017_2670133_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376000.1|2670295_2670820_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017375999.1|2670819_2671350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2673009_2673885_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2674005_2674506_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2674502_2674769_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2674934_2675909_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2676088_2676709_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2677015_2678419_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771922.1|2679253_2680444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|2681010_2681478_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|2681979_2682234_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|2682435_2682939_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|2683155_2683761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2683921_2684605_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2684680_2685460_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|2685446_2686307_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|2686430_2686796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377271.1|2687181_2687511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2687921_2688896_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377273.1|2689430_2689670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420610.1|2689663_2691043_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	3.3e-36
WP_017377275.1|2692077_2692800_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2692791_2693160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2693422_2694724_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2694819_2695263_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2695266_2695776_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2695768_2698582_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2699078_2700011_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2700115_2701042_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2701220_2702759_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2702932_2703193_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2704467_2705076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2705122_2705851_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2706097_2706235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619438.1|2707385_2707937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2708171_2709083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2709342_2709639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2709983_2711137_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2711733_2712282_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2712385_2712949_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2713166_2713925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2715200_2715428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2715650_2715830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2716085_2717342_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2717409_2718054_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_017378393.1|2718858_2719065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378392.1|2719335_2719488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816949.1|2720065_2720464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378390.1|2720657_2722235_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378389.1|2722368_2723310_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378388.1|2723311_2724085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963621.1|2725693_2725900_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2726166_2726454_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378384.1|2726459_2728841_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|2728853_2729849_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_016210495.1|2729980_2730340_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378382.1|2730382_2730577_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|2730611_2731142_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378381.1|2731146_2733078_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
>prophage 35
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	2770856	2823885	3196457	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2770856_2771831_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2771987_2773562_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2773786_2774065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2774134_2775010_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2775019_2776180_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2776294_2777443_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2777453_2780255_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2780361_2781060_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2781072_2782836_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2782839_2783187_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2783180_2783555_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2784502_2785786_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2786195_2787491_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2787846_2788392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046622.1|2788985_2789501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2789512_2790892_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2791127_2791562_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2791558_2792911_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2792910_2794026_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2794026_2795043_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2795032_2796703_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2796722_2797058_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2797085_2798525_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2798521_2799568_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2799710_2801207_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2801502_2802504_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2802609_2803221_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2803341_2803719_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2803769_2805176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2805169_2806237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2806343_2807945_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2808193_2809111_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2809179_2810874_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2811108_2812038_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2812068_2813472_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2813702_2814407_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2814473_2815130_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2815140_2816022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2816192_2818862_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2819222_2820197_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2820276_2821248_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2821301_2822276_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2822395_2822617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2822680_2822989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2822913_2823885_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	2838451	2892712	3196457	transposase	Staphylococcus_phage(37.5%)	51	NA	NA
WP_026063658.1|2838451_2839180_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2839489_2839744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2840457_2843112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2843150_2843441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2843557_2844856_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2845426_2845915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2845895_2846198_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2846444_2846933_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2846966_2847605_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2847726_2848266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2848355_2849582_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2850194_2850452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2850538_2851438_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2851582_2851849_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2851840_2851990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2852217_2853093_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2853222_2853450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2853516_2853711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2853769_2854744_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2854781_2854970_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2854970_2856743_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2856732_2857725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2858332_2859025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2859511_2860081_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2860077_2861052_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2861091_2861595_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2861685_2863089_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2863787_2863973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2864078_2865482_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046624.1|2865528_2866059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2866092_2867520_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|2868805_2871175_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2871250_2872069_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2872420_2872966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2873448_2874687_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2874663_2875638_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017375625.1|2875730_2875958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|2875962_2876454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243039.1|2877126_2878014_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_027243038.1|2878103_2879594_-	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_017376549.1|2879617_2880499_-	ROK family protein	NA	NA	NA	NA	NA
WP_017376548.1|2880495_2881218_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376547.1|2881917_2882709_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|2882895_2883141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420598.1|2883292_2883523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376543.1|2883552_2884332_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_047927468.1|2884357_2884663_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_144420752.1|2884659_2885553_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_027243035.1|2885908_2887207_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376538.1|2889809_2890991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2891284_2892712_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	2900298	2949879	3196457	transposase,tRNA	Bodo_saltans_virus(14.29%)	44	NA	NA
WP_062312049.1|2900298_2901666_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2902158_2902638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2902817_2904881_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2904889_2905615_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2906242_2906956_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2906960_2907491_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2907725_2907959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2908071_2908320_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2909127_2911320_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2911337_2911646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2912299_2914009_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2914202_2914358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2915760_2916636_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2916961_2917723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2917947_2918679_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2918675_2919212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2919265_2920030_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2920032_2921610_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2921616_2922093_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2922068_2922500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2922532_2923288_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2923462_2923750_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2924132_2924357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2924696_2925860_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2925894_2926872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2926865_2927552_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2927490_2928606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2928885_2929491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2929728_2930208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2932030_2932684_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2932796_2933348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2933447_2934422_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2934707_2935232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155050383.1|2935914_2936754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2937009_2937366_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2937362_2938766_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2938885_2939446_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2939603_2940170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075278726.1|2940372_2942607_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_027243087.1|2942870_2943566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2943606_2943819_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2945391_2946501_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2946556_2948038_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2948475_2949879_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 38
NZ_CP039060	Piscirickettsia salmonis strain Psal-099 chromosome, complete genome	3196457	3077561	3143098	3196457	protease,transposase	Hokovirus(14.29%)	57	NA	NA
WP_017376170.1|3077561_3078662_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3079019_3079994_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3080130_3081009_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3081016_3081247_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3081300_3082305_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3082811_3083639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3083720_3085109_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3085396_3086797_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3086891_3087818_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3087814_3088951_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3088947_3089955_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3089951_3091115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3091124_3091976_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3092007_3093180_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3093176_3094565_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3094593_3095001_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3095020_3096028_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3096024_3096897_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3096893_3097754_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3097755_3100026_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3100027_3101173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3101219_3101705_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3101744_3102368_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3108047_3108800_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155046626.1|3109402_3109570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243062.1|3110131_3110755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3110859_3111648_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3111647_3112379_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3112412_3114140_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3114153_3115215_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3115529_3116744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3116876_3117401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3118018_3118867_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3118853_3119552_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3119606_3120368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3120360_3120783_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3120912_3121464_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3121519_3122482_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3122482_3122698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3122884_3123694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3123673_3124516_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3124512_3125757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3125895_3126984_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3127001_3127502_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3127689_3128289_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3128294_3129458_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3129490_3130444_+	glutathione synthase	NA	NA	NA	NA	NA
WP_017376261.1|3130807_3131872_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3131868_3134931_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3135083_3135536_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3135567_3135924_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3136342_3137116_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243067.1|3137675_3137858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376269.1|3139739_3140030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3140254_3141130_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3141126_3141684_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3141694_3143098_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039061	Piscirickettsia salmonis strain Psal-099 plasmid unnamed1, complete sequence	175441	0	131711	175441	transposase,portal,terminase,integrase	Streptococcus_phage(41.82%)	126	8795:8854	98041:99157
WP_017377655.1|1412_1658_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|1654_2041_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|2128_2857_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|2835_3456_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|3801_4488_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|5437_5800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|5802_7542_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|7943_8096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|8123_8807_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
8795:8854	attL	GGCTTTGTTGCATAGCTCAAAAAGTGATCAATTCTGGAGGTTTGCCTACCCTGCTGCTAC	NA	NA	NA	NA
WP_036771347.1|8888_9866_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|9941_10112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|10152_10881_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_036771293.1|11426_11693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420835.1|11988_13902_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|14308_15037_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_080999960.1|15104_15257_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|15673_15838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|15858_17145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|17327_18056_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|18183_19161_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155050392.1|19190_19484_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_017377526.1|19885_20746_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243210.1|21075_21810_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.9e-36
WP_047927763.1|22223_22487_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036816769.1|22483_22882_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_036815609.1|23125_23581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619477.1|25445_25739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377667.1|25883_26054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420839.1|26723_27650_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375910.1|27845_28574_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|29722_30343_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|30398_31127_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|31977_32250_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|32252_32981_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420837.1|33010_33943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377509.1|34084_34813_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_036773695.1|34842_36915_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_016212398.1|38975_39437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876221.1|39531_39987_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
WP_048875857.1|40974_41949_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_081000017.1|42349_42601_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_080999971.1|42865_44269_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243203.1|48319_49114_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
WP_017375836.1|49207_49411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|49605_49941_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_048876182.1|50640_52536_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771296.1|52891_54787_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771293.1|55082_55349_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|55888_56863_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027243200.1|57169_57574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|57574_58321_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_036774644.1|58829_59891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963627.1|60870_61089_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036772541.1|61107_61836_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_087910667.1|61987_62671_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_027243197.1|62675_63245_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_036772541.1|63415_64144_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_036815648.1|64627_65356_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420834.1|65408_65804_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036772541.1|66097_66826_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929623.1|66983_70325_-	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_155046639.1|70424_70628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|70793_71522_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243202.1|71796_72732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876188.1|73445_74219_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_036774373.1|74392_75121_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_155046638.1|75394_75859_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774316.1|75855_76155_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774378.1|76197_76767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420833.1|76971_77163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|77176_78217_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242592.1|78283_78613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774388.1|78636_79599_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017377694.1|80976_81705_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|81951_82101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|82112_82841_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_081000015.1|82870_83257_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876191.1|83192_83621_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_082300723.1|85172_85400_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_155046637.1|86132_86624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|86705_87434_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_146619416.1|87777_87924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243206.1|88229_90095_+	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_080963664.1|90167_90434_-|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_080963665.1|90614_90956_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_048876194.1|91136_91670_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_036774350.1|92909_93638_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_027243215.1|94120_95143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876196.1|96956_98105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|98134_99112_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_047927782.1|99027_99417_-	hypothetical protein	NA	NA	NA	NA	NA
98041:99157	attR	GGCTTTGTTGCATAGCTCAAAAAGTGATCAATTCTGGAGGTTTGCCTACCCTGCTGCTACATTAACATCAAACTAATAGTTGTGATGAGTTGCAGTGCCATATAAATATCCAAAAGGAAAAGGGTGGGATATCCCTAAACAAAAATATGGCGTTACAAACTGGGCAAAGTACACCGATAGCCTGCGTAATCGTGGCCGTATTGATGTTTGGATTTCAGAGAAAGCCATTGAAGGTTGGTACAAAAAAGACCGAGTTTATGATGGTACAGGCACGCCGTTTCTATACTCAGACCTGGCGATCATCACCTGTCATGAAATTCGTAAAGTGTTTAAACAGCCATTACGCCAGACTCAGGGCCTAATTGATTCCTTCTTTGAATCCCAAGGACTGCCGATCAAATGCCCTGACTATACGGTGTTATCAAAAAGGTTAGCGGAGCTCGATATTAAGGTCCCACGCTATCGCAAAACAGATAAGCCAGATGATGATATTGCGGGAATAGCCATTGATTCTACAGGCCTTAAGCGTTTTGGCCGTGACGAGTGGCACCAAGAAAAATACAAGATATCAGCAAAGCGCAGCTGGCGTAAACTTCATGTGGCCGTTGATGATGATCACTATATTCAAGCCGCACTCATCACCGATCGCTATGAAGCAGATGAGGAGGTTGTGGATGAGCTACTGGAGCAAATTGATGAGCCGTTTGATCGCTTCACTGCAGACGGAGCCTACGATAGCCATGATGTTTACGATTCCGTTTTAAACCACTCACCTAATGCTGATGTTGTTATCCCTCCTCCTAAAAATGCCGTATTTGATGAAAATAACCACGCGATTAGAAACATAAATTTTAATGAGATTAAAGATCATGGTAGAATGCACTGGCAAAAGACACGACAATACGGCAAGCGTAATTATTCTGAGTTGGCGATTCAGCGTTACAAACGCATTTTGGGCAACACGATGCAGTCCAGAGAGATATCGCGTCAGAAAAATGAAGGACTAATTGGCGCGGGTATTTTAAATAAGATGACCAGTCTCGGCATGCCGGATAGTTTTAGACGCAGCTGAATTGTGCCTGGAATATGGGACCAGAGGTTACGCAACAACGCCCCT	NA	NA	NA	NA
WP_075317322.1|100212_101727_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|101713_102691_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|102848_103061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|104061_105039_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_027243212.1|105533_105821_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_027243211.1|105810_106065_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_155046636.1|106282_106444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|106458_107436_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_026063496.1|108045_108411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242932.1|108543_108771_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242931.1|108779_109187_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242930.1|109332_110715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375952.1|110904_111108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242929.1|111303_111687_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|111773_112256_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|112258_113590_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_155046635.1|113698_114229_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.6e-26
WP_087910668.1|114315_114702_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|114739_115474_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|115520_116234_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_144420848.1|117612_117798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243190.1|117801_121146_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017377509.1|121326_122055_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|122148_123123_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|123436_123799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|123838_124348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|124579_125560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|126025_127003_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155050394.1|127021_127303_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_146619517.1|127332_127485_+	phosphatase	NA	NA	NA	NA	NA
WP_017375959.1|127622_127856_-	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_017375960.1|128157_129201_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_036817201.1|129308_129716_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_036817204.1|130019_131015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|131285_131711_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
>prophage 2
NZ_CP039061	Piscirickettsia salmonis strain Psal-099 plasmid unnamed1, complete sequence	175441	139110	139839	175441	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_036771279.1|139110_139839_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
>prophage 3
NZ_CP039061	Piscirickettsia salmonis strain Psal-099 plasmid unnamed1, complete sequence	175441	145496	149457	175441	transposase	Staphylococcus_phage(50.0%)	3	NA	NA
WP_048876208.1|145496_146324_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_048876229.1|147188_148160_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|148728_149457_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 4
NZ_CP039061	Piscirickettsia salmonis strain Psal-099 plasmid unnamed1, complete sequence	175441	153425	160556	175441	transposase	Streptococcus_phage(50.0%)	7	NA	NA
WP_036771347.1|153425_154403_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155050395.1|154417_155023_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_075275471.1|155563_156538_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_155046640.1|157173_157341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876214.1|157309_158038_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_017377521.1|158546_158900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|159827_160556_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 5
NZ_CP039061	Piscirickettsia salmonis strain Psal-099 plasmid unnamed1, complete sequence	175441	166920	172823	175441	transposase	Staphylococcus_phage(28.57%)	9	NA	NA
WP_075275473.1|166920_167097_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|167213_167921_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|167874_168753_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243193.1|168783_169326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|169597_170302_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|170313_171042_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|171071_171461_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|171483_172212_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|172214_172823_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
>prophage 1
NZ_CP039063	Piscirickettsia salmonis strain Psal-099 plasmid unnamed3, complete sequence	50585	2917	16713	50585	tail,capsid,transposase,head	Moraxella_phage(18.18%)	18	NA	NA
WP_036771347.1|2917_3895_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375652.1|3922_4351_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242568.1|4409_7100_-	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375789.1|7096_7654_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_144420832.1|7643_8429_-	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375787.1|8358_9030_-|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_017375786.1|9026_9368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771950.1|9360_11439_-|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375784.1|11442_11709_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_017375783.1|11765_12089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375782.1|12090_12513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375781.1|12512_12863_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375780.1|12859_13255_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375779.1|13433_13859_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375778.1|13855_14167_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_027242598.1|14551_15136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275454.1|15149_15689_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_036771639.1|15738_16713_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
>prophage 1
NZ_CP039064	Piscirickettsia salmonis strain Psal-099 plasmid unnamed4, complete sequence	33497	3344	19366	33497	terminase,integrase,transposase,tail,capsid,head	unidentified_phage(35.71%)	21	NA	NA
WP_036771330.1|3344_4319_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4854_5445_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5675_5936_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5928_6282_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6458_7433_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|7965_8331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|8475_8730_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8713_9070_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|9167_10142_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|10767_11634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|11846_12230_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|12316_12799_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|12801_12987_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|13006_13981_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|14077_14470_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|14505_15087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|15467_16442_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|16515_16731_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|17534_18050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|18395_18953_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|18949_19366_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
