The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	31805	91608	3195565	transposase,tRNA	Staphylococcus_phage(28.57%)	52	NA	NA
WP_036772169.1|31805_32681_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33039_34395_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34486_34993_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34989_35358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36760_38545_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39025_40153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40225_40981_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|41017_43711_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43742_44294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44401_45415_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45535_45760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46115_46877_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47019_47814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|47958_48711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49022_50549_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50687_51761_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|51800_53108_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53082_54252_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54306_55032_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55497_57603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|57817_58282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58301_58811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59195_60137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60418_61870_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773655.1|62336_62741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63301_64276_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|65010_65388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|65977_66952_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773242.1|66991_67546_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|67740_68640_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|68644_69271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|69215_71537_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|71683_72163_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|72159_73311_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|73445_73949_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|74042_75017_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|75006_76320_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|76360_77740_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|77746_79198_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|79223_79592_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378407.1|79610_80678_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|80710_81607_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|81603_82440_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|82575_83028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|83166_83913_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|83893_84457_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|84465_84981_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|85122_87201_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|87200_88151_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|89018_89417_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|89642_89972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|90588_91608_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	123090	241158	3195565	transposase,protease,tRNA	Staphylococcus_phage(12.5%)	105	NA	NA
WP_075278722.1|123090_123966_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|124406_124700_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|124700_124955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|124971_127464_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|127456_128140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|128139_129183_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|129182_130412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|130413_130743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|130739_131939_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|132051_132441_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|132440_133385_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|133504_134902_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|135227_135749_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|135872_136181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|136195_141418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|141808_143815_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|143945_146276_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|146451_147282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|147398_147794_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|147790_148324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|148320_148722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|149116_149437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|149446_150403_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|150912_151437_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|151537_152536_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|152624_153521_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|153594_154881_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|155340_156657_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|156770_156941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|156960_157935_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|158061_158322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|158589_158880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|161418_162459_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|162561_163533_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|163655_164504_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|164655_164943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|165253_165625_+	isochorismatase	NA	NA	NA	NA	NA
WP_017377540.1|166676_166910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|167047_167185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|167198_167411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|167934_168759_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|168897_170031_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|170090_171500_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|171647_173228_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|173985_174981_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|174986_177053_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|177110_178061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|178255_178582_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|178804_180064_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|180323_181199_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|181237_182200_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|187894_188239_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|188335_189259_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|189758_190247_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|190349_191150_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|191160_192912_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|193801_194044_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|194047_194446_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|194677_195553_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|196271_196730_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|196911_197097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|197812_199627_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|200037_200706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|200715_202032_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|202191_203154_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|203234_203390_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|203403_203640_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|203832_205050_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|205027_205486_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|205513_206893_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|206929_207148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|207467_208763_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|208967_209159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|209357_210233_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|210420_211686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|211719_212595_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|212716_213175_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|213198_214119_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|214246_215029_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|215119_216619_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|216932_218816_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|219075_219738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|219804_220914_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|220925_221570_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|221588_222575_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|222659_223736_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|223937_224762_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|225064_226030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|226348_227401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|227459_228434_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|228769_229198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|229434_229917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|229972_231223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|231325_231544_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|232015_232870_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|232924_233395_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|233691_233928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|234074_234455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|234513_235389_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|236155_237067_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|237183_238032_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|238098_239109_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|239132_239456_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375571.1|239466_239868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|240138_241158_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	314961	357320	3195565	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|314961_315837_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|315917_316550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|316503_317949_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|317983_318403_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|319176_319545_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|319554_320094_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|320254_320686_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|320689_321388_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|321635_322142_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|322184_322553_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|322823_326900_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|326963_331172_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|331333_331708_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|331812_332286_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|332301_334413_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|334440_335631_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|335637_335949_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|336071_336710_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|336725_337343_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|337339_337636_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|337650_338475_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|338491_338767_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|338772_339105_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|339117_339852_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|339865_340279_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|340278_340479_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|340478_340736_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|340857_341226_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|341243_341555_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|341570_342113_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|342125_342431_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|342459_342852_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|342864_343398_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|343407_343761_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|343771_344272_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|344277_344460_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|344462_344897_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|344897_346220_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|346276_346390_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|346533_346890_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|346915_347305_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|347314_347935_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|347956_348934_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|348982_349381_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|349493_350741_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|350727_351384_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|351468_351747_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|351989_352217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|352349_353144_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|353452_354667_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|355064_355244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|355212_355866_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|356241_356490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|356579_357320_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	375338	425021	3195565	transposase,tRNA	Staphylococcus_phage(25.0%)	54	NA	NA
WP_017376964.1|375338_377819_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|377905_378385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|378357_379398_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|379334_380051_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|380063_380399_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|380435_380906_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|380948_382784_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|382828_383917_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|383938_385000_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|385077_385593_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|385633_386911_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|386925_387777_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|387805_388453_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|388449_389409_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_036774534.1|389500_389926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875861.1|389930_390800_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|390944_391199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|391343_391910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|392015_392456_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_027242664.1|392967_394170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|394453_395428_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046562.1|395609_395753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046563.1|395897_396035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|396051_396267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|396471_397083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|397079_397337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|397587_397980_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|398109_398658_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|398657_399485_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|399534_401220_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|401297_401759_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|401795_402359_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|402585_402915_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|402895_403120_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|403264_403855_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|403879_405151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|405168_406422_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|406418_407063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|407135_408185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|408286_409924_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|409958_410288_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|410444_410732_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_155046565.1|411258_411552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|411801_413022_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|413080_415879_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|416184_417351_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|417449_417986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|418047_418380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|418637_419540_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|419609_420107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|420252_421656_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|421856_422585_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963630.1|422754_423612_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_048875864.1|423995_425021_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	451093	499232	3195565	transposase	Staphylococcus_phage(100.0%)	42	NA	NA
WP_036774259.1|451093_452068_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377364.1|452217_453054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|453173_454577_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242658.1|455919_457383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856768.1|457458_458253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242656.1|458544_459363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|459380_459974_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376894.1|460190_460424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242655.1|460647_461544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420727.1|461848_462619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376891.1|462788_463691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|463687_464911_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_027242653.1|464928_465855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|465870_466911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242651.1|467025_467436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376888.1|467488_467992_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_017376887.1|467984_468731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376886.1|468733_469864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|469868_470108_+	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_027242650.1|472597_473086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|473088_474165_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_017376878.1|474157_474811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875870.1|474817_475243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|475279_478279_+	ATPase AAA	NA	NA	NA	NA	NA
WP_027242646.1|478340_479843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|480294_481914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|481955_484259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376870.1|484535_485432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|485434_488761_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_144420818.1|488962_489151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|489162_489639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|489681_489909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|490090_490624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|490654_490996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772347.1|490998_491415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876253.1|491576_492233_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036771639.1|492229_493204_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|493645_493909_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|494336_495311_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_087910671.1|495698_496163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910670.1|496256_496442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|498257_499232_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 6
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	504036	558719	3195565	transposase	Streptococcus_phage(22.22%)	52	NA	NA
WP_048875872.1|504036_505320_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|505492_505630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|505626_507030_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|507143_507581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|507701_508130_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|508377_508815_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|509246_510635_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|511081_512575_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|512769_513525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|514024_514255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|515359_516370_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|516366_516588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|517306_518248_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|518775_519174_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|519113_519968_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|520059_520341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|520426_521104_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|521149_522430_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|522605_523655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|523733_524534_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|524547_525342_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|525444_526464_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|526510_527122_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|527125_527812_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|527808_528351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|528643_529831_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|530075_530801_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|530986_531775_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|531771_532167_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|532559_533600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|533596_535000_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|537415_537673_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|537712_539098_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155050374.1|539415_540525_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.6e-49
WP_017377120.1|540558_541809_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|541809_542442_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|542731_543184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|543229_544072_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|544106_544598_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|544793_546761_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|546988_547393_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|547370_548399_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|548385_549174_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|549600_551004_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377110.1|551205_552216_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_075275363.1|552228_552696_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377107.1|553025_554396_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_017377106.1|554698_555169_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377105.1|555446_555722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|555732_557136_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069971661.1|557310_557748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|557744_558719_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 7
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	590510	723895	3195565	transposase,plate,tRNA	Staphylococcus_phage(13.64%)	110	NA	NA
WP_036772726.1|590510_591059_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|591811_593191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|593550_595014_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|595197_596010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|596474_598469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|598863_600243_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|600280_600718_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|600760_601477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|603023_603554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|603620_605441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|606005_606512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|606596_608000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|608114_608369_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|608521_608794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|609668_610244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377063.1|610240_610411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|611311_611554_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|611856_612948_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|612928_613882_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|614105_615590_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|615629_616133_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|616392_617568_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|617715_618120_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|618276_619152_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|619186_619540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|622869_623295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|623525_624662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|624648_625971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|625963_627082_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|627202_627736_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|627874_629512_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|629516_629738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|629846_630860_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|631122_633351_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_026063593.1|633331_634036_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|634270_634600_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|636000_636219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|636277_637153_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|637145_638012_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|638079_639399_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|639868_640429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|640747_641674_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|642569_643478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|647174_648014_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|648200_648416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|648464_649040_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|649036_649375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|649543_650533_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|651522_652425_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875883.1|652684_653221_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|653365_654283_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|654717_655728_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|656535_657072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|658284_658632_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|658776_659736_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|659837_660620_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|660752_661712_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|661736_662141_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|662169_662844_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|662943_664659_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|664655_665018_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|665032_666187_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|666190_667198_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|667200_668217_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|668432_669518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|669624_670017_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|670149_671433_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|671448_672750_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|672767_674570_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|674574_675567_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|675647_676724_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|676821_677796_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|677863_678835_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|679018_679288_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|679889_681176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|681240_681921_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376024.1|687576_687825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375775.1|687902_688097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275355.1|688144_689119_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_027242570.1|689332_690472_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|690680_692051_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|692429_693422_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|693425_693941_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|693937_694777_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|694809_696360_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|696467_696839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|698059_698221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|698801_700205_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|700239_700677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|700700_701675_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|701733_702162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|702349_703156_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|703230_703623_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|703667_704489_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|704501_705485_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|705486_706755_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|706761_709266_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|709396_710422_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|710418_711129_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|711053_711884_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|712033_712417_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|712451_713351_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|713396_714068_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|714150_714726_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|714824_715625_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|715766_716624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|717486_718623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|718689_721860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|721872_722583_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|722587_723895_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	732537	778839	3195565	transposase,plate	Staphylococcus_phage(21.43%)	51	NA	NA
WP_017376356.1|732537_732936_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|732932_734621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|734602_735559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|735601_736117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|736221_737154_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|737373_737760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|737777_738422_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|738572_739412_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|739487_740090_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|740090_740945_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|741302_741614_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|741638_743027_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|743182_743914_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|743910_744438_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|744469_745027_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|745032_746013_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|746152_746953_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|746956_747724_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|747720_748185_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|748207_748861_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|748864_749212_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|749245_749497_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|749574_750843_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|750845_751604_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|751665_752556_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|752606_753290_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|753299_753647_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_069971660.1|753919_756025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|756016_756889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|757056_758886_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|759053_759695_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|760019_760466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|760483_760657_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|760715_761765_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|761771_762722_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|762776_763721_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|763748_764486_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|764574_764817_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|764891_766115_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|766146_766995_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|766991_768044_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|768180_768801_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|769026_770179_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|771199_772174_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|772170_772341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|773309_773906_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|773874_775035_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|775545_775887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|775990_777025_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|777021_777732_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|777864_778839_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 9
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	786999	841310	3195565	transposase,protease,tRNA	Prochlorococcus_phage(33.33%)	49	NA	NA
WP_017377942.1|786999_787506_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_155048031.1|787587_787953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|788095_788956_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|789053_789599_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|789681_790533_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|790574_793481_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|793541_793739_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|793745_794756_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|794752_795811_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|795825_796605_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|796607_797420_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|797431_798379_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|798389_799682_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|799860_800964_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|800960_801353_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|801365_802742_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|802735_804205_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|804398_804833_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|805128_805305_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|806339_807365_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_155046573.1|807827_808259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|809651_810302_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|811000_811795_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|811974_812619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|812793_813768_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|814168_814426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|816103_816781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|817014_817839_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|817932_818646_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|818735_819827_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|819898_820480_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|820485_821112_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|821208_822156_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|822502_823165_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|823335_823995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|824163_825423_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|825419_826505_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|826497_827379_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|827367_828618_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|830003_830324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|830582_830849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|831339_831558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|832543_832765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|832761_833844_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|833854_834226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|834222_834402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|837105_837381_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|838216_839674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|840101_841310_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	884990	947538	3195565	transposase,tRNA	Staphylococcus_phage(28.57%)	53	NA	NA
WP_048875904.1|884990_885866_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|886122_886560_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|886620_887253_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|887268_887916_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|887918_889982_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|890308_891601_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|891989_894200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|894216_894873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|897258_898134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|898392_899004_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|899431_902020_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|902122_902884_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|902880_903417_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|903465_904422_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|904499_907685_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|907688_908744_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|908973_909576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|909619_910282_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|910316_910664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046576.1|911132_912077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|912626_914030_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|915148_915493_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|915584_916040_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|916288_916423_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|916415_917057_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|917053_917770_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|917773_919093_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155051395.1|919774_919918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773644.1|920897_923534_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_036773645.1|923575_924661_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|924660_925344_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_017377748.1|925404_927066_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377747.1|927218_927473_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|927551_927869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|928021_928420_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|928501_929140_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|929296_930271_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|930643_930919_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|931468_931753_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|933569_934163_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|935278_936160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|936271_937951_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|938077_939328_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|939403_939865_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|939861_941010_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|941015_941690_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|941686_942343_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|942468_942942_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|942943_943366_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|943352_944372_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|944531_944711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|944929_945211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|946662_947538_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	951440	1018403	3195565	transposase,protease,tRNA	Bacillus_phage(20.0%)	57	NA	NA
WP_048876012.1|951440_952844_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|953202_953970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|954083_955487_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|955483_955645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|955960_956935_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|957175_958459_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|958525_959449_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|961644_963789_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|963810_964017_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|964077_964698_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|964738_965632_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|965717_966443_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|966504_966909_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|967071_969180_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|969303_970353_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|970349_971816_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|971958_973296_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|973363_974854_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|975082_975454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|975604_976432_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|976734_977391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|977338_978262_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|978275_979199_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376987.1|979446_980130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|981829_982057_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_016210338.1|982124_982262_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376989.1|982381_982930_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|983010_983286_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|983285_984335_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|984447_986385_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|986532_988245_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|988313_989033_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|989029_989632_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|989746_990634_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|990824_991172_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|991222_992062_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|992157_992904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|993100_993727_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|994042_994612_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|994755_995454_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|996160_996784_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|996893_997787_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|997893_999504_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|999500_1000796_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|1000817_1002740_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|1002850_1003153_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|1003247_1008134_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1008181_1009504_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1009628_1010723_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1010774_1011713_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1011793_1012378_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1012762_1013653_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1013855_1014347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1014486_1014978_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1015146_1015860_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065653747.1|1015922_1017263_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1017527_1018403_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	1024016	1086543	3195565	transposase	Staphylococcus_phage(33.33%)	57	NA	NA
WP_017377787.1|1024016_1024244_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1024270_1025311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1025377_1025947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1026177_1026582_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1026594_1026735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1026829_1028029_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1028049_1028661_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1028862_1029624_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1029919_1030846_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1031006_1031963_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1032107_1032377_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1032643_1033618_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1033771_1033999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1034115_1034541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1034697_1035627_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1036073_1036604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|1036925_1037231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1037708_1038020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1038359_1039526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1041713_1042685_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1043287_1043461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1043856_1044774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1044774_1045626_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1046066_1047113_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1047102_1049094_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1049203_1049578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1049831_1050014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1050275_1050977_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420709.1|1050977_1051397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619460.1|1053050_1055834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1056069_1057362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1057848_1058754_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376296.1|1059531_1060248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1060533_1061295_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1061327_1062731_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1062727_1062892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1062951_1063239_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1063983_1064712_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1064680_1065427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046685.1|1065477_1065897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1065893_1066868_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1067024_1067342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772457.1|1069817_1070126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1070201_1070474_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1073007_1073445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1074046_1075234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1075504_1077139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1077189_1077918_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1079345_1080308_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1080531_1081527_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1081554_1082490_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1082533_1082995_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1082973_1083591_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1083620_1084595_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1084649_1085117_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1085129_1085774_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1085814_1086543_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 13
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	1095243	1144811	3195565	transposase	Acinetobacter_phage(22.22%)	39	NA	NA
WP_082300708.1|1095243_1095804_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1097128_1097524_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1097532_1097889_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1097881_1098757_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1098842_1099421_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1099378_1099672_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1100632_1102144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1102391_1103795_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1104000_1104435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1104517_1105222_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1105480_1105969_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1105997_1106672_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1106912_1107788_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275340.1|1108318_1108927_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1109197_1109656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1109934_1110324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1110509_1111325_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1111547_1112453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1112616_1113378_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1113381_1114248_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1114333_1114945_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1115323_1116571_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1116722_1117424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1117721_1117895_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1118384_1118885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1119963_1120191_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774233.1|1120243_1120477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1120505_1121186_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1121208_1123383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1123628_1124699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1124695_1126099_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619408.1|1126247_1126733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1126804_1127626_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1128292_1129792_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1130095_1132789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1132785_1136187_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_048875961.1|1137774_1139178_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1140256_1140928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1143836_1144811_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 14
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	1169534	1226914	3195565	transposase,tRNA	Staphylococcus_phage(37.5%)	53	NA	NA
WP_053093677.1|1169534_1170254_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1170481_1170658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1170906_1171230_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1171318_1173337_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1173359_1174313_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1174478_1175666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1176379_1177018_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1177315_1178311_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_036772169.1|1178451_1179327_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242772.1|1179437_1180484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1180476_1181502_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1181568_1183599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1184905_1185133_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1186476_1186620_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1186616_1187309_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242771.1|1187575_1187893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|1188035_1188446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1188602_1188929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1189075_1190113_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1190154_1190400_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_129556541.1|1190524_1190839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1190846_1192421_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1192575_1193145_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1193454_1195257_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1195253_1196195_+	signal peptidase I	NA	NA	NA	NA	NA
WP_036771308.1|1196222_1196444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242761.1|1196606_1197281_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1197286_1198186_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1198199_1198943_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1198945_1199677_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1199673_1200057_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1200194_1201442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1201852_1202998_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1202990_1203344_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1203624_1204167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1204811_1205000_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1205019_1205994_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1206037_1206913_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1207266_1208094_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1208193_1208355_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1209005_1210346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1211397_1211625_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|1211766_1213128_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1213223_1213883_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144420701.1|1214723_1215080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1215676_1217236_-	APC family permease	NA	NA	NA	NA	NA
WP_027243001.1|1217596_1219567_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375893.1|1219764_1220835_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1220892_1221099_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1221105_1222581_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1222716_1223280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1223449_1224853_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1225819_1226914_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	1243156	1290593	3195565	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_036772169.1|1243156_1244032_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1244101_1245205_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1245272_1245596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1245752_1246535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1246670_1247648_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1247721_1249713_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1249768_1250050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1250303_1251503_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_051929862.1|1253646_1254159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1254345_1255221_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1255257_1255422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1256630_1257044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1257054_1257390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1257534_1258653_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1258882_1259149_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1260431_1260659_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1260669_1261176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1261253_1261871_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1262002_1263235_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1263224_1263887_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1264161_1265418_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1265555_1266215_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1266289_1266991_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1267738_1268713_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1269921_1270275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1270488_1270683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1270750_1271263_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1271400_1272255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1272303_1272948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1272981_1273626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653744.1|1274166_1274442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1274540_1275323_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1275405_1276356_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1278398_1281239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1281261_1281843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1281962_1282691_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1282836_1283811_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1283926_1284832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1285430_1286177_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1286429_1286822_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1286859_1287507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1289222_1290593_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	1314412	1355622	3195565	transposase	Enterobacteria_phage(16.67%)	37	NA	NA
WP_048876023.1|1314412_1315516_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1315606_1316759_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1317172_1318024_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|1318161_1318311_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1318935_1321302_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1321349_1322546_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1323114_1325547_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1325868_1327368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1327476_1328049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1328363_1329833_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1329905_1330655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1330658_1331432_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1331530_1332481_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1332620_1334063_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1334278_1335463_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1335586_1336273_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1336408_1336993_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1337082_1337412_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1337747_1337987_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_017377970.1|1338035_1338227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1339001_1339295_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1339443_1339605_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1340119_1340659_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1340997_1341642_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1341975_1342626_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1343149_1344202_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1344219_1347300_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1347465_1347714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1347779_1348655_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1349577_1350084_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1350101_1350299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1350317_1350461_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1350528_1350702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1350906_1352220_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1352229_1352493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1352551_1353526_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1355394_1355622_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 17
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	1386839	1435738	3195565	transposase,tRNA	Bacillus_thuringiensis_phage(25.0%)	40	NA	NA
WP_036772026.1|1386839_1387715_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1387819_1391122_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1391118_1392942_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1392981_1393380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1393488_1394505_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1394939_1396394_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1396475_1399532_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_144420694.1|1399825_1400062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081329473.1|1400922_1401342_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376676.1|1401714_1402179_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1402251_1403253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1406145_1406478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1406839_1406983_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1406970_1407915_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080963606.1|1407918_1408305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1408126_1408465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1408839_1409439_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1409438_1409786_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1409936_1410920_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1411829_1412144_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1412292_1412451_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1412422_1413352_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1414266_1414683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1415811_1416528_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1417276_1417435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1417483_1418059_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1418203_1418482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1418546_1419422_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1419587_1423454_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1423609_1424419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1424468_1425290_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1425489_1426722_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1426892_1427618_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1427660_1429199_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1429205_1430591_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1430904_1431954_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1432513_1432891_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|1433082_1433958_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1434939_1435167_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1435219_1435738_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	1440036	1625602	3195565	transposase,protease,integrase,tRNA	Staphylococcus_phage(19.51%)	167	1506499:1506558	1576924:1577534
WP_048875984.1|1440036_1440573_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876016.1|1440717_1441128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375877.1|1441398_1441647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|1442007_1442343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375878.1|1442680_1442953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243180.1|1443024_1444284_-	phosphoesterase	NA	NA	NA	NA	NA
WP_017375881.1|1444368_1445634_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_026063485.1|1445792_1446275_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_036772592.1|1446352_1447813_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_155046587.1|1447935_1448076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|1448489_1448990_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_017375698.1|1455104_1456298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243221.1|1456641_1458270_+	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_027243222.1|1458285_1459434_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_051929845.1|1459508_1460333_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1460736_1461711_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1461896_1462490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1462670_1463135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1463529_1463811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1463807_1465211_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1465862_1466243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1466482_1467139_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1467283_1467580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1467639_1467927_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_027243051.1|1468210_1468420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772296.1|1469116_1469494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1469693_1470743_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1470719_1472537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1472807_1473386_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1473413_1473878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1473914_1475372_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1475433_1476921_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1477690_1478293_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1478854_1479325_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1480972_1481716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1481867_1482299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1484936_1486283_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1486370_1488176_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1488641_1489439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1489823_1490285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1490507_1491482_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1491524_1491647_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1491718_1493674_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1494063_1494249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1494570_1495560_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1495972_1497598_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1497706_1498021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1498316_1499702_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1499866_1500094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1500234_1500693_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1500893_1501079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1501147_1501975_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1502429_1502954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420684.1|1503136_1503385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1503554_1504508_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1504702_1505677_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1505804_1506830_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
1506499:1506558	attL	CCACCACGTGTCACTGATAAGTGGACGTGCGTATTCCAATTTAAACTCTGGCCGAAAGTA	NA	NA	NA	NA
WP_017376231.1|1507482_1507770_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1507829_1508162_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1508366_1508927_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_017376814.1|1511521_1512247_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_026063564.1|1512621_1515441_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_048876146.1|1516290_1517424_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_017376809.1|1517648_1519418_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_017376808.1|1519556_1520600_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376807.1|1520613_1521357_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_027243093.1|1521469_1521787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1521848_1522028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243094.1|1522090_1522798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420791.1|1523581_1524793_+	protein kinase	NA	NA	NA	NA	NA
WP_017376801.1|1524848_1525673_-	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_017376798.1|1526860_1527496_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017376797.1|1527777_1528137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1528410_1530696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420683.1|1530684_1531341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|1531517_1532150_+	MarC family protein	NA	NA	NA	NA	NA
WP_027243097.1|1532185_1532371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243098.1|1532436_1533582_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243099.1|1533817_1535131_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_155046588.1|1536246_1536456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420682.1|1536990_1537152_-	phosphatase	NA	NA	NA	NA	NA
WP_017376785.1|1538558_1539464_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376784.1|1539704_1539890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242578.1|1539926_1540463_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_027242577.1|1540480_1541782_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_048876008.1|1541778_1542753_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_155046589.1|1542832_1542982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1543161_1543326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1543327_1544203_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1544518_1545439_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1545454_1545838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1546164_1547121_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_144420678.1|1547388_1547667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243017.1|1548165_1549509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|1549682_1549826_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1549905_1550880_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1551027_1552899_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1552931_1553030_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1553265_1553895_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1553878_1554301_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1554307_1556047_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1556047_1557112_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1557115_1557469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1557581_1558550_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1558559_1558871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1558886_1559456_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1559719_1561048_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1561088_1562063_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1562649_1563051_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146619459.1|1563570_1566027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1566229_1567081_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1567126_1568833_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1570304_1571279_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1571641_1571887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1572250_1573279_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1573409_1573613_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420676.1|1573897_1574854_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_047927838.1|1575146_1575392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1575388_1575688_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1575910_1576381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1576991_1577219_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036772851.1|1578441_1578759_+	hypothetical protein	NA	NA	NA	NA	NA
1576924:1577534	attR	TACTTTCGGCCAGAGTTTAAATTGGAATACGCACGTCCACTTATCAGTGACACGTGGTGGTGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGATAGGTTAGCATTGGCTGTATGCAACCGATCATGATTGTAATATCGAATATAGGCCTCAACATCCTCCTTCATAGTATCACGGGTTAAGTGAATCACATTCAACAGCCATTCGTGCTTTAGGCTGCCAAAAAAACGCTCGACAACCGCATTGTCAACGCAAGCACCGACACTGCTCATAGAAGCGGTGATTTTATGCTTCTTCAACAGTTTTCGATATTTTTTACTGGTATACTGCGAACCACGATCACTGTGAAATAACAAGTGTTCTGTCGGCTGCCGCAAGTGAATCGCCATATCCATTGCACGACAAACTAGATTTTCGCTCATTCTCTTATTCATCGCCCAGCCAATCACTTTTCGAGAGTATAAATCAATAACGACCGCAAGATACAACCAGCCTTCAGCAGTTCTAAGGTAGGTAATGTCACCTGCCCATGAGTGATTTGCAATGACTGGATTAAACTGCTGATTCAATACGTTATCTGCAACAGC	NA	NA	NA	NA
WP_027243023.1|1578752_1578995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243024.1|1579345_1580446_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_017377328.1|1580614_1581916_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_047927520.1|1581992_1582496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|1582671_1584075_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1584262_1585120_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1585244_1585880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1585928_1586180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1586435_1587335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1587471_1588545_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1588645_1589059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1589079_1589793_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1589980_1591393_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1591602_1592571_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1593304_1593673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1593676_1593994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1594069_1595044_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1595563_1596064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1596134_1597463_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1597598_1598987_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1599134_1600445_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1600785_1602069_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1602142_1602763_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1602961_1603222_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1603424_1603571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1603546_1604140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1606003_1606222_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1607474_1608245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1608331_1608547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1608643_1609765_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1610031_1611006_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1611268_1612390_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1612682_1612970_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1612942_1613446_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1613526_1614186_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1614527_1615445_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1615574_1615748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1616413_1617772_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_144420789.1|1617963_1618410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376485.1|1618604_1619834_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1619879_1620506_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1620655_1621843_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1621851_1622544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1622665_1623818_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1624618_1625602_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 19
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	1683937	1774252	3195565	transposase,protease,tRNA	Burkholderia_phage(14.29%)	82	NA	NA
WP_036774017.1|1683937_1684813_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1685202_1685541_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1685537_1686134_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1686136_1688131_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1688194_1689133_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1689481_1690456_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1690659_1690857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1691018_1691423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1693006_1693447_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1693773_1694649_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1694661_1694904_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1695310_1695565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1696776_1697742_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1697834_1698146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1698346_1699123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1699952_1700144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1700872_1701922_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1702092_1702866_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1702926_1704516_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1704706_1705798_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1705820_1706138_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1706224_1707502_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1707523_1708360_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1708366_1710001_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1710432_1710792_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1711073_1712432_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1712457_1712700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1713193_1713373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1713628_1714885_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1714998_1715256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1715400_1716411_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1716787_1717642_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1717671_1718505_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036773204.1|1719081_1719855_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1719936_1720257_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1720475_1721381_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1721466_1721865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1722009_1722507_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047927093.1|1724167_1725271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1725369_1725747_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1725826_1726801_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1728345_1729065_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1729148_1729436_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1729720_1730593_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1730549_1731326_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1731530_1731866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1732264_1732621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1732782_1733058_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1733167_1733515_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1733532_1734312_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1734311_1734821_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1734856_1735105_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1735416_1735752_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1736051_1737302_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1737383_1739411_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1739956_1740175_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1740346_1740709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1740857_1742261_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1742542_1743718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1743735_1745733_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1745713_1746694_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1746749_1747592_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_036772544.1|1747591_1748008_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1747988_1748408_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1748430_1749060_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1749628_1751818_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1751829_1753035_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1753019_1754867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1754851_1756090_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1756076_1757945_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1757978_1759232_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1759237_1760095_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1760113_1760842_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1761980_1762772_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1763137_1763425_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|1765547_1765937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1766113_1766872_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1766868_1769268_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1769281_1770559_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1770648_1771947_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1772144_1773038_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1773037_1774252_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 20
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	1784951	1835436	3195565	transposase,tRNA	Vibrio_phage(14.29%)	46	NA	NA
WP_069971651.1|1784951_1785827_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1786199_1786463_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1786769_1789364_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1789360_1789843_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1789820_1790861_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1791035_1791521_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1791628_1794199_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1794232_1794694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1795030_1795906_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1796183_1797944_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1798037_1798703_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1798715_1800221_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1800242_1800773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1800846_1802109_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1802295_1803168_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1803269_1804058_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1804150_1805476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1805829_1807005_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1807173_1807827_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1807982_1809923_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1809919_1810543_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1810707_1811682_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1811953_1812574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1812570_1813974_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1814041_1814458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1814865_1815363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1815359_1816334_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|1816413_1816983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1817127_1817664_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1817668_1817965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1817973_1818579_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1818764_1819163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1819353_1819557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1819701_1819857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1819981_1820434_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1820550_1822023_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1822461_1822926_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1823614_1824865_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1824974_1825445_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1825467_1826061_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1826198_1827248_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1827271_1828195_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1828211_1828673_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1828780_1829599_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1830208_1830352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1834515_1835436_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	1897669	1912985	3195565	transposase	Staphylococcus_phage(50.0%)	15	NA	NA
WP_017378288.1|1897669_1897891_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1897949_1898924_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1899122_1899287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1899283_1899919_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046602.1|1900195_1900975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1901007_1901769_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1901745_1902735_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1902870_1903746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1903764_1904424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1904665_1905112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1905108_1906512_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1906625_1907471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1907615_1909265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1909355_1910141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|1911581_1912985_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	1941658	1990530	3195565	transposase,tRNA	uncultured_Mediterranean_phage(33.33%)	43	NA	NA
WP_144420657.1|1941658_1942720_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1943431_1943593_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1944509_1945049_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1945431_1945848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1945943_1946759_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1946891_1948385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1948570_1948996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1948992_1951053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1951336_1952152_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1952252_1953071_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1953067_1953436_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1953617_1954445_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1954508_1955237_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1955639_1956368_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1956757_1957483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1957517_1961390_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1961590_1962724_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1962737_1962926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1963149_1964508_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_036773947.1|1966114_1966990_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1967501_1968137_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999981.1|1968149_1968623_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_155046603.1|1968550_1968703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929627.1|1968896_1969247_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1969306_1969594_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1969646_1970426_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376415.1|1970850_1971768_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1971819_1972575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1972642_1973917_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376412.1|1974037_1974715_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376411.1|1974915_1976340_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_016209938.1|1976314_1976953_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376410.1|1977315_1977594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376409.1|1977827_1978772_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376408.1|1978793_1980662_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376407.1|1980682_1981036_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_026063528.1|1981074_1982190_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1982374_1983415_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_027242800.1|1983417_1984452_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376402.1|1984448_1985510_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_017376401.1|1985621_1987094_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376400.1|1987246_1987690_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376399.1|1987758_1990530_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
>prophage 23
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	1994961	2043828	3195565	transposase	Staphylococcus_phage(25.0%)	45	NA	NA
WP_036773116.1|1994961_1995936_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|1996459_1999186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|2000073_2001048_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|2001298_2002003_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|2003242_2003761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|2004728_2006213_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2006337_2007873_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2007895_2008225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2008121_2008337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2010320_2011520_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2011729_2012590_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2012705_2013284_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2013440_2014082_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2014120_2014342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2014334_2015318_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2015711_2016209_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2016353_2016629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2016780_2018463_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2018470_2019493_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2019661_2020663_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2020776_2021115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2021590_2022850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2023058_2023286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2023314_2023533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2023670_2024036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2024103_2024346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2024360_2024696_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2024700_2025138_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_036772812.1|2025163_2026549_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2026659_2027091_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2027196_2028708_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2028998_2030591_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2030791_2032987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772819.1|2033080_2034514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2034556_2035072_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2035071_2036019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2036002_2036668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2036664_2037393_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2037382_2038129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2038112_2039177_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2039381_2040569_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2040625_2041744_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2042191_2042449_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2042728_2043406_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2043624_2043828_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	2063528	2113063	3195565	transposase,protease,tRNA	Burkholderia_virus(20.0%)	41	NA	NA
WP_017377787.1|2063528_2063756_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2063845_2064601_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2065014_2065611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2065690_2068495_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2068475_2069429_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2069421_2070792_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2070962_2072366_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2073137_2073464_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420651.1|2073668_2074322_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_017376600.1|2074641_2074821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2075076_2076333_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2076571_2076718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2076800_2077157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2077652_2078012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2078021_2078405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2079293_2079434_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2079578_2080499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2082656_2083187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2083197_2084253_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2084268_2086308_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2086294_2087125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2087191_2090731_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2090844_2091564_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2091802_2092432_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2092551_2093955_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2094100_2096044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2096561_2097422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2097857_2099603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771696.1|2100017_2101478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2101660_2102260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2102397_2102595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2102795_2102936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2103003_2103783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2104347_2104749_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2104893_2105271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2105730_2107038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2107786_2108044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2108095_2109499_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2109739_2111449_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2111618_2111981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|2112088_2113063_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 25
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	2127632	2187185	3195565	transposase,protease,tRNA	unidentified_phage(14.29%)	60	NA	NA
WP_017377892.1|2127632_2129054_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_026063687.1|2129143_2130742_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377894.1|2130898_2131525_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027242839.1|2131605_2134278_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377896.1|2134760_2135717_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_017377897.1|2135769_2136189_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_048875958.1|2136215_2137079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377899.1|2137068_2137860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2138164_2139136_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2139484_2139793_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2139789_2140446_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2140579_2141065_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2141142_2141664_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2141709_2142603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2142599_2143421_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2143615_2143765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2143992_2144823_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046606.1|2146228_2146399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2146551_2147955_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_144420645.1|2148064_2149321_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2149292_2150024_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2150035_2151313_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2151412_2151787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2151871_2152759_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2152816_2153545_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2153541_2154651_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2154802_2155231_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2155325_2155682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2155674_2156886_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2156882_2157671_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2157833_2158628_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2159077_2159818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2159821_2162320_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2162582_2163539_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2163522_2164284_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2164491_2165466_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2165574_2166330_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2166454_2166700_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2166759_2169033_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2169087_2169390_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2169630_2169924_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2170094_2170274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2170349_2170961_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2171207_2172524_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2172534_2172903_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2172933_2173596_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2174018_2174597_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2174576_2174984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2175107_2175404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2175450_2176326_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876123.1|2176395_2178576_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_017376060.1|2178679_2180029_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_036772012.1|2180102_2180792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2180924_2182112_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376055.1|2182630_2183275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2183271_2184585_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2184789_2184963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2185232_2185706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2185850_2186045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2186309_2187185_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	2206247	2254470	3195565	transposase,tRNA	Staphylococcus_phage(16.67%)	42	NA	NA
WP_036771639.1|2206247_2207222_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875951.1|2207265_2208102_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2208247_2208667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2208943_2209624_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2209589_2209940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2209972_2211184_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2211524_2212154_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2212202_2213219_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2213465_2213681_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2213733_2214183_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2214262_2216008_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2216099_2217971_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2218415_2219132_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2220569_2221439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2221395_2221623_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2222591_2223506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2223551_2224574_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2224642_2225692_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155051404.1|2226097_2226268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046607.1|2226308_2226491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243219.1|2226775_2227084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2227250_2228654_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046608.1|2228746_2228911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2229232_2229457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2229467_2230679_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036774710.1|2231073_2231973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|2232146_2232548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2232794_2233838_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2233957_2234194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2234982_2236536_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2238716_2238944_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2239814_2240789_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017375736.1|2241515_2242598_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_017375735.1|2242640_2243291_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375734.1|2243513_2243885_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_027243178.1|2243995_2245357_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155046609.1|2247077_2247284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2247594_2248677_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2248673_2248985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2250030_2251005_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2252011_2252791_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2253252_2254470_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	2267319	2328287	3195565	transposase,integrase	Staphylococcus_phage(30.0%)	47	2275172:2275231	2325593:2326353
WP_144420638.1|2267319_2268402_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2268398_2268710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2270207_2271143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2271735_2272881_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2275123_2276287_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2275172:2275231	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|2276315_2276540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2277887_2279063_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2279408_2281919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2281977_2282790_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377669.1|2283230_2283935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2283984_2284959_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2285063_2286395_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2286593_2286662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2286793_2288236_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2288627_2290040_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2290729_2291176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2291770_2292619_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2292872_2293931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2293922_2295629_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2295700_2297434_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2297730_2298297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2298421_2299075_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2299101_2300562_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2300658_2301636_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2302105_2303509_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2304034_2304328_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2304554_2305319_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2305526_2305754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2305817_2306000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2306562_2306742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376902.1|2306805_2307117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2307971_2308676_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2308873_2309014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2309418_2309943_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|2310089_2311346_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2311413_2311893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2312333_2313737_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420632.1|2314151_2316467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2317039_2318932_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2319103_2320078_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2320381_2321188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2321256_2321868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2323349_2323646_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2323642_2324485_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2324875_2325661_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2325665_2327069_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2325593:2326353	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2327342_2328287_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	2349129	2376782	3195565	transposase,protease	Staphylococcus_phage(25.0%)	28	NA	NA
WP_017377305.1|2349129_2350431_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2350512_2351118_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2351230_2352535_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2353135_2354011_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2354126_2354798_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2354977_2356333_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2356453_2357191_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2357269_2357986_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2358634_2359909_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2359939_2360515_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2360559_2361525_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2361988_2362897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|2363284_2363536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2363680_2364109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2364094_2365039_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2365243_2365396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2365424_2366159_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2366253_2366514_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2366732_2367698_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|2367674_2367971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2368161_2368611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2368870_2369299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2369394_2369895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2369831_2369993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2370873_2371095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2372593_2373271_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2374585_2374924_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2375807_2376782_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 29
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	2415829	2543293	3195565	transposase,tRNA	Burkholderia_virus(25.0%)	106	NA	NA
WP_080999971.1|2415829_2417233_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2417346_2417922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2419167_2419395_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2419684_2420224_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2420533_2422021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2422072_2422498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2422716_2424120_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2424116_2424494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2424453_2424999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2425394_2426621_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2427221_2428874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2428810_2429005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963645.1|2429337_2430528_-	MFS transporter	NA	NA	NA	NA	NA
WP_027243147.1|2430776_2433449_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2433737_2434574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2435234_2436125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2436593_2437568_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876012.1|2438052_2439456_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2439601_2441005_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|2441089_2442904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2444815_2446219_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2446252_2447782_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2447817_2449278_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_027242908.1|2449252_2450212_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376200.1|2450289_2453796_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_017376201.1|2453819_2454389_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_027242907.1|2454602_2455757_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376204.1|2455775_2456549_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|2456548_2456995_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376206.1|2457012_2458062_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_017376207.1|2458172_2458706_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_036771893.1|2458786_2461204_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_027242906.1|2461488_2462556_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_017376209.1|2464758_2465823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376210.1|2465812_2466841_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376211.1|2466837_2467377_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376212.1|2467913_2469824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420623.1|2469871_2470069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420622.1|2470268_2471846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|2471942_2472818_-	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_080963646.1|2472906_2473806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063514.1|2473720_2474467_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_017376216.1|2474474_2475032_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_017376217.1|2475035_2475773_-	UMP kinase	NA	NA	NA	NA	NA
WP_017376218.1|2475776_2476655_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376219.1|2476819_2477587_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376220.1|2477993_2478803_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376221.1|2478880_2481538_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|2481541_2482579_+	asparaginase	NA	NA	NA	NA	NA
WP_017376223.1|2482580_2483402_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376224.1|2483532_2484417_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_036773116.1|2484729_2485704_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2485756_2486752_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2486794_2487769_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376319.1|2488393_2489074_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017376318.1|2489073_2489883_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027242903.1|2489956_2493637_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_026063524.1|2493646_2495134_-	ribonuclease G	NA	NA	NA	NA	NA
WP_017376313.1|2495143_2495761_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_017376312.1|2495830_2496349_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376311.1|2496345_2497245_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2497260_2498304_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376309.1|2498501_2498789_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2498909_2500370_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2500449_2501886_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2502010_2502985_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2505175_2505937_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2507094_2507322_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2508275_2508488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2508505_2508823_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2508849_2509539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2509879_2510083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2510214_2511150_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2511162_2511945_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2512074_2512386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2512729_2513056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2513080_2513536_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2513525_2514578_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2514580_2516044_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2516178_2516406_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2517822_2518287_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2518543_2519359_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2519487_2521800_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2521916_2522444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2523135_2524413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2524423_2524675_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2524708_2525230_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2525399_2526386_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2526476_2527292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2527720_2528116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2528088_2528316_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_047927746.1|2529284_2529872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2530474_2531146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875918.1|2531290_2531872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420767.1|2531914_2532592_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243185.1|2532870_2533827_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_017377736.1|2533886_2534552_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017377737.1|2534585_2535131_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_155046615.1|2535410_2535572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774946.1|2536268_2536883_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_144420620.1|2536809_2538012_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875923.1|2537997_2538993_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2538996_2539401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2540368_2540596_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2541564_2542161_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046616.1|2542129_2543293_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
>prophage 30
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	2553014	2604428	3195565	transposase,tRNA	Bacillus_phage(20.0%)	55	NA	NA
WP_048876031.1|2553014_2554418_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|2554523_2554748_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2554930_2555752_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|2555897_2556152_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377841.1|2556540_2558325_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|2558413_2559133_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2559294_2559501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2559500_2559737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2559749_2560103_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2560640_2561474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2561566_2561764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2561861_2563247_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2563373_2563964_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2564995_2565283_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2565342_2565507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2565503_2566874_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2567240_2568653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2568722_2569493_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2569985_2570273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2571749_2572043_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2572000_2572822_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2572966_2573191_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155046618.1|2573445_2573973_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|2574149_2574410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2574328_2574484_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2574582_2575557_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2576885_2577035_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2577151_2577445_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2578253_2578829_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2578906_2579782_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2579846_2580467_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2580451_2581534_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2581767_2582172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2583662_2584964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2585110_2585779_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2586711_2587275_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2587331_2588528_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_017376587.1|2588652_2590017_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376586.1|2590013_2591105_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376585.1|2591359_2592010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2592202_2592397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2592504_2592657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376583.1|2592923_2594051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063543.1|2594140_2594974_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376581.1|2594977_2595628_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_017376580.1|2595617_2596457_-	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_016210074.1|2596462_2597089_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376579.1|2597249_2597792_+	septation protein A	NA	NA	NA	NA	NA
WP_017376578.1|2597875_2598178_+	YciI family protein	NA	NA	NA	NA	NA
WP_144420763.1|2598195_2598438_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376576.1|2598536_2598809_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376575.1|2598847_2599486_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376574.1|2599518_2600610_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376573.1|2600781_2602524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2603453_2604428_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 31
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	2613722	2732183	3195565	transposase,tRNA	Staphylococcus_phage(29.63%)	108	NA	NA
WP_080999966.1|2613722_2615072_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2615369_2615927_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2616020_2616527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2617031_2617727_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|2617857_2618646_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2618679_2620083_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2620506_2621481_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2621737_2621965_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2623052_2623583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2623579_2625112_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2625108_2626059_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2626479_2627112_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2627354_2627552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2627901_2628330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2628407_2629403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2629547_2629799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2629903_2630548_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2630783_2631281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2631792_2632767_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2633137_2633431_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2634243_2634579_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2634899_2636438_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2636590_2637689_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2637927_2639127_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2639157_2639784_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2639812_2640697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2640830_2641061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2641198_2642440_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_144420613.1|2642719_2643091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2645222_2645384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2645759_2646887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2647003_2647666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2647751_2648012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2648430_2649192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2651253_2651913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2652013_2652664_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2652811_2653501_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377795.1|2653523_2654687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2654891_2655143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619442.1|2655666_2656329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2656462_2657437_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376009.1|2658791_2659082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376008.1|2659404_2660442_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376007.1|2660472_2661927_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376006.1|2661936_2663121_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376005.1|2663194_2664202_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376004.1|2664270_2666274_-	transketolase	NA	NA	NA	NA	NA
WP_017376003.1|2666725_2667886_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376001.1|2668122_2669238_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376000.1|2669400_2669925_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017375999.1|2669924_2670455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2672114_2672990_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2673110_2673611_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2673607_2673874_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2674039_2675014_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2675193_2675814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2676120_2677524_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771922.1|2678358_2679549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|2680115_2680583_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|2681084_2681339_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|2681540_2682044_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|2682260_2682866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2683026_2683710_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2683785_2684565_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|2684551_2685412_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|2685535_2685901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377271.1|2686286_2686616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2687026_2688001_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_144420611.1|2688535_2688736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420610.1|2688768_2690148_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	3.3e-36
WP_017377275.1|2691182_2691905_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2691896_2692265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2692527_2693829_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2693924_2694368_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2694371_2694881_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2694873_2697687_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2698183_2699116_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2699220_2700147_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2700325_2701864_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2702037_2702298_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2703572_2704181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2704227_2704956_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2705202_2705340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619438.1|2706490_2707042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2707276_2708188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2708447_2708744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2709088_2710242_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2710838_2711387_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2711490_2712054_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2712271_2713030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2714305_2714533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2714755_2714935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2715190_2716447_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2716514_2717159_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_017378393.1|2717963_2718170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378392.1|2718440_2718593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816949.1|2719170_2719569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378390.1|2719762_2721340_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378389.1|2721473_2722415_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378388.1|2722416_2723190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963621.1|2724798_2725005_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2725271_2725559_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378384.1|2725564_2727946_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|2727958_2728954_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_016210495.1|2729085_2729445_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378382.1|2729487_2729682_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|2729716_2730247_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378381.1|2730251_2732183_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
>prophage 32
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	2769961	2822990	3195565	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2769961_2770936_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2771092_2772667_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2772891_2773170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2773239_2774115_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2774124_2775285_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2775399_2776548_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2776558_2779360_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2779466_2780165_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2780177_2781941_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2781944_2782292_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2782285_2782660_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2783607_2784891_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2785300_2786596_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2786951_2787497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046622.1|2788090_2788606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2788617_2789997_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2790232_2790667_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2790663_2792016_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2792015_2793131_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2793131_2794148_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2794137_2795808_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2795827_2796163_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2796190_2797630_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2797626_2798673_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2798815_2800312_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2800607_2801609_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2801714_2802326_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2802446_2802824_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2802874_2804281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2804274_2805342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2805448_2807050_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2807298_2808216_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2808284_2809979_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2810213_2811143_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2811173_2812577_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2812807_2813512_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2813578_2814235_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2814245_2815127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2815297_2817967_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2818327_2819302_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2819381_2820353_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2820406_2821381_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2821500_2821722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2821785_2822094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2822018_2822990_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	2837556	2891817	3195565	transposase	Staphylococcus_phage(37.5%)	51	NA	NA
WP_026063658.1|2837556_2838285_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2838594_2838849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2839562_2842217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2842255_2842546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2842662_2843961_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2844531_2845020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2845000_2845303_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2845549_2846038_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2846071_2846710_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2846831_2847371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2847460_2848687_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2849299_2849557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2849643_2850543_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2850687_2850954_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2850945_2851095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2851322_2852198_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2852327_2852555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2852621_2852816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2852874_2853849_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2853886_2854075_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2854075_2855848_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2855837_2856830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2857437_2858130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2858616_2859186_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2859182_2860157_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2860196_2860700_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2860790_2862194_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2862892_2863078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2863183_2864587_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046624.1|2864633_2865164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2865197_2866625_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|2867910_2870280_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2870355_2871174_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2871525_2872071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2872553_2873792_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2873768_2874743_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017375625.1|2874835_2875063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|2875067_2875559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243039.1|2876231_2877119_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_027243038.1|2877208_2878699_-	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_017376549.1|2878722_2879604_-	ROK family protein	NA	NA	NA	NA	NA
WP_017376548.1|2879600_2880323_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376547.1|2881022_2881814_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|2882000_2882246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420598.1|2882397_2882628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376543.1|2882657_2883437_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_047927468.1|2883462_2883768_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_144420752.1|2883764_2884658_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_027243035.1|2885013_2886312_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376538.1|2888914_2890096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2890389_2891817_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	2899403	2948987	3195565	transposase,tRNA	Bodo_saltans_virus(14.29%)	44	NA	NA
WP_062312049.1|2899403_2900771_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2901263_2901743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2901922_2903986_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2903994_2904720_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2905347_2906061_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2906065_2906596_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2906830_2907064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2907176_2907425_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2908232_2910425_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2910442_2910751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2911404_2913114_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2913307_2913463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2914865_2915741_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2916066_2916828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2917052_2917784_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2917780_2918317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2918370_2919135_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2919137_2920715_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2920721_2921198_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2921173_2921605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2921637_2922393_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2922567_2922855_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2923237_2923462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2923801_2924965_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2924999_2925977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2925970_2926657_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2926595_2927711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2927990_2928596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2928833_2929313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2931135_2931789_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2931901_2932453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2932552_2933527_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2933812_2934337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2935034_2935859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2936114_2936471_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2936467_2937871_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2937990_2938551_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2938708_2939275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155070642.1|2939477_2941715_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_027243087.1|2941978_2942674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2942714_2942927_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2944499_2945609_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2945664_2947146_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2947583_2948987_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP039055	Piscirickettsia salmonis strain Psal-098 chromosome, complete genome	3195565	3076669	3142206	3195565	transposase,protease	Hokovirus(14.29%)	58	NA	NA
WP_017376170.1|3076669_3077770_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3078127_3079102_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3079238_3080117_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3080124_3080355_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3080408_3081413_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3081919_3082747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3082828_3084217_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3084504_3085905_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3085999_3086926_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3086922_3088059_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3088055_3089063_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3089059_3090223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3090232_3091084_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3091115_3092288_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3092284_3093673_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3093701_3094109_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3094128_3095136_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3095132_3096005_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3096001_3096862_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3096863_3099134_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3099135_3100281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3100327_3100813_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3100852_3101476_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3107155_3107908_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155046626.1|3108510_3108678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243062.1|3109239_3109863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3109967_3110756_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3110755_3111487_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3111520_3113248_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3113261_3114323_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3114637_3115852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3115984_3116509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3117126_3117975_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3117961_3118660_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3118714_3119476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3119468_3119891_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3120020_3120572_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3120627_3121590_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3121590_3121806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3121992_3122802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3122781_3123624_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3123620_3124865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3125003_3126092_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3126109_3126610_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3126797_3127397_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3127402_3128566_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3128598_3129552_+	glutathione synthase	NA	NA	NA	NA	NA
WP_155048072.1|3129696_3129852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376261.1|3129915_3130980_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3130976_3134039_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3134191_3134644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3134675_3135032_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3135450_3136224_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243067.1|3136783_3136966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376269.1|3138847_3139138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3139362_3140238_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3140234_3140792_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3140802_3142206_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039056	Piscirickettsia salmonis strain Psal-098 plasmid unnamed1, complete sequence	175317	0	51260	175317	transposase	Streptococcus_phage(43.75%)	57	NA	NA
WP_017377655.1|1412_1658_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|1654_2041_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|2128_2857_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|2835_3456_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|3801_4488_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|5437_5800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|5802_7542_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|7943_8096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|8123_8807_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|8888_9866_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|9941_10112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|10152_10881_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_036771293.1|11426_11693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420835.1|11988_13902_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|14308_15037_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420842.1|15098_15257_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|15673_15838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|15858_17145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|17327_18056_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|18183_19161_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046631.1|19235_19886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046632.1|21895_22045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126795.1|22517_22778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|22781_23054_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|23129_23858_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|24426_25398_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|26262_27090_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|27943_28414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|29307_29451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212068.1|30430_30634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|30657_31257_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|31610_32387_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|32747_33476_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|33545_33746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|33664_34636_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027242938.1|35049_35418_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017375972.1|35419_35728_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017375841.1|36172_36382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|36688_36907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242936.1|36903_37356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420845.1|37483_37714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876207.1|38219_39695_-	response regulator	NA	NA	NA	NA	NA
WP_017375966.1|39695_40262_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_146619519.1|40406_40844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|40875_41301_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_036817204.1|41571_42567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817201.1|42870_43278_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017375960.1|43385_44429_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_017375959.1|44730_44964_+	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_146619517.1|45101_45254_-	phosphatase	NA	NA	NA	NA	NA
WP_155050394.1|45283_45565_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_036771347.1|45583_46561_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_144420849.1|47026_48007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|48238_48748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242596.1|48787_49150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275482.1|49463_50438_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_017377509.1|50531_51260_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
>prophage 2
NZ_CP039056	Piscirickettsia salmonis strain Psal-098 plasmid unnamed1, complete sequence	175317	56352	126621	175317	portal,integrase,transposase,terminase	Streptococcus_phage(43.75%)	64	55590:55649	122229:122888
55590:55649	attL	GGCACTGTTGCGAAAAATTATAGTGAGCTTCAGAAAGGTTATTTTCTTGTGCTCTCTGCT	NA	NA	NA	NA
WP_048876202.1|56352_57066_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_036771649.1|57112_57847_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_087910668.1|57884_58271_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_047927581.1|58357_58792_-	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_048876205.1|58996_60328_-|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_075278733.1|60330_60813_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_027242929.1|60899_61283_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_017375952.1|61478_61682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242930.1|61871_63254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242931.1|63399_63807_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242932.1|63815_64043_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_026063496.1|64175_64541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|65627_66605_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|67085_68063_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|68077_68239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|68456_68711_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|68700_68988_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_036771347.1|69482_70460_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155070653.1|70726_70984_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_017377526.1|71385_72246_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243210.1|72575_73310_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.9e-36
WP_047927763.1|73723_73987_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036816769.1|73983_74382_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_036815609.1|74625_75081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619477.1|76945_77239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377667.1|77383_77554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420839.1|78223_79150_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375910.1|79345_80074_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|81222_81843_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|81898_82627_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|83477_83750_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|83752_84481_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420837.1|84510_85443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377509.1|85584_86313_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_036773695.1|86342_88415_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_016212398.1|90475_90937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876221.1|91031_91487_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
WP_048875857.1|92474_93449_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_081000017.1|93849_94101_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_080999971.1|94365_95769_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243203.1|99819_100614_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
WP_017375836.1|100707_100911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|101105_101441_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_048876182.1|102140_104036_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771296.1|104391_106287_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771293.1|106582_106849_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|107388_108363_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027243200.1|108669_109074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|109074_109821_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_036774644.1|110329_111391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963627.1|112370_112589_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036772541.1|112607_113336_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_087910667.1|113487_114171_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_027243197.1|114175_114745_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_036772541.1|114915_115644_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_036815648.1|116127_116856_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420834.1|116908_117304_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036772541.1|117597_118326_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929623.1|118483_121825_-	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_155046639.1|121924_122128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|122293_123022_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
122229:122888	attR	GGCACTGTTGCGAAAAATTATAGTGAGCTTCAGAAAGGTTATTTTCTTGTGCTCTCTGCTTAGAATTAAGCAGCTAATCCAAATAATTTATCAATGAGCTGATTTTGGGCACAGATATTCTGTTTTTTAATATAACGTAATTGACCTTTTTGAACCATGCGCATCGCTTCCATTATGTCAATGGTAGGCCGTGCTGTAGAAAGTGATTGGTACCATTGGCGGAAACGGGATTTGCGCTTTACCGCTTTGTGATCATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACACTGACTAGAAAAGAGACCTTCATCTTTGGCTTTTTGGTGAGCGGGTGGAAATGAAGCGTGCTTGTCGACATTCACAACACGCGGTGATTTCACATAAGGTTGGGCGATTGCCTTTTTGAAAAAGCGCATCGCCGCTTTGGCATTTTGCTGTCGGCTGAGCATCCAGTCCAAAGTATTGCCATATTTATCAATGGCTCGATAAAGGTAATACCAACGACCTTTAATTTTCACCAACGTTTCATCTAACCGCCAAGAGGCACACGTTTGACGAAAGTGGGGCCTCAGCCGTTTGGCGATCTGCGAGCCATACTCGTGCACCCAACGACAAATGGTTGAACGCTCAATCTCAAGACCTCTTTCA	NA	NA	NA	NA
WP_027243202.1|123296_124232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876188.1|124945_125719_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_036774373.1|125892_126621_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
>prophage 3
NZ_CP039056	Piscirickettsia salmonis strain Psal-098 plasmid unnamed1, complete sequence	175317	132476	145138	175317	portal,transposase	Streptococcus_phage(44.44%)	14	NA	NA
WP_017377694.1|132476_133205_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|133451_133601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|133612_134341_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_081000015.1|134370_134757_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876191.1|134692_135121_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_082300723.1|136672_136900_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_155046637.1|137632_138124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|138205_138934_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_146619416.1|139277_139424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243206.1|139729_141595_+	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_080963664.1|141667_141934_-|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_080963665.1|142114_142456_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_048876194.1|142636_143170_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_036774350.1|144409_145138_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
>prophage 4
NZ_CP039056	Piscirickettsia salmonis strain Psal-098 plasmid unnamed1, complete sequence	175317	149634	160432	175317	transposase	Salmonella_phage(40.0%)	10	NA	NA
WP_036771347.1|149634_150612_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_047927782.1|150527_150917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075317322.1|151712_153227_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|153213_154191_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155070655.1|154272_154899_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_075275471.1|155439_156414_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_155046640.1|157049_157217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876214.1|157185_157914_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_017377521.1|158422_158776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|159703_160432_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 5
NZ_CP039056	Piscirickettsia salmonis strain Psal-098 plasmid unnamed1, complete sequence	175317	166796	172699	175317	transposase	Staphylococcus_phage(28.57%)	9	NA	NA
WP_075275473.1|166796_166973_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|167089_167797_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|167750_168629_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243193.1|168659_169202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|169473_170178_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|170189_170918_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|170947_171337_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|171359_172088_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|172090_172699_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
>prophage 1
NZ_CP039058	Piscirickettsia salmonis strain Psal-098 plasmid unnamed3, complete sequence	50585	32334	46130	50585	head,transposase,capsid,tail	Moraxella_phage(18.18%)	18	NA	NA
WP_036771639.1|32334_33309_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|33358_33898_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|33911_34496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|34880_35192_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|35188_35614_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|35792_36188_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|36184_36535_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|36534_36957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|36958_37282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|37338_37605_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|37608_39687_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|39679_40021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|40017_40689_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|40618_41404_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|41393_41951_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|41947_44638_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|44696_45125_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|45152_46130_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 1
NZ_CP039059	Piscirickettsia salmonis strain Psal-098 plasmid unnamed4, complete sequence	33555	3402	19424	33555	head,capsid,transposase,tail,integrase,terminase	unidentified_phage(35.71%)	21	NA	NA
WP_036771330.1|3402_4377_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4912_5503_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5733_5994_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5986_6340_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6516_7491_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|8023_8389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|8533_8788_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8771_9128_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|9225_10200_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|10825_11692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|11904_12288_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|12374_12857_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|12859_13045_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|13064_14039_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|14135_14528_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|14563_15145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|15525_16500_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|16573_16789_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|17592_18108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|18453_19011_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|19007_19424_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
