The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	31810	93955	3189955	tRNA,transposase	uncultured_Caudovirales_phage(16.67%)	54	NA	NA
WP_036772169.1|31810_32686_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33044_34400_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34491_34998_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34994_35363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069402.1|36765_38550_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39030_40158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40230_40986_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|41022_43716_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43747_44299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44406_45420_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45540_45765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46120_46882_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_155069403.1|47024_47360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772017.1|47504_47948_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155069405.1|48251_49004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49315_50842_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50980_52054_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|52093_53401_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53375_54545_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54599_55325_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_155069407.1|55790_57896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|58110_58575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58594_59104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59488_60430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|60471_61875_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773655.1|62341_62746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378420.1|63909_64287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773242.1|66178_66733_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|66871_67771_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|67775_68402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|68346_70668_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|70814_71294_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|71290_72442_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|72576_73080_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|73173_74148_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|74137_75451_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|75491_76871_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|76877_78329_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|78354_78723_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378407.1|78741_79809_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|79841_80738_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|80734_81571_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|81706_82159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|82297_83044_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|83024_83588_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|83596_84112_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|84253_86332_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|86331_87282_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|88149_88548_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|88773_89103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|89719_90739_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155069409.1|90743_92147_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046560.1|92252_92426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376171.1|92980_93955_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 2
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	123133	183712	3189955	tRNA,transposase	Staphylococcus_phage(33.33%)	53	NA	NA
WP_053093682.1|123133_123877_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|124317_124611_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|124611_124866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|124882_127375_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|127367_128051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|128050_129094_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_155069411.1|129093_130323_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_017377402.1|130324_130654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|130650_131850_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|131962_132352_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|132351_133296_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|133415_134813_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|135138_135660_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|135783_136092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|136106_141329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|141719_143726_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|143856_146187_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|146362_147193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|147309_147705_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_155069413.1|147701_147977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|147987_149391_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155069415.1|149544_149784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|149780_150182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069417.1|150441_150897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|150906_151863_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_155068500.1|152372_152897_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|152997_153996_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|154084_154981_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|155054_156341_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|156800_158117_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|158230_158401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|158420_159395_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|159521_159782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|160049_160340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|162809_163784_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377545.1|163985_165026_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|165128_166100_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|166222_167071_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|167222_167510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|167820_168192_+	isochorismatase	NA	NA	NA	NA	NA
WP_155052673.1|168964_169189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|169326_169464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|169477_169690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|170213_171038_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|171176_172310_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|172369_173779_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|173926_175507_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|176210_177206_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|177211_179278_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|179335_180286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|180480_180807_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|181317_182577_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772169.1|182836_183712_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	196314	245908	3189955	protease,transposase	Streptococcus_phage(12.5%)	52	NA	NA
WP_081000012.1|196314_196557_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|196560_196959_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|197190_198066_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155069419.1|198545_199835_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155069421.1|199993_200155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375951.1|200653_201112_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155069423.1|201605_201812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420736.1|201949_202135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069425.1|202091_202724_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_017375949.1|202850_204665_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|205075_205744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|205753_207070_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|207229_208192_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|208272_208428_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|208441_208678_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|208870_210088_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|210065_210524_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_155069427.1|210551_211931_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.1	1.0e-53
WP_075275379.1|211967_212186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069428.1|212505_213801_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|214005_214197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|214395_215271_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|215458_216724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|216757_217633_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|217754_218213_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|218236_219157_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|219284_220067_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|220157_221657_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|221970_223854_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|224113_224776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|224842_225952_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|225963_226608_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|226626_227613_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|227697_228774_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|228975_229800_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|230102_231068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|231386_232439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|232497_233472_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|233807_234236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|234472_234955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|235010_236261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|236363_236582_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|237053_237908_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|237962_238433_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|238729_238966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|239112_239493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|239551_240427_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|241193_242105_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|242221_243070_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|243136_244147_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|244170_244494_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|244504_245908_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	319671	361151	3189955	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_048875904.1|319671_320547_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|320627_321260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|321213_322659_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|322693_323113_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|323886_324255_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|324264_324804_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|324964_325396_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|325399_326098_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|326345_326852_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|326894_327263_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|327533_331610_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|331673_335882_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|336043_336418_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|336522_336996_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|337011_339123_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|339150_340341_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|340347_340659_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|340781_341420_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|341435_342053_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|342049_342346_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|342360_343185_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|343201_343477_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|343482_343815_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|343827_344562_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|344575_344989_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|344988_345189_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|345188_345446_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|345567_345936_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|345953_346265_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|346280_346823_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|346835_347141_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|347169_347562_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|347574_348108_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|348117_348471_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|348481_348982_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|348987_349170_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|349172_349607_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|349607_350930_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|350986_351100_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|351243_351600_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|351625_352015_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|352024_352645_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|352666_353644_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|353692_354091_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|354203_355451_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|355437_356094_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|356178_356457_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|356699_356927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|357059_357854_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155069434.1|358162_358804_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|358962_359142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|359110_359764_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|360072_360321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|360410_361151_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 5
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	367631	424418	3189955	protease,tRNA,transposase	uncultured_Caudovirales_phage(20.0%)	58	NA	NA
WP_017376977.1|367631_369389_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_065653729.1|369390_370494_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376975.1|370574_371126_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_017376974.1|371136_372504_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376973.1|372654_372891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376972.1|372949_373693_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_027242667.1|373692_374334_+	lipoprotein	NA	NA	NA	NA	NA
WP_017376970.1|374333_375998_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_017376969.1|376026_376362_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_027242666.1|376526_378125_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376966.1|378184_378475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772765.1|378675_379107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|379169_381650_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|381736_382216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|382188_383229_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|383165_383882_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|383894_384230_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|384266_384737_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|384779_386615_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|386659_387748_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|387769_388831_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|388908_389424_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|389464_390742_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|390756_391608_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|391636_392284_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|392280_393240_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_017376950.1|393761_394631_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155069436.1|394775_395453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|395558_395999_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_027242664.1|396510_397713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|397996_398971_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_155046564.1|399521_400133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|400129_400387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|400637_401030_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|401159_401708_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|401707_402535_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|402584_404270_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|404347_404809_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|404845_405409_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|405635_405965_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|405945_406170_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|406314_406905_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|406929_408201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|408218_409472_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|409468_410113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|410185_411235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|411336_412974_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|413008_413338_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|413494_413782_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376927.1|414208_414346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|414851_416072_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|416130_418929_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|419234_420401_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|420499_421036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|421097_421430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069438.1|421426_422302_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|422371_422869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|423014_424418_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	500875	535013	3189955	transposase	Salmonella_phage(25.0%)	32	NA	NA
WP_048875873.1|500875_502279_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|502392_502830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|502950_503379_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|503626_504064_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|504495_505884_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|506330_507824_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|508018_508774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|509273_509504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|510608_511619_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|511615_511837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|512555_513497_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|514024_514423_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|514362_515217_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|515308_515590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|515675_516353_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|516398_517679_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|517854_518904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|518982_519783_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|519796_520591_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|520693_521713_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|521759_522371_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|522374_523061_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|523057_523600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|523892_525080_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|525324_526050_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|526235_527024_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|527020_527416_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|527808_528849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|528845_530249_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155069451.1|531094_531802_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|532613_533588_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155069453.1|533627_535013_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	585339	698662	3189955	tRNA,transposase	Planktothrix_phage(13.64%)	93	NA	NA
WP_036772726.1|585339_585888_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_155069755.1|586119_586482_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.3	4.6e-06
WP_017377077.1|586928_588308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|588667_590131_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|590314_591127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|591591_593586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|593980_595360_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|595397_595835_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|595877_596594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|598140_598671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|598737_600558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|601122_601629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|601713_603117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|603231_603486_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|603638_603911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|604785_605361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046568.1|605369_605528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|606428_606671_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|606973_608065_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|608045_608999_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|609222_610707_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|610746_611250_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|611509_612685_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|612832_613237_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|613393_614269_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|614303_614657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069455.1|615102_617148_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.3	2.9e-81
WP_017377052.1|617698_618124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|618354_619491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|619477_620800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|620792_621911_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|622031_622565_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|622703_624341_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|624345_624567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|624675_625689_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|625969_628198_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_026063593.1|628178_628883_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|629117_629447_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|631135_631354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|631412_632288_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|632280_633147_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|633214_634534_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_155069457.1|635003_635627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375592.1|635831_636902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|637176_637971_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155069459.1|638198_639035_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_048876012.1|639342_640746_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|640876_641785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|645481_646321_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|646507_646723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|646771_647347_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|647343_647682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|647850_648840_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|649829_650732_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155069460.1|650991_652395_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|652736_653747_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|654554_655091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|656015_656363_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|656507_657467_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|657568_658351_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|658483_659443_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|659467_659872_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|659900_660575_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|660674_662390_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|662386_662749_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|662763_663918_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|663921_664929_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|664931_665948_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|666163_667249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|667355_667748_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|667880_669164_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|669179_670481_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|670498_672301_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|672305_673298_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|673378_674455_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|674552_675527_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|675594_676566_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|676749_677019_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|677620_678907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|678971_679652_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155052676.1|685307_685595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375775.1|685633_685828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275355.1|685875_686850_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_027242570.1|687063_688203_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|688411_689782_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|690160_691153_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_155069757.1|691240_691672_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|691668_692508_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|692540_694091_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|694198_694570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|695790_695952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069462.1|696532_697717_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772169.1|697786_698662_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	734737	1139289	3189955	protease,tRNA,transposase,integrase	Staphylococcus_phage(13.16%)	350	813887:813946	1108717:1109081
WP_017376198.1|734737_736198_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_017376197.1|736233_737763_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_080999970.1|737796_739200_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377286.1|741338_743147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999971.1|743231_744635_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|745119_746094_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420769.1|746562_747453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243146.1|748113_748950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243147.1|749238_751911_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_080963645.1|752159_753350_+	MFS transporter	NA	NA	NA	NA	NA
WP_155046613.1|753682_753877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377214.1|753813_755466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|756066_757293_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243150.1|757688_758234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377217.1|758193_758571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|758567_759971_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082300719.1|760189_760615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243151.1|760666_762154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377221.1|762475_763015_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_082300723.1|763304_763532_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377224.1|764777_765353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069469.1|765466_765634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377226.1|767154_767445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377227.1|767812_768226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106211.1|768914_770702_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017377229.1|770868_771489_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155046612.1|771835_771976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377230.1|771995_773972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377231.1|774344_775802_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.1	9.4e-98
WP_017377232.1|775870_777451_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	1.1e-16
WP_017377234.1|778091_781988_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	3.4e-118
WP_016210741.1|781994_782318_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_017377235.1|782391_782865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772195.1|782896_783892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069471.1|784194_785781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910659.1|786140_787088_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.3e-35
WP_017377238.1|787406_787751_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_144420626.1|787844_788516_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_017377240.1|788556_789384_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_036772199.1|789470_789998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243013.1|790883_791303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106212.1|791412_791994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377245.1|792348_793629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377246.1|793749_794613_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_155069472.1|794701_795496_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036772212.1|795733_796720_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027243014.1|796725_798252_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_144420771.1|798347_799592_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017377251.1|799645_801025_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_026063614.1|801142_801928_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	3.7e-32
WP_016211687.1|802270_802915_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_017377253.1|802949_804755_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|804778_805354_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|806403_807378_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377700.1|808018_808312_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_155069474.1|808519_809569_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_053093666.1|809626_810304_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081000005.1|812626_812788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|812724_813225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|813320_813749_-	hypothetical protein	NA	NA	NA	NA	NA
813887:813946	attL	TAATGGCACTACCTTAAGAGCTAGATCTGAACAAAAACGCACTTTAGCGCAATAATCACT	NA	NA	NA	NA
WP_048875928.1|814008_814458_+	hypothetical protein	NA	NA	NA	NA	NA
813887:813946	attL	TAATGGCACTACCTTAAGAGCTAGATCTGAACAAAAACGCACTTTAGCGCAATAATCACT	NA	NA	NA	NA
WP_144420628.1|814510_814945_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999973.1|814921_815887_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_017377288.1|816105_816366_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087910637.1|816460_817195_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_155046611.1|817223_817376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|817580_818525_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155069475.1|818510_819047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069477.1|819434_820454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377295.1|820917_821883_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_016209646.1|821927_822503_-	VOC family protein	NA	NA	NA	NA	NA
WP_036771756.1|822533_823808_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420629.1|824456_825173_+	aldolase	NA	NA	NA	NA	NA
WP_017377300.1|825251_825989_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017377301.1|826109_827465_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_075275279.1|827644_828316_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377303.1|828431_829307_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_017377304.1|829907_831212_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|831324_831930_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377305.1|832011_833313_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_017377306.1|833380_835813_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.2e-219
WP_016209655.1|835916_836189_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075275280.1|836271_838170_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_017377308.1|838201_839086_+	hypothetical protein	NA	A0A1W6JP29	Morganella_phage	35.7	2.2e-41
WP_017377309.1|839094_839490_-	CrcB family protein	NA	NA	NA	NA	NA
WP_048875932.1|839913_842061_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	3.1e-25
WP_017377313.1|842032_843382_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377314.1|843378_845499_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_017377315.1|845495_847199_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.0	3.4e-22
WP_017377316.1|847333_848476_-	galactokinase	NA	NA	NA	NA	NA
WP_017377317.1|848532_849561_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_026063623.1|849687_851202_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_017377319.1|851308_851509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420630.1|851653_851989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069479.1|852133_852370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420772.1|852640_853519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875933.1|854155_855100_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999974.1|855373_856777_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|856781_857567_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_048875904.1|857636_858512_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155069481.1|858508_858892_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_017377471.1|859998_860610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377472.1|860678_861485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|861788_862763_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377475.1|862934_864827_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_027243186.1|865333_867715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|867841_869245_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
867720:868255	attR	TAATGGCACTACCTTAAGAGCTAGATCTGAACAAAAACGCACTTTAGCGCAATAATCACTTGAAGTCAGCAACCGTATAAGGTTGTATATTTTCGTCTAACAACTCAGACGGAAACTGACAGATGCATTATGTAATTAATAAACTAAAATCACAAATTGAAAAACAAAAAGCAACCCTTTTAGATGATGAAGGAAGTCTAAGCATTGAAAGCCTTCTGTCCTCCGATAAGTTTCAAAGCATCATCAACAATTGCCGAAGCTTTAGATCGCGTTTTTATACGCCATTTGTAACACTCATACTATTTATACGGCAAGTACTCTCTCCAGATAAATCATGCAAAAATACGGTTGCTACTTTCCTTGCATCAGTGTCGACAGAGGATAATAATAACATCCCATCAAGCAATACAGGACCTTACTGTAAAGCACGTCAAAAGTTACCAATAGAAACGCTTGAATCACTCGTTAAACTCAGTGGAGATAGTTTATCTAAAAGCAGTAATGCACGTTGGAAGATTTATAATCGAGAGGTGAAG	NA	NA	NA	NA
WP_048875935.1|869973_870453_+	hypothetical protein	NA	NA	NA	NA	NA
867720:868255	attR	TAATGGCACTACCTTAAGAGCTAGATCTGAACAAAAACGCACTTTAGCGCAATAATCACTTGAAGTCAGCAACCGTATAAGGTTGTATATTTTCGTCTAACAACTCAGACGGAAACTGACAGATGCATTATGTAATTAATAAACTAAAATCACAAATTGAAAAACAAAAAGCAACCCTTTTAGATGATGAAGGAAGTCTAAGCATTGAAAGCCTTCTGTCCTCCGATAAGTTTCAAAGCATCATCAACAATTGCCGAAGCTTTAGATCGCGTTTTTATACGCCATTTGTAACACTCATACTATTTATACGGCAAGTACTCTCTCCAGATAAATCATGCAAAAATACGGTTGCTACTTTCCTTGCATCAGTGTCGACAGAGGATAATAATAACATCCCATCAAGCAATACAGGACCTTACTGTAAAGCACGTCAAAAGTTACCAATAGAAACGCTTGAATCACTCGTTAAACTCAGTGGAGATAGTTTATCTAAAAGCAGTAATGCACGTTGGAAGATTTATAATCGAGAGGTGAAG	NA	NA	NA	NA
WP_155069483.1|870520_871609_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155069485.1|871574_871778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069487.1|871915_872092_-	phosphatase	NA	NA	NA	NA	NA
WP_155069489.1|872250_872403_-	phosphatase	NA	NA	NA	NA	NA
WP_155069490.1|872362_872737_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376899.1|873141_873282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069492.1|873479_874184_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155069494.1|874281_874500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376902.1|874750_875062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|875125_875305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|875867_876050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|876113_876341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063576.1|876548_877313_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_026063577.1|877539_877833_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_155069495.1|877904_878354_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	35.3	4.9e-13
WP_048875878.1|878358_879762_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376909.1|880231_881209_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_027243158.1|881305_882766_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376911.1|882792_883446_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_017376912.1|883570_884137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774028.1|884433_886167_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_047927497.1|886238_887945_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_017376916.1|887936_888995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375855.1|889361_889808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420773.1|890497_891910_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375857.1|892301_893744_+	MFS transporter	NA	NA	NA	NA	NA
WP_144420774.1|893875_893944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|894142_894640_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155069497.1|894784_895702_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771639.1|895866_896841_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377669.1|896890_897595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069499.1|898035_898899_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420636.1|898907_901418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|901763_902939_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420637.1|904286_904511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875940.1|904539_905703_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_036774146.1|907945_909091_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_027243152.1|909683_910619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069501.1|911172_911325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|912404_913808_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377679.1|914123_914330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243160.1|914427_914958_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_017377681.1|915245_916424_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.6	7.7e-50
WP_144420775.1|916572_920337_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_017377683.1|920395_921898_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_036773927.1|922449_923085_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_016211781.1|923575_924823_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_075275285.1|925045_926482_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|926657_927875_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999976.1|928336_929116_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_155069502.1|929119_929995_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155069504.1|930748_932119_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046609.1|932429_932636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243178.1|934356_935718_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_017375734.1|935828_936200_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_017375735.1|936422_937073_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375736.1|937115_938198_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_069971648.1|938924_939899_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_155069506.1|941319_941529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|942046_942274_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376860.1|944056_945610_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017376859.1|946398_946635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|946754_948158_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376857.1|948184_948415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|948736_948961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|948971_950183_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_155069508.1|950577_950868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069512.1|951072_951765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|951938_952340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|952586_953630_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243219.1|953796_954105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052687.1|954389_954560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875947.1|955188_956238_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875948.1|956306_957329_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_017378198.1|957374_958289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|959257_959485_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378197.1|959441_960311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093667.1|962036_962753_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155069514.1|963197_965069_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.7	1.1e-34
WP_027243175.1|965160_966906_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376029.1|966985_967435_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_016211035.1|967487_967703_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376030.1|967949_968966_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_017376031.1|969014_969644_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376032.1|969984_971196_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048875949.1|971228_971579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|971544_972225_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376035.1|972501_972921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875951.1|973066_973903_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|973946_974921_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420641.1|974940_975576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275290.1|975819_976821_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376037.1|976919_978128_-	MFS transporter	NA	NA	NA	NA	NA
WP_036771498.1|978117_979848_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036771517.1|980031_981168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875952.1|981912_982548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376043.1|982662_983997_-	dihydroorotase	NA	NA	NA	NA	NA
WP_017376044.1|984125_984767_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376045.1|985072_985495_+	universal stress protein	NA	NA	NA	NA	NA
WP_017376046.1|985772_986735_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_075275404.1|986773_987949_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_087910638.1|988037_989738_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_017376050.1|989737_991276_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_017376051.1|991315_992968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|993041_993797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|993983_994859_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420642.1|995123_995318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|995462_995936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046586.1|996205_996379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|996583_997897_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376055.1|997893_998538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|999056_1000244_-	MFS transporter	NA	NA	NA	NA	NA
WP_036772012.1|1000376_1001066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376060.1|1001139_1002489_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_048876123.1|1002592_1004773_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_036772169.1|1004842_1005718_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080999977.1|1005764_1006061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376065.1|1006184_1006592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420776.1|1006571_1007150_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376067.1|1007572_1008235_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1008265_1008634_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376068.1|1008644_1009961_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420644.1|1010207_1010819_+	DedA family protein	NA	NA	NA	NA	NA
WP_065653731.1|1010894_1011074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|1011244_1011538_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_036772670.1|1011778_1012081_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_017376072.1|1012135_1014409_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_016211259.1|1014468_1014714_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_048875954.1|1014838_1015594_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875955.1|1015702_1016677_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_155069516.1|1016653_1016803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771709.1|1017172_1017934_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_017376076.1|1017917_1018874_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_155069518.1|1019136_1021635_+	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	1.4e-85
WP_017376078.1|1021638_1022379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1022587_1023562_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376079.1|1023934_1024729_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376080.1|1024891_1025680_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376081.1|1025676_1026888_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_144420777.1|1026880_1027237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376083.1|1027331_1027760_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_036771725.1|1027911_1029021_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376085.1|1029017_1029746_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_017376086.1|1029803_1030691_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376087.1|1030775_1031150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376088.1|1031249_1032527_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_080963644.1|1032538_1033270_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_144420645.1|1033241_1034498_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_027242841.1|1034607_1036011_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_155046606.1|1036163_1036334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|1037739_1038570_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242840.1|1038853_1039675_+	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_017375751.1|1039671_1040565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375750.1|1040610_1041132_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375749.1|1041209_1041695_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_048875957.1|1041828_1042485_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375746.1|1042481_1042790_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_155069520.1|1043138_1044110_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377899.1|1044414_1045206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875958.1|1045195_1046059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377897.1|1046085_1046505_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_017377896.1|1046557_1047514_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_027242839.1|1047996_1050669_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377894.1|1050749_1051376_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_026063687.1|1051532_1053131_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377892.1|1053220_1054642_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377891.1|1054672_1055194_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_017377890.1|1055190_1055796_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_017377889.1|1055872_1056883_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.9e-07
WP_017377888.1|1056995_1057700_+	protein TolQ	NA	NA	NA	NA	NA
WP_017377887.1|1057734_1058166_+	protein TolR	NA	NA	NA	NA	NA
WP_036771700.1|1058168_1059263_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_048875959.1|1059322_1060675_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_017377882.1|1060710_1061352_+	OmpA family protein	NA	NA	NA	NA	NA
WP_144420778.1|1061424_1062324_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_027242836.1|1062326_1062974_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.6	1.6e-36
WP_027242835.1|1063024_1063828_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	6.8e-42
WP_017377879.1|1064009_1064225_+	SlyX family protein	NA	NA	NA	NA	NA
WP_017377878.1|1064228_1064462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377877.1|1064523_1066116_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_017377875.1|1066318_1067248_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.9	7.0e-14
WP_017377874.1|1067249_1068017_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927659.1|1068382_1069153_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_036771330.1|1069211_1070186_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377870.1|1070293_1070656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377869.1|1070825_1072535_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_048875941.1|1072775_1073087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069522.1|1073083_1074166_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619530.1|1074217_1074475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|1075223_1076531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773793.1|1076990_1077368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|1077512_1077914_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875964.1|1078478_1079258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|1079325_1079466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069524.1|1079722_1080313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|1080495_1081968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|1082370_1084116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|1084551_1085412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378007.1|1085929_1087873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069525.1|1088018_1089422_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378006.1|1089541_1090171_-	response regulator	NA	NA	NA	NA	NA
WP_017378005.1|1090409_1091129_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378004.1|1091242_1094782_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378003.1|1094848_1095679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773465.1|1095665_1097705_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_027243145.1|1097720_1098776_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_017377998.1|1098786_1099317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069527.1|1101216_1102104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|1102704_1103088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|1103097_1103457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774554.1|1103742_1104021_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999979.1|1104103_1104250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875941.1|1104488_1104800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069528.1|1104796_1105732_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|1105987_1106167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069530.1|1106516_1106813_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155069532.1|1107017_1107428_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0N7C035	Escherichia_phage	32.0	2.1e-07
WP_075275295.1|1107632_1107959_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999971.1|1108730_1110134_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377761.1|1110304_1111675_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_144420780.1|1111721_1112621_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377763.1|1112601_1115406_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377764.1|1115485_1116082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377765.1|1116495_1117251_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_082300723.1|1117340_1117568_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242898.1|1118684_1119326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377768.1|1119595_1120921_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_047927230.1|1120917_1122975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377771.1|1122952_1123525_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420781.1|1123607_1123940_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_017377773.1|1124004_1125039_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_027242897.1|1125026_1126148_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|1126241_1127225_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_027242896.1|1127381_1129049_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.3	1.2e-19
WP_027242895.1|1129335_1130187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377782.1|1130883_1133352_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_017377783.1|1133365_1134340_+	homoserine kinase	NA	NA	NA	NA	NA
WP_017377784.1|1134326_1135595_+	threonine synthase	NA	NA	NA	NA	NA
WP_027242894.1|1135628_1137377_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155069534.1|1137556_1137856_+|transposase	transposase	transposase	Q716C1	Shigella_phage	37.1	1.1e-05
WP_144420652.1|1138074_1138752_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_047927086.1|1139031_1139289_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
>prophage 9
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	1179629	1278448	3189955	tRNA,transposase	uncultured_Mediterranean_phage(20.83%)	80	NA	NA
WP_155069539.1|1179629_1180322_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155069541.1|1180872_1181070_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155069543.1|1181274_1182135_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	2.6e-23
WP_017376395.1|1183022_1185749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|1186272_1187247_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376397.1|1187444_1188926_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1189385_1190048_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376398.1|1190289_1191522_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017376399.1|1191678_1194450_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376400.1|1194518_1194962_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376401.1|1195114_1196587_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376402.1|1196698_1197760_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_027242800.1|1197756_1198791_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376405.1|1198793_1199834_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_026063528.1|1200018_1201134_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376407.1|1201172_1201526_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_155069544.1|1201546_1203415_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376409.1|1203436_1204381_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376410.1|1204614_1204893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1205255_1205894_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376411.1|1205868_1207293_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_017376412.1|1207493_1208171_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_027242801.1|1208291_1209566_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376414.1|1209633_1210389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376415.1|1210440_1211358_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376416.1|1211492_1211663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420654.1|1211782_1212562_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1212614_1212902_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929627.1|1212961_1213312_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046603.1|1213505_1213658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999981.1|1213585_1214059_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_048875973.1|1214071_1214707_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|1215218_1216094_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376433.1|1217988_1219347_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_026063530.1|1219570_1219759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376430.1|1219772_1220906_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_048875975.1|1221106_1224979_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376428.1|1225013_1225739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|1226128_1226857_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155069546.1|1226917_1227745_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242802.1|1227926_1228295_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_017376425.1|1228291_1229110_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_017376424.1|1229210_1230026_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376423.1|1230309_1232370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1232366_1232792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376421.1|1232977_1234471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1234603_1235419_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376419.1|1235514_1235931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376418.1|1236313_1236853_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_144420656.1|1237769_1237931_-	phosphatase	NA	NA	NA	NA	NA
WP_144420657.1|1238642_1239704_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155069548.1|1241194_1241548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242803.1|1241756_1243469_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.5e-25
WP_155069550.1|1243915_1245769_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	2.2e-43
WP_016209821.1|1245871_1246204_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_017377485.1|1246234_1246831_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_017377486.1|1246827_1247952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377487.1|1248063_1248711_+	hypothetical protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_017377488.1|1248762_1250676_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	1.8e-117
WP_017377489.1|1250880_1251918_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242805.1|1251976_1255303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242806.1|1256009_1256978_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_017377494.1|1257107_1257596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069552.1|1258019_1258481_+	response regulator	NA	NA	NA	NA	NA
WP_017375667.1|1258969_1259455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275301.1|1259725_1259995_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_017377496.1|1260029_1261355_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.3e-37
WP_144420783.1|1261410_1262058_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027242809.1|1262251_1264210_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	2.5e-45
WP_155069554.1|1264353_1267284_+	peptidase M16	NA	NA	NA	NA	NA
WP_036771347.1|1267380_1268358_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|1268467_1269445_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|1269955_1270933_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155069555.1|1271012_1271606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376680.1|1271737_1272970_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1272959_1273622_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1273896_1275153_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1275290_1275950_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1276024_1276726_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1277473_1278448_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 10
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	1292859	1504079	3189955	tRNA,transposase	Staphylococcus_phage(22.22%)	166	NA	NA
WP_036771330.1|1292859_1293834_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1293949_1294855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1295453_1296200_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1296452_1296845_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1296882_1297530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815628.1|1298024_1298852_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080999995.1|1298957_1300328_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155069559.1|1301012_1301666_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242970.1|1301725_1303705_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_026063557.1|1303835_1304654_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_087910646.1|1304738_1305863_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_026063558.1|1305865_1306432_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	2.8e-74
WP_155069561.1|1306545_1306947_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375873.1|1307335_1307497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|1308168_1309143_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017375871.1|1309367_1309916_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_144420795.1|1310043_1310721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242968.1|1310837_1314329_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_017375867.1|1314386_1315640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375866.1|1315749_1316652_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	3.2e-56
WP_017375865.1|1316706_1317744_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_017375864.1|1317881_1319120_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_047927270.1|1319112_1319838_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	6.4e-31
WP_017375862.1|1319941_1321669_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|1321969_1322323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375861.1|1322731_1323232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876023.1|1323571_1324675_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1324765_1325918_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_155069562.1|1326331_1327207_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377952.1|1327806_1330173_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1330220_1331417_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1331985_1334418_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1334739_1336239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1336347_1336920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069564.1|1337234_1338704_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1338776_1339526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1339529_1340303_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1340401_1341352_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1341491_1342934_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1343149_1344334_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1344457_1345144_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1345279_1345864_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1345953_1346283_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1346618_1346858_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_017377970.1|1346906_1347098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1347872_1348166_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155069566.1|1348370_1348619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069568.1|1348756_1348933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378162.1|1349278_1349818_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1350156_1350801_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1351134_1351785_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1352308_1353361_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1353378_1356459_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1356624_1356873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|1356938_1357814_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1358736_1359243_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1359260_1359458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1359476_1359620_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_048876031.1|1359687_1361091_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155069569.1|1361388_1361652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069571.1|1361710_1362685_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.2e-29
WP_017377787.1|1364553_1364781_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_155069573.1|1364756_1364936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376639.1|1364953_1365574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242925.1|1365577_1366741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069575.1|1366753_1369768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420695.1|1369912_1371346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971656.1|1371361_1371634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275427.1|1372912_1372984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772036.1|1374239_1374746_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027242922.1|1374762_1376262_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_027242921.1|1376276_1376900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242920.1|1376905_1378069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376650.1|1378100_1380641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376651.1|1380672_1382565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275426.1|1382926_1383649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376655.1|1383651_1386531_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_027242917.1|1386531_1386936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772028.1|1386950_1388672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242914.1|1388671_1391620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376660.1|1391622_1393020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376661.1|1393033_1393774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376662.1|1393754_1394189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242913.1|1394233_1394863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376663.1|1394927_1395842_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_036772026.1|1395879_1396755_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1396859_1400162_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1400158_1401982_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1402021_1402420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1402528_1403545_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1403979_1405434_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1405515_1408572_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_155069577.1|1409368_1409590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376676.1|1410466_1410931_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1411003_1412005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069578.1|1414603_1415518_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036771585.1|1416756_1417089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774196.1|1417266_1418238_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420692.1|1418241_1418631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069580.1|1418476_1418788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1419162_1419762_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1419761_1420109_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1420259_1421243_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_026063521.1|1424301_1424718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1425846_1426563_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1427311_1427470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1427518_1428094_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1428238_1428517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1428581_1429457_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1429622_1433489_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1433644_1434454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1434503_1435325_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1435524_1436757_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1436927_1437653_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1437695_1439234_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1439240_1440626_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_155069582.1|1440939_1441989_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1442548_1442926_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|1443117_1443993_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1444974_1445202_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1445254_1445773_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_146619432.1|1446028_1446220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420793.1|1446628_1447402_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243181.1|1447515_1448487_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376772.1|1448468_1449440_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069971648.1|1450017_1450992_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_155069584.1|1451177_1451981_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155069586.1|1452251_1452635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|1452860_1453196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375878.1|1453533_1453806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243180.1|1453877_1455137_-	phosphoesterase	NA	NA	NA	NA	NA
WP_017375881.1|1455221_1456487_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_026063485.1|1456645_1457128_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_036772592.1|1457205_1458666_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_155046587.1|1458788_1458929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|1459342_1459843_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_017375698.1|1465957_1467151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243221.1|1467494_1469123_+	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_027243222.1|1469138_1470287_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_051929845.1|1470361_1471186_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1471589_1472564_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1472749_1473343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1473523_1473988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1474382_1474664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1474660_1476064_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1476715_1477096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1477335_1477563_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_155069588.1|1478775_1479771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1479970_1481020_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155069590.1|1480996_1482814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1483084_1483663_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1483690_1484155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1484191_1485649_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1485710_1487198_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1487967_1488570_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1489131_1489602_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1491249_1491993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1492144_1492576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1495213_1496560_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1496647_1498453_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1498918_1499716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1500100_1500562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1500784_1501759_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155069592.1|1502746_1502887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|1502883_1503858_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1503956_1504079_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	1517134	1639677	3189955	protease,tRNA,transposase,integrase	Staphylococcus_phage(32.26%)	112	1577163:1577222	1587624:1587914
WP_036771330.1|1517134_1518109_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1518236_1519262_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1519914_1520202_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1520261_1520594_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046603.1|1520773_1520926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069594.1|1520853_1521336_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	47.0	2.3e-32
WP_036771330.1|1523691_1524666_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376814.1|1525315_1526041_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_026063564.1|1526415_1529235_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_048876146.1|1530084_1531218_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_017376809.1|1531442_1533212_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_017376808.1|1533350_1534394_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376807.1|1534407_1535151_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_027243093.1|1535263_1535581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1535642_1535822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069596.1|1535884_1536592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420791.1|1537663_1538875_+	protein kinase	NA	NA	NA	NA	NA
WP_017376801.1|1538930_1539755_-	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_017376798.1|1540942_1541578_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017376797.1|1541859_1542219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1542492_1544778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420683.1|1544766_1545423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|1545599_1546232_+	MarC family protein	NA	NA	NA	NA	NA
WP_027243097.1|1546267_1546453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243098.1|1546518_1547664_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243099.1|1547899_1549213_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_155046588.1|1550328_1550538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420682.1|1551072_1551234_-	phosphatase	NA	NA	NA	NA	NA
WP_017376785.1|1552640_1553546_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027242578.1|1554008_1554545_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_027242577.1|1554562_1555864_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_036774259.1|1555860_1556835_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420681.1|1557166_1557352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1557531_1557696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1557697_1558573_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155069598.1|1558888_1559764_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1559779_1560163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1561363_1561591_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243017.1|1562347_1563691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378522.1|1563864_1564044_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1564087_1565062_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_047927346.1|1565209_1567081_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1567113_1567212_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1567447_1568077_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1568060_1568483_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1568489_1570229_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1570229_1571294_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1571297_1571651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1571913_1572882_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1572891_1573203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1573218_1573788_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1574051_1575380_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_155069599.1|1575420_1576395_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_155069601.1|1576453_1577095_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
1577163:1577222	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_146619459.1|1577614_1580071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1580273_1581125_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1581170_1582877_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1584348_1585323_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1585685_1585931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1586294_1587323_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1587453_1587657_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420679.1|1587941_1588898_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
1587624:1587914	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGGCCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTAGTGGAGTGTGCCGCTTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTCT	NA	NA	NA	NA
WP_047927838.1|1589190_1589436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1589432_1589732_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1589954_1590425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1591035_1591263_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036772851.1|1592485_1592803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243023.1|1592796_1593039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243024.1|1593389_1594490_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_017377328.1|1594658_1595960_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_047927520.1|1596036_1596540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|1596715_1598119_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1598306_1599164_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1599288_1599924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1599972_1600224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1600479_1601379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1601515_1602589_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1602689_1603103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1603123_1603837_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1604024_1605437_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1605646_1606615_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1607636_1608005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1608008_1608326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1608401_1609376_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1609895_1610396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069603.1|1610654_1610792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773519.1|1612218_1613607_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1613754_1615065_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1615405_1616689_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1616762_1617383_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_155069605.1|1617581_1617776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046592.1|1617934_1618081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1618056_1618650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069607.1|1620513_1621488_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	4.7e-29
WP_036772303.1|1621696_1622467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1622553_1622769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1622865_1623987_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_017376171.1|1624253_1625228_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1625559_1626681_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1626973_1627261_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1627233_1627737_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_155069608.1|1627817_1628693_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1628833_1629808_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_075275317.1|1629937_1630111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1630776_1632135_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_017376486.1|1632209_1632773_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376485.1|1632967_1634197_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1634242_1634869_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1635018_1636206_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1636214_1636907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|1637028_1638181_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|1638702_1639677_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 12
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	1698012	1794228	3189955	protease,tRNA,transposase	Staphylococcus_phage(10.0%)	85	NA	NA
WP_036774017.1|1698012_1698888_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1699277_1699616_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1699612_1700209_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1700211_1702206_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1702269_1703208_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_155069617.1|1703556_1704252_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	7.1e-11
WP_155069619.1|1704498_1704846_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	39.5	1.2e-08
WP_080999986.1|1705310_1705508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1705669_1706074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1707945_1708386_+	universal stress protein	NA	NA	NA	NA	NA
WP_155069621.1|1708835_1708988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420669.1|1709888_1710131_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155069622.1|1710291_1710792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1712003_1712969_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1713061_1713373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1713573_1714350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1715179_1715371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1716099_1717149_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1717319_1718093_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1718153_1719743_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1719933_1721025_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1721047_1721365_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1721451_1722729_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1722750_1723587_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1723593_1725228_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1725659_1726019_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1726300_1727659_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1727684_1727927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1728420_1728600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1728855_1730112_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1730225_1730483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1730627_1731638_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1732014_1732869_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1732898_1733732_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155069624.1|1734308_1734863_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_082300723.1|1735821_1736049_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875990.1|1736005_1736782_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1736986_1737322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1737720_1738077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1738238_1738514_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1738623_1738971_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1738988_1739768_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1739767_1740277_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1740312_1740561_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1740872_1741208_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1741507_1742758_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1742839_1744867_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1745412_1745631_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1745802_1746165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1746313_1747717_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1747998_1749174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1749191_1751189_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1751169_1752150_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1752205_1753048_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_027242816.1|1753047_1753452_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1753444_1753864_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1753886_1754516_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1755084_1757274_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1757285_1758491_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1758475_1760323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1760307_1761546_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1761532_1763401_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1763434_1764688_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1764693_1765551_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1765569_1766298_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377787.1|1767436_1767664_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036771330.1|1769156_1770131_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376477.1|1770427_1770817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1770993_1771752_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1771748_1774148_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1774161_1775439_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1775528_1776827_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1777024_1777918_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1777917_1779132_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_048876132.1|1779151_1780405_-	GTPase HflX	NA	NA	NA	NA	NA
WP_026063533.1|1780453_1780708_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_017376470.1|1780967_1782335_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_017376469.1|1782691_1783714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376467.1|1784233_1785709_+	APC family permease	NA	NA	NA	NA	NA
WP_036772167.1|1785928_1786876_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_017376465.1|1787417_1788980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046597.1|1789524_1789701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|1789815_1790691_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1791063_1791327_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_155069626.1|1791633_1794228_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
>prophage 13
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	1799894	1867768	3189955	tRNA,transposase	Staphylococcus_phage(25.0%)	59	NA	NA
WP_036773947.1|1799894_1800770_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1801047_1802808_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1802901_1803567_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1803579_1805085_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1805106_1805637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1805710_1806973_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1807159_1808032_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1808133_1808922_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1809014_1810340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1810693_1811869_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1812037_1812691_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1812846_1814787_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1814783_1815407_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1815571_1816546_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1816817_1817438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1817434_1818838_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155069628.1|1818905_1819103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069630.1|1819101_1819269_+	phosphatase	NA	NA	NA	NA	NA
WP_017375607.1|1819406_1819610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1820017_1820515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069631.1|1820511_1821486_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875985.1|1821529_1822135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1822279_1822816_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1822820_1823117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1823125_1823731_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_155069633.1|1823916_1824600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1824744_1824900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1825024_1825477_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1825593_1827066_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1827504_1827969_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1828657_1829908_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1830017_1830488_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1830510_1831104_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1831241_1832291_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1832314_1833238_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1833254_1833716_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1833823_1834642_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1835251_1835395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075278722.1|1835412_1836288_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378228.1|1839270_1840191_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_017378229.1|1840197_1842090_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.8	9.7e-87
WP_027242797.1|1842154_1843705_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_017378231.1|1843829_1844501_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_017378232.1|1844509_1845361_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_017378233.1|1845537_1846836_+	PAS domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_017378234.1|1846973_1848320_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_036771503.1|1848497_1849601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771505.1|1849761_1850262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378239.1|1850466_1850736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378240.1|1851084_1852362_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_017378241.1|1852358_1852535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378242.1|1853005_1854607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378243.1|1854623_1855766_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_017378245.1|1856028_1856757_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_017378246.1|1856779_1858051_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_155069635.1|1858723_1864033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378249.1|1864092_1865832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378250.1|1866409_1866643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1866793_1867768_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 14
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	1904051	1924366	3189955	transposase	Acinetobacter_phage(50.0%)	21	NA	NA
WP_048875973.1|1904051_1904687_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420659.1|1904963_1905743_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420658.1|1905775_1906537_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1906513_1907503_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1907638_1908514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1908532_1909192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148037443.1|1909218_1909428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1909433_1909880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1909876_1911280_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1911393_1912239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1912383_1914033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1914123_1914909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1916349_1917753_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155069639.1|1917920_1918199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|1918278_1919256_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_048876026.1|1919562_1919829_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420796.1|1920058_1921177_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774270.1|1921321_1921657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069641.1|1921667_1922081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375562.1|1923289_1923454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1923490_1924366_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	1933794	1978259	3189955	tRNA,transposase	Indivirus(20.0%)	40	NA	NA
WP_155069644.1|1933794_1934898_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772169.1|1934967_1935843_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_047927184.1|1935839_1936184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963581.1|1936193_1936655_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_027242985.1|1936668_1938060_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_027242986.1|1938101_1941089_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_027242987.1|1941158_1941992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069646.1|1942046_1943228_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_027242989.1|1943215_1943920_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_027242990.1|1943965_1944751_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_027242991.1|1944778_1945516_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|1945620_1947816_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242992.1|1947890_1948574_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_027242993.1|1948584_1949016_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242994.1|1949061_1949460_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242995.1|1949836_1950544_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_027242996.1|1950608_1950905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619421.1|1950943_1951423_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_027242998.1|1951476_1951998_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_027242999.1|1952079_1953174_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_048876031.1|1954140_1955544_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155069648.1|1955632_1956361_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	6.6e-44
WP_155069650.1|1956518_1957490_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420659.1|1957641_1958421_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1958697_1959333_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375890.1|1959502_1960066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375891.1|1960201_1961677_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375892.1|1961683_1961890_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375893.1|1961947_1963018_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375757.1|1965834_1967394_+	APC family permease	NA	NA	NA	NA	NA
WP_144420701.1|1967990_1968347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243002.1|1969187_1969847_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027243003.1|1969942_1971304_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_017377787.1|1971445_1971673_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375762.1|1972724_1974065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963648.1|1974715_1974877_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155069652.1|1974976_1975804_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155069654.1|1976157_1977033_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036771330.1|1977076_1978051_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_047927692.1|1978070_1978259_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	1995761	2062048	3189955	transposase	Burkholderia_virus(22.22%)	50	NA	NA
WP_048876034.1|1995761_1996454_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375561.1|1996450_1996594_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1997937_1998165_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375766.1|1999471_2001502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|2001568_2002594_-	FUSC family protein	NA	NA	NA	NA	NA
WP_027242772.1|2002586_2003633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771312.1|2003773_2004769_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_048876036.1|2005066_2005705_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_017375978.1|2006418_2007606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375977.1|2007771_2008725_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036771316.1|2008747_2010766_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375975.1|2010854_2011178_-	YqcC family protein	NA	NA	NA	NA	NA
WP_155046584.1|2011426_2011603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069759.1|2011830_2012706_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016209463.1|2012877_2013261_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_048876037.1|2013905_2014379_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027242774.1|2014484_2015855_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_048876038.1|2015970_2016702_+	hypothetical protein	NA	M1IDP9	Pelagibacter_phage	35.8	9.1e-09
WP_027242775.1|2016726_2017824_-	alanine racemase	NA	NA	NA	NA	NA
WP_048876039.1|2017859_2019278_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	2.0e-153
WP_027242777.1|2019487_2019940_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|2019951_2020179_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_027242778.1|2020228_2020555_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_155069656.1|2020758_2021448_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036771340.1|2021596_2022085_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_027242781.1|2022125_2023229_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_027242782.1|2023271_2024354_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	4.5e-73
WP_080963651.1|2024346_2024907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771345.1|2024897_2026202_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_155069657.1|2026255_2027278_-	chorismate mutase	NA	NA	NA	NA	NA
WP_027242785.1|2027302_2028319_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_155069660.1|2028751_2031919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929877.1|2032270_2032894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378208.1|2033676_2035227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378207.1|2035521_2036277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2036985_2037960_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378201.1|2040868_2041540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2042618_2044022_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242788.1|2045609_2049011_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_017378193.1|2049007_2051701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378192.1|2052004_2053504_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_027242789.1|2054170_2054992_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_146619408.1|2055063_2055549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2055697_2057101_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816728.1|2057097_2057694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069661.1|2057894_2058383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242790.1|2058628_2060803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|2060825_2061506_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_144420705.1|2061534_2061735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2061820_2062048_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 17
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	2072067	2134280	3189955	transposase	Escherichia_phage(33.33%)	54	NA	NA
WP_155069663.1|2072067_2073117_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|2073647_2074523_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929548.1|2074763_2075438_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999996.1|2075466_2075955_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_080999997.1|2077000_2077435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|2077640_2078723_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2078719_2079031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927811.1|2079278_2080790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069665.1|2080966_2081110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876046.1|2082038_2082332_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_144420706.1|2082289_2082868_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876047.1|2082953_2083829_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378015.1|2083821_2084178_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_017378014.1|2084186_2084582_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155069667.1|2085906_2086467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876048.1|2087589_2089479_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_027243106.1|2089513_2090719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420707.1|2090721_2092020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243104.1|2092000_2093224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243103.1|2093273_2094074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377848.1|2094070_2094469_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_027243102.1|2094465_2094774_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|2095167_2095896_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155069669.1|2095936_2096581_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377852.1|2096593_2097061_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|2097115_2098090_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963625.1|2098119_2098737_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|2098715_2099177_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_017377856.1|2099220_2100156_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377857.1|2100183_2101179_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377858.1|2101402_2102365_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377694.1|2103504_2104233_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963626.1|2104283_2105918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|2106188_2107376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377863.1|2107977_2108415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|2110948_2111221_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_036772457.1|2111296_2111605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876052.1|2114601_2115348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2115316_2116045_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155069761.1|2116592_2116775_+	phosphatase	NA	NA	NA	NA	NA
WP_155069671.1|2117239_2118145_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376294.1|2118631_2119924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376293.1|2120159_2122910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376291.1|2124270_2124492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242868.1|2124548_2125016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|2125016_2125718_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420801.1|2125979_2126162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773579.1|2126415_2126790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420802.1|2126899_2128891_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2128880_2129927_-	glutathione synthase	NA	NA	NA	NA	NA
WP_017376284.1|2130367_2131219_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_017376283.1|2131219_2132137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046581.1|2132532_2132706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774196.1|2133308_2134280_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	2142087	2197027	3189955	protease,tRNA,transposase,integrase	Burkholderia_virus(22.22%)	48	2132250:2132309	2193952:2194122
2132250:2132309	attL	AGCGGCACACTCCACTACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGAC	NA	NA	NA	NA
WP_036771330.1|2142087_2143062_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155069672.1|2143058_2144216_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963583.1|2144283_2145210_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242871.1|2145505_2146267_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211971.1|2146468_2147080_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_051929560.1|2147100_2148300_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_017377024.1|2148394_2148535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|2148547_2148952_-	SufE family protein	NA	NA	NA	NA	NA
WP_017377022.1|2149182_2149752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2150184_2150412_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242872.1|2151462_2152320_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_144420712.1|2152316_2153078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242873.1|2153162_2155892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2156025_2156901_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065653747.1|2157165_2158506_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|2158568_2159282_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_155069674.1|2159450_2159942_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_017377014.1|2160081_2160573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242876.1|2160775_2161666_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_026063591.1|2162050_2162635_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242877.1|2162715_2163654_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_036771855.1|2163705_2164800_-	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_047927528.1|2164924_2166247_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_017377008.1|2166294_2171181_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_017377007.1|2171275_2171578_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_027242879.1|2171688_2173611_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_027242880.1|2173632_2174928_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_017377006.1|2174924_2176535_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052106204.1|2176641_2177535_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377003.1|2177644_2178268_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_017377001.1|2178974_2179673_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377000.1|2179816_2180386_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_026063589.1|2180701_2181328_-	porin family protein	NA	NA	NA	NA	NA
WP_017376998.1|2181524_2182271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376997.1|2182366_2183206_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_016210463.1|2183256_2183604_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376996.1|2183794_2184682_+	ROK family protein	NA	NA	NA	NA	NA
WP_017376995.1|2184796_2185399_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376994.1|2185395_2186115_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_080963631.1|2186183_2187896_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376991.1|2188043_2189981_+	AsmA family protein	NA	NA	NA	NA	NA
WP_027242882.1|2190093_2191143_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376990.1|2191142_2191418_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_017376989.1|2191498_2192047_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017377787.1|2192371_2192599_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_155069763.1|2193600_2193951_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_027243109.1|2194351_2195008_-	hypothetical protein	NA	NA	NA	NA	NA
2193952:2194122	attR	AGCGGCACACTCCACTACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGCCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_048876031.1|2195623_2197027_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	2219095	2265149	3189955	transposase	Staphylococcus_phage(45.45%)	39	NA	NA
WP_036771330.1|2219095_2220070_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046579.1|2220385_2220547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069678.1|2220543_2221947_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|2222060_2222828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2223186_2224590_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963604.1|2225410_2225611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377826.1|2225851_2227297_+	MFS transporter	NA	NA	NA	NA	NA
WP_155069680.1|2228813_2229967_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.2e-58
WP_027243174.1|2232066_2232348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046578.1|2232566_2232746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927196.1|2232905_2233925_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_017376520.1|2233911_2234334_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_017376521.1|2234335_2234809_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376522.1|2234942_2235599_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376523.1|2235595_2236270_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376524.1|2236275_2237424_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376525.1|2237420_2237882_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376526.1|2237957_2239208_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376527.1|2239334_2241014_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_027243172.1|2241125_2242007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772261.1|2243444_2244038_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075275347.1|2244399_2244915_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|2245854_2246139_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420804.1|2246400_2246676_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155069682.1|2247495_2248311_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	7.2e-15
WP_017377745.1|2249475_2249874_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377746.1|2250026_2250344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377747.1|2250422_2250677_-	LapA family protein	NA	NA	NA	NA	NA
WP_155069684.1|2250829_2252479_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377749.1|2252539_2253223_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_036773645.1|2253222_2254308_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377751.1|2254349_2256986_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	6.9e-99
WP_017377754.1|2258682_2260002_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|2260005_2260722_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377756.1|2260718_2261360_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_144420715.1|2261352_2261487_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242981.1|2261735_2262191_-	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_027242980.1|2262282_2262627_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048876031.1|2263745_2265149_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	2280650	2345395	3189955	tRNA,transposase	Staphylococcus_phage(25.0%)	58	NA	NA
WP_155069686.1|2280650_2281340_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.7	1.2e-10
WP_051929647.1|2281370_2281652_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	39.2	9.1e-10
WP_027242974.1|2282902_2283559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069688.1|2283575_2285786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242972.1|2286462_2287755_-	MFS transporter	NA	NA	NA	NA	NA
WP_027242971.1|2288081_2290145_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_017376742.1|2290147_2290795_+	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_017376743.1|2290810_2291443_+	endonuclease III	NA	NA	NA	NA	NA
WP_017376744.1|2291503_2291941_+	DUF1841 family protein	NA	NA	NA	NA	NA
WP_048875904.1|2292197_2293073_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046575.1|2294085_2294223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242567.1|2294923_2295706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376750.1|2296013_2296652_-	DUF4937 domain-containing protein	NA	NA	NA	NA	NA
WP_017376751.1|2297126_2297801_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	45.4	8.9e-35
WP_017376752.1|2297934_2298297_+	sulfurtransferase complex subunit TusD	NA	NA	NA	NA	NA
WP_017376753.1|2298293_2298650_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_017376754.1|2298657_2298954_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_017376755.1|2298961_2299294_+	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_016210720.1|2299381_2300011_-	MarC family protein	NA	NA	NA	NA	NA
WP_036773672.1|2300277_2301714_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_048876062.1|2302005_2302761_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_017376759.1|2302862_2303081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376760.1|2303150_2304071_+	1-aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_027242566.1|2304077_2304488_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376763.1|2304681_2305479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376764.1|2305481_2305850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773673.1|2305932_2306748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376766.1|2306846_2307626_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377993.1|2313352_2314210_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_017377992.1|2314196_2315120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377991.1|2315316_2316708_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_017377990.1|2316754_2317798_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	27.6	3.1e-18
WP_017377989.1|2317810_2318281_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377988.1|2318413_2319604_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_144420806.1|2319962_2320214_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_048875859.1|2320355_2321150_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036773621.1|2321439_2322363_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_017377984.1|2322630_2322924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377983.1|2324126_2325050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377982.1|2325185_2326028_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_017377981.1|2326115_2326766_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.6	2.7e-20
WP_017377980.1|2326779_2327820_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	2.9e-69
WP_036773623.1|2327942_2329028_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_027243121.1|2329054_2330164_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377976.1|2330468_2330786_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377975.1|2330782_2331142_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377974.1|2331244_2333977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081000000.1|2335466_2336144_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_144420807.1|2336390_2336609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|2336753_2337962_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155049740.1|2337972_2338344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049739.1|2338995_2339154_+	phosphatase	NA	NA	NA	NA	NA
WP_155049738.1|2339298_2339496_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_155069764.1|2339601_2340393_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2340389_2341364_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155049735.1|2341475_2342111_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|2342826_2344284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|2345119_2345395_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	2348944	2463738	3189955	protease,tRNA,transposase,plate	Staphylococcus_phage(16.0%)	115	NA	NA
WP_144420717.1|2348944_2350027_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420718.1|2350023_2350245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046586.1|2350449_2350623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|2350942_2351161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|2351363_2351630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069690.1|2351888_2352752_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243154.1|2353306_2354557_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377905.1|2354545_2355427_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_017377906.1|2355419_2356505_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377907.1|2356501_2357761_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377908.1|2357929_2358589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653730.1|2358759_2359422_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_026063691.1|2359768_2360716_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_017377911.1|2360812_2361439_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_017377912.1|2361444_2362026_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377913.1|2362097_2363189_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377914.1|2363278_2363992_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_027243155.1|2364085_2364910_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_144420808.1|2365143_2365821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377920.1|2367498_2367756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2368156_2369131_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876067.1|2369305_2369950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046574.1|2370129_2370924_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774583.1|2371622_2372273_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377925.1|2373674_2374067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069692.1|2374865_2375693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910651.1|2376661_2376838_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_053856762.1|2377133_2377568_-	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_017377929.1|2377761_2379231_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_027243054.1|2379224_2380601_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377930.1|2380613_2381006_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_017377931.1|2381002_2382106_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_144420809.1|2382284_2383577_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377933.1|2383587_2384535_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_027243055.1|2384546_2385359_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_087910662.1|2385361_2386141_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377934.1|2386155_2387214_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_017377935.1|2387210_2388221_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|2388227_2388425_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_155069694.1|2388485_2391392_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_017377937.1|2391433_2392285_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_144420810.1|2392367_2392913_-	chorismate lyase	NA	NA	NA	NA	NA
WP_027243057.1|2393010_2393871_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_027243058.1|2393962_2394379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377942.1|2394460_2394967_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243059.1|2395012_2397964_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_017377945.1|2397985_2398318_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	4.7e-05
WP_047927125.1|2398435_2398945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046571.1|2399478_2399634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774650.1|2400708_2401875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377687.1|2402019_2402772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2403127_2404102_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016209908.1|2404234_2404945_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_017377690.1|2404941_2405976_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_017377691.1|2406079_2406421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876071.1|2406931_2408092_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_069971647.1|2408060_2408657_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082300723.1|2409625_2409853_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_155069696.1|2409809_2410457_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2410817_2411792_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_155069698.1|2411788_2412091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069699.1|2412620_2413073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069701.1|2413850_2414825_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.5	3.6e-29
WP_087910645.1|2415844_2416998_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_017376389.1|2417223_2417844_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_155069766.1|2417846_2418020_+	phosphatase	NA	NA	NA	NA	NA
WP_017376388.1|2418268_2419321_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376387.1|2419317_2420166_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210403.1|2420197_2421421_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210413.1|2421495_2421738_-	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_017376386.1|2421826_2422564_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_017376385.1|2422591_2423536_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376384.1|2423590_2424541_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376383.1|2424547_2425597_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210404.1|2425655_2425829_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_144420811.1|2425846_2426293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376381.1|2426617_2427259_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_155069703.1|2429422_2430295_+	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_155062809.1|2430286_2432410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376377.1|2432679_2433027_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_016209511.1|2433036_2433720_-	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376376.1|2433770_2434661_-	OmpA family protein	NA	NA	NA	NA	NA
WP_027242847.1|2434722_2435481_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209518.1|2435483_2436752_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_017376373.1|2436828_2437080_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376372.1|2437113_2437461_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376371.1|2437464_2438118_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376370.1|2438140_2438605_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376369.1|2438601_2439369_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209539.1|2439372_2440173_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_027242848.1|2440312_2441293_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209499.1|2441298_2441856_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242849.1|2441887_2442415_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209538.1|2442411_2443143_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_017376366.1|2443298_2444687_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_017376365.1|2444711_2445023_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376364.1|2445380_2446235_+	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376363.1|2446235_2446838_-	signal peptidase I	NA	NA	NA	NA	NA
WP_017376362.1|2446913_2447753_-	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376361.1|2447903_2448548_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376360.1|2448565_2448952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|2449171_2450104_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209515.1|2450208_2450724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|2450766_2451723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242851.1|2451704_2453393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376356.1|2453389_2453788_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_144420812.1|2453787_2455215_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_087910652.1|2455265_2455757_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027242853.1|2455746_2457216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242854.1|2457220_2457913_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_027242855.1|2457890_2458919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242856.1|2458912_2460139_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242857.1|2460144_2461656_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_017376343.1|2461916_2462354_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_027242858.1|2462430_2463738_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 22
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	2484655	2525880	3189955	tRNA,transposase	Burkholderia_virus(33.33%)	38	NA	NA
WP_036771330.1|2484655_2485630_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376319.1|2486198_2486879_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017376318.1|2486878_2487688_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027242903.1|2487761_2491442_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_026063524.1|2491451_2492939_-	ribonuclease G	NA	NA	NA	NA	NA
WP_017376313.1|2492948_2493566_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_017376312.1|2493635_2494154_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376311.1|2494150_2495050_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2495065_2496109_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376309.1|2496306_2496594_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2496723_2498184_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2498263_2499700_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2499824_2500799_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2502989_2503751_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2504908_2505136_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2506089_2506302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2506319_2506637_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2506663_2507353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2507693_2507897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2508028_2508964_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2508976_2509759_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2509888_2510200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2510543_2510870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2510894_2511350_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2511339_2512392_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2512394_2513858_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2513992_2514220_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2515386_2515851_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2516107_2516923_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2517051_2519364_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2519480_2520008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2520699_2521977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2521987_2522239_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2522272_2522794_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2522963_2523950_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2524040_2524856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2525284_2525680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2525652_2525880_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 23
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	2534985	2585516	3189955	tRNA,transposase	Bacillus_phage(30.77%)	49	NA	NA
WP_053856766.1|2534985_2536389_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2537356_2537584_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2538552_2539149_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875914.1|2539117_2540278_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_017375625.1|2540982_2541210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875913.1|2541206_2541977_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017377194.1|2541973_2543287_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_027243130.1|2544211_2545081_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377197.1|2545077_2546427_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_017377198.1|2546539_2548180_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_027243131.1|2548565_2548832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377200.1|2548961_2549150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2549714_2551118_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|2551223_2551448_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2551630_2552452_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|2552597_2552852_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377841.1|2553240_2555025_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|2555113_2555833_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2555994_2556201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2556200_2556437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2556449_2556803_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2557340_2558174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2558266_2558464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2558561_2559947_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2560073_2560664_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017376231.1|2561695_2561983_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2562042_2562207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2562203_2563574_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2563940_2565353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2565422_2566298_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2566397_2566685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2568161_2568455_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_026063680.1|2569378_2569603_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155069706.1|2569665_2569824_+	phosphatase	NA	NA	NA	NA	NA
WP_155046618.1|2570145_2570673_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|2570849_2571110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2571028_2571184_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2571282_2572257_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2573585_2573735_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155069708.1|2573851_2574064_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376598.1|2575241_2575817_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2575894_2576770_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2576834_2577455_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2577439_2578522_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2578755_2579160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2580650_2581952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2582098_2582767_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2583699_2584263_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2584319_2585516_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
>prophage 24
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	2600153	2653202	3189955	tRNA,transposase	Staphylococcus_phage(27.27%)	49	NA	NA
WP_036771330.1|2600153_2601128_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376571.1|2601294_2603619_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.7	7.6e-25
WP_017376570.1|2603793_2604510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063542.1|2604589_2605204_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_017376568.1|2605196_2606579_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_017376567.1|2606587_2607061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376566.1|2607193_2608453_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_144420761.1|2608976_2609156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|2609300_2610011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|2610078_2611482_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2611779_2612337_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2612430_2612937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2613441_2614137_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|2614267_2615056_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_053856766.1|2615089_2616493_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2617790_2618018_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2619105_2619636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2619632_2621165_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2621161_2622112_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2622532_2623165_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2623407_2623605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2623954_2624383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2624460_2625456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2625600_2625852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2625956_2626601_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2626836_2627334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2627845_2628820_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2629190_2629484_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2630296_2630632_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2630952_2632491_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2632643_2633742_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2633980_2635180_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2635210_2635837_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2635865_2636750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2636883_2637114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2637251_2638493_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_144420613.1|2638772_2639144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069710.1|2640537_2641149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2641524_2642652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2642768_2643431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2643516_2643777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2644195_2644957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2647018_2647678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2647778_2648429_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2648576_2649266_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377795.1|2649288_2650452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2650656_2650908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046691.1|2651431_2652028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2652227_2653202_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 25
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	2667879	2723601	3189955	tRNA,transposase	Staphylococcus_phage(25.0%)	51	NA	NA
WP_036774017.1|2667879_2668755_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2668875_2669376_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2669372_2669639_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2669804_2670779_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2670958_2671579_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2671885_2673289_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771922.1|2674123_2675314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|2675880_2676348_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|2676849_2677104_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|2677305_2677809_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|2678025_2678631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2678791_2679475_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2679550_2680330_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|2680316_2681177_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|2681300_2681666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069712.1|2682321_2682669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420611.1|2683482_2683683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155052690.1|2683715_2685047_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	2.4e-36
WP_017377275.1|2686129_2686852_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2686843_2687212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2687474_2688776_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2688871_2689315_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2689318_2689828_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2689820_2692634_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2693130_2694063_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2694167_2695094_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2695272_2696811_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2696984_2697245_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_155069714.1|2698519_2699128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2699174_2699903_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2700149_2700287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377696.1|2701449_2701989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2702223_2703135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2703394_2703691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|2704035_2705189_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_017377702.1|2705497_2706046_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2706149_2706713_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2706930_2707689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2708964_2709192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2709414_2709594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069716.1|2709849_2711106_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2711173_2711818_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_017378393.1|2712622_2712829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069718.1|2713271_2714216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378390.1|2714409_2715987_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378389.1|2716120_2717062_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378388.1|2717063_2717837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963621.1|2719445_2719652_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2719918_2720206_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378384.1|2720211_2722593_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|2722605_2723601_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
>prophage 26
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	2764608	2832838	3189955	transposase	Staphylococcus_phage(28.57%)	55	NA	NA
WP_048875857.1|2764608_2765583_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2765739_2767314_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2767538_2767817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2767886_2768762_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2768771_2769932_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2770046_2771195_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2771205_2774007_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2774113_2774812_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2774824_2776588_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2776591_2776939_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2776932_2777307_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2778254_2779538_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2779947_2781243_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2781598_2782144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242732.1|2782731_2783253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2783264_2784644_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2784885_2785320_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2785316_2786669_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2786668_2787784_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2787784_2788801_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2788790_2790461_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2790480_2790816_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2790843_2792283_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2792279_2793326_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2793468_2794965_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2795260_2796262_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2796367_2796979_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2797115_2797493_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2797543_2798950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2798943_2800011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2800117_2801719_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2801967_2802885_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2802953_2804648_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_155069719.1|2804882_2805812_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_053856766.1|2805842_2807246_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2807476_2808181_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2808247_2808904_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2808914_2809796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069721.1|2809966_2812636_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2812996_2813971_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2814050_2815022_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420754.1|2815348_2815657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2815581_2816553_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017377642.1|2817120_2817378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069723.1|2817550_2817742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377643.1|2817886_2818114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653746.1|2818318_2819842_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_144420753.1|2819978_2824403_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_017377646.1|2825186_2826764_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_017377647.1|2826992_2827361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243069.1|2827474_2828260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377649.1|2828565_2829510_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_017377650.1|2829528_2830713_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_155069725.1|2830828_2831662_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.2	2.1e-17
WP_026063658.1|2832109_2832838_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
>prophage 27
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	2842815	2896384	3189955	transposase	Staphylococcus_phage(33.33%)	49	NA	NA
WP_026063658.1|2842815_2843544_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_017376563.1|2844906_2845104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069728.1|2845248_2846148_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2846292_2846559_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875887.1|2846639_2847515_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2847644_2847872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2847938_2848133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2848191_2849166_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2849203_2849392_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2849392_2851165_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_155069768.1|2851154_2852129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2852754_2853447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2853933_2854503_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2854499_2855474_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155069730.1|2855876_2856305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|2856395_2857799_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2858497_2858683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2858788_2860192_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046624.1|2860259_2860790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2860823_2862251_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|2863536_2865906_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2865981_2866800_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2867151_2867697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2868179_2869418_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2869394_2870369_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017375625.1|2870461_2870689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|2870693_2871185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243039.1|2871857_2872745_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_155069732.1|2872834_2874325_-	sodium/solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	2.3e-19
WP_017376549.1|2874348_2875230_-	ROK family protein	NA	NA	NA	NA	NA
WP_017376548.1|2875226_2875949_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376547.1|2876648_2877440_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_155069734.1|2877626_2877848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420598.1|2878023_2878254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376543.1|2878283_2879063_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_047927468.1|2879088_2879394_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_144420752.1|2879390_2880284_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_027243035.1|2880639_2881938_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376538.1|2884540_2885722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069736.1|2886015_2887122_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155069738.1|2887118_2887430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376537.1|2888153_2889779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376536.1|2889948_2890308_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376535.1|2890520_2890952_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017376534.1|2890963_2891143_-	rubredoxin	NA	NA	NA	NA	NA
WP_144420597.1|2891259_2892246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243034.1|2892426_2893716_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_017376531.1|2893827_2894625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|2895016_2896384_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	2902783	2961426	3189955	tRNA,tail,transposase	Escherichia_phage(16.67%)	49	NA	NA
WP_069971668.1|2902783_2903032_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2903839_2906032_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2906049_2906358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2907011_2908721_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2908914_2909070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2910472_2911348_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2911673_2912435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2912659_2913391_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2913387_2913924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2913977_2914742_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2914744_2916322_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2916328_2916805_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2916780_2917212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2917244_2918000_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2918174_2918462_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2918844_2919069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2919408_2920572_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2920606_2921584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2921577_2922264_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2922202_2923318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2923597_2924203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2924440_2924920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2926742_2927396_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2927508_2928060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2928159_2929134_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2929419_2929944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2930641_2931466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2931721_2932078_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048876031.1|2932074_2933478_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2933597_2934158_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2934315_2934882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069742.1|2935084_2936959_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_027243087.1|2937222_2937918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2937958_2938171_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2939743_2940853_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2940908_2942390_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876012.1|2942827_2944231_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376227.1|2944324_2944774_+	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_027243088.1|2945081_2945867_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_017376226.1|2945863_2946847_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_017376225.1|2946903_2948175_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036772069.1|2953605_2954157_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_017377639.1|2954217_2955579_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_017377638.1|2955852_2957133_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017377637.1|2957150_2957807_+	DedA family protein	NA	NA	NA	NA	NA
WP_017377636.1|2957852_2958902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377635.1|2959055_2959910_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_036772063.1|2960208_2961021_+	trfA family protein	NA	NA	NA	NA	NA
WP_016210080.1|2961132_2961426_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
>prophage 29
NZ_CP039046	Piscirickettsia salmonis strain Psal-073 chromosome, complete genome	3189955	3071049	3136292	3189955	protease,transposase	Hokovirus(14.29%)	55	NA	NA
WP_017376170.1|3071049_3072150_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3072507_3073482_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3073618_3074497_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3074504_3074735_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3074788_3075793_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3076005_3076833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3076914_3078303_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_155069748.1|3078590_3079991_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.3	2.3e-53
WP_017376177.1|3080085_3081012_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3081008_3082145_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3082141_3083149_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3083145_3084309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3084318_3085170_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3085201_3086374_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3086370_3087759_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3087787_3088195_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3088214_3089222_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3089218_3090091_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3090087_3090948_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3090949_3093220_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3093221_3094367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3094413_3094899_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3094938_3095562_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3101241_3101994_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243062.1|3103325_3103949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3104053_3104842_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3104841_3105573_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3105606_3107334_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3107347_3108409_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3108723_3109938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3110070_3110595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3111212_3112061_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3112047_3112746_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3112800_3113562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3113554_3113977_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3114106_3114658_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3114713_3115676_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3115676_3115892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069749.1|3116078_3116888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3116867_3117710_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3117706_3118951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3119089_3120178_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3120195_3120696_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3120883_3121483_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3121488_3122652_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3122684_3123638_+	glutathione synthase	NA	NA	NA	NA	NA
WP_017376261.1|3124001_3125066_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3125062_3128125_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3128277_3128730_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3128761_3129118_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3129536_3130310_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376269.1|3132933_3133224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3133448_3134324_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3134320_3134878_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3134888_3136292_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039047	Piscirickettsia salmonis strain Psal-073 plasmid unnamed1, complete sequence	208052	0	179345	208052	tail,portal,integrase,transposase,terminase,head	Streptococcus_phage(32.43%)	179	6659:6718	167847:168961
WP_017377655.1|1436_1682_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|1678_2065_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772541.1|2152_2881_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_017377658.1|3062_3749_+	Fic family protein	NA	NA	NA	NA	NA
WP_036771347.1|4030_5008_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017377662.1|5954_6269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377663.1|6279_6609_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	44.9	6.1e-13
6659:6718	attL	ACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGC	NA	NA	NA	NA
WP_017377664.1|6881_7418_-	hypothetical protein	NA	NA	NA	NA	NA
6659:6718	attL	ACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGC	NA	NA	NA	NA
WP_036771347.1|7432_8410_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155069781.1|8489_9446_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	6.9e-25
WP_036816420.1|9656_10289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929651.1|10292_11345_-	ParA family protein	NA	NA	NA	NA	NA
WP_036771347.1|11506_12484_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155069781.1|12563_13520_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	6.9e-25
WP_036816420.1|13730_14363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929651.1|14366_15419_-	ParA family protein	NA	NA	NA	NA	NA
WP_036771347.1|15580_16558_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771355.1|17143_18580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375933.1|18596_19589_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	28.9	5.0e-10
WP_017375932.1|20234_20465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375931.1|20560_20989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375930.1|20988_21426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375929.1|21425_22079_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_017375928.1|22088_23228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|23407_24382_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_155069783.1|24378_25221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069785.1|25425_27912_-	hypothetical protein	NA	A0A0R6PIC9	Moraxella_phage	32.9	5.7e-111
WP_017375789.1|27908_28466_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_144420832.1|28455_29241_-	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375787.1|29170_29842_-|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_017375786.1|29838_30180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771950.1|30172_32251_-|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375784.1|32254_32521_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_017375783.1|32577_32901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375782.1|32902_33325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375781.1|33324_33675_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_155069786.1|33671_33872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069787.1|34533_34866_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_036771347.1|35250_36228_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_087910670.1|36354_36540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910671.1|36633_37098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069788.1|37485_38274_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	5.4e-15
WP_036771347.1|38353_39331_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_080963571.1|40120_41206_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048876254.1|41293_42544_+	MFS transporter	NA	NA	NA	NA	NA
WP_036771639.1|42754_43729_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_032126138.1|44170_44434_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771347.1|44755_45733_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155069789.1|45896_46691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069790.1|46824_47763_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.4	2.3e-41
WP_036771347.1|47749_48727_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000017.1|50118_50370_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_048876012.1|50634_52038_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243203.1|56214_57009_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
WP_017375836.1|57102_57306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|57500_57836_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_048876182.1|58535_60431_-	DUF1561 family protein	NA	NA	NA	NA	NA
58006:58198	attR	ACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTACGTGCCTTGAAGCGGCACACTCCACTACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGC	NA	NA	NA	NA
WP_155069791.1|60786_62685_+	DUF1561 family protein	NA	NA	NA	NA	NA
58006:58198	attR	ACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTACGTGCCTTGAAGCGGCACACTCCACTACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGC	NA	NA	NA	NA
WP_036771293.1|62980_63247_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|63786_64761_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027243200.1|65067_65472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|65472_66219_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_036774644.1|66727_67789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963627.1|69056_69275_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036772541.1|69293_70022_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|70192_70762_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|70766_71450_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036815648.1|71942_72671_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420834.1|72723_73119_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|73412_74141_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_051929623.1|74297_77639_-	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_027243201.1|77702_77942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|78107_78836_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243202.1|79110_80046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|80270_81245_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_155046638.1|82419_82884_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_155069792.1|82880_83180_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774378.1|83222_83792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420833.1|83996_84188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|84201_85242_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242592.1|85308_85638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774388.1|85661_86624_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017377694.1|88001_88730_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|88976_89126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|89137_89866_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_081000015.1|89895_90282_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876191.1|90217_90646_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_082300723.1|92197_92425_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_155046637.1|93157_93649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|93730_94459_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155069793.1|94889_95048_-	phosphatase	NA	NA	NA	NA	NA
WP_146619416.1|95090_95237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243206.1|95542_97408_+	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_080963664.1|97480_97747_-|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_080963665.1|97927_98269_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_048876194.1|98449_98983_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_036771347.1|100238_101216_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155069794.1|101315_101741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|102175_103153_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155069795.1|103234_103519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069796.1|103522_103978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069797.1|103997_104555_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.7	2.7e-21
WP_027243212.1|104561_104849_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_027243211.1|104838_105093_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_155069798.1|105186_106929_+	hypothetical protein	NA	V9QJ77	Rhizobium_phage	36.8	2.3e-95
WP_036771639.1|106981_107956_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_036771347.1|109034_110012_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375754.1|110691_111978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082884401.1|112291_112414_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|112511_113240_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_048876182.1|113317_115213_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155069791.1|115568_117467_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155069799.1|117796_117997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876210.1|118345_119074_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_081000019.1|119114_119285_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|119324_120299_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_155069800.1|120698_121433_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_144420849.1|121514_122495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|122726_123236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242596.1|123275_123638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275482.1|123951_124926_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_017377509.1|125019_125748_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_027243190.1|125928_129273_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_048876202.1|130553_131267_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_155069801.1|131313_132030_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.8e-38
WP_155069803.1|131995_132142_+	phosphatase	NA	NA	NA	NA	NA
WP_087910668.1|132373_132760_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_155069805.1|132846_134529_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	45.3	1.8e-137
WP_075278733.1|134531_135014_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_027242929.1|135100_135484_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_017375952.1|135679_135883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242930.1|136072_137455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242931.1|137600_138008_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242932.1|138016_138244_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036771332.1|138457_139432_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	2.2e-26
WP_026063496.1|139482_139848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069807.1|140066_140219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081078123.1|140683_141046_-	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
WP_146619517.1|141075_141228_+	phosphatase	NA	NA	NA	NA	NA
WP_017375966.1|141372_141939_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_155069809.1|141939_143349_+	response regulator	NA	NA	NA	NA	NA
WP_144420845.1|144164_144395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242936.1|144522_144975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|144971_145190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375841.1|145496_145706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375972.1|146150_146459_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027242938.1|146460_146829_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_048876229.1|147242_148214_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046634.1|148132_148333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771279.1|148402_149131_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375850.1|149491_150268_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_027242940.1|150621_151221_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_155068179.1|151554_152283_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036771289.1|153092_153563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876208.1|154416_155244_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_155069811.1|155656_155812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069813.1|155956_156190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|156108_157080_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|157651_158380_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036772441.1|158455_158728_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|158731_158992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069815.1|159331_160060_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.2e-37
WP_036775032.1|161335_162151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375909.1|162198_162888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069817.1|163176_163905_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_155069819.1|164730_165864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069820.1|166359_166806_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036771347.1|166885_167863_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155069822.1|168783_169518_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	3.0e-36
WP_047927763.1|169931_170195_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036816769.1|170191_170590_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_036815609.1|170833_171289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069824.1|173189_173474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420839.1|174143_175070_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375910.1|175265_175994_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|176509_176782_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|176784_177513_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420837.1|177542_178475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377509.1|178616_179345_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
>prophage 2
NZ_CP039047	Piscirickettsia salmonis strain Psal-073 plasmid unnamed1, complete sequence	208052	184063	193760	208052	transposase,portal	Streptococcus_phage(40.0%)	8	NA	NA
WP_048876221.1|184063_184519_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
WP_036771347.1|185635_186613_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017377525.1|187429_188227_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155069826.1|188767_189742_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	2.2e-26
WP_155046640.1|190377_190545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069828.1|190513_191242_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377521.1|191750_192104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|193031_193760_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 3
NZ_CP039047	Piscirickettsia salmonis strain Psal-073 plasmid unnamed1, complete sequence	208052	198401	205458	208052	transposase	Streptococcus_phage(28.57%)	9	NA	NA
WP_155069829.1|198401_199130_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_075275473.1|199267_199444_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|199560_200268_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|200221_201100_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_144420840.1|201130_201562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|201944_202649_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_155069831.1|203706_204096_-	hypothetical protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|204118_204847_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|204849_205458_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
>prophage 1
NZ_CP039048	Piscirickettsia salmonis strain Psal-073 plasmid unnamed2, complete sequence	125516	521	55803	125516	tRNA,transposase	Acinetobacter_phage(25.0%)	53	NA	NA
WP_048875973.1|521_1157_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420659.1|1433_2213_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420658.1|2245_3007_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|2983_3973_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|4108_4984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|5002_5662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148037443.1|5688_5898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|5903_6350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|6346_7750_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|7863_8709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|8853_10503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|10593_11379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|12819_14223_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155069639.1|14390_14669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|14748_15726_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_048876026.1|16032_16299_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420796.1|16528_17647_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774270.1|17791_18127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069641.1|18137_18551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375562.1|19759_19924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|19960_20836_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929862.1|21022_21535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|23966_25166_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_017375900.1|25419_25701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069642.1|25756_27766_-	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_026063491.1|27821_28799_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_027242984.1|28934_29717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774087.1|29873_30197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069644.1|30264_31368_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772169.1|31437_32313_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_047927184.1|32309_32654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963581.1|32663_33125_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_027242985.1|33138_34530_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_027242986.1|34571_37559_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_027242987.1|37628_38462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069646.1|38516_39698_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_027242989.1|39685_40390_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_027242990.1|40435_41221_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_027242991.1|41248_41986_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|42090_44286_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242992.1|44360_45044_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_027242993.1|45054_45486_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242994.1|45531_45930_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242995.1|46306_47014_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_027242996.1|47078_47375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619421.1|47413_47893_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_027242998.1|47946_48468_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_027242999.1|48549_49644_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_048876031.1|50610_52014_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155069834.1|52102_52831_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	2.4e-38
WP_032126374.1|52988_53960_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420659.1|54111_54891_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875973.1|55167_55803_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039049	Piscirickettsia salmonis strain Psal-073 plasmid unnamed3, complete sequence	24115	4042	16054	24115	transposase,terminase,capsid,tail	unidentified_phage(30.0%)	15	NA	NA
WP_155069845.1|4042_4957_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.4	8.1e-23
WP_155069847.1|5026_5683_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.8	5.1e-11
WP_027242953.1|7069_7324_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|7307_7664_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|7763_8738_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|9256_10123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|10335_10719_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|10805_11288_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|11290_11476_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|11495_12470_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|12566_12959_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|12994_13576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069848.1|13895_14054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242945.1|14635_15151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|15496_16054_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
