The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	45576	89169	3139871	transposase	Moraxella_phage(20.0%)	43	NA	NA
WP_075273371.1|45576_46152_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46097_46463_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036776493.1|46661_47423_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_036779326.1|47724_49251_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49622_50462_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50501_51809_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51783_52953_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|53007_53733_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54011_54401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54588_55494_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55541_55685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047031.1|55732_56329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|56563_57717_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016210704.1|58611_60558_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61212_64275_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64271_65336_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65691_66645_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66676_67840_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67845_68445_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68632_69133_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69150_70239_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70377_71622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71618_72461_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_036777711.1|72440_73250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73417_73645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73645_74596_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74651_75203_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75329_75752_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75744_76491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76533_77232_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77242_78067_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78396_78765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|78759_79821_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|79870_80101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80230_81445_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81745_82807_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_036777695.1|82820_84548_+	oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_016211245.1|84581_85313_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85312_86101_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86205_86829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87148_87361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047032.1|87516_88578_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047033.1|88572_89169_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	127259	181534	3139871	transposase	Staphylococcus_phage(42.86%)	58	NA	NA
WP_054300271.1|127259_128234_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209611.1|128482_128674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047035.1|128753_128933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209580.1|129024_129549_+	ankyrin repeat family protein	NA	NA	NA	NA	NA
WP_016209612.1|129932_130301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209595.1|130338_130611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300576.1|130701_131997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211692.1|132632_133535_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.4	1.6e-18
WP_051307362.1|133591_134443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211694.1|135022_137032_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	3.0e-110
WP_054300271.1|137069_138044_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|138545_139958_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|140450_141458_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|141477_142998_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_016211018.1|143948_145265_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145368_145752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145886_148952_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|149020_150124_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|150147_150702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150816_151386_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151505_152261_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_155047036.1|152427_153327_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047037.1|153471_153777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082829.1|154171_154567_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|154588_154954_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|155010_155175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|155164_155464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300544.1|155554_156001_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|156496_157063_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|157074_157860_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|158491_159415_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|159466_160462_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|160493_160988_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_036778333.1|161079_161337_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|161426_161849_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|162167_162884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|162927_163179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778330.1|163183_164620_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|164647_166090_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|166177_166516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|166600_167131_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|167191_169384_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|169426_169912_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|170181_170613_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036778324.1|170630_171461_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|171475_171619_-	lipoprotein	NA	NA	NA	NA	NA
WP_052104672.1|171649_172534_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|172505_172727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|172900_173179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|174149_175055_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_036780891.1|175111_176290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|176286_176862_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155053570.1|176960_177173_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300541.1|177500_178280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126848.1|178813_179614_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_052104671.1|179832_180591_+	ion transporter	NA	NA	NA	NA	NA
WP_016211859.1|180667_180955_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_075273327.1|180958_181534_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	200550	271547	3139871	tail,tRNA,transposase,protease	Acinetobacter_phage(25.0%)	59	NA	NA
WP_016209871.1|200550_202533_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|202742_204086_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|204352_207022_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|207045_208965_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|209134_210556_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|210701_211676_+	phospholipase A	NA	NA	NA	NA	NA
WP_054300537.1|211707_212115_+	glyoxalase	NA	NA	NA	NA	NA
WP_016209859.1|212393_212615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|212778_214440_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|214512_214803_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_036776911.1|215028_215484_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|215548_216013_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216105_217452_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|217451_218357_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|218418_219405_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|219397_219640_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|219761_221306_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_036776914.1|221352_222639_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|222681_224076_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224099_224279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|224275_224455_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300181.1|224458_224740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|224796_225162_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210079.1|228167_228665_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|228835_229531_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|229633_231196_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|231511_233305_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233390_233663_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|233668_234295_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234281_235712_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236044_237100_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237068_237746_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|237735_238572_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|238731_239025_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|239131_239938_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|240242_241097_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_036776920.1|241251_242301_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_036776924.1|242351_243008_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|243025_244306_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|244579_245941_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_155046933.1|246214_246892_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016211802.1|252323_253595_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036778206.1|253651_254635_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|254631_255417_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_032126362.1|256113_256479_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|256424_257000_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300535.1|257003_257723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|257867_258068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|258115_258577_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|259000_260482_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|260544_261654_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|261751_263713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|264242_264647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047045.1|264699_265395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|265371_266346_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_098082809.1|266516_266867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046934.1|267265_267436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|267809_268892_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556499.1|270394_271547_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 4
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	300544	360404	3139871	transposase	Bodo_saltans_virus(20.0%)	57	NA	NA
WP_054300526.1|300544_300841_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962174.1|300989_301154_-	phosphatase	NA	NA	NA	NA	NA
WP_016211026.1|301252_301657_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075273367.1|301949_302726_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_155047049.1|302734_304816_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	4.0e-17
WP_016211031.1|304980_305460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211032.1|305769_306567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211033.1|306678_307971_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_032126377.1|308136_309138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211034.1|309254_309434_+	rubredoxin	NA	NA	NA	NA	NA
WP_016211023.1|309444_309879_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_016211029.1|310092_310455_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.6e-25
WP_016212102.1|310628_312269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|313779_314932_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556441.1|318360_319587_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126490.1|319935_320901_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_016210868.1|320897_321197_+	pilZ domain protein	NA	NA	NA	NA	NA
WP_036778898.1|321228_322008_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_016210861.1|322033_322264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|322415_322661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210870.1|322812_323604_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016212128.1|324517_325264_+	solute symporter family protein	NA	NA	NA	NA	NA
WP_032126495.1|325354_326239_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_054300397.1|326644_326890_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046705.1|327130_327298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|327243_327819_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047050.1|327871_328609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777815.1|328612_328897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|328990_329254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|329620_330439_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|330511_332884_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_036777812.1|333596_335024_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|335058_336081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|336097_336475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|337437_337803_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|337748_338324_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210122.1|338563_339256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|339882_340857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|340846_342619_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|342619_342967_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036777821.1|343216_344443_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|344532_345831_-	MFS transporter	NA	NA	NA	NA	NA
WP_081007061.1|345864_346614_-	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	30.4	3.9e-15
WP_016210137.1|346594_347146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007060.1|347372_348671_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|348787_349078_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_155047051.1|349389_350259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047052.1|350403_351132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777801.1|351994_352213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212044.1|352986_353241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|353963_354950_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|355087_355282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007059.1|355964_357026_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_016211797.1|357187_358591_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|358641_359217_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|359162_359477_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047053.1|359517_360404_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	444636	545108	3139871	tRNA,transposase,integrase	Escherichia_phage(43.75%)	108	511423:511482	525634:525807
WP_054300513.1|444636_445500_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|445716_447276_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|447297_448332_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|448380_448950_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|449085_450057_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|450068_451646_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|451711_452698_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054300512.1|453029_454139_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|454244_455429_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|455506_457495_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|457703_457859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047055.1|458129_458417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|458454_458820_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|458765_459341_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047056.1|459330_459693_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|460609_462016_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|462033_463020_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|463022_464177_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|464173_464869_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|465003_466494_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_036777447.1|466514_467564_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|467630_469025_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_036777444.1|469903_471835_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	1.0e-120
WP_075273353.1|471839_472370_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|472404_472599_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|472641_473001_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|473420_474416_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_036777440.1|474428_476810_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|476815_477103_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|477374_477851_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|477995_478193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|478317_479292_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|480192_480291_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780545.1|480775_481486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047057.1|481649_482066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|482302_482995_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|483036_483810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|483811_484753_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|484885_486463_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|486672_488430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|488978_489737_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|489944_490517_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|490620_491169_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|491470_491716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|491744_492041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779353.1|492308_493220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300506.1|493710_494118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|494189_494918_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126799.1|494998_495811_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_155047058.1|496872_497235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|497237_498977_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046941.1|499378_499642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300500.1|500313_501042_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_016212070.1|501451_502051_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_016212069.1|502025_502193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212066.1|502404_503181_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_054300501.1|503541_504270_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|504281_504674_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|504670_504916_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|505076_505805_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211714.1|505879_509224_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|510472_511048_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|510993_511359_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
511423:511482	attL	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCT	NA	NA	NA	NA
WP_155047059.1|511637_512552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212159.1|512819_513017_+	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_054300201.1|513376_514105_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_155047060.1|514134_514809_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	45.9	5.2e-27
WP_016212024.1|514953_515202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|515198_515798_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|515797_516016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|516790_517783_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|517779_518514_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_155047061.1|518774_519041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155082071.1|519185_519365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047063.1|519366_519618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300477.1|520067_520796_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_051307368.1|521502_522783_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|522782_523751_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211646.1|524122_524362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|524354_524708_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|525010_525739_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047064.1|526208_526517_-	hypothetical protein	NA	NA	NA	NA	NA
525634:525807	attR	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTTTTACCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCC	NA	NA	NA	NA
WP_155047065.1|526678_527356_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.1	7.0e-40
WP_155047066.1|527849_528578_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.5e-43
WP_016212269.1|528746_529430_+	Fic family protein	NA	NA	NA	NA	NA
WP_016212268.1|529433_530018_+	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_017375910.1|530174_530903_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047064.1|531371_531680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|531930_532533_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300203.1|532537_532996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781052.1|534372_534975_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211639.1|535354_535657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211644.1|535771_536038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104773.1|536145_536589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|536650_537536_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047067.1|537636_538530_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047259.1|538674_538890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104771.1|539339_539678_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	54.9	5.4e-25
WP_075274739.1|539670_540018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274717.1|540014_540245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274718.1|540248_540719_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	64.3	1.3e-32
WP_075274740.1|540863_541229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780395.1|541373_541628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377363.1|541611_541968_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_075274719.1|542273_543140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047068.1|543625_543826_+	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	64.3	3.5e-16
WP_155047069.1|543913_544267_+	hypothetical protein	NA	Q6DMU4	Streptococcus_phage	34.8	8.2e-08
WP_054300202.1|544379_545108_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 6
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	552807	600760	3139871	tRNA,transposase	Synechococcus_phage(33.33%)	51	NA	NA
WP_054300202.1|552807_553536_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|553629_554295_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|554359_555316_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|555574_556273_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|556315_557428_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|558032_558608_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|558553_558919_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|559006_559357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|560092_561154_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210908.1|562365_563181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|563271_564255_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|564425_564947_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_036779246.1|564980_565235_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.4e-20
WP_016210909.1|565237_566515_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|567207_567735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|567854_570167_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|570295_571111_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|571308_571773_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|571902_572964_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|573224_573521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|573803_575267_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|575269_576322_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_036779281.1|576311_576767_+	arginine repressor	NA	NA	NA	NA	NA
WP_155047071.1|576791_577115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|577462_577774_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_054300208.1|577903_578695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779278.1|579852_580806_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|580919_581117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047032.1|581329_581563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142396463.1|581673_581790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212074.1|581876_582098_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|582124_582490_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|582546_582711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047072.1|582700_583015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046713.1|583152_583317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|583611_585048_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|585089_586541_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|586652_586940_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|587129_588173_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210536.1|588188_589088_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210528.1|589084_589603_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210527.1|589672_590290_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_036776217.1|590299_591787_+	ribonuclease G	NA	NA	NA	NA	NA
WP_016210534.1|591796_595477_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_036776215.1|595550_596363_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210530.1|596359_597040_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_155047260.1|597880_598039_-	phosphatase	NA	NA	NA	NA	NA
WP_155047073.1|598231_598789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|598838_599129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300215.1|599932_600427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|600421_600760_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	622230	724826	3139871	tRNA,transposase,plate,protease	Prochlorococcus_phage(17.65%)	108	NA	NA
WP_016209523.1|622230_623580_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|623630_624068_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|624329_625841_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_036778935.1|625846_627073_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|627066_628095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|628072_628765_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_155049805.1|628766_630239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778941.1|630231_630720_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|630725_632198_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|632197_632596_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|632592_634281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|634262_635219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|635261_635777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|635881_636814_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|637033_637420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|637436_638081_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|638261_639101_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|639176_639779_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|639779_640634_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|640990_641302_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|641326_642718_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|642873_643605_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_129556465.1|643601_644174_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|644160_644718_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|644723_645704_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|645843_646644_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_036780687.1|646647_647415_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|647411_647876_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|647898_648552_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|648555_648903_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|648936_649188_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|649264_650533_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|650535_651294_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|651355_652246_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|652296_652980_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|653065_653323_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155047218.1|653595_655764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|655755_656628_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|656795_658625_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|658787_659429_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|659670_660201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|660218_660392_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|660450_661500_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|661506_662457_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|662510_663455_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|663482_664220_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|664308_664551_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|664625_665849_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|665880_666729_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|666725_667778_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|667898_668519_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_036780649.1|668534_669521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|669631_670087_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|670046_670385_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|671149_672055_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155047217.1|672129_673191_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|673240_673450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|674684_675131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|675134_675710_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|675655_676021_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|676141_676327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|676430_677465_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|677461_678172_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|678646_679165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|679282_679615_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_036777003.1|679644_682599_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_054300221.1|682644_683142_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|683201_683618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|683709_684570_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|684652_685219_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|685251_686106_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_155047216.1|686147_689054_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|689114_689312_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|689318_690329_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|690325_691384_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|691377_692178_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|692180_692999_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|693010_693958_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|693965_695267_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|695445_696549_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|696545_696938_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|696949_698326_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|698319_699789_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_032126362.1|700246_700612_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|700557_701133_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300223.1|701227_702199_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_129556478.1|702435_703322_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|703621_703867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|704829_705249_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046954.1|705355_705529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|705755_706490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|706614_707676_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|707998_708703_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|708796_709510_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|709592_710684_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|710755_711337_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|711342_711969_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|712065_713001_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|713360_714032_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_036778813.1|714173_714833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|715001_716261_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|716257_717343_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|717335_718217_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|718205_719456_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_054300237.1|720741_721803_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047215.1|721780_723034_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_032126362.1|723939_724305_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|724250_724826_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	760243	808168	3139871	tRNA,transposase	Staphylococcus_phage(42.86%)	37	NA	NA
WP_016209374.1|760243_761695_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|761730_763260_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_155047212.1|763835_765479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047211.1|766020_766962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|767312_768128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|768419_771110_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_081007011.1|771358_772579_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|772746_774453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|775051_776278_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|776830_777805_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273456.1|777927_778227_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047210.1|778186_778549_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|778610_779496_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047266.1|780604_781036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|781751_782117_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|782062_782638_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|782664_783726_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556478.1|783840_784727_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047209.1|785076_785631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211819.1|785849_786080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|786376_786877_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|787079_788336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777316.1|788692_789106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|789415_790300_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300240.1|790556_790760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|791059_792034_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047208.1|792336_793809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|793828_794803_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|794953_795229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|795394_796015_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_054300241.1|796333_798310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|798465_799923_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|799991_801572_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_054300242.1|801612_802149_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|802194_806091_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|806097_806421_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300237.1|807106_808168_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	824849	931269	3139871	transposase,integrase,protease	Staphylococcus_phage(24.14%)	100	884950:885009	906144:907246
WP_033923708.1|824849_825725_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|825980_826625_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|826655_828461_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|828484_829060_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_155047207.1|829604_830678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|830787_831762_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046989.1|831994_833059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|833549_833915_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047206.1|833929_834439_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|834474_835449_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300250.1|835531_836191_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_016209640.1|836609_837629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|838087_839053_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|839097_839673_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|839703_840978_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|841623_842337_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|842416_843154_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|843274_844630_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|844806_845478_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|845593_846469_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|847072_848377_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|848489_849095_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|849176_850478_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|850545_852978_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|853081_853354_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075273480.1|853436_855335_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209643.1|855366_856251_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|856259_856655_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|857082_859230_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|859201_860551_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|860547_862668_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|862664_864368_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209654.1|864486_865629_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|865693_866722_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_036776625.1|866848_868363_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|868452_868938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275067.1|869270_870338_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|871400_872306_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_051307360.1|872422_873352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780074.1|874443_875250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|875592_877485_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|877771_878176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923634.1|878380_878929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|878918_879805_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|880143_880554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047205.1|880728_880950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|881437_881803_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|881748_882324_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664862.1|883497_884196_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_016211528.1|884176_884482_+	hypothetical protein	NA	NA	NA	NA	NA
884950:885009	attL	CGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACT	NA	NA	NA	NA
WP_054300271.1|885041_886016_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300253.1|886234_887185_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	34.7	6.9e-09
WP_016211534.1|887171_887681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211530.1|887686_888583_-	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211531.1|888936_889617_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155047204.1|889680_890238_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0V4T7	Roseobacter_phage	33.3	8.4e-15
WP_054300271.1|890261_891236_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212424.1|891579_891858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|891850_892123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|892240_893323_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036780532.1|893400_894441_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_081007067.1|894952_900427_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_016212302.1|900647_900947_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_155047203.1|901247_902309_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036781361.1|902328_902718_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_155047202.1|903000_904065_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.2	4.7e-139
WP_016211579.1|904569_905055_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|905122_906031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|906235_907210_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211584.1|907382_907736_+	hypothetical protein	NA	NA	NA	NA	NA
906144:907246	attR	CGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_016211586.1|907802_907997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|908012_908357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|908426_909002_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|908947_909313_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155049808.1|909397_910006_+	DNA polymerase	NA	NA	NA	NA	NA
WP_052047108.1|910090_910489_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046984.1|911300_912419_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046716.1|912840_912987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|913684_914239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|914675_914858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|914922_915150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|915380_916127_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|916353_916647_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|916718_917324_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|917472_918450_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_155047199.1|918546_919989_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|920015_920669_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_036779374.1|920793_921360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|921714_923493_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_052104721.1|923564_925271_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_054300262.1|925262_925553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|926015_926381_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|926326_926902_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|926905_927280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|927655_928630_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_054300263.1|928701_929142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047198.1|929129_929297_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|929441_929702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|929661_930000_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|930383_931269_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	951811	996934	3139871	tRNA,transposase	Escherichia_phage(16.67%)	44	NA	NA
WP_054300173.1|951811_952873_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211781.1|953089_954337_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036779112.1|954559_955996_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_129556486.1|956081_956429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273492.1|956519_956639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|956747_957809_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|957803_957974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|957963_958128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|958184_958550_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|958571_958940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047196.1|959084_959666_-	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_017375910.1|959736_960465_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016210898.1|960721_961072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|961160_961451_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|961925_962228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300270.1|962568_963546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|963624_964962_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|965080_965452_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|965673_966324_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|966366_967449_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|967502_969386_+	APC family permease	NA	NA	NA	NA	NA
WP_033923708.1|969995_970871_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155047195.1|970883_971786_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211091.1|971860_974341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273494.1|975405_975966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|976556_977618_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275207.1|977665_978115_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211036.1|978462_980334_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_036779409.1|980425_982171_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211043.1|982250_982700_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211035.1|982752_982968_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211042.1|983214_984231_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211037.1|984279_984909_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211040.1|985259_986471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126170.1|986698_986971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047067.1|987134_988028_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556557.1|988172_988484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104774.1|988531_989164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047009.1|989308_989482_-	phosphatase	NA	NA	NA	NA	NA
WP_016211450.1|990257_991280_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211448.1|991378_992587_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211446.1|992576_994304_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036776407.1|994487_995624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|995872_996934_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	1009442	1064331	3139871	tRNA,transposase,protease	Orpheovirus(16.67%)	56	NA	NA
WP_129556478.1|1009442_1010329_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211932.1|1010739_1012029_-	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_036777061.1|1012224_1013412_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211476.1|1013729_1013939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211473.1|1013922_1014522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211474.1|1014596_1015946_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_032126518.1|1016028_1018230_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211478.1|1018246_1019062_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126519.1|1019041_1019761_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_075273327.1|1019928_1020504_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1020449_1020815_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211265.1|1020989_1021652_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1021682_1022051_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_032126514.1|1022061_1023378_-	MFS transporter	NA	NA	NA	NA	NA
WP_051307354.1|1023660_1024236_+	DedA family protein	NA	NA	NA	NA	NA
WP_032126515.1|1024311_1024491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|1024663_1024957_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_075273504.1|1025146_1025500_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211262.1|1025554_1027828_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_016211259.1|1027887_1028133_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_054300275.1|1028257_1029133_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211550.1|1029210_1029972_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_016211548.1|1029955_1030912_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211549.1|1031174_1033679_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211553.1|1033682_1034423_+	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_054300209.1|1034762_1035128_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1035184_1035349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1035338_1035638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126933.1|1035641_1036943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1037111_1038086_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209411.1|1038291_1039086_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_016209421.1|1039248_1040037_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_036776605.1|1040033_1041245_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_032126508.1|1041234_1041594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209444.1|1041688_1042117_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_129556555.1|1042247_1043378_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209436.1|1043374_1044103_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_016209412.1|1044160_1045048_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209433.1|1045132_1045507_+	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209424.1|1045606_1046884_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_080664816.1|1046895_1047627_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_052047073.1|1047613_1048864_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_016209427.1|1048957_1050361_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_016209408.1|1050514_1050685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209406.1|1050999_1051821_+	ParA family protein	NA	Q8JL10	Natrialba_phage	32.2	5.0e-16
WP_016209405.1|1051817_1052711_+	cheW-like domain protein	NA	NA	NA	NA	NA
WP_016209443.1|1052756_1053278_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_036776598.1|1053352_1053838_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_155047194.1|1054126_1054885_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_016209404.1|1054874_1055738_-	chemotaxis phosphatase CheX family protein	NA	NA	NA	NA	NA
WP_016209435.1|1055764_1056136_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_016209445.1|1056236_1057193_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_054300277.1|1057675_1060357_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_016209439.1|1060437_1061064_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_129556553.1|1061227_1062820_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_016209434.1|1062909_1064331_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	1079370	1208586	3139871	tRNA,transposase,protease	Staphylococcus_phage(21.43%)	105	NA	NA
WP_016209432.1|1079370_1081080_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209448.1|1081337_1082669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209449.1|1083110_1084583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1085298_1085664_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273508.1|1085904_1086771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|1087283_1087628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776562.1|1087780_1087972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1088215_1088791_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1088736_1089102_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300283.1|1089342_1089984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1090451_1091426_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047193.1|1092639_1094028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780476.1|1094263_1096201_-	histidine kinase	NA	NA	NA	NA	NA
WP_016210517.1|1097214_1097934_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|1098047_1101587_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|1101653_1102472_+	ZipA protein	NA	NA	NA	NA	NA
WP_016210518.1|1102458_1104498_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210522.1|1104513_1105566_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210524.1|1105576_1106107_+	exsB family protein	NA	NA	NA	NA	NA
WP_016210010.1|1107744_1107921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780418.1|1108096_1108480_+	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_075273518.1|1108555_1108849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210016.1|1109015_1109975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|1110705_1110861_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|1111125_1112496_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_052104723.1|1112488_1113442_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036779556.1|1113422_1116227_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.0	3.1e-57
WP_016210027.1|1116306_1116903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1117292_1118048_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155047191.1|1118445_1119177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|1119437_1120763_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210023.1|1120759_1122817_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210007.1|1122794_1123367_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|1123422_1123782_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|1123846_1124881_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|1125138_1125990_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|1126084_1127068_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|1127224_1128892_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_155047190.1|1129830_1130148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556556.1|1130166_1130742_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1130687_1131053_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|1131074_1131404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047175.1|1131812_1133135_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_032126362.1|1133665_1134031_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1133976_1134552_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047189.1|1134611_1134785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047265.1|1135074_1135668_+	reverse transcriptase	NA	A0A0N7AE80	Bacillus_phage	28.9	4.0e-07
WP_105962623.1|1135676_1136830_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300290.1|1136963_1137221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007015.1|1137322_1137748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1137959_1138217_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1138216_1139224_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155082072.1|1139632_1139770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155082073.1|1139799_1140480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|1140935_1141088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|1141060_1141234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047188.1|1141223_1141388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300293.1|1141444_1141810_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300294.1|1142081_1143143_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211279.1|1143886_1146355_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_016211277.1|1146368_1147337_+	homoserine kinase	NA	NA	NA	NA	NA
WP_016211278.1|1147323_1148583_+	threonine synthase	NA	NA	NA	NA	NA
WP_129556646.1|1148634_1150020_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_036781047.1|1151337_1152195_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_036778145.1|1152807_1153929_+	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	8.7e-11
WP_016211172.1|1153978_1155175_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_080664856.1|1155363_1156428_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_051307350.1|1156411_1157158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778066.1|1157147_1157876_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211168.1|1157872_1158532_+	wbqC-like family protein	NA	NA	NA	NA	NA
WP_016211169.1|1158515_1159463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1159462_1159978_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778065.1|1160020_1161454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210393.1|1161547_1163749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210398.1|1164237_1165830_+	B-type flagellin	NA	NA	NA	NA	NA
WP_032126669.1|1166054_1167632_+	B-type flagellin	NA	NA	NA	NA	NA
WP_122940572.1|1167743_1168169_+	flaG family protein	NA	NA	NA	NA	NA
WP_016210394.1|1168279_1169665_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032126670.1|1169690_1170128_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210390.1|1170132_1170474_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_016210399.1|1170488_1172480_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210388.1|1172505_1173180_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210397.1|1173176_1175351_-	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210772.1|1176559_1178113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1178196_1179006_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_033923762.1|1179133_1179367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210769.1|1179667_1181170_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_016210773.1|1181473_1184167_+	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210771.1|1184163_1187565_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_054300162.1|1187656_1188739_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300297.1|1188801_1189869_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212246.1|1190804_1191461_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|1191564_1192647_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300271.1|1192986_1193961_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212247.1|1194588_1195344_-	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_036779544.1|1195710_1196718_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1196717_1196975_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047187.1|1197338_1198313_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_075273524.1|1198353_1199319_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|1199474_1201025_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_054300299.1|1203226_1204309_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046981.1|1204398_1204575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1205573_1206437_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155047186.1|1206466_1207696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047185.1|1207699_1208586_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	1249258	1425159	3139871	tRNA,transposase,integrase	Staphylococcus_phage(17.65%)	153	1281512:1281571	1357621:1357984
WP_054300304.1|1249258_1249537_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047180.1|1249589_1249793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776195.1|1250435_1251683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923708.1|1252094_1252970_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211947.1|1253084_1254230_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_129556540.1|1254222_1254618_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211946.1|1254836_1255592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212551.1|1256947_1257442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556643.1|1257899_1259264_-	histidine kinase	NA	NA	NA	NA	NA
WP_016211983.1|1259359_1260019_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_155047179.1|1260266_1260611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047178.1|1260679_1261408_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.5e-43
WP_155047177.1|1261454_1261601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300189.1|1261657_1262023_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036779232.1|1262317_1263877_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|1264237_1266208_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|1266399_1267479_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_052104715.1|1267527_1267734_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211210.1|1267740_1269222_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211214.1|1269324_1269888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1271649_1272909_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211940.1|1273029_1273362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1273475_1274450_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_155047176.1|1274594_1274747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300312.1|1274964_1275987_+	YHYH protein	NA	NA	NA	NA	NA
WP_036778055.1|1275994_1277677_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.7e-32
WP_016211344.1|1277837_1278656_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|1278869_1279853_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|1279845_1280067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|1280094_1280736_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_033923708.1|1280979_1281855_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1281512:1281571	attL	TACCTGAAATTGCTCAAGGTCTGACAGGTAAGATTATTGGTGATAAAGGTTACATTTCAC	NA	NA	NA	NA
WP_129556490.1|1284317_1285203_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1285207_1285495_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|1285547_1285826_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|1285924_1286272_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|1286593_1286833_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|1287050_1287638_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|1287598_1287934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|1288121_1288766_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|1289100_1289751_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|1290283_1291336_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032126786.1|1291353_1294434_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_054300384.1|1294732_1295548_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047175.1|1295956_1297279_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_155047174.1|1298187_1298832_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.4	1.1e-39
WP_155047173.1|1298887_1299097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209615.1|1300449_1300956_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016209623.1|1300972_1302472_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209624.1|1302493_1303105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209622.1|1303110_1304274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777073.1|1304305_1306843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|1306874_1308767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273639.1|1309134_1309851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777070.1|1309853_1312727_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_016209636.1|1312727_1313132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|1313146_1314868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|1314867_1317816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|1317818_1319216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209630.1|1319229_1319970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|1319950_1320385_+	lipoprotein	NA	NA	NA	NA	NA
WP_016209618.1|1320429_1321059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209616.1|1321129_1322044_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_033923701.1|1322074_1325377_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209627.1|1325373_1327197_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_016209617.1|1327236_1327635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209621.1|1327755_1328760_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|1329192_1330641_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_036777066.1|1330727_1333784_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081007073.1|1333766_1333937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046976.1|1334002_1334140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212485.1|1334436_1334970_-	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_032126753.1|1335786_1336251_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|1336320_1337841_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126752.1|1337928_1338531_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|1338527_1338875_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|1339025_1340009_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_122942160.1|1340636_1341617_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052047087.1|1341777_1341996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047172.1|1342167_1343193_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300320.1|1344338_1344938_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300321.1|1345155_1345527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212346.1|1346321_1346468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1346701_1347565_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211748.1|1349046_1350651_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211752.1|1350666_1351812_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_075273313.1|1351888_1352227_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1352186_1352642_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212445.1|1352887_1353154_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047171.1|1353228_1353792_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	39.9	3.2e-30
WP_155047170.1|1353996_1354278_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047169.1|1354312_1354921_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212534.1|1355333_1355600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1356727_1357093_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1357038_1357614_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211725.1|1358129_1359044_+	hypothetical protein	NA	NA	NA	NA	NA
1357621:1357984	attR	TACCTGAAATTGCTCAAGGTCTGACAGGTAAGATTATTGGTGATAAAGGTTACATTTCACAAGATTTATTTAACAGGCTTTATGAAAAAGGACTGCAATTAATCAATAAAATTCGCAAGAATATGAAAAATAGGCTCATGCCTATCATCGATAAAATTTTACTCAGAAAACGTGGAATTATTGAAAGTGTATTTGATCAACTTAAAAACATCTCACAAATCGAGCACTCTAGGCATCGTAGTGTCAACAACTTTATGGTCAATATTCTTGCTGGATTAGCAGCCTACTGTCTTCAGGAGAAGAAGCCATCGCTTAATATCCAGCGTAATCTATTGACCAGCTGAGTTATATCGAACTCACGTTA	NA	NA	NA	NA
WP_054300322.1|1359082_1361017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1361404_1361998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273534.1|1363629_1364511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1364704_1364977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300326.1|1365078_1365543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046975.1|1365956_1366406_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_016212459.1|1366525_1366906_+	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_054300328.1|1367043_1367820_-	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_155047167.1|1367930_1369448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047166.1|1369497_1370559_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211456.1|1371180_1371759_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_122942091.1|1371786_1372182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211455.1|1372287_1373745_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_016211452.1|1373806_1375294_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211454.1|1376044_1376515_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|1378389_1378662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1378814_1379180_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1379125_1379701_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556641.1|1381783_1383046_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016210751.1|1383133_1384939_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_016210752.1|1385422_1386220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210749.1|1386389_1386851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1387149_1389105_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1389786_1389972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|1390305_1391295_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016211834.1|1394668_1394983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307365.1|1395240_1395501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1395520_1396009_+	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_155046972.1|1397532_1398123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047040.1|1398711_1399650_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047165.1|1399675_1401241_-	amino acid permease	NA	NA	NA	NA	NA
WP_036778182.1|1401447_1402275_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_075273540.1|1402641_1403253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556527.1|1403437_1403698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047164.1|1404690_1405113_+	response regulator	NA	NA	NA	NA	NA
WP_036777256.1|1405535_1405736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104738.1|1406110_1406917_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210795.1|1407022_1407994_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210801.1|1407975_1408947_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155047264.1|1409269_1409629_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_054300271.1|1409668_1410643_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007028.1|1411058_1411514_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1411473_1411812_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|1411985_1412426_-	universal stress protein	NA	NA	NA	NA	NA
WP_032126362.1|1412892_1413258_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1413203_1413779_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211350.1|1414063_1415002_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211349.1|1415065_1417060_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|1417056_1417659_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_036779888.1|1417655_1417994_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|1418069_1419296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300339.1|1419853_1420825_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.2e-25
WP_016211856.1|1421040_1421226_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|1421352_1421820_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|1421816_1422695_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|1422945_1424253_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007028.1|1424405_1424861_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1424820_1425159_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	1440774	1547041	3139871	tRNA,transposase	Staphylococcus_phage(14.81%)	103	NA	NA
WP_054300271.1|1440774_1441749_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047162.1|1441768_1442206_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|1442220_1442586_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210855.1|1442739_1443717_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210849.1|1443834_1445283_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210847.1|1445311_1446316_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210851.1|1446338_1447010_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210850.1|1446994_1448248_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1448496_1449051_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210848.1|1449634_1450819_+	MFS transporter	NA	NA	NA	NA	NA
WP_051307341.1|1450985_1452584_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_155047161.1|1453277_1454249_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300343.1|1454284_1454512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1454515_1455402_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007031.1|1455489_1455762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209794.1|1456496_1457120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776664.1|1457165_1459109_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	23.9	1.1e-05
WP_016209788.1|1459230_1459983_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016209790.1|1460034_1460493_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_129556639.1|1460788_1461199_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209775.1|1461215_1461671_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_016209797.1|1461667_1462159_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_080664822.1|1462155_1462905_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_016209776.1|1462934_1463204_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_036776670.1|1463219_1464005_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_016209786.1|1464018_1465152_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_016209770.1|1465186_1467280_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_016209767.1|1467310_1468771_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_129556524.1|1468751_1469639_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_016209784.1|1469635_1470358_+	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_017377132.1|1470444_1470828_+	response regulator	NA	NA	NA	NA	NA
WP_036776675.1|1470869_1471613_+	chemotaxis protein CheZ	NA	NA	NA	NA	NA
WP_036776682.1|1471625_1473650_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_051307317.1|1473711_1474005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209791.1|1474141_1474864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209771.1|1475028_1475751_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126436.1|1476457_1476913_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209793.1|1476928_1478377_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_016209795.1|1478417_1479173_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_080664823.1|1479153_1480554_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209796.1|1480577_1481795_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_016209778.1|1481825_1482200_+	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209772.1|1482218_1482770_+	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_054300271.1|1484051_1485026_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1485123_1486185_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1486739_1487714_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212424.1|1488057_1488336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|1488328_1488601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1488718_1489801_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300346.1|1489947_1490823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126678.1|1490833_1491844_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_016211554.1|1492170_1492797_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_016211557.1|1492842_1494072_+	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_032126677.1|1494266_1494830_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211555.1|1494904_1496263_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_016211664.1|1496799_1497528_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211666.1|1497900_1500720_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211669.1|1500874_1501225_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1502049_1503024_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556522.1|1504334_1505567_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211405.1|1505773_1507546_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_016211403.1|1507681_1508725_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_036777261.1|1508738_1509482_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_155047160.1|1509616_1509916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144019306.1|1509977_1510157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1510520_1511219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047159.1|1511640_1513032_+	protein kinase	NA	NA	NA	NA	NA
WP_016211733.1|1513087_1513912_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_054300173.1|1514526_1515588_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046730.1|1515806_1515947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1516214_1516862_-	LysE family translocator	NA	NA	NA	NA	NA
WP_016212267.1|1517142_1517502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|1517668_1518124_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1518083_1518422_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047158.1|1518557_1520831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126823.1|1520819_1521542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104609.1|1521652_1522285_+	MarC family protein	NA	NA	NA	NA	NA
WP_098082850.1|1522320_1522497_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_016211481.1|1522571_1523714_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_155049129.1|1523792_1523930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126825.1|1523946_1525260_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_054300349.1|1525811_1527536_+	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_155046942.1|1528596_1529482_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046942.1|1529646_1530532_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556521.1|1531066_1531255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1531205_1532359_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047157.1|1532423_1532828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047156.1|1532999_1533623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211631.1|1533881_1534688_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_054300351.1|1534943_1535765_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211632.1|1535800_1536655_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211627.1|1536880_1537045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1537350_1538007_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1538090_1538456_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300181.1|1538512_1538794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|1538797_1538977_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016210103.1|1539329_1540688_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_016210117.1|1540969_1541329_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210111.1|1541749_1543384_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_017377579.1|1543390_1544227_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210099.1|1544248_1545526_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_016210105.1|1545609_1545930_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210106.1|1545949_1547041_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	1565439	1610352	3139871	transposase,integrase,protease	Staphylococcus_phage(45.45%)	49	1565344:1565403	1593115:1593203
1565344:1565403	attL	GGTAACCCTCCCTTAAAATAGTACAAGTGATAAGTGGAATCTTCTGTTAAATTAACTTAG	NA	NA	NA	NA
WP_054300353.1|1565439_1565667_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300354.1|1565813_1566332_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	42.9	1.3e-30
WP_054300271.1|1566470_1567445_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047154.1|1567517_1567898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1567858_1568224_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1568169_1568745_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300355.1|1568734_1568920_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211563.1|1569130_1569292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211564.1|1569324_1570200_-	ParA family protein	NA	NA	NA	NA	NA
WP_052104693.1|1570365_1574232_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_080728343.1|1574313_1574454_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_081007034.1|1574435_1574720_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_155047153.1|1574984_1576403_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_016211991.1|1577311_1578217_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126537.1|1578457_1578643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211994.1|1578679_1579216_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_155047152.1|1579418_1580141_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1580180_1581155_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047151.1|1581151_1581691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047150.1|1581740_1582967_+	DUF4131 domain-containing protein	NA	NA	NA	NA	NA
WP_155047149.1|1582961_1583177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|1583200_1584175_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016212012.1|1584218_1584896_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016212013.1|1584911_1585295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212011.1|1585516_1586638_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_054300357.1|1586871_1587747_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155065715.1|1588029_1589142_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075273327.1|1589145_1589721_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1589666_1590032_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273551.1|1590209_1590512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556638.1|1590511_1591192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377865.1|1592536_1592821_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664876.1|1593179_1595042_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
1593115:1593203	attR	CTAAGTTAATTTAACAGAAGATTCCACTTATCACTTGTACTATTTTAAGGGAGGGTTACCGATGGTTATTTCACTAGATGAATTTTATT	NA	NA	NA	NA
WP_054300359.1|1595266_1595839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047148.1|1596197_1597235_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047147.1|1597764_1598739_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_054300361.1|1598892_1599189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377353.1|1599166_1599832_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1599871_1600846_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211144.1|1601402_1602032_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_036779218.1|1602015_1602438_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|1602444_1604184_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|1604184_1605249_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1605252_1605606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1605718_1606675_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|1606684_1606996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1607011_1607581_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|1607844_1609173_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1609377_1610352_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 16
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	1619240	1666644	3139871	tRNA,transposase,integrase	Staphylococcus_phage(25.0%)	44	1609287:1609346	1652112:1653213
1609287:1609346	attL	GCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTC	NA	NA	NA	NA
WP_129556637.1|1619240_1620020_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|1620494_1620932_-	MFS transporter	NA	NA	NA	NA	NA
WP_155047262.1|1621320_1621437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047146.1|1621379_1621589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300363.1|1621828_1622176_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047145.1|1622121_1622697_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273553.1|1622686_1623613_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300364.1|1623786_1624665_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126267.1|1625084_1625327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211330.1|1625674_1626775_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_098082827.1|1626949_1628251_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_052104656.1|1628327_1628831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126265.1|1629154_1630072_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016211336.1|1630137_1630752_-	chorismate mutase	NA	NA	NA	NA	NA
WP_016211334.1|1630800_1630989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210322.1|1631606_1632503_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016210320.1|1632639_1633713_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_054300366.1|1633862_1634276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300568.1|1634296_1635007_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.3	4.1e-38
WP_129556511.1|1635189_1636626_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210321.1|1636822_1637791_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_016210325.1|1640461_1641838_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210326.1|1641991_1643290_-	ankyrin repeats family protein	NA	NA	NA	NA	NA
WP_036778577.1|1643629_1644913_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_016210333.1|1644986_1645616_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_016210330.1|1645819_1646203_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210332.1|1646300_1647044_+	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_075273555.1|1647174_1647708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1647985_1648669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|1649422_1650397_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_155047144.1|1650432_1651758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1652202_1653177_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211804.1|1653559_1654945_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
1652112:1653213	attR	GCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_081007037.1|1654951_1656490_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211806.1|1656532_1657258_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032126804.1|1657422_1658298_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1658457_1659363_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_032126803.1|1659596_1660829_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_016211764.1|1661029_1661851_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155047143.1|1662158_1662386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211767.1|1662689_1663499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211289.1|1665115_1665388_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211286.1|1665499_1665847_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_036777656.1|1665864_1666644_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 17
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	1692705	1737051	3139871	tRNA,transposase,protease	Staphylococcus_phage(22.22%)	40	NA	NA
WP_054300173.1|1692705_1693767_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046721.1|1693947_1694115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1694286_1695261_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300373.1|1695257_1696115_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209842.1|1696842_1697232_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209834.1|1697408_1698167_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209829.1|1698163_1700563_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209839.1|1701942_1703241_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209838.1|1703438_1704332_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|1704331_1705546_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|1705565_1706852_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|1706867_1707122_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_036777393.1|1707357_1708725_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|1709055_1710078_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_155064795.1|1710906_1712364_+	amino acid permease	NA	NA	NA	NA	NA
WP_054300271.1|1712603_1713578_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556633.1|1713686_1714583_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209827.1|1714901_1716461_+	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_016209841.1|1716536_1716731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209831.1|1716950_1717649_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|1717927_1718191_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_036777412.1|1718497_1721092_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209835.1|1721088_1721571_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209844.1|1721548_1722589_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209840.1|1722761_1723247_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_032126641.1|1723354_1725925_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_032126642.1|1725960_1726422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049837.1|1726491_1726683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|1727901_1728441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067955.1|1728401_1728587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|1729388_1730873_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|1730997_1732533_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|1732766_1733132_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047140.1|1733077_1733662_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047139.1|1733685_1734090_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047138.1|1734065_1734548_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728346.1|1734565_1734898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300375.1|1735704_1735905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|1736119_1736425_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_075273327.1|1736475_1737051_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	1758471	1810221	3139871	tRNA,transposase	Staphylococcus_phage(15.38%)	53	NA	NA
WP_075273298.1|1758471_1759047_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066235.1|1759050_1759425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1760148_1760649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|1761064_1761418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211831.1|1761718_1763446_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_081007040.1|1763583_1764240_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210510.1|1764270_1764999_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_016210506.1|1764991_1766230_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210512.1|1766365_1767403_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210515.1|1767456_1768359_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210514.1|1768467_1769721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1769778_1773276_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075273576.1|1773335_1774064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778516.1|1774191_1774740_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016210508.1|1775060_1776758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1776766_1777920_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_036781272.1|1778515_1778734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046961.1|1778853_1779258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1779425_1779791_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047135.1|1779736_1780312_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211467.1|1780386_1780953_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_032126344.1|1780955_1782044_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032126343.1|1782164_1782977_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|1783107_1785093_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211470.1|1785152_1785806_-	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_155047134.1|1786572_1787595_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047133.1|1787866_1788841_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.6e-27
WP_016212421.1|1789591_1789774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|1790125_1790350_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155047132.1|1790494_1791157_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.6	5.3e-32
WP_032126637.1|1791273_1791567_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556508.1|1791628_1792072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047131.1|1792342_1792999_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047130.1|1793186_1793945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1794007_1795069_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211841.1|1795928_1796381_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211839.1|1796498_1797971_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|1798129_1798594_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|1799064_1799238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1799947_1800313_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1800258_1800834_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300250.1|1800823_1801483_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_032126143.1|1801582_1802854_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_016211422.1|1802942_1803413_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_051307357.1|1803435_1804029_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211417.1|1804165_1805215_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_016211415.1|1805238_1806162_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1806178_1806640_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211414.1|1806747_1807566_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_129556449.1|1807781_1808288_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1808302_1808668_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047129.1|1808871_1809528_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300382.1|1809798_1810221_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	1820762	1879679	3139871	transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(33.33%)	58	NA	NA
WP_054300162.1|1820762_1821845_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212040.1|1822050_1823400_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_016212039.1|1823576_1824134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133287.1|1824322_1824721_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047128.1|1824776_1826144_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.6e-12
WP_155047127.1|1826552_1827368_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212251.1|1827529_1828066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046960.1|1828227_1828881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047126.1|1829000_1829492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|1829763_1829946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1830295_1831573_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_080664858.1|1831569_1831707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211223.1|1832218_1833820_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211221.1|1833836_1834979_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211218.1|1835231_1835969_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|1835993_1837265_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_032126790.1|1837493_1838399_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_054300387.1|1838657_1841057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300388.1|1841104_1842787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209976.1|1843656_1843890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007074.1|1844123_1844711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209969.1|1844677_1845643_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016209951.1|1845633_1846044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209957.1|1846050_1846386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556634.1|1846386_1846929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209950.1|1847233_1848025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209973.1|1848061_1851166_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_016209965.1|1851195_1851993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209956.1|1851997_1854988_-	ATPase AAA	NA	NA	NA	NA	NA
WP_036776383.1|1854993_1855425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209972.1|1855475_1856042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036776381.1|1856041_1857085_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_016209954.1|1857090_1857615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209953.1|1857636_1859943_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_016209962.1|1859989_1860229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209958.1|1860230_1861358_-	type II/IV secretion system family protein	NA	NA	NA	NA	NA
WP_016209964.1|1861357_1862110_-	dotC-like type IV secretion system protein	NA	NA	NA	NA	NA
WP_051307320.1|1862102_1862609_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_016209959.1|1862633_1863041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556635.1|1863068_1864076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209971.1|1864134_1865040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209955.1|1865046_1866240_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_155047125.1|1866236_1867163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209960.1|1867780_1867933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211310.1|1868137_1868851_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SEW9	Cyanophage	39.1	2.2e-39
WP_016211308.1|1868926_1869205_-	lipoprotein	NA	NA	NA	NA	NA
WP_032126213.1|1869249_1870140_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_016211307.1|1870224_1870698_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_016211313.1|1870833_1871355_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016211309.1|1871395_1872190_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016211305.1|1872192_1872474_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155047124.1|1872470_1873448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211312.1|1874153_1874900_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|1875021_1876083_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780082.1|1876626_1877532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|1877662_1878391_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|1878510_1878789_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_129556478.1|1878792_1879679_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	1890470	1945903	3139871	tRNA,transposase	uncultured_Mediterranean_phage(30.77%)	46	NA	NA
WP_081007041.1|1890470_1890998_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|1891663_1891858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1892071_1892425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1892756_1893377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211823.1|1893417_1893606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047122.1|1893640_1897732_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211770.1|1897931_1899065_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|1899078_1899267_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_054300276.1|1899559_1900534_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_075273594.1|1900573_1901944_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300404.1|1902016_1902910_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|1903018_1903936_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_036777569.1|1903987_1904743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|1904810_1906085_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_036777566.1|1906219_1906897_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209944.1|1907097_1908525_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|1908499_1909138_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|1909347_1909626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|1909859_1910804_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_036777561.1|1910825_1912694_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|1912714_1913068_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777579.1|1913106_1914222_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209932.1|1914404_1915445_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|1915447_1916482_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|1916478_1917540_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|1917651_1919124_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_052104625.1|1919276_1919720_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209940.1|1919795_1922567_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_036777555.1|1922723_1923953_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1923979_1924642_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|1925163_1925664_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047121.1|1925765_1926869_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	9.5e-10
WP_075274669.1|1927073_1927376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300286.1|1927760_1928225_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962623.1|1928388_1929541_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047120.1|1929550_1929895_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047119.1|1930179_1931502_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_081007042.1|1931910_1932726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300406.1|1935279_1938015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1938315_1939377_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126856.1|1939437_1939779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1940083_1941237_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_032126362.1|1941871_1942237_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1942182_1942758_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212005.1|1943096_1944857_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_016210592.1|1945246_1945903_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	1950451	2064172	3139871	tRNA,transposase	Staphylococcus_phage(17.65%)	106	NA	NA
WP_032126176.1|1950451_1951234_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210588.1|1951324_1952650_-	fimV domain protein	NA	NA	NA	NA	NA
WP_016210595.1|1953017_1954196_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210594.1|1954372_1955026_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_036778626.1|1955161_1957102_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_129556498.1|1957098_1957707_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054300271.1|1957886_1958861_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080728317.1|1959051_1962417_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211391.1|1962483_1963059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779996.1|1963070_1964627_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_036779999.1|1964646_1965078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780001.1|1965064_1965328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|1965684_1966056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|1966260_1966986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212252.1|1967300_1967459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047118.1|1967496_1968939_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_075273327.1|1968928_1969504_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1969449_1969815_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274672.1|1969852_1970446_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211114.1|1970811_1973742_-	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_016211115.1|1973874_1975827_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211112.1|1976019_1976667_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211113.1|1976722_1978048_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_032126179.1|1978077_1978329_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_080664854.1|1978286_1978868_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300408.1|1979204_1979861_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_032126362.1|1979911_1980277_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1980222_1980798_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209823.1|1982019_1982463_-	response regulator	NA	NA	NA	NA	NA
WP_016209809.1|1982887_1983376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|1983482_1984451_+	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_155047117.1|1985152_1988452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209810.1|1990041_1991955_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209822.1|1992011_1992659_-	methyltransferase domain protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_036777933.1|1992794_1993919_-	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_016209800.1|1993915_1994512_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209821.1|1994542_1994875_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209812.1|1994964_1996788_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_036777937.1|1997234_1998947_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	4.3e-25
WP_016209815.1|1999264_1999804_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016209799.1|2000190_2000607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209818.1|2000702_2001518_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209805.1|2001650_2003144_+	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_032126324.1|2003322_2003745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209801.1|2003744_2005799_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016209813.1|2006083_2006899_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_036778458.1|2006999_2007818_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209808.1|2007814_2008183_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016212343.1|2009487_2010294_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_129556499.1|2010532_2011686_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211588.1|2011853_2012555_-	cyclase family protein	NA	NA	NA	NA	NA
WP_032126329.1|2012630_2013260_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_129556496.1|2013445_2014684_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_036778365.1|2014958_2015621_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_016211589.1|2015610_2016843_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_129556495.1|2016965_2017223_+	VOC family protein	NA	NA	NA	NA	NA
WP_032126637.1|2018203_2018497_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126540.1|2018727_2019591_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046995.1|2019724_2020610_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126332.1|2021257_2022457_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_016211366.1|2022709_2022997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779263.1|2023052_2025062_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_032126330.1|2025404_2026364_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_016211367.1|2026511_2027294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273303.1|2027449_2028166_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016210281.1|2028179_2029571_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210270.1|2029612_2032600_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210277.1|2032669_2033503_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210279.1|2033556_2034723_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210272.1|2034710_2035421_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210283.1|2035460_2036246_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_129556492.1|2036273_2037017_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|2037114_2039310_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_016210271.1|2039386_2040070_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_032126334.1|2040080_2040512_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_036778186.1|2040551_2040950_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_016210273.1|2041322_2042030_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210275.1|2042094_2042397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210276.1|2042452_2042929_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210284.1|2042983_2043505_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210280.1|2043586_2044681_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_075273327.1|2045092_2045668_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2045613_2045979_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047116.1|2045939_2046191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300415.1|2046780_2047482_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_032126500.1|2047615_2048332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|2048468_2049716_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126499.1|2050094_2050706_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211122.1|2050802_2051669_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2051672_2052434_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_036779309.1|2052597_2053503_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211125.1|2053725_2054556_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|2054725_2055115_+	lipoprotein	NA	NA	NA	NA	NA
WP_032126498.1|2055247_2055808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|2055869_2056235_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2056249_2056756_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047115.1|2056752_2057157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212585.1|2057451_2057772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2057883_2058858_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|2059227_2059803_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2059748_2060114_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274673.1|2060074_2061073_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780900.1|2061243_2061897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047081.1|2061947_2062385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212519.1|2062655_2063036_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300173.1|2063110_2064172_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	2081925	2124559	3139871	transposase	Staphylococcus_phage(25.0%)	45	NA	NA
WP_129556490.1|2081925_2082811_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155082074.1|2082815_2084015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047110.1|2084260_2085322_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126869.1|2085299_2085539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2086059_2086635_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2086580_2086946_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047109.1|2087007_2087421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556488.1|2088601_2089452_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275079.1|2089600_2090662_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126801.1|2090709_2091219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274679.1|2091887_2092949_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212218.1|2094399_2094750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285943.1|2094894_2095731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|2095784_2097077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104686.1|2097312_2100069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046956.1|2100538_2100703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046955.1|2101224_2101404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|2101645_2102347_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|2102607_2102814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|2103043_2103349_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|2103527_2105525_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2105508_2106555_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|2107275_2108127_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|2108127_2109048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|2109458_2109743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2109734_2110190_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2110149_2110488_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2110700_2111630_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2111786_2112215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047107.1|2112295_2112748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2112773_2113679_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2113875_2114484_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155047106.1|2114524_2115411_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556499.1|2115607_2116760_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211971.1|2116966_2117578_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2117598_2118795_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2118891_2119032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2119044_2119449_-	SufE family protein	NA	NA	NA	NA	NA
WP_075273313.1|2119574_2119913_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300431.1|2119872_2120175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|2120319_2120505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|2121074_2121656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300573.1|2121683_2122817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|2123080_2123608_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_081007045.1|2123929_2124559_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	2146264	2199270	3139871	tRNA,transposase,protease	Leptospira_phage(16.67%)	56	NA	NA
WP_016209884.1|2146264_2146888_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2146964_2147165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2147306_2148005_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2148151_2148721_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2149035_2149659_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2149867_2150470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2150541_2151427_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|2151650_2152537_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273603.1|2152616_2152793_+	phosphatase	NA	NA	NA	NA	NA
WP_016212526.1|2152916_2153450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047105.1|2153620_2154502_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	3.4e-50
WP_016212445.1|2154744_2155011_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|2155069_2155654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274681.1|2156204_2157080_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063519.1|2157128_2157545_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210465.1|2157831_2158674_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2158724_2159072_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2159262_2160150_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2160264_2160867_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2160863_2161583_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_052104601.1|2161651_2163364_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_036777098.1|2163511_2165449_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2165557_2166610_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2166609_2166885_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2166965_2167514_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_051307322.1|2167787_2167967_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_155047104.1|2167970_2168252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2168308_2168674_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047103.1|2168789_2169911_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_155049817.1|2170705_2171592_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036780722.1|2171653_2172628_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_016210459.1|2172792_2173311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047101.1|2173515_2174634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211720.1|2174881_2175805_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211716.1|2175818_2176742_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036778439.1|2176689_2177346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|2177648_2178476_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_155047100.1|2178916_2179276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047099.1|2179420_2179576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126590.1|2179768_2181301_+	nuclease	NA	NA	NA	NA	NA
WP_032126591.1|2181363_2182701_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_016210313.1|2182843_2184310_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210314.1|2184306_2185356_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_036778435.1|2185479_2187594_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|2187758_2188163_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2188223_2188949_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210307.1|2189034_2189925_+	YicC family protein	NA	NA	NA	NA	NA
WP_032126592.1|2189965_2190586_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.3	2.5e-20
WP_016210310.1|2190646_2190853_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_016210316.1|2190874_2193028_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.1e-12
WP_054300439.1|2193034_2195017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780594.1|2195288_2195771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2195774_2196350_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2196295_2196661_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036780787.1|2196859_2197819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2198187_2199270_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 24
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	2203193	2248244	3139871	transposase	Staphylococcus_phage(50.0%)	50	NA	NA
WP_054300443.1|2203193_2203472_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|2203524_2203773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|2203730_2204792_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212177.1|2205787_2205961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2206037_2206295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781320.1|2208513_2208741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2208727_2209054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2209055_2209487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2210015_2211077_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300445.1|2211171_2211723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2211992_2213012_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2212998_2213421_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2213422_2213896_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|2214011_2214635_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|2214664_2215339_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2215344_2216493_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2216489_2216951_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2217026_2218277_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2218403_2220083_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2220192_2221059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2221961_2222936_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_036781250.1|2223031_2223817_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2223960_2224647_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2224680_2225079_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2225242_2225548_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|2225625_2225880_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2226033_2227695_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2227754_2228438_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2228437_2229526_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2229574_2232211_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300173.1|2232623_2233685_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300448.1|2233874_2236244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2236287_2237262_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300449.1|2237281_2238061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2238190_2238529_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2238488_2238944_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211507.1|2239269_2240589_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|2240592_2241309_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|2241305_2241947_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_081007048.1|2241939_2242038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2242378_2242744_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2242689_2243265_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047096.1|2243296_2243569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047095.1|2243625_2243766_+	phosphatase	NA	NA	NA	NA	NA
WP_155047094.1|2243910_2244378_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211503.1|2244528_2244984_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|2245038_2245383_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2245412_2246456_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|2247158_2247368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2247357_2248244_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	2318432	2380775	3139871	tRNA,transposase	Planktothrix_phage(18.18%)	58	NA	NA
WP_129556571.1|2318432_2319143_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2319171_2319576_+	RidA family protein	NA	NA	NA	NA	NA
WP_036777168.1|2319600_2320560_-	response regulator	NA	NA	NA	NA	NA
WP_016209567.1|2320691_2321309_-	MFS transporter	NA	NA	NA	NA	NA
WP_155046949.1|2321379_2321550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126712.1|2321743_2322202_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2322946_2323957_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2324441_2325353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2325678_2329173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2329210_2330050_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_036777155.1|2330236_2330452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2330500_2331076_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2331072_2331411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2331579_2332569_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2332569_2333532_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_054300271.1|2334487_2335462_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2335599_2335833_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2335926_2336292_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2336306_2336813_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212572.1|2336870_2337263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2337392_2337758_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2337814_2338123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2338214_2338790_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2338735_2339101_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|2339253_2339526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126774.1|2340134_2340470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2340629_2342162_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2342194_2343034_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2343030_2343528_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_036779082.1|2343531_2344524_-	AAA family ATPase	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_155047091.1|2344638_2345985_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2346208_2347270_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2347348_2348494_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|2354301_2355159_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2355145_2356069_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_036778204.1|2356265_2357657_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2357703_2358747_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2358789_2359233_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2359365_2360556_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2360610_2360757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|2361307_2362225_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2362492_2362786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2362862_2363057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300462.1|2364075_2364993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2365458_2366301_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2366368_2367019_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|2367033_2368074_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|2368196_2369282_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2369308_2370418_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2370434_2370752_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2370748_2371108_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_054300463.1|2371210_2373940_-	kinase	NA	NA	NA	NA	NA
WP_080664847.1|2374440_2375394_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300173.1|2375466_2376528_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212048.1|2377291_2377849_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_032126664.1|2378042_2378726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126663.1|2379444_2379687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|2379713_2380775_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	2470668	2553379	3139871	tRNA,transposase	Escherichia_phage(37.93%)	81	NA	NA
WP_054300202.1|2470668_2471397_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|2471486_2472098_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_036779399.1|2472454_2472709_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2472807_2474592_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779389.1|2474680_2475400_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|2475582_2475789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779393.1|2475788_2476025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2476037_2476415_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2476921_2477740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779396.1|2477833_2478031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|2478125_2479511_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|2479637_2480228_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_155047083.1|2482419_2483148_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	4.3e-43
WP_016211816.1|2484216_2484570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2484611_2486225_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2486446_2486668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2486976_2487705_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2488321_2489419_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2489452_2490703_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_054300202.1|2490842_2491571_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212193.1|2491693_2492032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2492099_2492486_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2492482_2492728_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300475.1|2493136_2493865_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211625.1|2494348_2495218_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_036779883.1|2495214_2496564_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211623.1|2496676_2498317_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_054300202.1|2499131_2499860_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300478.1|2500139_2501876_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_054300477.1|2502379_2503108_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016212214.1|2503266_2503767_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016212213.1|2503741_2504251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2505004_2505733_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300479.1|2505883_2506924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211653.1|2507121_2508147_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_155065724.1|2508254_2509460_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	7.1e-35
WP_016211655.1|2509719_2510133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2510261_2510831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2510834_2511167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300480.1|2511159_2511999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047081.1|2512086_2513634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2514083_2514587_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2514549_2515257_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2515325_2516186_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_036777969.1|2516166_2516940_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2516970_2518224_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2518223_2519186_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2519229_2519982_+	ComF family protein	NA	NA	NA	NA	NA
WP_036777977.1|2520035_2521916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|2522063_2522534_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2522579_2522819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777984.1|2522837_2523287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2523507_2524932_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|2524996_2526046_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2526312_2527092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2527143_2528046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047080.1|2528104_2528851_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	4.4e-19
WP_016210616.1|2529099_2531910_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_081007053.1|2532144_2533005_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_155047079.1|2533847_2534090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2534244_2535397_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047078.1|2535583_2535919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2536011_2536311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2536300_2536465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047077.1|2536696_2537849_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	4.4e-58
WP_155047076.1|2537858_2538134_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212641.1|2538329_2538776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049820.1|2538740_2539196_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273369.1|2539304_2540120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047075.1|2540193_2541114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2541125_2541854_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2541943_2542150_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007054.1|2542312_2543545_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_054300482.1|2544060_2545350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049821.1|2546508_2546697_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047219.1|2546743_2547472_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032127022.1|2548148_2550335_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2550396_2551550_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2551835_2552360_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|2552550_2552718_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|2552662_2553379_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
>prophage 27
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	2568719	2596906	3139871	tRNA,transposase,integrase,protease	Acinetobacter_phage(12.5%)	27	2566108:2566167	2583948:2584236
2566108:2566167	attL	ACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTT	NA	NA	NA	NA
WP_155047267.1|2568719_2568929_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007057.1|2570256_2570673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|2570730_2571883_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016212230.1|2571939_2573388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2574921_2575110_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046946.1|2576511_2576787_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2576789_2577392_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_016212522.1|2577488_2577743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|2578287_2579367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780431.1|2579685_2581404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2581447_2582353_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155049822.1|2582823_2582979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047221.1|2583370_2583850_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	42.0	1.7e-11
WP_155047222.1|2583958_2584633_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.8	2.2e-09
2583948:2584236	attR	AAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTT	NA	NA	NA	NA
WP_155047223.1|2584676_2584922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2585552_2586128_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_036778086.1|2586203_2587079_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_052104629.1|2587479_2588505_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047224.1|2588648_2589125_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778088.1|2589109_2590192_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.0e-20
WP_036777829.1|2590432_2590837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047225.1|2591171_2591369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2591549_2592281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2592537_2593839_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2593980_2594649_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2595092_2595689_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2595709_2596906_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
>prophage 28
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	2626122	2678582	3139871	tRNA,transposase	Microbacterium_phage(12.5%)	57	NA	NA
WP_054300282.1|2626122_2626587_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047228.1|2626643_2627126_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2627980_2628376_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|2628372_2629167_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_036778479.1|2629345_2630071_-	D-Ala-D-Ala dipeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2630316_2631504_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016210935.1|2632080_2632623_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2632619_2633306_-	acireductone synthase	NA	NA	NA	NA	NA
WP_036778484.1|2633309_2633921_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2633967_2634987_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2635088_2635883_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2635920_2636727_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2636805_2637855_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2638052_2639312_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2639358_2640036_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2640121_2640403_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|2640494_2641682_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_016210820.1|2641918_2642860_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2643363_2643588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2643879_2644584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|2645054_2645693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2646027_2646558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779158.1|2646554_2648087_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2648083_2649034_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2649454_2650087_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2650329_2650527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2650901_2651267_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2651323_2651488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2651477_2651777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2651824_2652253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300194.1|2652330_2653029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2653006_2654068_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2654292_2654589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|2654693_2655350_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2655573_2656071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047229.1|2657280_2657742_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2657701_2658040_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036778253.1|2658097_2659636_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_098082804.1|2659747_2660846_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2661083_2662283_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2662312_2662951_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|2662966_2665150_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|2665387_2665732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|2666777_2666984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|2667148_2667607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|2668194_2669322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2669445_2670108_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2670199_2670445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2671518_2672178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2672279_2672930_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|2673042_2673363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2673421_2674396_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2674646_2674868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047230.1|2675156_2675579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047231.1|2675579_2676113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300190.1|2676607_2677570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046995.1|2677696_2678582_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	2739461	2797494	3139871	tRNA,transposase,protease	Staphylococcus_phage(37.5%)	56	NA	NA
WP_054300271.1|2739461_2740436_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047235.1|2740455_2741442_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2741532_2742279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275004.1|2742403_2743267_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2743510_2743873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273422.1|2744059_2744587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2744731_2745148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2747244_2748156_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2748207_2749056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2749500_2750211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2750302_2751271_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2751258_2751906_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036779767.1|2751934_2752786_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2752800_2754078_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2754118_2754634_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_054300183.1|2754712_2755774_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2755795_2756884_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_036777788.1|2756928_2758764_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2758806_2759277_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2759313_2759649_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2759661_2760378_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2760314_2761331_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2761327_2761807_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2761890_2764371_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2764433_2764799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2765137_2765476_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2765435_2765891_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2765905_2766196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777784.1|2766261_2767860_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2767990_2768326_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777781.1|2768353_2770018_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210581.1|2770014_2770659_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2770658_2771402_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2771460_2771700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2771850_2773218_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2773228_2773780_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2773860_2774844_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2774965_2776723_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2776945_2777536_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_155049840.1|2777624_2778044_-	DksA protein	NA	NA	NA	NA	NA
WP_075273416.1|2778184_2778799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2778859_2779645_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075273313.1|2779898_2780237_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007003.1|2780196_2780658_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2781030_2782005_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212084.1|2782286_2783303_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2783302_2783818_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2783859_2784333_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_155047236.1|2784388_2784931_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2784954_2785410_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_155046996.1|2787183_2789697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046997.1|2790631_2793154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2793728_2794790_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2794816_2795392_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2795337_2795703_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_105962623.1|2796341_2797494_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 30
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	2922362	2986494	3139871	transposase	Staphylococcus_phage(16.67%)	54	NA	NA
WP_054300271.1|2922362_2923337_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211161.1|2923919_2925029_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2925040_2925685_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2925703_2926690_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2926769_2927846_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2928048_2928873_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2929189_2930194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2930402_2931368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047242.1|2931506_2932382_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2932678_2933731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2933998_2934427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2934640_2935132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2935187_2936438_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2936540_2936759_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_036777591.1|2937216_2938071_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016210728.1|2938125_2938596_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2938983_2940363_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2940390_2940849_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2940826_2942044_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2942235_2942472_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2942485_2942641_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2942721_2943684_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2943843_2945160_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2945169_2945838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2946200_2948015_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_054300166.1|2948132_2948921_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211543.1|2949501_2951253_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|2951263_2952064_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|2952166_2952655_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_032126435.1|2952828_2953143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375799.1|2954163_2954508_+	DMT family protein	NA	NA	NA	NA	NA
WP_016210038.1|2960201_2961164_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|2961350_2962610_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|2962833_2963160_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|2963354_2964305_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|2964362_2966429_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|2966434_2967430_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|2968015_2969596_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|2969752_2971162_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|2971221_2972355_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|2972494_2973319_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|2973546_2974176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|2974512_2974884_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|2975187_2975475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|2975626_2976475_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|2976602_2977643_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_155047244.1|2977715_2979653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|2979936_2980596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2980750_2981725_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2981800_2982820_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047000.1|2982867_2983014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556602.1|2983218_2983428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|2984302_2985385_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_054300161.1|2985432_2986494_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP039040	Piscirickettsia salmonis strain Psal-072 chromosome, complete genome	3139871	2994379	3108299	3139871	tRNA,transposase	Staphylococcus_phage(33.33%)	113	NA	NA
WP_155047053.1|2994379_2995265_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212222.1|2995741_2996215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|2996211_2996607_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2997536_2998112_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2998057_2998423_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036778680.1|2998687_3001018_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_129556603.1|3001138_3003154_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300160.1|3003337_3006730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3006794_3007100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|3007290_3007470_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_155047245.1|3007473_3007662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|3007685_3008660_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	1.8e-28
WP_032126362.1|3008917_3009283_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047247.1|3009346_3009715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|3009718_3010605_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047248.1|3010668_3011355_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047249.1|3011607_3012708_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155082076.1|3012955_3014212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|3015254_3015620_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047002.1|3015634_3016240_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036776867.1|3016610_3018008_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_051307313.1|3018127_3019075_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3019071_3019587_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3019573_3020773_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3020769_3021093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3021094_3022324_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3022323_3023367_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3023366_3024050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3024046_3026536_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3026552_3026807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3026807_3027164_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3027943_3029107_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3029126_3032234_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3032235_3033741_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3033768_3034050_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3034198_3034540_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3034659_3036540_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3036624_3038223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3038240_3039356_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3039483_3040482_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_052104582.1|3040485_3041244_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3041245_3042445_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3042428_3043100_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3043121_3043898_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3043901_3044900_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3044901_3045480_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3045476_3046946_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3046989_3047277_-	trp operon repressor	NA	NA	NA	NA	NA
WP_155047250.1|3047477_3048074_+	EamA family transporter	NA	NA	NA	NA	NA
WP_054300152.1|3048100_3048466_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3048522_3048678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273401.1|3048822_3049275_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047251.1|3049312_3049537_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155047003.1|3051132_3052018_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3052204_3052426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047252.1|3052541_3053120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047253.1|3053264_3053459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3053517_3054492_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|3054545_3055607_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776841.1|3056334_3056874_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3056958_3057495_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3058146_3058449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3058898_3059207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|3059815_3060265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3060547_3061258_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3061484_3061883_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_036778156.1|3062750_3063701_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3063700_3065779_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3065926_3066442_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3066450_3067014_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3066994_3067741_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3067880_3068333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3068756_3069593_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3069589_3070486_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3070518_3071586_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3071604_3071973_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3071998_3073447_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3073456_3074836_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3074876_3076208_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3076179_3077139_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3077231_3077735_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3077869_3079021_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3079017_3079497_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3079643_3081965_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3081909_3082536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3082540_3083440_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3083512_3084091_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3084391_3084649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556718.1|3084657_3085844_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_155046758.1|3086658_3086790_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3086934_3087090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777721.1|3087417_3088191_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155047254.1|3089127_3089265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3089308_3090283_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3091377_3091716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007065.1|3091732_3092572_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_081007013.1|3092784_3093084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3093073_3093238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3093294_3093660_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3094964_3095660_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3095656_3097084_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3097109_3097373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3097445_3098420_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047005.1|3098478_3099329_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3099366_3099711_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3099707_3100544_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3100544_3100886_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3100887_3101493_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3101489_3103484_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3103503_3104445_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052104719.1|3104672_3106097_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3106609_3107584_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3107642_3108299_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039041	Piscirickettsia salmonis strain Psal-072 plasmid unnamed1, complete sequence	251458	1257	43158	251458	transposase,tRNA	Indivirus(16.67%)	41	NA	NA
WP_016211839.1|1257_2730_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|2888_3353_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|3823_3997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|4706_5072_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|5017_5593_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_054300250.1|5582_6242_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_032126143.1|6341_7613_-	AMIN domain-containing protein	NA	A0A0N6W8I1	Bacillus_phage	26.6	9.9e-19
WP_016211422.1|7701_8172_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_051307357.1|8194_8788_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.0	6.4e-29
WP_016211417.1|8924_9974_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_016211415.1|9997_10921_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|10937_11399_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211414.1|11506_12325_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_129556449.1|12540_13047_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	1.0e-06
WP_054300209.1|13061_13427_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047129.1|13630_14287_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300382.1|14557_14980_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300383.1|15250_17731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126139.1|17826_18756_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_016210804.1|18762_20682_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126141.1|20746_22021_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210805.1|22439_23111_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_036776426.1|23119_23971_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210803.1|24148_25447_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_054300162.1|25521_26604_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212040.1|26809_28159_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_016212039.1|28335_28893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133287.1|29081_29480_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_105962624.1|29535_30903_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.3	1.2e-22
WP_155047127.1|31311_32127_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212251.1|32288_32825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046960.1|32986_33640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047126.1|33759_34251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|34522_34705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|35054_36332_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_080664858.1|36328_36466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211223.1|36977_38579_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211221.1|38595_39738_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211218.1|39990_40728_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|40752_42024_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_032126790.1|42252_43158_-|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
>prophage 2
NZ_CP039041	Piscirickettsia salmonis strain Psal-072 plasmid unnamed1, complete sequence	251458	79780	122861	251458	transposase,tRNA	unidentified_phage(33.33%)	42	NA	NA
WP_054300173.1|79780_80842_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780082.1|81385_82291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|82421_83150_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|83269_83548_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_129556478.1|83551_84438_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	5.8e-10
WP_155047008.1|84495_84810_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016210889.1|84827_87674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210887.1|88183_89134_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210886.1|89216_89996_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_052104770.1|90064_90772_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210888.1|90732_90984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|91006_91303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|91836_92610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|92642_93239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300398.1|93296_94178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|94519_94786_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300400.1|94930_95173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|95229_95757_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|96422_96617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|96830_97184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|97515_98136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211823.1|98176_98365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047122.1|98399_102491_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211770.1|102690_103824_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|103837_104026_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_054300271.1|104318_105293_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155082077.1|105328_105595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|105639_106614_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.8	2.4e-25
WP_155047144.1|106649_107975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|108419_109394_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016211804.1|109776_111162_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_081007037.1|111168_112707_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016211806.1|112749_113475_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_033923708.1|113639_114515_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126790.1|114674_115580_+|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_032126803.1|115813_117046_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_016211764.1|117246_118068_+	alpha/beta hydrolase	NA	A0A2P1CHW5	Mycobacterium_phage	36.7	6.0e-09
WP_155047143.1|118375_118603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211767.1|118906_119716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211289.1|121332_121605_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211286.1|121716_122064_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_036777656.1|122081_122861_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP039041	Piscirickettsia salmonis strain Psal-072 plasmid unnamed1, complete sequence	251458	148922	190765	251458	transposase,protease,tRNA	unidentified_phage(20.0%)	36	NA	NA
WP_054300173.1|148922_149984_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046721.1|150164_150332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|150503_151478_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_054300373.1|151474_152332_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209842.1|153059_153449_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209834.1|153625_154384_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209829.1|154380_156780_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209839.1|158159_159458_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	34.5	5.5e-65
WP_016209838.1|159655_160549_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|160548_161763_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|161782_163069_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|163084_163339_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_036777393.1|163574_164942_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|165272_166295_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_155064795.1|167123_168581_+	amino acid permease	NA	NA	NA	NA	NA
WP_054300271.1|168820_169795_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_129556633.1|169903_170800_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209827.1|171118_172678_+	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_016209841.1|172753_172948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209831.1|173167_173866_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|174144_174408_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_036777412.1|174714_177309_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209835.1|177305_177788_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209844.1|177765_178806_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209840.1|178978_179464_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_032126641.1|179571_182142_+	DNA mismatch repair protein MutS	NA	F2QAF9	Pyramimonas_orientalis_virus	31.7	1.9e-05
WP_032126642.1|182177_182639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049837.1|182708_182900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|184118_184658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067955.1|184618_184804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|185605_187090_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|187214_188750_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|188983_189349_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047140.1|189294_189879_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	6.1e-08
WP_155047139.1|189902_190307_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047138.1|190282_190765_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039042	Piscirickettsia salmonis strain Psal-072 plasmid unnamed2, complete sequence	192523	2012	48760	192523	transposase,integrase	Acinetobacter_phage(21.43%)	54	NA	NA
WP_105962625.1|2012_2898_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.7	4.5e-10
WP_016212151.1|3500_4463_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|4486_4801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|4864_5839_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_033923686.1|5963_7013_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|7121_8162_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|8175_8805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|8895_9195_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_081377909.1|9191_9656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104769.1|10617_11541_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_155067971.1|11883_12054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|12685_13838_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274741.1|13907_14165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273822.1|14266_14767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|15211_16294_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212255.1|16480_16651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|16647_16851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|17187_17412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212260.1|17431_17704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|17861_18836_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_129556717.1|19490_20717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|21042_21879_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_016212398.1|22141_22603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047268.1|22769_23150_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|24238_24604_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|24549_25125_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_105962623.1|26108_27262_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273810.1|27282_27990_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	34.2	1.4e-11
WP_081007042.1|30149_30965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728342.1|31279_31783_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_105962174.1|31926_32091_+	phosphatase	NA	NA	NA	NA	NA
WP_155047269.1|32239_32635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273806.1|32896_33460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|33565_34021_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_075273804.1|33980_34319_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|34403_35132_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_016212413.1|35465_35894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|35941_36682_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_075273798.1|37082_37307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|37415_37940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047270.1|38060_38207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047297.1|38351_38498_-	phosphatase	NA	NA	NA	NA	NA
WP_032126138.1|39706_39970_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211871.1|40535_40871_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_129556699.1|40864_41065_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300590.1|41372_41597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|42213_43239_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273790.1|43783_44086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|44075_44702_-	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_016212412.1|45002_45167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|45159_45609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|45856_46030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212499.1|46234_46609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|47607_48760_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 2
NZ_CP039042	Piscirickettsia salmonis strain Psal-072 plasmid unnamed2, complete sequence	192523	51856	165786	192523	transposase,integrase,head,capsid,protease,tail	Streptococcus_phage(20.75%)	120	46910:46969	175794:177038
46910:46969	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_016211912.1|51856_52447_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
46910:46969	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_129556698.1|52536_53238_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_054300249.1|53351_53717_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|53731_54238_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	1.0e-06
WP_155047271.1|54241_55359_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	3.6e-57
WP_051307374.1|55473_55950_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_016212298.1|56190_56517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|57183_58209_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047272.1|58418_59147_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_054300594.1|59509_60535_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047273.1|60665_60803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046942.1|60941_61828_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.8	2.6e-10
WP_081377350.1|62458_63274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211897.1|63667_64072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|64072_64819_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211895.1|65327_66386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126360.1|66508_67243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211773.1|67829_68504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|68605_68974_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211776.1|69141_70479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556697.1|70961_71354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|71738_72644_-|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_016210664.1|72941_73364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210651.1|73363_73714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210658.1|73710_74106_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210667.1|74098_74422_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210663.1|74418_74730_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210655.1|75048_75645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556716.1|75658_75949_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_052047108.1|76082_76481_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047275.1|76536_77034_-	DNA polymerase	NA	NA	NA	NA	NA
WP_155047276.1|77030_77810_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	31.7	1.8e-18
WP_129556718.1|77838_79024_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_081377350.1|79557_80373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047277.1|80437_81046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067974.1|81260_81404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211936.1|81780_82803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047278.1|83292_83694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|83811_84837_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|85411_85573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|85572_86073_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273747.1|86334_86925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|86987_87281_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155049832.1|87363_88239_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	3.7e-57
WP_052104629.1|88356_89382_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047281.1|89608_89938_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.8	5.5e-06
WP_155047018.1|90005_90809_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.9e-55
WP_075274752.1|90844_91144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|91140_91716_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|91661_92027_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|92931_94974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|95743_95944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|96084_97059_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.0	1.9e-25
WP_016212579.1|98555_98753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|99352_100327_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
99317:99955	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCT	NA	NA	NA	NA
WP_016212456.1|100370_100658_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
99317:99955	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCT	NA	NA	NA	NA
WP_036779532.1|100654_101056_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_075273881.1|101065_103252_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.2	9.2e-73
WP_016212404.1|103372_103606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273857.1|104382_105117_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	8.4e-39
WP_129556710.1|105270_105741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556709.1|105821_105911_-	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_052047129.1|106122_107706_-	protein kinase	NA	NA	NA	NA	NA
WP_075274745.1|107988_108717_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_016212365.1|109429_109672_+	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_036781349.1|109673_110000_+	potassium ABC transporter ATPase	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.1e-11
WP_054300202.1|110115_110844_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212152.1|111313_111697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|112003_112381_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_155047283.1|112545_112878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|112830_112983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377351.1|113066_113846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047298.1|114375_114561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212019.1|114947_115643_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_105962690.1|116111_116387_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|116383_116629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047016.1|116658_116886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212014.1|117289_117703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|117800_118529_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_105962623.1|118595_119748_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047284.1|120377_121406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|121685_122839_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273826.1|122798_123926_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	30.3	1.9e-18
WP_155047013.1|124146_124293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|124622_125438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780064.1|125683_126274_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	38.3	2.0e-22
WP_016211879.1|127228_128248_+	ParA family protein	NA	NA	NA	NA	NA
WP_075274742.1|128260_129142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|129171_129900_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|130103_132680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|132796_133774_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155049828.1|134068_135142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049829.1|135465_136200_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155049830.1|136255_136837_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.6	4.2e-33
WP_032126239.1|136911_137184_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049831.1|137765_138305_+	helix-turn-helix domain-containing protein	NA	W5R8L2	Staphylococcus_phage	34.9	1.0e-04
WP_017375910.1|138334_139063_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377658.1|139310_139997_+	Fic family protein	NA	NA	NA	NA	NA
WP_155047286.1|140000_140567_+	helix-turn-helix domain-containing protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	35.0	1.4e-20
WP_155047299.1|140656_142015_+	DEAD/DEAH box helicase	NA	D2J050	Enterococcus_phage	50.5	2.6e-126
WP_017375910.1|142198_142927_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_080963647.1|144597_144768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774631.1|145106_145571_-	hypothetical protein	NA	H6WFS7	Cyanophage	38.2	2.9e-21
WP_155047285.1|146704_146962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|146980_147958_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_075275153.1|148783_149581_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300202.1|149825_150554_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155047021.1|150577_150733_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_075273760.1|150835_153238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273757.1|153581_154031_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556703.1|156511_157000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211956.1|157057_157786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211955.1|158242_159223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275154.1|159359_160016_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.7	7.6e-31
WP_036771347.1|160378_161356_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046642.1|161985_162477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242576.1|162504_164367_-	AAA family ATPase	NA	A0A088C4M0	Shewanella_sp._phage	30.9	1.0e-56
WP_036771347.1|164559_165537_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047288.1|165551_165677_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047289.1|165609_165786_+|transposase	transposase	transposase	NA	NA	NA	NA
175794:177038	attR	TGTGATTCCTCCGGCTCGGATTATTGTAATTTATTTGTCCGGAATAGGGTAGCCTGATCACTATTTCTTTGAGATCACGGTAAGATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATGATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTCTACCCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCCAACTAGAGAGTTTATCTGTATGGATATGAACTCTCTACTCGGTGTTGCACTTCATGTGACGGAGGGCGAAGACTATATGCCTCAGAAGTTATTAATTTTGTTTGCACAGATCAGGTATATATTCTGTTCTAGATGAATATTTCCAAAGAGGGCGCCAGAAACTATTTCTAATAATGTTAGATGCTTTCTTGCTATTAATGATATGACCATAGTTTTGTAATCCTGATGGGTAAAAGTTTTGTGATCCTACATAAAACATCCCTTTGTCTACCATCATAAATTTATAATGGCCTGTTATTTTTTCATTATCAGTCCATAAGTCATCATATTCATTGAACCTAATTGTAGAAATATGCAATTTATTGCATAGTTTTAAATTAATAGTATCTTCTTTTAATGCTGGATACATTGCCATCGCTTCACTTTTTATTTTACTCCATACTTCTTCATCGGTGGCTAAAGATAAATAACCTGATTCCATCATAGTTGCATCACTGTAAGGAGATTGGACAATATATACATGGCCTGCTTCCATGAGAAGTTTAGCTAGGGCACTAATAAGGTTAGTGTGTTGTTCCTTTGTAGTATCATAAGGCCAAGTATTAAAGTGTGCTTTAAGGCTCTGTTGTGCTATATAAATCCTTTTTTTTGCTGAAGTTAATAACCGATACAAAGCATAGTCTGAATTATTATTATTTTTAGCTGAATCATCCTTATATAAACCATAACCAGTGCGACCGATTGCAAGAACTTCTGCATTTCCAGAAGTAGTATGAGGTGCAGCATATAAATCATGTCCTAGCAAATCATTACTCACAATAGCATAATTGTTATTTTTTGTTGCGGAATACTCAATAACATTAAAAGGATAGTAAAGATAAAGTTTAATATTATTCCTTACAAACCTCCACAGCAAATTTGTAAATCTAATTGCTTGAGTTGCTGCTGGGCCTTCTAACTCAATCATGAGATCAAAAACTGGGTGTT	NA	NA	NA	NA
>prophage 1
NZ_CP039043	Piscirickettsia salmonis strain Psal-072 plasmid unnamed3, complete sequence	58537	2671	47775	58537	capsid,protease,tail,integrase,transposase,portal,head	Streptococcus_phage(13.64%)	57	NA	NA
WP_052104629.1|2671_3697_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047304.1|3967_4099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047313.1|4825_5179_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_016211142.1|6767_7034_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075274761.1|7090_7414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047305.1|7415_7838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274762.1|7837_8188_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_075274763.1|8184_8580_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	39.1	6.0e-07
WP_075274764.1|8572_8896_-|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	41.7	5.4e-14
WP_075274765.1|8892_9204_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.7	2.5e-08
WP_036778347.1|9523_10105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047306.1|10140_11307_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	38.7	1.2e-66
WP_081007077.1|11362_12034_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	45.8	5.5e-45
WP_054300593.1|11981_13223_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	43.6	2.7e-85
WP_155047307.1|13219_13816_-	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.3	2.0e-38
WP_155047308.1|13859_14834_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	8.3e-26
WP_155047309.1|14853_15783_-	hypothetical protein	NA	A0A1W6JP18	Morganella_phage	52.0	1.5e-85
WP_155047310.1|16011_16494_-	hypothetical protein	NA	Q9B019	Phage_GMSE-1	33.3	1.1e-13
WP_032126915.1|16580_16964_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	4.7e-25
WP_052047121.1|17142_17544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126916.1|17688_18159_-	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	48.8	1.5e-33
WP_155047311.1|18146_18449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923627.1|18445_18733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210963.1|18828_19068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047315.1|19064_19412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047314.1|19404_19767_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.9e-24
WP_036780304.1|19735_20272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211080.1|20312_21299_-	helix-turn-helix domain-containing protein	NA	A0A0S2MVA0	Bacillus_phage	45.4	4.3e-14
WP_036780299.1|21337_21640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211079.1|21794_22100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211067.1|22309_23053_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211077.1|23185_23971_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300594.1|24403_25429_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036780005.1|25576_26224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211069.1|26207_26639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047030.1|26663_26807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211075.1|27021_28263_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211068.1|28266_29079_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080664851.1|29075_29885_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|30087_31062_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047312.1|31097_31439_-	toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.7	2.0e-11
WP_027242955.1|31431_31692_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211925.1|32200_32986_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	28.7	9.7e-17
WP_016211928.1|32978_33419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|33969_34233_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_054300276.1|35163_36138_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.8	2.4e-25
WP_016212188.1|37227_37968_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155047301.1|38145_38418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|39038_39614_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	6.0e-08
WP_032126136.1|39679_40225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|41258_42284_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047302.1|42937_44017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212274.1|44547_45012_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032126154.1|45022_45217_-	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_032126152.1|45432_46023_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
WP_081007075.1|46086_46428_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155047303.1|46773_47775_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.3e-29
>prophage 1
NZ_CP039044	Piscirickettsia salmonis strain Psal-072 plasmid unnamed4, complete sequence	38376	6445	19646	38376	head,tail,terminase,capsid,protease,portal,transposase	Erysipelothrix_phage(25.0%)	15	NA	NA
WP_054300271.1|6445_7420_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047317.1|7554_8391_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_016211139.1|8470_8866_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211132.1|8858_9182_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211137.1|9178_9490_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_155047318.1|9680_11015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211140.1|11135_12329_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_080664855.1|12386_13058_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_155047319.1|13005_13626_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	50.9	5.5e-39
WP_052104629.1|13828_14854_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047320.1|14984_15707_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	40.8	2.6e-40
WP_155047321.1|15703_17386_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	45.7	6.9e-137
WP_016212234.1|17388_17868_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_155047322.1|17944_18337_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	4.4e-26
WP_054300271.1|18671_19646_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
>prophage 1
NZ_CP039045	Piscirickettsia salmonis strain Psal-072 plasmid unnamed5, complete sequence	33277	10315	26969	33277	tail,transposase	Indivirus(18.18%)	19	NA	NA
WP_036781073.1|10315_10576_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	A0A1S5NR91	Burkholderia_phage	48.8	2.1e-13
WP_081007079.1|10646_10919_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_129556478.1|11130_12017_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	5.8e-10
WP_016212315.1|13555_13990_+	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	39.7	9.1e-25
WP_155047334.1|14398_14839_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	37.6	1.1e-06
WP_054300249.1|14799_15165_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047335.1|15179_15623_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	5.1e-07
WP_054300271.1|16632_17607_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047336.1|17603_17888_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047337.1|17906_18269_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|18268_18691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275196.1|18692_19016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|19072_19339_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075275195.1|19342_21421_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.4	2.5e-56
WP_036776958.1|21413_21755_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|21751_22423_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|22391_23138_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_054300696.1|23127_23685_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_075275194.1|23681_26969_+	host specificity protein J	NA	A0A0R6PIC0	Moraxella_phage	33.2	5.2e-112
