The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	45566	89679	3162712	transposase	Moraxella_phage(16.67%)	46	NA	NA
WP_129556427.1|45566_46142_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46087_46453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46651_47413_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_016211195.1|47714_49241_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49612_50452_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50491_51799_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51773_52943_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|52997_53723_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54001_54391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54550_55456_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55531_55675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274979.1|55722_56562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|56554_56890_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_155046698.1|57068_57230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|57346_57640_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_016210704.1|58534_60481_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61135_64198_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64194_65259_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65614_66568_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66599_67763_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67768_68368_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68555_69056_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69073_70162_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70588_71833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71829_72672_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016211096.1|72651_73461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73639_73867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73867_74818_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74873_75425_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75551_75974_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75966_76713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76755_77454_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77464_78289_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78618_78987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274980.1|78981_80043_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|80092_80323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80452_81667_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81967_83029_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_016211249.1|83042_84770_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_016211245.1|84803_85535_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85534_86323_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86427_87051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87370_87583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273383.1|87738_88311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300362.1|88563_89088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274981.1|89082_89679_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	136473	178470	3162712	transposase	Staphylococcus_phage(50.0%)	46	NA	NA
WP_054300271.1|136473_137448_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|137949_139362_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|139854_140862_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|140881_142402_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_129556430.1|142458_142665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211018.1|143640_144957_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145060_145444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145578_148644_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|148712_149816_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|149839_150394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150508_151078_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151197_151953_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_054300545.1|152119_153181_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|153575_153971_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|153992_154358_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154414_154579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|154568_154868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|155120_155486_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|155431_156007_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212607.1|156007_156364_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|156452_157028_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|156973_157339_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|157818_158385_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|158396_159182_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|159813_160737_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|160788_161784_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|161815_162310_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|162401_162659_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|162748_163171_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|163489_164206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|164249_164501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556431.1|164514_165942_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|165969_167412_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|167499_167838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|167922_168453_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|168513_170706_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|170748_171234_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|171503_171935_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_016210245.1|171952_172783_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|172797_172941_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|172971_173856_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|173827_174049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|174222_174501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|175471_176377_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016212383.1|176779_177898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|177894_178470_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	182276	239530	3162712	transposase,protease,tail,tRNA	Escherichia_phage(12.5%)	56	NA	NA
WP_075273327.1|182276_182852_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|182797_183163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|183226_183499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212441.1|183766_183991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372761.1|185006_185456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|185519_186248_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210779.1|186290_187220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|187512_188106_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|188074_188728_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|188905_189877_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|189899_190796_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|190954_191401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210787.1|191397_192039_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|192148_192727_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|193202_193640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|193964_195305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|195568_196963_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075274986.1|198411_199479_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|199531_199954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|200194_200638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|200692_200950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|200927_201554_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|201631_203614_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|203823_205167_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|205433_208103_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|208126_210046_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|210215_211637_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|211782_212757_+	phospholipase A	NA	NA	NA	NA	NA
WP_016209855.1|212788_213184_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209859.1|213186_213408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|213571_215233_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|215305_215596_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_016209861.1|215821_216277_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|216341_216806_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216898_218245_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|218244_219150_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|219211_220198_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|220190_220433_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|220554_222099_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|222145_223432_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|223474_224869_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224892_225072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|225068_225644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|225589_225955_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274988.1|226016_228251_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016210079.1|228672_229170_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|229340_230036_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|230138_231701_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|232016_233810_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233895_234168_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|234173_234800_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234786_236217_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236549_237605_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237573_238251_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|238240_239077_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|239236_239530_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	256927	301882	3162712	transposase,tRNA	Acinetobacter_phage(40.0%)	49	NA	NA
WP_075274991.1|256927_257503_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377888.1|257506_258067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556436.1|258122_259009_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046701.1|259035_259185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|259329_259530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|259577_260039_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|260462_261944_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|262006_263116_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|263213_265175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|265704_266109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|266161_267223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046702.1|267348_267504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270449_271602_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556437.1|271644_272067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556438.1|272336_273803_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_032126861.1|274006_274321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046703.1|274514_274652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|274655_275542_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212538.1|275713_276154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210630.1|276683_277799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664846.1|277737_278424_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032126366.1|278417_279395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210638.1|279433_280597_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210640.1|281061_281286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|281671_281959_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210633.1|282133_282889_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|282894_283350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210637.1|283325_283802_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210636.1|283808_285386_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_032126367.1|285389_286154_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210629.1|286207_286744_+	tim44-like domain protein	NA	NA	NA	NA	NA
WP_016210634.1|286740_287472_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_032126368.1|287580_288735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275120.1|288879_289191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664872.1|289514_290495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211898.1|290736_291360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211899.1|291687_291981_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_105962625.1|292077_292964_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046704.1|293575_293728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212296.1|293743_294472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126374.1|294580_295552_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664866.1|295583_296000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211609.1|296614_296923_+	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_032126373.1|296955_299142_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	2.7e-141
WP_016211605.1|299245_299479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|299695_300226_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211607.1|300254_300479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|300661_301477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300526.1|301585_301882_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	329457	375012	3162712	transposase	Hokovirus(33.33%)	46	NA	NA
WP_075273298.1|329457_330033_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210127.1|330085_331111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|331204_331468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|331834_332653_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|332725_335098_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_016210125.1|335810_337238_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|337272_338295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|338311_338689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126491.1|339046_339364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210122.1|339530_340223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|340849_341824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|341813_343586_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|343586_343934_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_032126493.1|344183_345410_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|345499_346798_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664834.1|346831_347191_-	VUT family protein	NA	NA	NA	NA	NA
WP_080664833.1|347236_347581_-	VUT family protein	NA	NA	NA	NA	NA
WP_016210137.1|347561_348113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664832.1|348339_349638_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|349754_350045_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_016212281.1|350356_351811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|352010_352586_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|352531_352897_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212359.1|353632_353851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|354218_355193_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212044.1|355731_355986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|356708_357695_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|357832_358027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664870.1|358709_359357_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_129556444.1|359349_359772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211797.1|359933_361337_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|361387_361963_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|361908_362223_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556445.1|362263_363150_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126227.1|363788_364079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212008.1|364116_364815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212010.1|364831_365128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212007.1|365251_366397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273619.1|366669_367245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211273.1|367302_368136_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.0	3.5e-17
WP_016211268.1|368251_369436_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211271.1|369454_370399_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016211269.1|370703_371489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211272.1|371606_371975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211270.1|372202_373780_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_054300173.1|373950_375012_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	447624	545944	3162712	transposase,tRNA,protease	Escherichia_phage(32.14%)	93	NA	NA
WP_075275004.1|447624_448488_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|448704_450264_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|450285_451320_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|451368_451938_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|452073_453045_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|453056_454634_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|454699_455686_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016210646.1|456017_457127_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|457232_458417_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|458494_460483_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|460691_460847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|461104_461404_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_075275005.1|461562_461898_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|462814_464221_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|464238_465225_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|465227_466382_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|466378_467074_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|467208_468699_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|468719_469769_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|469835_471230_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|472108_474040_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|474044_474575_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|474609_474804_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|474846_475206_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|475625_476621_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_032126132.1|476633_479015_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|479020_479308_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|479579_480056_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|480200_480398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|480522_481497_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|483605_483704_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210477.1|484188_485478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126626.1|485714_486407_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|486448_487222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|487223_488165_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|488297_489875_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|490084_491842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|492390_493149_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|493356_493929_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|494032_494581_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|494882_495128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|495156_495453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|495720_496644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556451.1|497122_497380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275008.1|497443_498172_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	3.3e-43
WP_129556452.1|498287_498635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|498637_500377_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300501.1|500881_501610_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_016212066.1|501970_502747_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016212069.1|502958_503126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212070.1|503100_503700_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_054300500.1|504109_504838_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_155049877.1|504880_505123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300501.1|505186_505915_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|505926_506319_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|506315_506561_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300307.1|507664_508393_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300307.1|508999_509728_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_016212268.1|510372_510957_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|510960_511644_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|511926_512655_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_052104629.1|512991_514017_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212159.1|514160_514358_-	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_016212158.1|514625_515540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275019.1|515649_516354_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	9.2e-43
WP_105962625.1|516317_517204_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211714.1|517578_520923_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_144019196.1|520955_521612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|521667_522396_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126534.1|522910_523426_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212084.1|523425_524442_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_075274955.1|524723_525698_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212327.1|527083_527869_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075274956.1|527929_528298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|528340_529315_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016210580.1|529390_529651_-	methyltransferase	NA	NA	NA	NA	NA
WP_016210574.1|529791_530211_+	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_032126277.1|530298_530889_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210572.1|531111_532869_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126278.1|532990_533974_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_032126275.1|534054_534606_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126276.1|534616_535984_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126279.1|536134_536374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210582.1|536432_537176_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_016210581.1|537175_537820_+	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210578.1|537816_539481_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	7.1e-33
WP_016210576.1|539508_539844_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_016210570.1|539974_541573_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210577.1|541638_541929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|541943_542399_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273456.1|542358_542658_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556663.1|543035_543401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210376.1|543463_545944_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
>prophage 7
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	590095	641240	3162712	transposase,tRNA	Staphylococcus_phage(37.5%)	52	NA	NA
WP_075273298.1|590095_590671_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377880.1|590616_591096_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210761.1|591733_592471_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_016210755.1|592574_593303_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_016210763.1|593406_594651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|594959_595220_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_016210758.1|595393_596932_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_051307336.1|597089_598016_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	9.4e-11
WP_016210756.1|598154_600968_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
WP_032126291.1|600960_601470_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210766.1|601473_601917_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_129556593.1|602005_602647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|602643_603219_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|603164_603530_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211782.1|603591_603774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|604373_605651_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211783.1|605931_606297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211784.1|606288_607011_-	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_075274951.1|607564_608449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|608445_609420_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016210171.1|609977_611537_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	5.8e-37
WP_016210175.1|611850_612180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210177.1|612565_612931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126297.1|613055_613916_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|613902_614682_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_016210168.1|614757_615441_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556592.1|615601_616132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210179.1|616422_616926_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_016210161.1|617126_617381_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210178.1|617882_618350_+	DoxX family protein	NA	NA	NA	NA	NA
WP_016210163.1|618439_618970_-	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_016210172.1|618969_619494_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.6	6.9e-51
WP_016210170.1|619656_620772_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210174.1|621008_622169_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	8.2e-121
WP_016210183.1|622619_624623_+	transketolase	NA	NA	NA	NA	NA
WP_016210176.1|624691_625699_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210181.1|625772_626957_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_032126295.1|626966_628421_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_016210162.1|628451_629489_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_105962625.1|630173_631060_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212028.1|631147_631396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212027.1|631890_633114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126299.1|633136_633358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|633608_634583_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211964.1|634641_634962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|635074_635725_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211963.1|635826_636486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211962.1|637034_637550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212030.1|637847_638093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|638184_638847_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212032.1|638970_640098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|640354_641240_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	649327	683767	3162712	transposase,tRNA	Catovirus(20.0%)	37	NA	NA
WP_016210986.1|649327_650866_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	1.3e-86
WP_075273313.1|650923_651262_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377882.1|651221_651503_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377881.1|651509_651677_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377817.1|652593_653091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|653314_653971_+	porin family protein	NA	NA	NA	NA	NA
WP_032126306.1|654075_654372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274949.1|654596_655658_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046752.1|655635_656373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|656411_656840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210814.1|657189_657387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210817.1|657629_658262_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210815.1|658681_659632_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210821.1|659628_661161_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_017377821.1|661157_661688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|662022_662661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|663110_663815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210818.1|664106_664331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210820.1|664834_665776_-	DMT family transporter	NA	NA	NA	NA	NA
WP_129556549.1|665977_666863_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210940.1|666971_668159_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_016210937.1|668250_668532_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126309.1|668617_669295_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_032126310.1|669341_670601_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_016210941.1|670798_671848_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_016210931.1|671926_672733_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210936.1|672770_673565_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210944.1|673666_674686_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210942.1|674732_675344_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210943.1|675347_676034_+	acireductone synthase	NA	NA	NA	NA	NA
WP_016210935.1|676030_676573_+	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016211759.1|678385_679573_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016211756.1|679818_680544_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_032126312.1|680722_681517_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_129556590.1|681513_681909_-	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_051307363.1|682185_682368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300282.1|683302_683767_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	712407	819880	3162712	protease,tRNA,transposase,integrase	Escherichia_phage(36.59%)	102	729021:729080	735249:735536
WP_016210052.1|712407_713604_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
WP_032126425.1|713624_714221_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210066.1|714664_715333_-|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_016210076.1|715474_716776_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210073.1|717032_717764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210051.1|718188_718593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210069.1|718833_719916_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.6e-20
WP_016210054.1|719900_720422_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210050.1|720486_721362_+	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210068.1|721437_722013_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_155046750.1|723199_723337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|724581_725487_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211874.1|725530_727249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|727567_728647_-	hypothetical protein	NA	NA	NA	NA	NA
729021:729080	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_155046749.1|729191_729479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300489.1|729542_730145_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_129556589.1|730147_730423_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032126389.1|731824_732013_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212230.1|733546_734995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|735050_735275_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_075274946.1|735496_735940_+	hypothetical protein	NA	NA	NA	NA	NA
735249:735536	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACG	NA	NA	NA	NA
WP_016212294.1|735953_736298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046748.1|736649_736955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212659.1|737042_737288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|737432_737582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274945.1|737806_738157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211326.1|738301_739042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211324.1|739538_740093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211322.1|740628_741219_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211325.1|741281_742802_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211323.1|742791_743889_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211321.1|744062_745223_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211722.1|745603_748906_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_032126817.1|748915_749737_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_075274944.1|750093_750810_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
WP_129556588.1|750754_750922_+	phosphatase	NA	NA	NA	NA	NA
WP_075274943.1|751112_751637_-	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_087910645.1|751922_753075_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_032127022.1|753137_755324_-	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_075274942.1|756000_756729_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	2.7e-45
WP_016212339.1|756747_757494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275114.1|757646_758009_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274941.1|758038_758767_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.2e-42
WP_016211996.1|759150_760098_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211997.1|760099_761209_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.5	4.4e-07
WP_075274940.1|761564_762245_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	2.0e-42
WP_087910645.1|762272_763426_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274939.1|763538_764267_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.8e-42
WP_016212238.1|764296_765586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212264.1|766101_766695_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	5.4e-28
WP_016212263.1|766740_767334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664881.1|767496_767703_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300481.1|767792_768521_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_129556661.1|768509_769073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210616.1|769373_772184_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_016210625.1|772432_773179_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_129556587.1|773237_774140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307334.1|774183_774963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210618.1|775229_776279_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_016210617.1|776343_777768_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_075274938.1|777931_778438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210624.1|778456_778696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|778741_779212_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016211056.1|781587_782340_-	ComF family protein	NA	NA	NA	NA	NA
WP_016211049.1|782383_783346_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211052.1|783345_784599_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211045.1|784629_785403_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211044.1|785383_786244_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_016211050.1|786312_787020_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211051.1|786982_787486_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211047.1|787847_789482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049878.1|789560_790136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|790178_790907_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_036780855.1|791672_792170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049879.1|792144_792546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|792514_793243_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211625.1|793726_794596_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_016211621.1|794592_795942_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	4.6e-75
WP_016211623.1|796054_797695_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_016211987.1|799516_801253_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_144019359.1|801414_801612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556671.1|801756_802485_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_098082825.1|802548_802857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|802849_803182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|803185_803755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211655.1|803883_804297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211652.1|804556_805762_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211653.1|805869_806895_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_054300202.1|806986_807715_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300202.1|808145_808874_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212196.1|809282_809528_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016212195.1|809524_809911_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212193.1|809978_810317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274934.1|810439_811108_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.0	2.8e-41
WP_016211949.1|811595_812846_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_016211951.1|812879_813977_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_075274933.1|814593_815322_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_075274932.1|815630_815852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|816073_817687_-	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_016211816.1|817728_818082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126570.1|818094_818394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|819151_819880_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
>prophage 10
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	909092	961152	3162712	transposase,tRNA	Agrobacterium_phage(12.5%)	44	NA	NA
WP_081007050.1|909092_909620_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|909676_910042_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211061.1|910103_910457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211058.1|910577_911111_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_032126660.1|911249_912887_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.2	5.8e-88
WP_016211065.1|912891_913113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211066.1|913210_914224_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_016211063.1|914386_916615_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
WP_032126658.1|916595_917300_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|917534_917864_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_054300173.1|918944_920006_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126663.1|920032_920275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126664.1|920993_921677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212048.1|921870_922428_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_075274927.1|923191_924253_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664847.1|924325_925279_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_016210879.1|928612_928972_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210871.1|928968_929286_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210872.1|929302_930412_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210882.1|930438_931524_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210874.1|931646_932687_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210873.1|932701_933352_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210876.1|933419_934262_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016212197.1|934727_935645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|936663_936858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036794860.1|936934_937228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|937495_938413_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_016211373.1|938964_939111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211374.1|939165_940356_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211370.1|940488_940932_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211369.1|940974_942018_-	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211368.1|942064_943456_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211371.1|943652_944576_+	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211372.1|944562_945420_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016212287.1|951516_952662_-|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_054300173.1|952740_953802_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211408.1|954025_955372_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_016211412.1|955486_956479_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211411.1|956482_956980_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211407.1|956976_957816_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_051307356.1|957848_959381_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_032126774.1|959540_959876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|960031_960304_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|960315_961152_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
>prophage 11
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	1023064	1104672	3162712	transposase,tRNA	Staphylococcus_phage(35.29%)	83	NA	NA
WP_016211428.1|1023064_1025128_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
WP_054300237.1|1025398_1026460_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556651.1|1026701_1027910_+	MFS transporter	NA	NA	NA	NA	NA
WP_075274925.1|1028097_1029159_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212285.1|1029206_1030685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1030734_1031796_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210196.1|1031753_1032107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210185.1|1032460_1034671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|1034671_1035358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210198.1|1035669_1036221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|1036237_1036639_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210190.1|1036829_1037705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126472.1|1037924_1038575_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_016210202.1|1039037_1041626_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.8	9.7e-122
WP_016210199.1|1041731_1042493_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_016210206.1|1042489_1043026_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210205.1|1043074_1044031_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210187.1|1044111_1047297_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210201.1|1047300_1048356_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_152498667.1|1048606_1049185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210186.1|1049228_1049891_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_016210194.1|1049925_1050273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|1050329_1050491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126473.1|1050471_1050654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210192.1|1050862_1051381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1051693_1052059_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1052004_1052580_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556569.1|1052569_1052779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211502.1|1053193_1054237_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_016211508.1|1054266_1054611_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211503.1|1054665_1055121_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_075274922.1|1055131_1055428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274921.1|1055405_1055504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211506.1|1055496_1056138_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|1056134_1056851_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211507.1|1056854_1058174_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_054300271.1|1058487_1059462_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212450.1|1059505_1060408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1060563_1060929_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1060874_1061450_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1061463_1061754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1061699_1062275_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126470.1|1062365_1063793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|1063982_1065044_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211004.1|1065456_1068093_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_080664849.1|1068141_1069230_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016210997.1|1069229_1069913_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_016210998.1|1071787_1072042_+	LapA family protein	NA	NA	NA	NA	NA
WP_016211001.1|1072119_1072425_+	competence protein ComEA	NA	NA	NA	NA	NA
WP_016211002.1|1072588_1072987_+	VOC family protein	NA	NA	NA	NA	NA
WP_051307345.1|1073020_1073707_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211000.1|1073850_1074636_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_075274920.1|1074731_1075466_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	4.8e-10
WP_016210826.1|1076896_1077763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210824.1|1077872_1079552_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210830.1|1079678_1080929_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_032126465.1|1081004_1081466_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210835.1|1081462_1082611_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_016210836.1|1082616_1083291_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_052133275.1|1083320_1083944_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210828.1|1084059_1084533_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_016210832.1|1084534_1084957_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210829.1|1084943_1085963_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210831.1|1086232_1086778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|1086872_1087934_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212318.1|1088462_1088894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|1088895_1089222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212319.1|1089208_1089436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|1089994_1091440_-	MFS transporter	NA	NA	NA	NA	NA
WP_016212205.1|1091579_1091759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274918.1|1092442_1092808_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1092753_1093329_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046952.1|1094403_1094565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|1094737_1094911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|1095906_1096968_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|1096925_1097174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300443.1|1097226_1097505_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211538.1|1097743_1098667_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_016211536.1|1099361_1099595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211535.1|1099670_1101458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923739.1|1101669_1103178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212614.1|1103322_1103529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1103697_1104672_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 12
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	1125342	1252690	3162712	transposase,tRNA,protease	Staphylococcus_phage(17.65%)	119	NA	NA
WP_054300271.1|1125342_1126317_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212492.1|1126366_1127221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210459.1|1127425_1127944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210458.1|1131018_1131567_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210461.1|1131647_1131923_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210464.1|1133082_1135020_-	AsmA family protein	NA	NA	NA	NA	NA
WP_075275113.1|1135170_1136880_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_016210468.1|1136948_1137668_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_016210467.1|1137664_1138267_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210471.1|1138381_1139269_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|1139459_1139807_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210465.1|1139857_1140700_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_129556566.1|1141207_1141411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372565.1|1141319_1141691_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274914.1|1141739_1142615_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|1143165_1143750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556565.1|1145219_1145615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273603.1|1145738_1145915_-	phosphatase	NA	NA	NA	NA	NA
WP_129556564.1|1147071_1147401_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046744.1|1148570_1148744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1148800_1149166_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126745.1|1149237_1149840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122940402.1|1150048_1150672_+	porin family protein	NA	NA	NA	NA	NA
WP_016209896.1|1150986_1151556_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016209891.1|1151702_1152401_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_036777115.1|1152542_1152743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209884.1|1152819_1153443_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_016209882.1|1153552_1154446_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209898.1|1154552_1156163_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_016209888.1|1156159_1157455_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209876.1|1157476_1159399_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209881.1|1159509_1159812_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209893.1|1159904_1164794_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_016209883.1|1164848_1166165_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	9.4e-65
WP_129556563.1|1166283_1167384_+	FUSC family protein	NA	NA	NA	NA	NA
WP_016209878.1|1167435_1168374_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_080664826.1|1168454_1169054_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209877.1|1169242_1170133_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_016209887.1|1170335_1170827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209894.1|1170970_1171462_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1171630_1172344_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556650.1|1172772_1173747_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209897.1|1174067_1174310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1174331_1174697_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1174642_1175218_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211960.1|1175461_1175989_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_129556649.1|1176528_1177386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|1177413_1177995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|1178564_1178750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556562.1|1178894_1179197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1179156_1179495_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211968.1|1179620_1180025_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1180037_1180178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126649.1|1180274_1181471_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_016211971.1|1181491_1182103_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_129556561.1|1182308_1183462_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	2.6e-58
WP_032126362.1|1183632_1183998_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1183943_1184519_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274909.1|1184617_1184944_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1185327_1185492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1185481_1185781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728345.1|1185821_1186430_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032126790.1|1186620_1187526_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556560.1|1187495_1188032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556559.1|1188112_1188541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212093.1|1188697_1189627_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_075273313.1|1189839_1190178_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377876.1|1190137_1190593_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212654.1|1190584_1190869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212100.1|1191279_1192200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212098.1|1192200_1193052_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1193759_1194806_+	glutathione synthase	NA	NA	NA	NA	NA
WP_032126840.1|1194789_1196787_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_122941967.1|1196965_1197271_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|1197500_1197707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|1197967_1198669_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211519.1|1198669_1199089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049880.1|1199610_1199775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307348.1|1200244_1203001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211092.1|1203236_1204529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|1204572_1207053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211094.1|1208117_1208441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1208460_1209435_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211036.1|1209782_1211654_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_016211039.1|1211745_1213491_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211043.1|1213570_1214020_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211035.1|1214072_1214288_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211042.1|1214534_1215551_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211037.1|1215599_1216229_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211040.1|1216579_1217791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126170.1|1218018_1218291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556558.1|1218454_1219348_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556557.1|1219492_1219804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212394.1|1219851_1220556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211450.1|1221577_1222600_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211448.1|1222698_1223907_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211446.1|1223896_1225624_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_129556648.1|1225807_1226779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1227192_1228254_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126397.1|1228602_1229193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210561.1|1229307_1230642_-	dihydroorotase	NA	NA	NA	NA	NA
WP_016210568.1|1230769_1231411_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210566.1|1231716_1232139_+	universal stress protein	NA	NA	NA	NA	NA
WP_016210559.1|1232499_1233462_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_016210564.1|1233458_1233920_+	amidohydrolase	NA	NA	NA	NA	NA
WP_016210557.1|1233922_1234675_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016210560.1|1234763_1236464_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_016210562.1|1238031_1239684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|1239757_1240513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1242149_1242515_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211932.1|1242925_1244215_-	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_016211931.1|1244410_1245598_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211476.1|1245915_1246125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211473.1|1246108_1246708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211474.1|1246782_1248132_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_032126518.1|1248214_1250416_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211478.1|1250432_1251248_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126519.1|1251227_1251947_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_129556556.1|1252114_1252690_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	1295410	1478618	3162712	transposase,tRNA,protease,integrase	Leptospira_phage(12.5%)	175	1361095:1361154	1429634:1430863
WP_016209434.1|1295410_1296832_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209437.1|1296862_1297384_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_016209438.1|1297380_1297980_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_016209440.1|1298057_1299068_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	1.5e-06
WP_016209415.1|1299180_1299885_+	protein TolQ	NA	NA	NA	NA	NA
WP_016209407.1|1299921_1300353_+	protein TolR	NA	NA	NA	NA	NA
WP_016209428.1|1300355_1301450_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_129556552.1|1301485_1302853_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_016209425.1|1302888_1303530_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126507.1|1303572_1304502_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_016209451.1|1304504_1305152_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	37.9	1.2e-36
WP_032126506.1|1305202_1306006_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	8.9e-42
WP_016209417.1|1306187_1306400_+	SlyX family protein	NA	NA	NA	NA	NA
WP_016209423.1|1306403_1306637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209422.1|1306698_1308279_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_016209426.1|1308480_1309410_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.3	1.6e-13
WP_016209420.1|1309411_1310179_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_032126509.1|1310583_1311300_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_016209442.1|1311337_1311700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209432.1|1311871_1313581_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209448.1|1313838_1315170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209449.1|1315611_1317084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1317257_1318232_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300152.1|1318905_1319271_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274897.1|1319511_1320378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|1320890_1321235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210519.1|1321224_1321992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210521.1|1322227_1324165_-	his Kinase A domain protein	NA	NA	NA	NA	NA
WP_016210517.1|1325178_1325898_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|1326011_1329551_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|1329617_1330436_+	ZipA protein	NA	NA	NA	NA	NA
WP_016210518.1|1330422_1332462_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210522.1|1332477_1333530_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210524.1|1333540_1334071_+	exsB family protein	NA	NA	NA	NA	NA
WP_129556549.1|1334609_1335495_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046739.1|1336380_1336521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210010.1|1338165_1338342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210017.1|1338517_1338901_+	hpt domain protein	NA	NA	NA	NA	NA
WP_075273518.1|1338976_1339270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210016.1|1339436_1340396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|1340996_1341152_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|1341416_1342787_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210009.1|1342779_1342986_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016210012.1|1343061_1343733_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210005.1|1343713_1346518_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	2.4e-57
WP_016210027.1|1346597_1347194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1347583_1348339_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210004.1|1348538_1349180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|1349440_1350766_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210023.1|1350762_1352820_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210007.1|1352797_1353370_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|1353425_1353785_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|1353849_1354884_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|1355141_1355993_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|1356087_1357071_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|1357227_1358895_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_032126790.1|1359080_1359986_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211421.1|1360082_1360307_+	hypothetical protein	NA	NA	NA	NA	NA
1361095:1361154	attL	GGTAACCCTCCCTTAAAATGAGACAACTCATAACTGGAATCTTCTGTTAACATTTTCAAA	NA	NA	NA	NA
WP_032126239.1|1361165_1361438_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1361449_1362286_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274733.1|1362336_1362654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1362672_1363248_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1363193_1363559_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|1363580_1363910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556547.1|1364318_1364879_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_155049882.1|1365146_1365296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556546.1|1365304_1366491_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	5.9e-58
WP_081377874.1|1366951_1367419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1367587_1367845_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274890.1|1367914_1368595_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_016212209.1|1369395_1370397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1370852_1371152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|1371141_1371306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1371463_1371802_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1371761_1372217_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075274888.1|1372221_1372557_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274886.1|1372828_1373890_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211279.1|1374633_1377102_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_016211277.1|1377115_1378084_+	homoserine kinase	NA	NA	NA	NA	NA
WP_016211278.1|1378070_1379330_+	threonine synthase	NA	NA	NA	NA	NA
WP_129556646.1|1379381_1380767_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300295.1|1381577_1381802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126750.1|1382082_1382880_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211170.1|1383038_1383209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211167.1|1383840_1384962_+	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	1.5e-10
WP_016211172.1|1385011_1386208_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_080664856.1|1386396_1387461_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_051307350.1|1387444_1388191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211165.1|1388180_1388909_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211168.1|1388905_1389565_+	wbqC-like family protein	NA	NA	NA	NA	NA
WP_155046736.1|1389542_1390496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1390495_1391011_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211164.1|1391053_1391431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210396.1|1391568_1391757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210391.1|1391824_1392775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210393.1|1392868_1395070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210398.1|1395270_1396863_+	B-type flagellin	NA	NA	NA	NA	NA
WP_032126669.1|1397087_1398665_+	B-type flagellin	NA	NA	NA	NA	NA
WP_122940572.1|1398783_1399209_+	flaG family protein	NA	NA	NA	NA	NA
WP_016210394.1|1399319_1400705_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032126670.1|1400730_1401168_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210390.1|1401172_1401514_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_016210399.1|1401528_1403520_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210388.1|1403545_1404220_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210397.1|1404216_1406391_-	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_054300550.1|1406580_1406946_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1407002_1407167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1407156_1407456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210772.1|1407588_1409142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1409225_1410035_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_033923762.1|1410162_1410396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210769.1|1410696_1412199_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_016210773.1|1412502_1415196_+	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210771.1|1415192_1418594_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_054300162.1|1418685_1419768_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556544.1|1419830_1420187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274882.1|1420301_1420898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212246.1|1421833_1422490_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|1422593_1423676_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300271.1|1424015_1424990_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212247.1|1425617_1426373_-	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_036779544.1|1426739_1427747_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1427746_1428004_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1428501_1429338_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1429349_1429622_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274880.1|1430617_1431583_+|transposase	transposase	transposase	NA	NA	NA	NA
1429634:1430863	attR	TTTGAAAATGTTAACAGAAGATTCCAGTTATGAGTTGTCTCATTTTAAGGGAGGGTTACCTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGAAGTATCAGCCATGATAAAGTCACACGCTTTTTAAATAAAAACCACTTTGGATCAAAAGAGCTCTGGAGCTATGTTAAAAAGCATGTTCGTCAGTATGAAGAAGAAGTTGGAGGCGTTTTAAGTCTGGATGATACCGTGGAAGAAAAGCCTTATACAGATGAGAATGATGTGGTTTGTTGGCATTATTCACACAGCAAAAGCGCTCATGTAAAGGGAATTAATATTTTGACAAGTATGGTGACTTACAAG	NA	NA	NA	NA
WP_016212058.1|1431738_1433289_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_081377873.1|1433931_1434768_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.6e-41
WP_032126239.1|1434779_1435052_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209461.1|1435161_1435626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209453.1|1435735_1435885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209496.1|1436052_1436265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664817.1|1436294_1437068_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209485.1|1437092_1438115_+	chorismate mutase	NA	NA	NA	NA	NA
WP_032126728.1|1438167_1439472_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_052133284.1|1439462_1440029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209460.1|1440018_1441101_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.1	1.0e-72
WP_129556542.1|1441144_1442248_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_016209488.1|1442288_1442777_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_052047096.1|1442926_1443616_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016209481.1|1443818_1444145_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_016209480.1|1444194_1444422_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_016209484.1|1444433_1444886_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209475.1|1445095_1446517_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	1.7e-152
WP_016209491.1|1446549_1447647_+	alanine racemase	NA	NA	NA	NA	NA
WP_016209456.1|1447671_1448403_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	M1IDP9	Pelagibacter_phage	35.8	5.3e-09
WP_016209472.1|1448516_1449887_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_032126730.1|1449989_1450478_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_016209463.1|1450832_1451216_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_016209490.1|1451642_1451966_+	YqcC family protein	NA	NA	NA	NA	NA
WP_129556645.1|1452056_1454006_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_016209478.1|1454097_1455051_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209459.1|1455214_1456381_-	rasGEF domain protein	NA	NA	NA	NA	NA
WP_075273528.1|1456640_1457606_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_016209455.1|1457786_1458833_+	membrane protein	NA	NA	NA	NA	NA
WP_016209467.1|1458825_1459851_+	FUSC family protein	NA	NA	NA	NA	NA
WP_016209494.1|1459920_1461945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664818.1|1462626_1462962_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016209474.1|1463103_1463514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209462.1|1463523_1463667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209471.1|1463676_1464003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664819.1|1464149_1465187_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_016209486.1|1465228_1465480_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_155046977.1|1465598_1465919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209458.1|1465926_1467501_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_016209457.1|1467644_1468226_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_016209482.1|1468525_1470328_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	39.2	5.1e-21
WP_129556644.1|1470378_1471266_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209466.1|1471671_1472346_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	34.5	8.9e-27
WP_016209492.1|1472351_1473251_+	GTPase Era	NA	NA	NA	NA	NA
WP_016209497.1|1473264_1474008_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_016209489.1|1474010_1474742_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_016209473.1|1474738_1475122_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_016212202.1|1476083_1477331_-	glutaminase	NA	NA	NA	NA	NA
WP_075274878.1|1477742_1478618_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	1483059	1527190	3162712	transposase,integrase	Escherichia_phage(16.67%)	46	1498185:1498244	1527957:1528247
WP_075273327.1|1483059_1483635_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1483648_1483939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|1483884_1484460_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212551.1|1484801_1485296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556643.1|1485753_1487118_-	histidine kinase	NA	NA	NA	NA	NA
WP_016211983.1|1487213_1487873_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556539.1|1488120_1488465_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300307.1|1488533_1489262_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_075274875.1|1489308_1489611_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211212.1|1489893_1491453_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|1491813_1493784_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|1493975_1495055_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211213.1|1495103_1495310_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211210.1|1495316_1496798_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211214.1|1496900_1497464_-	hypothetical protein	NA	NA	NA	NA	NA
1498185:1498244	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_016211942.1|1499226_1500486_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211940.1|1500606_1500939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1501052_1502027_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211341.1|1502171_1502342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211343.1|1502540_1503563_+	YHYH protein	NA	NA	NA	NA	NA
WP_016211342.1|1503570_1505253_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.1e-32
WP_016211344.1|1505413_1506232_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|1506445_1507429_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|1507421_1507643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|1507670_1508312_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_105962625.1|1509461_1510347_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1510351_1510639_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|1510691_1510970_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|1511068_1511416_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|1511737_1511977_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|1512194_1512782_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|1512742_1513078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|1513265_1513910_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|1514244_1514895_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|1515427_1516480_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032126786.1|1516497_1519578_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_075274874.1|1519876_1520245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1520245_1520821_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1520766_1521132_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274873.1|1521153_1521651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274872.1|1522125_1522665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556536.1|1522624_1523777_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_081377871.1|1523780_1524473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1524677_1524935_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556535.1|1525124_1526011_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377829.1|1526455_1527190_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1527957:1528247	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTTT	NA	NA	NA	NA
>prophage 15
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	1556812	1612070	3162712	transposase,tRNA	Bacillus_thuringiensis_phage(20.0%)	47	NA	NA
WP_016209621.1|1556812_1557817_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|1558249_1559698_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209620.1|1559784_1562841_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_080664820.1|1562823_1562994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556532.1|1563302_1563485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212485.1|1563781_1564315_-	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_075273327.1|1565067_1565643_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1565588_1565954_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126753.1|1566046_1566511_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|1566580_1568101_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126752.1|1568188_1568791_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|1568787_1569135_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|1569285_1570269_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211462.1|1570896_1571877_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052047087.1|1572037_1572256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274864.1|1572427_1573453_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212346.1|1576293_1576440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1576673_1577537_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211749.1|1577745_1578939_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211748.1|1579018_1580623_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211752.1|1580638_1581784_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_129556531.1|1581988_1582186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1582148_1582487_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1582446_1582902_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_081007023.1|1583076_1583733_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212534.1|1583809_1584076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1585646_1586561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211728.1|1586599_1588534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1588921_1589515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274862.1|1589686_1590283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046732.1|1590397_1590568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1590761_1591034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1591655_1592234_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_122942091.1|1592261_1592657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211455.1|1592762_1594220_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_016211452.1|1594281_1595769_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211454.1|1596519_1596990_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1597130_1597706_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1597651_1598017_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556641.1|1601891_1603154_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016210751.1|1603241_1605047_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_016210752.1|1605530_1606328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210749.1|1606497_1606959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1607257_1609213_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1609892_1610078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|1610411_1611401_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_075273327.1|1611494_1612070_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	1618238	1674031	3162712	transposase	Staphylococcus_phage(42.86%)	56	NA	NA
WP_098082828.1|1618238_1618496_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047040.1|1618565_1619504_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_051307338.1|1619529_1621095_-	APC family permease	NA	NA	NA	NA	NA
WP_016210800.1|1621304_1622132_-	DsbA family protein	NA	NA	NA	NA	NA
WP_075273540.1|1622498_1623110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556527.1|1623294_1623555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210799.1|1624016_1624970_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_016210791.1|1625396_1625597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307339.1|1625971_1626778_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210795.1|1626883_1627855_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210801.1|1627836_1628808_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210793.1|1629130_1629811_-	OmpW family protein	NA	NA	NA	NA	NA
WP_081007004.1|1629812_1630268_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1630227_1630566_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|1630739_1631180_-	universal stress protein	NA	NA	NA	NA	NA
WP_016211350.1|1631858_1632797_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211349.1|1632860_1634855_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|1634851_1635454_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211351.1|1635450_1635789_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|1635864_1637091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1637357_1638332_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211856.1|1638547_1638733_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|1638859_1639327_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|1639323_1640202_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|1640452_1641760_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007004.1|1641912_1642368_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1642327_1642666_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1643627_1644533_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211738.1|1644603_1645248_+	membrane protein	NA	NA	NA	NA	NA
WP_016211741.1|1645724_1646501_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126783.1|1646646_1647888_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_155046971.1|1647998_1648544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|1648845_1649820_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_129556526.1|1649878_1650664_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	1.3e-45
WP_016212445.1|1650660_1650927_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016211177.1|1651141_1652362_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126450.1|1652729_1654724_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211185.1|1654836_1655445_-	smr domain protein	NA	NA	NA	NA	NA
WP_032126449.1|1655511_1656435_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016211180.1|1656455_1656920_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_016211178.1|1656982_1658011_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032126448.1|1658101_1658482_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211182.1|1658513_1658843_+	DUF4404 family protein	NA	NA	NA	NA	NA
WP_016212475.1|1659827_1660034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1660231_1661206_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556525.1|1661281_1662102_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210855.1|1662255_1663233_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210849.1|1663350_1664799_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210847.1|1664827_1665832_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210851.1|1665854_1666526_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210850.1|1666510_1667764_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1668012_1668567_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210848.1|1668862_1670047_+	MFS transporter	NA	NA	NA	NA	NA
WP_051307341.1|1670213_1671812_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_081007030.1|1672505_1673477_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377870.1|1673512_1674031_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	31.0	1.6e-07
>prophage 17
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	1702057	1740899	3162712	transposase,tRNA	Staphylococcus_phage(20.0%)	31	NA	NA
WP_129556523.1|1702057_1702944_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1703279_1704254_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_054300148.1|1704351_1705413_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1705967_1706942_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|1707632_1708208_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1708153_1708519_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274858.1|1708655_1709741_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274857.1|1711320_1712196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126678.1|1712206_1713217_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_016211554.1|1713543_1714170_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_016211557.1|1714215_1715445_+	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_032126677.1|1715639_1716203_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211555.1|1716277_1717636_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_016211664.1|1718172_1718901_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211666.1|1719273_1722093_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211669.1|1722247_1722598_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556522.1|1725706_1726939_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211405.1|1727145_1728918_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_016211403.1|1729053_1730097_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211399.1|1730110_1730854_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_032126682.1|1730961_1731288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1731892_1732591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211734.1|1733012_1733282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211731.1|1733297_1734404_+	protein kinase	NA	NA	NA	NA	NA
WP_016211733.1|1734459_1735284_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_075274856.1|1737039_1738065_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046730.1|1738283_1738424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1738691_1739339_-	LysE family translocator	NA	NA	NA	NA	NA
WP_016212267.1|1739619_1739979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|1740145_1740601_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273804.1|1740560_1740899_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	1751164	1851060	3162712	transposase,tRNA,protease,integrase	Staphylococcus_phage(20.0%)	96	1821576:1821635	1856060:1856140
WP_105962625.1|1751164_1752050_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556521.1|1752584_1752773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556520.1|1752723_1753620_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.8e-54
WP_032126362.1|1753580_1753946_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1753891_1754467_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1754542_1754836_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556519.1|1754921_1756100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211631.1|1756358_1757165_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_016211634.1|1757420_1758242_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211632.1|1758277_1759132_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211627.1|1759357_1759522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377868.1|1759827_1760484_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210103.1|1760559_1761918_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_016210117.1|1762199_1762559_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210111.1|1762979_1764614_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_017377579.1|1764620_1765457_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210099.1|1765478_1766756_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_016210105.1|1766839_1767160_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210106.1|1767179_1768271_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210102.1|1768453_1770043_+	APC family permease	NA	NA	NA	NA	NA
WP_016210110.1|1770103_1770859_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_016210113.1|1771046_1772096_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210101.1|1772518_1774015_+	flagellin domain protein	NA	NA	NA	NA	NA
WP_016210107.1|1774304_1774577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210114.1|1774648_1775908_-	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210108.1|1776000_1777266_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_122943012.1|1777451_1777907_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210112.1|1778023_1779451_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_032126690.1|1780144_1780627_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_052047138.1|1786674_1786908_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046728.1|1787170_1788145_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	6.8e-28
WP_155049900.1|1788273_1788579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211563.1|1788927_1789089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211564.1|1789121_1789997_-	ParA family protein	NA	NA	NA	NA	NA
WP_016211561.1|1790162_1794029_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_080728343.1|1794110_1794251_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_081007034.1|1794232_1794517_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_032126538.1|1794781_1796200_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_016211991.1|1797108_1798014_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126537.1|1798254_1798440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211994.1|1798476_1799013_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_016212348.1|1800431_1801661_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_075274849.1|1801655_1802399_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1802524_1802797_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1802808_1803645_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_129556517.1|1803663_1803951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1804348_1805323_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300271.1|1805970_1806945_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212012.1|1807181_1807859_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016212013.1|1807874_1808258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212011.1|1808479_1809601_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_075274847.1|1809834_1810710_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211974.1|1810992_1812114_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075273551.1|1812213_1812516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556638.1|1812515_1813196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377865.1|1814540_1814825_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664876.1|1815183_1817046_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_033923779.1|1817358_1818195_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1818206_1818479_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212529.1|1818519_1819077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275108.1|1819435_1820041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1820017_1820992_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046727.1|1821235_1821580_+	hypothetical protein	NA	NA	NA	NA	NA
1821576:1821635	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_129556515.1|1822405_1822765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1822783_1823056_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1823067_1823904_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274844.1|1823912_1824164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|1824344_1825319_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016211144.1|1825875_1826505_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_016211152.1|1826488_1826911_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|1826917_1828657_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|1828657_1829722_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1829725_1830079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1830191_1831148_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|1831157_1831469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1831484_1832054_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|1832317_1833646_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_081377864.1|1833727_1833967_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1833980_1834817_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1834828_1835101_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1835185_1836160_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210841.1|1836373_1836745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1836803_1837577_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_129556514.1|1837728_1840185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126340.1|1840464_1841226_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_122941824.1|1841306_1843043_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016210844.1|1843227_1844355_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_016210843.1|1844441_1844672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556637.1|1845286_1846066_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|1846540_1846978_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300363.1|1847401_1847749_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556512.1|1847694_1848270_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212275.1|1848259_1849243_-	MFS transporter	NA	NA	NA	NA	NA
WP_051307372.1|1849358_1849748_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036774189.1|1849795_1850803_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1850802_1851060_-|transposase	transposase	transposase	NA	NA	NA	NA
1856060:1856140	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCC	NA	NA	NA	NA
>prophage 19
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	1877910	1937020	3162712	transposase,tRNA	uncultured_Mediterranean_phage(30.77%)	55	NA	NA
WP_016211804.1|1877910_1879296_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_016211805.1|1879302_1880841_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211806.1|1880883_1881609_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032126239.1|1882398_1882671_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1882682_1883519_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_129556510.1|1884042_1885146_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	7.3e-10
WP_054300405.1|1885247_1885748_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209947.1|1886269_1886932_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016209946.1|1886958_1888188_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209940.1|1888344_1891116_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_016209937.1|1891191_1891635_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209931.1|1891787_1893260_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209926.1|1893371_1894433_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209945.1|1894429_1895464_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209932.1|1895466_1896507_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209936.1|1896689_1897805_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.6	1.4e-93
WP_016209930.1|1897843_1898197_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_032126634.1|1898217_1900086_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209935.1|1900107_1901052_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_016209925.1|1901285_1901564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1901773_1902412_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209944.1|1902386_1903814_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209927.1|1904014_1904692_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209939.1|1904826_1906101_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209943.1|1906168_1906924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209948.1|1906975_1907893_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209929.1|1908001_1908895_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075274822.1|1910353_1911328_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016211771.1|1911620_1911809_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_016211770.1|1911822_1912956_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_075274823.1|1913155_1917166_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211823.1|1917200_1917389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1917429_1918050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1918381_1918735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1918948_1919143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1919808_1920336_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300400.1|1920392_1920635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1920779_1921046_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210885.1|1921387_1922269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1922326_1922923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1922955_1923729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1924262_1924559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210888.1|1924581_1924833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210883.1|1924793_1925501_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210886.1|1925569_1926349_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210887.1|1926431_1927382_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210889.1|1927891_1930738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556636.1|1930755_1931064_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016212002.1|1932017_1932296_-	DNA-J related family protein	NA	NA	NA	NA	NA
WP_016212000.1|1932415_1933144_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016211998.1|1933274_1933838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211999.1|1933827_1934181_-	ras family protein	NA	NA	NA	NA	NA
WP_033923779.1|1934560_1935397_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1935408_1935681_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274825.1|1935958_1937020_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	1973834	2018957	3162712	transposase	Bacillus_phage(50.0%)	37	NA	NA
WP_075274826.1|1973834_1974740_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1974996_1976268_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_016211218.1|1976292_1977030_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1977282_1978425_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1978441_1980043_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1980554_1980692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1980688_1981966_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1982315_1982498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211682.1|1983187_1984870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049884.1|1984917_1986717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049885.1|1986892_1987318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274826.1|1987548_1988454_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211218.1|1990007_1990745_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_155049886.1|1994232_1994427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|1996031_1996214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049887.1|1996903_1997647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049888.1|1997646_1998207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049889.1|1998247_1998586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049890.1|1998633_1999350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049891.1|1999366_2001034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274826.1|2001263_2002169_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|2002425_2003697_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_016211218.1|2003721_2004459_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|2004711_2005854_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|2005870_2007472_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|2007983_2008121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|2008117_2009395_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|2009744_2009927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126600.1|2010198_2010720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212250.1|2010842_2011493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212251.1|2011654_2012191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300384.1|2012352_2013168_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075274828.1|2013576_2014899_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.2e-11
WP_052133287.1|2015000_2015399_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212039.1|2015587_2016145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212040.1|2016321_2017671_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_054300162.1|2017874_2018957_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 21
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	2025713	2069391	3162712	transposase,tRNA	Staphylococcus_phage(14.29%)	47	NA	NA
WP_032126139.1|2025713_2026643_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_033923779.1|2029311_2030148_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274829.1|2030159_2030432_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2030455_2031430_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300382.1|2031830_2032253_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377858.1|2032471_2033182_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2033385_2033751_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2033765_2034272_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211414.1|2034487_2035306_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|2035413_2035875_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211415.1|2035891_2036815_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211417.1|2036838_2037888_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_051307357.1|2038024_2038618_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211422.1|2038640_2039111_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032126143.1|2039199_2040471_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_075274832.1|2040570_2041545_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_016211838.1|2041856_2042030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211840.1|2042500_2042965_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211839.1|2043123_2044596_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211841.1|2044713_2045166_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|2046025_2047087_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|2047389_2048472_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212483.1|2048482_2049280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2049276_2049852_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2049797_2050163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300380.1|2050264_2050921_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556508.1|2051191_2051635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|2051696_2051990_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556507.1|2052106_2052793_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.3	5.5e-48
WP_075273327.1|2052782_2053358_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2053303_2053669_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212421.1|2054160_2054343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2055093_2056068_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556505.1|2056108_2057074_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211470.1|2057840_2058494_+	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_016211471.1|2058553_2060539_-	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
WP_032126343.1|2060669_2061482_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_032126344.1|2061602_2062691_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_016211467.1|2062693_2063260_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_075273298.1|2063334_2063910_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|2063855_2064221_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047029.1|2064388_2064730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2064802_2065864_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032127044.1|2066067_2066268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212482.1|2066482_2066626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|2067169_2067463_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556503.1|2068524_2069391_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	5.6e-58
>prophage 22
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	2081917	2139791	3162712	transposase,tRNA,protease	Klosneuvirus(28.57%)	53	NA	NA
WP_081007040.1|2081917_2082574_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211831.1|2082711_2084439_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|2084739_2085093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|2085508_2086009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372328.1|2086639_2087107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2087110_2087686_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2087631_2087997_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126565.1|2088207_2088480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211013.1|2088797_2091164_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_016211011.1|2091224_2092421_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_016211010.1|2092699_2095129_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_016211008.1|2095221_2096724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211012.1|2096832_2097405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273571.1|2097554_2098232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556502.1|2098340_2098904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210926.1|2099163_2100633_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016210918.1|2100717_2101467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210930.1|2101470_2102244_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210927.1|2102304_2103255_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210917.1|2103379_2104822_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	5.4e-21
WP_032126561.1|2105035_2106220_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210925.1|2106343_2107030_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.5	9.7e-29
WP_016210921.1|2107121_2107706_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_155046724.1|2107930_2108098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210929.1|2108094_2108451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|2108485_2108791_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_054300375.1|2109005_2109206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728346.1|2110012_2110345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372539.1|2110362_2111226_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556501.1|2111258_2111834_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2111779_2112145_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211651.1|2112378_2113914_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016211650.1|2114038_2115523_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211648.1|2116182_2116722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|2117925_2118132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126642.1|2118201_2118663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126641.1|2118698_2121269_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_016209840.1|2121376_2121862_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_016209844.1|2122034_2123075_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209835.1|2123052_2123535_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209848.1|2123531_2126126_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209832.1|2126432_2126696_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209831.1|2126974_2127673_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|2127892_2128087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209827.1|2128162_2129722_-	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_129556633.1|2130040_2130937_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|2131153_2132629_-	APC family permease	NA	NA	NA	NA	NA
WP_016209826.1|2133151_2134174_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209830.1|2134504_2135872_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209846.1|2136107_2136362_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126639.1|2136377_2137664_+	GTPase HflX	NA	NA	NA	NA	NA
WP_016209836.1|2137683_2138898_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_016209838.1|2138897_2139791_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 23
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	2176863	2213939	3162712	transposase,tRNA	Vibrio_phage(14.29%)	28	NA	NA
WP_016211285.1|2176863_2177643_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211286.1|2177660_2178008_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211289.1|2178119_2178392_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211767.1|2179720_2180530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211764.1|2181080_2181902_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126803.1|2182102_2183335_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_081377862.1|2183821_2184658_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2184669_2184942_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046719.1|2184960_2185119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|2187337_2188153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211525.1|2190452_2193188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275102.1|2193776_2194235_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377901.1|2194415_2195126_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126856.1|2195186_2195528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|2195832_2196986_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016212005.1|2197886_2199647_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_016210592.1|2200036_2200693_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016210586.1|2200705_2202211_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210593.1|2202232_2202763_-	colicin V production protein	NA	NA	NA	NA	NA
WP_016210590.1|2202842_2204105_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210587.1|2204279_2205140_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_032126176.1|2205241_2206024_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210588.1|2206114_2207440_-	fimV domain protein	NA	NA	NA	NA	NA
WP_016210595.1|2207807_2208986_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210594.1|2209162_2209816_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210596.1|2209951_2211892_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.1e-72
WP_129556498.1|2211888_2212497_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075275098.1|2213009_2213939_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-24
>prophage 24
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	2224007	2283898	3162712	transposase	Bacillus_phage(27.27%)	55	NA	NA
WP_075273327.1|2224007_2224583_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|2224528_2224819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2224832_2225408_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2225353_2225719_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274672.1|2225890_2226484_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211114.1|2226849_2229780_-	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_016211115.1|2229912_2231865_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211112.1|2232057_2232705_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211113.1|2232760_2234086_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_032126179.1|2234115_2234367_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_080664854.1|2234324_2234906_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300408.1|2235242_2235899_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_032126362.1|2235949_2236315_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275097.1|2236260_2236836_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275095.1|2237237_2238014_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209823.1|2238058_2238502_-	response regulator	NA	NA	NA	NA	NA
WP_016209809.1|2238926_2239415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|2239521_2240490_+	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209820.1|2241191_2244491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209803.1|2244549_2245587_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209810.1|2245791_2247705_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209822.1|2247766_2248414_-	methyltransferase domain protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_016209802.1|2248549_2249674_-	D-isomer specific 2-hydroxyacid dehydrogenase catalytic domain protein	NA	NA	NA	NA	NA
WP_016209800.1|2249670_2250267_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209821.1|2250297_2250630_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209812.1|2250719_2252543_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_032126326.1|2252995_2254258_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	3.1e-25
WP_016209815.1|2255025_2255565_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016209799.1|2255950_2256367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209818.1|2256462_2257278_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209805.1|2257410_2258904_+	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_032126324.1|2259082_2259505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209801.1|2259504_2261559_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016209813.1|2261843_2262659_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_016209824.1|2262759_2263578_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209808.1|2263574_2263943_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016212343.1|2265247_2266054_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_105962623.1|2266292_2267446_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016211588.1|2267613_2268315_-	cyclase family protein	NA	NA	NA	NA	NA
WP_032126329.1|2268390_2269020_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_129556496.1|2269205_2270444_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_016211592.1|2270718_2271381_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_016211589.1|2271370_2272603_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_129556495.1|2272725_2272983_+	VOC family protein	NA	NA	NA	NA	NA
WP_032126637.1|2273963_2274257_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126540.1|2274487_2275351_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2275484_2275850_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2275795_2276371_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126332.1|2277017_2278217_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_016211366.1|2278469_2278757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126331.1|2278812_2280822_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_032126330.1|2280876_2281836_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_016211367.1|2281983_2282766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664860.1|2282921_2283359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2283322_2283898_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	2300025	2399582	3162712	transposase,tRNA	Armadillidium_vulgare_iridescent_virus(12.5%)	99	NA	NA
WP_016210280.1|2300025_2301120_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_054300412.1|2301356_2301671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|2301815_2302226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275091.1|2302496_2302982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556631.1|2303990_2304158_+	phosphatase	NA	NA	NA	NA	NA
WP_075275089.1|2304302_2304635_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	37.3	8.0e-05
WP_032126500.1|2304768_2305485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|2305621_2306869_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126499.1|2307247_2307859_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211122.1|2307955_2308822_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2308825_2309587_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211128.1|2309750_2310656_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211125.1|2310878_2311709_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|2311878_2312268_+	lipoprotein	NA	NA	NA	NA	NA
WP_032126498.1|2312400_2312961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2313022_2313388_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2313333_2313909_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212621.1|2313905_2314310_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_016212585.1|2314604_2314925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|2315036_2316011_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_075273327.1|2316380_2316956_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2316901_2317267_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275086.1|2317227_2318226_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212356.1|2318203_2319049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047081.1|2319099_2319537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212519.1|2319807_2320188_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_075275084.1|2320262_2321324_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212611.1|2321371_2321692_-	histidine kinase	NA	NA	NA	NA	NA
WP_081377357.1|2322175_2322577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285940.1|2322661_2323483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126778.1|2323697_2323892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211088.1|2324070_2325033_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211087.1|2325252_2326248_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211081.1|2326275_2327211_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|2327251_2327713_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|2327691_2328735_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211090.1|2328747_2330382_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080664853.1|2330341_2332084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|2332807_2334844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211709.1|2337103_2337250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274676.1|2337408_2337606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212323.1|2337680_2337953_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_148037404.1|2338029_2338290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212326.1|2338424_2338622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|2338847_2339733_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556489.1|2339737_2340934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2341179_2342241_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126869.1|2342218_2342458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2342978_2343554_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2343499_2343865_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2344095_2344671_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2344616_2344982_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|2345862_2346726_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556488.1|2347874_2348725_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275079.1|2348873_2349935_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126801.1|2349982_2350492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2351162_2352245_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300173.1|2352370_2353432_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212218.1|2354882_2355233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275077.1|2355377_2356214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2356298_2357204_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016210899.1|2357703_2359587_-	APC family permease	NA	NA	NA	NA	NA
WP_016210896.1|2359640_2360723_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210904.1|2360765_2361416_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210903.1|2361636_2362008_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_129556487.1|2362126_2363464_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210897.1|2363542_2364523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210894.1|2364863_2365166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|2365640_2365931_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210898.1|2366019_2366370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300269.1|2367281_2367650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2367671_2368037_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2368093_2368258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007012.1|2368247_2368418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275075.1|2368412_2369474_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273492.1|2369582_2369702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556486.1|2369792_2370140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556630.1|2370225_2371575_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211781.1|2371884_2373132_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_081377899.1|2373546_2374410_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210418.1|2374722_2375358_-	peroxiredoxin C	NA	NA	NA	NA	NA
WP_016210422.1|2375908_2377411_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_016210425.1|2377397_2381246_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_016210420.1|2381394_2382573_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.1	2.0e-50
WP_016210416.1|2382643_2383174_-	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_016210423.1|2383263_2384148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210417.1|2384144_2384582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126554.1|2385023_2386109_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_129556485.1|2386128_2388687_-	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.6	6.3e-73
WP_054300148.1|2388839_2389901_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273490.1|2390141_2391434_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_016211426.1|2392416_2393859_-	MFS transporter	NA	NA	NA	NA	NA
WP_129556484.1|2394202_2395663_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_075275072.1|2396122_2396473_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|2396432_2396693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300264.1|2396837_2397176_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_075275071.1|2397278_2398253_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212461.1|2398628_2399003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|2399006_2399582_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	2415420	2457190	3162712	transposase,integrase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(20.0%)	42	2425637:2425696	2453819:2454922
WP_052047108.1|2415420_2415819_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275068.1|2415920_2416511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2416595_2416961_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2416906_2417482_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211578.1|2417839_2418184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|2418199_2418394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|2418460_2418814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211582.1|2418911_2419691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211585.1|2419752_2420310_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016211581.1|2420428_2421199_-	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.9	8.9e-31
WP_016211583.1|2421475_2422384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211579.1|2422451_2422937_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054300162.1|2423160_2424243_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556481.1|2424500_2424932_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_016212302.1|2425116_2425416_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
2425637:2425696	attL	ACGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAAC	NA	NA	NA	NA
WP_054300271.1|2425729_2426704_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556480.1|2426727_2432217_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_016211300.1|2432728_2433769_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_054300162.1|2433819_2434902_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781387.1|2435046_2435319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|2435311_2435590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126152.1|2435792_2436383_+|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016211531.1|2436446_2437127_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016211530.1|2437480_2438377_+	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211534.1|2438382_2438892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211532.1|2438878_2439829_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	35.8	1.8e-09
WP_016211528.1|2440475_2440781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664862.1|2440761_2441460_-	P-loop NTPase	NA	NA	NA	NA	NA
WP_075273327.1|2442633_2443209_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274918.1|2443154_2443520_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556479.1|2444007_2444190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212436.1|2444403_2444814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|2445152_2446038_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923634.1|2446028_2446577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126157.1|2446781_2447186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|2447472_2449365_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_016211512.1|2449707_2450514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307360.1|2451605_2452535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2453374_2453740_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|2453911_2454886_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273512.1|2455022_2455367_+	hypothetical protein	NA	NA	NA	NA	NA
2453819:2454922	attR	ACGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_075275067.1|2456122_2457190_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	2475982	2649049	3162712	transposase,protease,tRNA	Staphylococcus_phage(11.11%)	152	NA	NA
WP_016209663.1|2475982_2477284_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_016209647.1|2477365_2477971_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209645.1|2478083_2479388_-	trigger factor	NA	NA	NA	NA	NA
WP_016209661.1|2479991_2480867_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_075273478.1|2480982_2481654_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209658.1|2481830_2483186_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_016209641.1|2483306_2484044_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032126159.1|2484123_2484837_-	aldolase	NA	NA	NA	NA	NA
WP_016209651.1|2485463_2486738_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2486768_2487344_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209649.1|2487388_2488354_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209640.1|2488812_2489832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|2490250_2491225_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_129556476.1|2491320_2492331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211684.1|2492875_2493451_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016211685.1|2493474_2495280_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211687.1|2495310_2495955_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_033923708.1|2496210_2497086_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556628.1|2497290_2498106_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.5e-32
WP_016210297.1|2498191_2499571_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_032126463.1|2499627_2500884_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_032126458.1|2500964_2502491_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_129556475.1|2502496_2503519_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_016210290.1|2503741_2504536_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210287.1|2504624_2505488_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_016210293.1|2505608_2506889_-	outer membrane beta-barrel domain protein	NA	NA	NA	NA	NA
WP_032126457.1|2507933_2508353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126460.1|2509260_2509698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210301.1|2509874_2510702_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_075273633.1|2510751_2511378_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_016210294.1|2511515_2511860_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_051307327.1|2512177_2513209_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.7e-35
WP_016210303.1|2513484_2513724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2513773_2514835_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210741.1|2515520_2515844_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_016210746.1|2515850_2519747_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210744.1|2519843_2520329_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210743.1|2520369_2521950_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210739.1|2522018_2523476_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210737.1|2523631_2525608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|2525926_2526547_-	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_129556474.1|2526712_2526934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2527138_2528113_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212172.1|2528132_2529605_-	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_075275065.1|2530495_2531170_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.9e-10
WP_054300173.1|2531469_2532531_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211822.1|2532840_2533254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211818.1|2533610_2534867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|2535069_2535570_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211819.1|2535866_2536097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556627.1|2536315_2536921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2536973_2538035_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2538061_2538637_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2538582_2538948_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047106.1|2539663_2540140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2540213_2540789_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2540734_2541100_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155049892.1|2541150_2541390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212416.1|2541519_2542050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2542051_2542507_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273456.1|2542466_2542766_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274832.1|2542888_2543863_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_016209398.1|2544421_2545648_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|2546246_2547953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664814.1|2548120_2549341_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209395.1|2549589_2552280_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_016209384.1|2552571_2553387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126585.1|2553737_2554658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209378.1|2555199_2556333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209380.1|2556420_2556843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209368.1|2557418_2558948_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_016209374.1|2558983_2560435_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209366.1|2560409_2561369_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_016209365.1|2561446_2564953_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.5	4.9e-193
WP_032126583.1|2564976_2565546_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	42.9	5.7e-27
WP_016209376.1|2565758_2566913_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_016209377.1|2566931_2567705_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_016209390.1|2567704_2568142_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_016209391.1|2568168_2569218_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_016209381.1|2569269_2569803_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_129556472.1|2569883_2572277_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_051307309.1|2572615_2573656_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_016209394.1|2575858_2576923_+	GHMP kinase	NA	NA	NA	NA	NA
WP_016209364.1|2576912_2577941_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_016209393.1|2577937_2578477_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_016209400.1|2579021_2580983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152498662.1|2581453_2583112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209397.1|2583232_2584108_-	bacterial lipid A biosynthesis acyltransferase family protein	NA	NA	NA	NA	NA
WP_016209379.1|2584195_2585002_-	cytidylyltransferase	NA	NA	NA	NA	NA
WP_032126580.1|2585009_2585747_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.5	7.2e-22
WP_016209396.1|2585763_2586321_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_016209399.1|2586324_2587062_-	UMP kinase	NA	NA	NA	NA	NA
WP_016209372.1|2587065_2587944_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_032126579.1|2588118_2588886_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_016209375.1|2589308_2590118_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_016209367.1|2590195_2592853_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_016209389.1|2592853_2593891_+	asparaginase	NA	NA	NA	NA	NA
WP_016209373.1|2593892_2594714_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_016209387.1|2594843_2595728_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2595865_2596441_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2596386_2596752_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275125.1|2598888_2599932_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210612.1|2601523_2602774_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016210605.1|2602762_2603644_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210611.1|2603636_2604722_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210607.1|2604718_2605978_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210598.1|2606146_2606806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556471.1|2606947_2607619_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210609.1|2607978_2608914_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_016210606.1|2609010_2609637_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210603.1|2609642_2610224_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210601.1|2610295_2611387_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210599.1|2611469_2612183_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_122940948.1|2612276_2612981_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300148.1|2613303_2614365_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126800.1|2614489_2615224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049893.1|2615408_2615624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046715.1|2615772_2616018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556470.1|2616317_2617203_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209916.1|2617440_2618412_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	3.7e-34
WP_016209900.1|2618603_2620073_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209924.1|2620066_2621443_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209906.1|2621454_2621847_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209919.1|2621843_2622947_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_032126654.1|2623125_2624427_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209907.1|2624434_2625382_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_016209913.1|2625393_2626212_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_032126655.1|2626214_2627015_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209910.1|2627008_2628067_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_016209903.1|2628063_2629074_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|2629080_2629278_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209914.1|2629338_2632245_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209918.1|2632286_2633141_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_032126652.1|2633173_2633740_-	chorismate lyase	NA	NA	NA	NA	NA
WP_016209915.1|2633822_2634683_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016209922.1|2634774_2635191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209912.1|2635250_2635748_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209920.1|2635793_2638748_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209901.1|2638777_2639110_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209923.1|2639227_2639746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209908.1|2640220_2640931_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209899.1|2640927_2641962_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_032126651.1|2642065_2642251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275054.1|2642371_2642737_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2642682_2643258_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212369.1|2643261_2643708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212599.1|2644942_2645152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275052.1|2645201_2645711_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275050.1|2645855_2646551_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2646626_2647532_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275072.1|2648283_2648634_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080743011.1|2648593_2649049_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	2686128	2825112	3162712	transposase,plate,integrase,tRNA	Escherichia_phage(32.14%)	140	2791068:2791127	2804853:2805044
WP_032126187.1|2686128_2686527_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_051307310.1|2686526_2687999_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_129556464.1|2688004_2688496_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016209516.1|2688485_2689955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|2689959_2690652_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|2690629_2691658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126188.1|2691651_2692878_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209501.1|2692883_2694395_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_016209510.1|2694656_2695094_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209523.1|2695144_2696494_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209529.1|2696498_2697209_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_016209536.1|2697221_2700392_+	intracellular multiplication and macrophage-killing family protein	NA	NA	NA	NA	NA
WP_016209533.1|2702253_2702574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126191.1|2702718_2703240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376335.1|2703372_2704173_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_016210437.1|2704271_2704847_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.5	3.7e-58
WP_016210432.1|2704905_2705577_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_016210442.1|2705622_2706522_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_016210438.1|2706556_2706940_-	response regulator	NA	NA	NA	NA	NA
WP_016210440.1|2707067_2707544_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_033923648.1|2707543_2707825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210439.1|2707821_2708532_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_016210436.1|2708528_2709554_-	phosphotransferase	NA	NA	NA	NA	NA
WP_080664841.1|2709683_2712188_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_016210428.1|2712194_2713466_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_016210429.1|2713467_2714451_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_016210434.1|2714463_2715282_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_016210431.1|2715326_2715719_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_016210435.1|2715778_2716585_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_129556462.1|2716815_2717661_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.8	1.4e-24
WP_105962625.1|2717657_2718544_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007066.1|2718923_2719262_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275039.1|2719256_2719751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|2720554_2720845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007010.1|2720894_2721515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210530.1|2722355_2723036_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_016210535.1|2723032_2723845_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210534.1|2723918_2727599_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_016210531.1|2727608_2729096_-	ribonuclease G	NA	NA	NA	NA	NA
WP_016210527.1|2729105_2729723_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016210528.1|2729792_2730311_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210536.1|2730307_2731207_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2731222_2732266_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210537.1|2732455_2732743_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210532.1|2732854_2734306_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_032126195.1|2734347_2735784_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_155046713.1|2736078_2736243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275038.1|2736380_2736971_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2736916_2737282_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212074.1|2737308_2737530_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212072.1|2737616_2737814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047032.1|2737843_2738077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212075.1|2738289_2738487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126197.1|2738600_2739554_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300271.1|2739694_2740669_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|2740779_2741841_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126201.1|2741862_2742609_-	lipoprotein	NA	NA	NA	NA	NA
WP_032126199.1|2742738_2743050_+	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_016211487.1|2743397_2743721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211494.1|2743745_2744201_-	arginine repressor	NA	NA	NA	NA	NA
WP_016211489.1|2744190_2745243_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211493.1|2745245_2746709_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211491.1|2746991_2747288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275036.1|2747548_2748610_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210915.1|2748739_2749204_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_032126715.1|2749401_2750217_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210906.1|2750345_2752658_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_051307343.1|2752777_2753305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210909.1|2753997_2755275_+	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_016210914.1|2755280_2755532_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210913.1|2755565_2756087_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_032126716.1|2756257_2757241_-	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210908.1|2757331_2758147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049894.1|2758468_2758660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556458.1|2759038_2759272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2759647_2760709_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212580.1|2761444_2761795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2761882_2762248_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2762193_2762769_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211662.1|2763373_2764486_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_032126810.1|2764528_2765227_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211661.1|2765485_2766442_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_016211663.1|2766506_2767172_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_036776715.1|2767265_2767994_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211244.1|2768395_2769091_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_016211242.1|2769044_2770013_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_129556456.1|2770056_2770806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211238.1|2771007_2772501_-	amino acid permease	NA	NA	NA	NA	NA
WP_129556626.1|2772943_2774332_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211235.1|2774761_2775199_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300202.1|2775693_2776422_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211644.1|2776563_2776830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211639.1|2776944_2777247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211640.1|2777626_2778229_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211645.1|2778260_2779010_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	28.2	2.4e-09
WP_016211641.1|2779032_2779488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|2779492_2780095_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211642.1|2780395_2780749_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_016211646.1|2780741_2780981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2781350_2782187_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2782198_2782471_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275032.1|2782521_2783331_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	1.1e-15
WP_075275029.1|2784074_2784803_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	9.6e-43
WP_129556454.1|2784971_2786984_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_080728351.1|2787247_2787406_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211807.1|2787293_2787515_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275025.1|2787764_2789780_+	DUF1561 family protein	NA	NA	NA	NA	NA
2791068:2791127	attL	GAGGCACACGTTTGACGAAAGTGGGGCCTCAGCCGTTTGGCGATCTGCGAGCCATACTCG	NA	NA	NA	NA
WP_036771330.1|2791295_2792270_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_032126150.1|2792368_2792602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212425.1|2792750_2793341_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.4	1.1e-20
WP_016212424.1|2793544_2793823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126738.1|2793815_2794088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|2794214_2794943_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211918.1|2795491_2796460_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_051307368.1|2796459_2797740_-	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_054300202.1|2798397_2799126_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_052047116.1|2799827_2800007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556453.1|2800151_2800583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273432.1|2801002_2801737_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_016212023.1|2801733_2802726_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_016212022.1|2803212_2803431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212021.1|2803430_2804030_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212024.1|2804026_2804275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|2804670_2805399_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
2804853:2805044	attR	CGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTCTTGGCGGTTAGATGAAACGTTGGTGAAAATTAAAGGTCGTTGGTATTACCTTTATCGAGCCATTGATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTT	NA	NA	NA	NA
WP_016212110.1|2806045_2806516_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	62.5	7.6e-33
WP_016212114.1|2806519_2806750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126479.1|2806746_2807100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126478.1|2807086_2807425_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.7e-24
WP_129556625.1|2807417_2807975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275021.1|2808189_2809131_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300201.1|2809198_2809927_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_075274955.1|2810226_2811201_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_155049895.1|2811236_2811773_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2811796_2812252_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_129556598.1|2814801_2817315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211935.1|2818249_2820898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274958.1|2821346_2822408_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2822434_2823010_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2822955_2823321_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556599.1|2823959_2825112_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 29
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	2937674	2981072	3162712	transposase,protease	Acanthamoeba_polyphaga_lentillevirus(14.29%)	41	NA	NA
WP_016209259.1|2937674_2938523_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_016209274.1|2938639_2939551_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_075274963.1|2940269_2941331_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212454.1|2941550_2942231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211192.1|2943019_2944378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211189.1|2944422_2944881_-	NfeD family protein	NA	NA	NA	NA	NA
WP_016211187.1|2944905_2945826_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_016211186.1|2945952_2946735_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.3	8.2e-32
WP_016211190.1|2946824_2948324_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_016211188.1|2948645_2950529_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_075273298.1|2950602_2951178_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2951123_2951489_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211157.1|2952053_2952710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211161.1|2952817_2953927_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2953938_2954583_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2954601_2955588_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2955667_2956744_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2956946_2957771_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2958087_2959092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2959300_2960266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274965.1|2960404_2961280_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2961576_2962629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046999.1|2962917_2963325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2963538_2964030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2964085_2965336_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2965438_2965657_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_052104629.1|2966099_2967125_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080728341.1|2967574_2967745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212561.1|2967716_2967857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210728.1|2968771_2969242_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2969530_2970910_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2970937_2971396_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2971373_2972591_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2972782_2973019_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2973032_2973188_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2973268_2974231_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2974390_2975707_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2975716_2976385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2976747_2978562_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_129556601.1|2978679_2979456_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_052104629.1|2980046_2981072_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP039032	Piscirickettsia salmonis strain Psal-070 chromosome, complete genome	3162712	3012757	3130184	3162712	transposase,tRNA	Staphylococcus_phage(33.33%)	113	NA	NA
WP_054300271.1|3012757_3013732_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|3013807_3014827_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047000.1|3014874_3015021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047001.1|3015225_3015411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274966.1|3017426_3018488_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|3018568_3018877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|3018991_3020308_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664857.1|3020769_3022056_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|3022128_3023025_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|3023111_3024110_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|3024218_3024743_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|3024990_3026229_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|3026776_3027250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|3027246_3027642_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3028571_3029147_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3029092_3029458_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211610.1|3029722_3032053_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_129556603.1|3032173_3034189_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075274967.1|3034372_3037765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3037829_3038135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274968.1|3038304_3039405_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049897.1|3039652_3040909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209721.1|3041847_3043245_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.3e-77
WP_051307313.1|3043364_3044312_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3044308_3044824_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3044810_3046010_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3046006_3046330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3046331_3047561_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3047560_3048604_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3048603_3049287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3049283_3051773_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3051789_3052044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3052044_3052401_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3053180_3054344_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3054363_3057471_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3057472_3058978_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3059005_3059287_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3059435_3059777_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3059896_3061777_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_155049898.1|3061861_3063379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3063477_3064593_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3064720_3065719_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|3065722_3066481_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3066482_3067682_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3067665_3068337_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3068358_3069135_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3069138_3070137_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3070138_3070717_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3070713_3072183_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3072226_3072514_-	trp operon repressor	NA	NA	NA	NA	NA
WP_016209699.1|3072714_3073311_+	DMT family transporter	NA	NA	NA	NA	NA
WP_075274970.1|3073520_3073991_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3074047_3074203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274971.1|3074347_3074800_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3074985_3075207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|3075322_3075955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274972.1|3075932_3076994_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211865.1|3077433_3077973_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3078057_3078594_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3079245_3079548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3079997_3080306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|3080914_3081364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3081646_3082357_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3082583_3082982_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|3083849_3084800_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3084799_3086878_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3087025_3087541_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3087549_3088113_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3088093_3088840_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3088979_3089432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3089855_3090692_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3090688_3091585_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3091617_3092685_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3092703_3093072_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3093097_3094546_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3094555_3095935_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3095975_3097307_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3097278_3098238_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3098330_3098834_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3098968_3100120_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3100116_3100596_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3100742_3103064_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3103008_3103635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3103639_3104539_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3104611_3105190_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3105490_3105748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556611.1|3105756_3106910_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155049899.1|3107594_3107738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046758.1|3108046_3108178_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3108322_3108478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212051.1|3108805_3109579_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126148.1|3110120_3110303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3110906_3111881_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3112975_3113314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212337.1|3113330_3114041_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_051307375.1|3114028_3114220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|3114381_3114681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3114670_3114835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3114891_3115257_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3116561_3117257_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3117253_3118681_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3118706_3118970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3119330_3120305_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556612.1|3120363_3121214_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3121251_3121596_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3121592_3122429_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3122429_3122771_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3122772_3123378_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3123374_3125369_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3125388_3126330_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211292.1|3126557_3127982_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3128494_3129469_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3129527_3130184_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039033	Piscirickettsia salmonis strain Psal-070 plasmid unnamed1, complete sequence	108848	2892	102211	108848	protease,transposase,integrase	Streptococcus_phage(27.27%)	116	84783:84842	101094:101474
WP_054300202.1|2892_3621_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212168.1|3589_5278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275149.1|5621_6596_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.9e-25
WP_016211953.1|6830_7310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211956.1|7367_8096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211955.1|8552_9533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|9678_10407_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126843.1|10710_10890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126844.1|11108_11405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212118.1|11499_11961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|12879_13854_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_075274955.1|15229_16204_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556704.1|16697_17027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212122.1|17903_18605_+	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_016212121.1|18558_19482_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_032126205.1|19915_20281_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556705.1|20226_20727_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	28.0	9.9e-07
WP_036771330.1|20785_21760_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_054300162.1|22272_23355_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212255.1|23541_23712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|23708_23912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|24248_24473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212260.1|24492_24765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|24922_25897_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556717.1|26551_27778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|28103_28940_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_016212398.1|29202_29664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047268.1|29830_30211_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|31011_31377_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|31322_31898_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_129556702.1|32881_34035_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075275159.1|34055_34763_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	32.0	3.8e-12
WP_129556701.1|35171_35696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|35942_36275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728342.1|36589_37093_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054300148.1|37132_38194_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|38299_38755_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_081377913.1|38714_39065_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|39136_39865_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_016212413.1|40198_40627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|40674_41415_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_032126346.1|41481_41724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273798.1|41815_42040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|42148_42673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211872.1|42793_43597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|44151_44415_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211871.1|44980_45316_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_129556699.1|45309_45510_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300590.1|45817_46042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|46071_46800_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155049901.1|46905_47427_-	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	34.4	6.9e-19
WP_016212412.1|47832_47997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|47989_48439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|48686_48860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212499.1|49064_49439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|50437_50731_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_081377914.1|50847_51177_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377915.1|51321_51879_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	2.9e-47
WP_075273786.1|51887_52286_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211913.1|52718_53840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|54165_54438_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|54441_54702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211912.1|54974_55565_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_129556698.1|55654_56356_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_098082791.1|56364_56667_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.6	8.6e-14
WP_081377916.1|56871_57396_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.4	2.5e-29
WP_075275158.1|57512_57806_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307374.1|57920_58397_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_016212298.1|58637_58964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|59405_60134_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_081007042.1|60738_61554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211897.1|61947_62352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|62352_63099_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211895.1|63607_64666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126360.1|64788_65523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|65729_66305_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|66250_66616_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211773.1|67068_67743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|67844_68213_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_098082839.1|68380_68581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|68666_69395_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212152.1|69864_70248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|70554_70932_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_032126739.1|71096_71429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|71381_71534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377351.1|71617_72397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212019.1|73210_73906_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_016212018.1|74062_74362_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|74358_74604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212017.1|74633_75032_-	hypothetical protein	NA	W8VUR5	Pseudomonas_phage	38.8	2.3e-06
WP_016212014.1|75326_75740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275144.1|75837_76569_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_033923779.1|76601_77438_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|77449_77722_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962623.1|77866_79019_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556707.1|79648_80668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|81027_82002_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_051307371.1|82819_83434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212139.1|83405_83651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212137.1|83726_84788_+	hypothetical protein	NA	NA	NA	NA	NA
84783:84842	attL	CTGTAAAACTCCAGATATGATCTGACAAGCTTAAATCATCTGACAACATTTGTCTGATTG	NA	NA	NA	NA
WP_075274931.1|85231_85960_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.4e-38
WP_075274822.1|86160_87135_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016211890.1|87540_90117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|90320_91049_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046765.1|91935_92130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|92241_92970_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126832.1|93080_93989_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_054300202.1|94233_94962_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211886.1|95750_96179_+	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_016211884.1|96175_96475_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_129556706.1|96565_97195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211885.1|97208_98249_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_033923686.1|98357_99407_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212150.1|99463_99778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212151.1|99801_100764_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054300162.1|101128_102211_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
101094:101474	attR	CTGTAAAACTCCAGATATGATCTGACAAGCTTAAATCATCTGACAACATTTGTCTGATTGATCAGACTGTCAGATTGCACATTTTTATTGATTATTTTTTCTTGTGCTAAATGTTTTGAGTCCTGAAATGTTTGCATTGGTGTTTTTCCATAACAGTATTTCCCAGAATGTGGCCGATGCTGATTGTACTTTATCAACCACTCATCAACATCAACTTGCAGCTCCTCAAGTGAATTATAGACTTTTTTACGAAAAGCAATGTCATAAAACTCTTGTTTCATCGTGCGATGAAAGCGTTCACAAATACCATTTGTTTGAGGTGAACGGGCTTTTGTTCTGGTGTGATCTACATCTTCGATCGCTAAATAAAGCTGATAAGCG	NA	NA	NA	NA
>prophage 1
NZ_CP039034	Piscirickettsia salmonis strain Psal-070 plasmid unnamed2, complete sequence	79943	4824	28863	79943	transposase	Streptococcus_phage(16.67%)	33	NA	NA
WP_075273327.1|4824_5400_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|5345_5711_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212400.1|5761_6361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212399.1|6360_6621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|6750_7903_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212392.1|7931_8939_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	26.4	1.2e-06
WP_075273802.1|9002_9731_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_016212131.1|9914_10262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212135.1|10700_11885_+	3-methylitaconate isomerase	NA	NA	NA	NA	NA
WP_075275202.1|12128_12830_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	6.0e-10
WP_075275201.1|12832_13561_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_016212164.1|13689_14718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211443.1|15741_16428_+	Fic family protein	NA	NA	NA	NA	NA
WP_016211439.1|16431_16986_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	40.6	1.0e-20
WP_016211436.1|17030_17969_+	fic/DOC family protein	NA	S4TP71	Salmonella_phage	37.2	5.2e-25
WP_016211434.1|17941_18133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211445.1|18310_18661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211437.1|18677_19304_-	zinc-ribbon domain-containing protein	NA	A0A1S5XYQ1	Kurlavirus	28.2	4.4e-12
WP_032126541.1|19310_19703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211440.1|19713_20628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211444.1|20897_21404_+	antirestriction protein ArdA	NA	A0A222YZE5	Mycobacterium_phage	33.7	2.8e-17
WP_051307358.1|21552_21936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556729.1|22219_22450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212541.1|22436_22661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212539.1|22720_22870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|22866_23841_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212090.1|23884_24064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212087.1|24063_24492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126714.1|24659_25199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212089.1|25435_25666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126713.1|25764_26802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|27271_28297_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275198.1|28323_28863_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	40.2	8.4e-12
>prophage 2
NZ_CP039034	Piscirickettsia salmonis strain Psal-070 plasmid unnamed2, complete sequence	79943	37206	57887	79943	protease,portal,capsid,terminase,tail,head	Pseudomonas_phage(11.76%)	29	NA	NA
WP_129556725.1|37206_37887_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	39.3	3.3e-37
WP_016210977.1|38065_38359_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_129556724.1|38576_38759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046773.1|38903_39083_-	phosphatase	NA	NA	NA	NA	NA
WP_129556723.1|39177_39495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126134.1|39795_40179_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	5.6e-26
WP_016212234.1|40266_40746_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_016212231.1|40749_40959_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	43.1	1.3e-08
WP_080743047.1|40974_41331_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	61.3	5.4e-23
WP_081377926.1|41349_42432_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	1.2e-89
WP_016211136.1|42428_43670_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	46.0	3.1e-86
WP_080664855.1|43617_44289_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_016211140.1|44346_45540_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_016211133.1|45660_46995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|47185_47497_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211132.1|47493_47817_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211139.1|47809_48205_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211129.1|48201_48552_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|48551_48974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126913.1|48975_49299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|49355_49622_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_032126912.1|49625_51704_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.0	2.5e-56
WP_016210657.1|51696_52038_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|52034_52706_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|52674_53421_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_016210665.1|53410_53968_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_016210662.1|53974_54262_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	2.5e-15
WP_016210670.1|54251_54506_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_016210653.1|54599_57887_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	33.5	5.2e-112
