The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	45566	89679	3138668	transposase	Moraxella_phage(16.67%)	46	NA	NA
WP_129556427.1|45566_46142_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46087_46453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46651_47413_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_016211195.1|47714_49241_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49612_50452_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50491_51799_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51773_52943_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|52997_53723_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54001_54391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54550_55456_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55531_55675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274979.1|55722_56562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|56554_56890_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_155046698.1|57068_57230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|57346_57640_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_016210704.1|58534_60481_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61135_64198_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64194_65259_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65614_66568_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66599_67763_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67768_68368_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68555_69056_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69073_70162_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70588_71833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71829_72672_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016211096.1|72651_73461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73639_73867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73867_74818_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74873_75425_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75551_75974_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75966_76713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76755_77454_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77464_78289_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78618_78987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274980.1|78981_80043_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|80092_80323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80452_81667_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81967_83029_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_016211249.1|83042_84770_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_016211245.1|84803_85535_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85534_86323_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86427_87051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87370_87583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273383.1|87738_88311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046699.1|88515_89088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274981.1|89082_89679_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	136473	178470	3138668	transposase	Staphylococcus_phage(50.0%)	46	NA	NA
WP_054300271.1|136473_137448_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|137949_139362_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|139854_140862_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|140881_142402_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_129556430.1|142458_142665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211018.1|143640_144957_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145060_145444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145578_148644_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|148712_149816_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|149839_150394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150508_151078_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151197_151953_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_054300545.1|152119_153181_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|153575_153971_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|153992_154358_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154414_154579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|154568_154868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|155120_155486_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|155431_156007_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212607.1|156007_156364_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|156452_157028_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|156973_157339_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|157818_158385_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|158396_159182_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|159813_160737_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|160788_161784_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|161815_162310_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|162401_162659_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|162748_163171_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|163489_164206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|164249_164501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556431.1|164514_165942_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|165969_167412_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|167499_167838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|167922_168453_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|168513_170706_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|170748_171234_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|171503_171935_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_016210245.1|171952_172783_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|172797_172941_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|172971_173856_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|173827_174049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|174222_174501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|175471_176377_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016212383.1|176779_177898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|177894_178470_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	182276	239530	3138668	tail,tRNA,transposase,protease	Escherichia_phage(12.5%)	56	NA	NA
WP_075273327.1|182276_182852_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274985.1|182797_183163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|183226_183499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212441.1|183766_183991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372761.1|185006_185456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|185519_186248_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210779.1|186290_187220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|187512_188106_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|188074_188728_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|188905_189877_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|189899_190796_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|190954_191401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210787.1|191397_192039_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|192148_192727_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|193202_193640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|193964_195305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|195568_196963_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075274986.1|198411_199479_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|199531_199954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|200194_200638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|200692_200950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|200927_201554_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|201631_203614_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|203823_205167_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|205433_208103_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|208126_210046_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|210215_211637_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|211782_212757_+	phospholipase A	NA	NA	NA	NA	NA
WP_016209855.1|212788_213184_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209859.1|213186_213408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|213571_215233_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|215305_215596_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_016209861.1|215821_216277_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|216341_216806_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216898_218245_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|218244_219150_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|219211_220198_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|220190_220433_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|220554_222099_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|222145_223432_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|223474_224869_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224892_225072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|225068_225644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|225589_225955_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274988.1|226016_228251_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016210079.1|228672_229170_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|229340_230036_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|230138_231701_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|232016_233810_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233895_234168_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|234173_234800_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234786_236217_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236549_237605_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237573_238251_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|238240_239077_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|239236_239530_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	256927	301967	3138668	tRNA,transposase	Acinetobacter_phage(40.0%)	48	NA	NA
WP_075274991.1|256927_257503_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377888.1|257506_258067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556436.1|258122_259009_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046701.1|259035_259185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|259329_259530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|259577_260039_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|260462_261944_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|262006_263116_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|263213_265175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|265704_266109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|266161_267223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046702.1|267348_267504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270449_271602_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556437.1|271644_272067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069170.1|272336_273887_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_032126861.1|274090_274405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046703.1|274598_274736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|274739_275626_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212538.1|275797_276238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210630.1|276767_277883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664846.1|277821_278508_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032126366.1|278501_279479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210638.1|279517_280681_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210640.1|281145_281370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|281755_282043_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210633.1|282217_282973_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|282978_283434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210637.1|283409_283886_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210636.1|283892_285470_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_032126367.1|285473_286238_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210629.1|286291_286828_+	tim44-like domain protein	NA	NA	NA	NA	NA
WP_016210634.1|286824_287556_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_032126368.1|287664_288819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275120.1|288963_289275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664872.1|289598_290579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556440.1|290820_291429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211899.1|291771_292065_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_105962625.1|292161_293048_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274996.1|293456_294557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126374.1|294665_295637_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728325.1|295668_296046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211609.1|296699_297008_+	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_032126373.1|297040_299227_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	2.7e-141
WP_016211605.1|299330_299564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|299780_300311_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211607.1|300339_300564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|300746_301562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300526.1|301670_301967_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	329542	375097	3138668	transposase	Hokovirus(33.33%)	46	NA	NA
WP_075273298.1|329542_330118_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210127.1|330170_331196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|331289_331553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|331919_332738_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|332810_335183_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_016210125.1|335895_337323_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|337357_338380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|338396_338774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126491.1|339131_339449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210122.1|339615_340308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|340934_341909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|341898_343671_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|343671_344019_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_032126493.1|344268_345495_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|345584_346883_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664834.1|346916_347276_-	VUT family protein	NA	NA	NA	NA	NA
WP_080664833.1|347321_347666_-	VUT family protein	NA	NA	NA	NA	NA
WP_016210137.1|347646_348198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664832.1|348424_349723_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|349839_350130_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_016212281.1|350441_351896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556427.1|352095_352671_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|352616_352982_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212359.1|353717_353936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|354303_355278_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212044.1|355816_356071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|356793_357780_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|357917_358112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664870.1|358794_359442_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_129556444.1|359434_359857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211797.1|360018_361422_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|361472_362048_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|361993_362308_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556445.1|362348_363235_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126227.1|363873_364164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212008.1|364201_364900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212010.1|364916_365213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212007.1|365336_366482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273619.1|366754_367330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211273.1|367387_368221_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.0	3.5e-17
WP_016211268.1|368336_369521_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211271.1|369539_370484_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016211269.1|370788_371574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211272.1|371691_372060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211270.1|372287_373865_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_054300173.1|374035_375097_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	447709	550123	3138668	tRNA,transposase,integrase	Escherichia_phage(42.86%)	98	507580:507639	540759:541139
WP_075275004.1|447709_448573_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|448789_450349_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|450370_451405_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|451453_452023_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|452158_453130_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|453141_454719_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|454784_455771_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016210646.1|456102_457212_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|457317_458502_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|458579_460568_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|460776_460932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|461189_461489_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_075275005.1|461647_461983_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|462899_464306_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|464323_465310_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|465312_466467_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|466463_467159_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|467293_468784_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|468804_469854_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|469920_471315_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|472193_474125_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|474129_474660_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|474694_474889_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|474931_475291_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|475710_476706_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_032126132.1|476718_479100_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|479105_479393_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|479664_480141_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|480285_480483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|480607_481582_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|482482_482581_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210477.1|483065_484355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126626.1|484591_485284_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|485325_486099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|486100_487042_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|487174_488752_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|488961_490719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|491267_492026_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|492233_492806_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|492909_493458_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|493759_494005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|494033_494330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|494597_495521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556451.1|495999_496257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275008.1|496320_497049_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	3.3e-43
WP_098082828.1|497363_497621_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275009.1|497752_498460_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.8	1.3e-44
WP_075275011.1|498503_499232_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.2e-42
WP_032126799.1|499423_500236_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_129556452.1|501356_501704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049103.1|501706_503023_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300501.1|502972_503701_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|503712_504105_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|504101_504347_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300307.1|505450_506179_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300307.1|506785_507514_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
507580:507639	attL	GATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCG	NA	NA	NA	NA
WP_016212268.1|508158_508743_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|508746_509430_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|509712_510441_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_052104629.1|510777_511803_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212159.1|511946_512144_-	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_016212158.1|512411_513326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275019.1|513435_514140_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	9.2e-43
WP_105962625.1|514103_514990_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211714.1|515364_518709_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_144019196.1|518741_519398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|519453_520182_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_075275021.1|520249_521191_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556625.1|521405_521963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126478.1|521955_522294_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.7e-24
WP_032126479.1|522280_522634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212114.1|522630_522861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212110.1|522864_523335_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	62.5	7.6e-33
WP_054300201.1|523981_524710_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_016212024.1|525105_525354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212021.1|525350_525950_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|525949_526168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|526654_527647_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|527643_528378_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_129556453.1|528797_529229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047116.1|529373_529553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|530254_530983_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_051307368.1|531640_532921_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|532920_533889_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_032126737.1|536400_537129_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_036781387.1|537329_537602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|537594_537873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212425.1|538076_538667_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.4	1.1e-20
WP_032126150.1|538871_539105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|539203_540178_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_075275025.1|541693_543709_-	DUF1561 family protein	NA	NA	NA	NA	NA
540759:541139	attR	GATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTTTTTCAAAAAGGCAATCGCCCAACCTTATGTGAAATCACCGCGTGTTGTGAATGTCGACAAGCACGCTTCATTTCCACCCGCTCACCAAAAAGCCAAAGATGAAGGTCTCTTTTCTAGTCAGTGTAAACTCAGGCGAGTGAAGTATTTAAACAACTGCATTGAAAATGATCACAAAGCGGTAAAGCGCAAATCCCGTTTCCGCCAATGGTACCAATCACTTTCTACAGCACGGCCTACCATTGACATAATGGAAGCGATGCGCATGGTTCAAAAAGGTCAATTACGTTATATTAAAAAACAGAATATCTGTGCC	NA	NA	NA	NA
WP_016211807.1|543958_544180_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728351.1|544067_544226_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556454.1|544489_546502_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_075275029.1|546670_547399_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	9.6e-43
WP_075275032.1|548142_548952_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	1.1e-15
WP_032126239.1|549002_549275_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|549286_550123_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
>prophage 7
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	555051	613815	3138668	tRNA,transposase	Escherichia_phage(22.22%)	60	NA	NA
WP_054300202.1|555051_555780_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211235.1|556274_556712_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|557141_558530_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211238.1|558972_560466_+	amino acid permease	NA	NA	NA	NA	NA
WP_129556456.1|560667_561417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556457.1|561460_562399_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016211244.1|562382_563078_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_036776715.1|563479_564208_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|564301_564967_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|565031_565988_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|566246_566945_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|566987_568100_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|568704_569280_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|569225_569591_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|569678_570029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|570764_571826_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556458.1|572201_572435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210908.1|573326_574142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|574232_575216_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|575386_575908_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_016210914.1|575941_576193_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210909.1|576198_577476_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|578168_578696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|578815_581128_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|581256_582072_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|582269_582734_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275036.1|582863_583925_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|584185_584482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|584764_586228_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|586230_587283_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211494.1|587272_587728_+	arginine repressor	NA	NA	NA	NA	NA
WP_016211487.1|587752_588076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|588423_588735_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_032126201.1|588864_589611_+	lipoprotein	NA	NA	NA	NA	NA
WP_054300148.1|589632_590694_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|590804_591779_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126197.1|591919_592873_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|592986_593184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|593429_593630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212072.1|593659_593857_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212074.1|593943_594165_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|594191_594557_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275038.1|594502_595093_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046713.1|595230_595395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|595689_597126_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|597167_598619_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|598730_599018_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|599207_600251_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210536.1|600266_601166_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210528.1|601162_601681_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210527.1|601750_602368_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016210531.1|602377_603865_+	ribonuclease G	NA	NA	NA	NA	NA
WP_016210534.1|603874_607555_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_016210535.1|607628_608441_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210530.1|608437_609118_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_081007010.1|609958_610579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|610628_610919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275039.1|611722_612217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|612211_612550_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|612929_613815_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	634979	735608	3138668	tRNA,transposase,protease,plate	Prochlorococcus_phage(17.65%)	104	NA	NA
WP_016209523.1|634979_636329_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|636379_636817_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|637078_638590_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_032126188.1|638595_639822_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|639815_640844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|640821_641514_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_016209516.1|641518_642988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556464.1|642977_643469_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|643474_644947_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|644946_645345_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|645341_647030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|647011_647968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|648010_648526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|648630_649563_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|649782_650169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|650185_650830_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|651010_651850_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|651925_652528_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|652528_653383_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|653739_654051_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|654075_655467_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|655622_656354_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_129556465.1|656350_656923_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|656909_657467_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|657472_658453_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|658592_659393_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_036780687.1|659396_660164_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|660160_660625_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|660647_661301_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|661304_661652_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|661685_661937_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|662011_663280_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|663282_664041_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|664102_664993_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|665043_665727_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|665812_666070_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_075275046.1|666342_668556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|668547_669420_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|669587_671417_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|671580_672222_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|672463_672994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|673011_673185_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|673243_674293_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|674299_675250_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|675303_676248_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|676275_677013_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|677101_677344_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|677418_678642_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|678673_679522_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|679518_680571_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|680691_681312_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_036780649.1|681327_682314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080743011.1|682424_682880_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556469.1|682839_683148_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|683941_684847_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275050.1|684922_685618_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275052.1|685762_686272_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|686321_686531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|687765_688212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|688215_688791_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275054.1|688736_689102_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|689222_689408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|689511_690546_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|690542_691253_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|691727_692246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|692363_692696_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209920.1|692725_695680_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209912.1|695725_696223_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|696282_696699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|696790_697651_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|697733_698300_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|698332_699187_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_016209914.1|699228_702135_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|702195_702393_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|702399_703410_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|703406_704465_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|704458_705259_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|705261_706080_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|706091_707039_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|707046_708348_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|708526_709630_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|709626_710019_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|710030_711407_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|711400_712870_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209916.1|713061_714033_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	3.7e-34
WP_129556470.1|714269_715156_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|715455_715701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|716249_716984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|717108_718170_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|718492_719197_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|719290_720004_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|720086_721178_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|721249_721831_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|721836_722463_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|722559_723495_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|723854_724526_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210598.1|724667_725327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|725495_726755_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|726751_727837_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|727829_728711_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|728699_729950_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_075275125.1|731541_732585_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|734721_735087_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|735032_735608_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	771026	817712	3138668	tRNA,transposase	Staphylococcus_phage(28.57%)	39	NA	NA
WP_016209374.1|771026_772478_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|772513_774043_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_016209380.1|774618_775041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556473.1|775173_776262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126585.1|776803_777724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|778074_778890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|779181_781872_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_080664814.1|782120_783341_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|783508_785215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|785813_787040_+	MFS transporter	NA	NA	NA	NA	NA
WP_075274832.1|787622_788597_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_075273456.1|788719_789019_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|788978_789434_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212416.1|789435_789966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212417.1|790089_790335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|790385_790751_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|790696_791272_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052047106.1|791345_791822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|792537_792903_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|792848_793424_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300173.1|793450_794512_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556627.1|794564_795170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211819.1|795388_795619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|795915_796416_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|796618_797875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211822.1|798231_798645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|798954_800016_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275065.1|800315_800990_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.9e-10
WP_016212172.1|801880_803353_+	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|803372_804347_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556474.1|804551_804773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|804938_805559_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_016210737.1|805877_807854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|808009_809467_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|809535_811116_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210744.1|811156_811642_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|811738_815635_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|815641_815965_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300173.1|816650_817712_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	834399	888852	3138668	transposase,protease	Staphylococcus_phage(15.38%)	45	NA	NA
WP_033923708.1|834399_835275_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|835530_836175_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|836205_838011_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|838034_838610_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556476.1|839154_840165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|840260_841235_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016209640.1|841653_842673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|843131_844097_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|844141_844717_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|844747_846022_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|846648_847362_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|847441_848179_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|848299_849655_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|849831_850503_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|850618_851494_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|852097_853402_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|853514_854120_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|854201_855503_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|855570_858003_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|858106_858379_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_032126162.1|858482_860360_+	SurA domain-containing protein	NA	NA	NA	NA	NA
WP_016209643.1|860391_861276_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|861284_861680_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|862107_864255_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|864226_865576_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|865572_867693_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|867689_869393_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_155049178.1|869511_870654_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|870718_871747_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_129556477.1|871906_873388_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|873477_873963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275067.1|874295_875363_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273512.1|876118_876463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|876599_877574_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126362.1|877745_878111_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051307360.1|878950_879880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780074.1|880971_881778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|882120_884013_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|884299_884704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923634.1|884908_885457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|885446_886333_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|886671_887082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556479.1|887295_887478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274918.1|887965_888331_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|888276_888852_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	895102	958137	3138668	integrase,transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(14.29%)	58	887462:887521	904746:905185
887462:887521	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_032126152.1|895102_895693_-|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016212424.1|895895_896174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|896166_896439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|896583_897666_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211300.1|897716_898757_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_129556480.1|899268_904758_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|904781_905756_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
904746:905185	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTA	NA	NA	NA	NA
WP_016212302.1|906069_906369_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_129556481.1|906553_906985_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_054300162.1|907242_908325_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211579.1|908548_909034_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|909101_910010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211581.1|910286_911057_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.9	8.9e-31
WP_016211585.1|911175_911733_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016211582.1|911794_912574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|912671_913025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|913091_913286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|913301_913646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|914003_914579_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|914524_914890_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275068.1|914974_915565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047108.1|915666_916065_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212107.1|916876_918013_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046716.1|918417_918564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|919261_919816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|920252_920435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210541.1|920499_920727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|920957_921704_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|921930_922224_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|922295_922901_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|923049_924027_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_032126547.1|924123_925566_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|925592_926246_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_016210552.1|926370_926937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|927291_929070_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_016210542.1|929141_930848_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.9	2.5e-25
WP_054300262.1|930839_931130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|931592_931958_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|931903_932479_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|932482_932857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275071.1|933232_934207_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_054300264.1|934309_934648_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300265.1|934792_935053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556469.1|935012_935321_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556484.1|935822_937283_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_016211426.1|937626_939069_+	MFS transporter	NA	NA	NA	NA	NA
WP_075273490.1|940051_941344_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_054300148.1|941584_942646_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556485.1|942798_945357_+	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.6	6.3e-73
WP_032126554.1|945376_946462_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_016210417.1|946903_947341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210423.1|947337_948222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210416.1|948311_948842_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_016210420.1|948912_950091_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.1	2.0e-50
WP_016210425.1|950239_954088_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_016210422.1|954074_955577_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_016210418.1|956127_956763_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_054300173.1|957075_958137_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	962011	1065203	3138668	tRNA,transposase	uncultured_Mediterranean_phage(11.11%)	110	NA	NA
WP_075275075.1|962011_963073_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|963067_963238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|963227_963392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|963448_963814_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|963835_964204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210898.1|965115_965466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|965554_965845_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|966319_966622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210897.1|966962_967943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|968021_969359_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|969477_969849_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|970069_970720_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|970762_971845_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|971898_973782_+	APC family permease	NA	NA	NA	NA	NA
WP_032126790.1|974281_975187_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275077.1|975271_976108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212218.1|976252_976603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|978052_979114_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|979239_980322_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_032126801.1|980992_981502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275079.1|981549_982611_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556488.1|982759_983609_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126540.1|984758_985622_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|986502_986868_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|986813_987389_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|987619_987985_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|987930_988506_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126869.1|989026_989266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|989243_990305_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212290.1|990421_991747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|991750_992637_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212326.1|992862_993060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122941816.1|993146_993455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212323.1|993531_993804_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_075274676.1|993878_994076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046717.1|994234_994384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|996640_998677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664853.1|999400_1001143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049116.1|1001102_1002749_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|1002761_1003805_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|1003783_1004245_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_016211081.1|1004285_1005221_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211087.1|1005248_1006244_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211088.1|1006463_1007426_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126778.1|1007604_1007799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075285940.1|1008013_1008835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377357.1|1008919_1009321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212611.1|1009804_1010125_+	histidine kinase	NA	NA	NA	NA	NA
WP_075275084.1|1010172_1011234_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212519.1|1011308_1011689_+	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_052047081.1|1011959_1012397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212356.1|1012447_1013293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275086.1|1013270_1014269_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1014229_1014595_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1014540_1015116_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1015485_1016460_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016212585.1|1016571_1016892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212621.1|1017186_1017591_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_075273327.1|1017587_1018163_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1018108_1018474_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126498.1|1018535_1019096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211126.1|1019228_1019618_-	lipoprotein	NA	NA	NA	NA	NA
WP_016211125.1|1019787_1020618_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211128.1|1020840_1021746_-	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211119.1|1021909_1022671_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211122.1|1022674_1023541_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126499.1|1023637_1024249_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211118.1|1024627_1025875_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126500.1|1026011_1026728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275089.1|1026861_1027194_-	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	37.3	8.0e-05
WP_129556631.1|1027338_1027506_-	phosphatase	NA	NA	NA	NA	NA
WP_075275091.1|1028514_1029000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|1029270_1029681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300412.1|1029825_1030140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210280.1|1030376_1031471_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_016210284.1|1031552_1032074_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210276.1|1032128_1032605_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210275.1|1032660_1032963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210273.1|1033027_1033735_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210274.1|1034107_1034506_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_032126334.1|1034545_1034977_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210271.1|1034987_1035671_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1035755_1037951_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_129556492.1|1038048_1038792_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210283.1|1038819_1039605_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_016210272.1|1039644_1040355_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210279.1|1040342_1041509_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210277.1|1041562_1042396_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210270.1|1042465_1045453_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210281.1|1045494_1046886_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210269.1|1046899_1047250_-	L,D-transpeptidase catalytic domain protein	NA	NA	NA	NA	NA
WP_032126362.1|1047287_1047653_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1047598_1048174_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664860.1|1048137_1048575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211367.1|1048730_1049513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126330.1|1049660_1050620_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_032126331.1|1050674_1052684_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_016211366.1|1052739_1053027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126332.1|1053279_1054479_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_075273327.1|1055125_1055701_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1055646_1056012_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|1056145_1057009_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1057239_1057533_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556495.1|1058513_1058771_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211589.1|1058893_1060126_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_016211592.1|1060115_1060778_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_129556496.1|1061052_1062291_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_032126329.1|1062476_1063106_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211588.1|1063181_1063883_+	cyclase family protein	NA	NA	NA	NA	NA
WP_105962623.1|1064050_1065203_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 13
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	1094660	1201176	3138668	tRNA,transposase	uncultured_Mediterranean_phage(22.22%)	95	NA	NA
WP_075275097.1|1094660_1095236_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1095181_1095547_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300408.1|1095597_1096254_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_080664854.1|1096590_1097172_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_032126179.1|1097129_1097381_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_016211113.1|1097410_1098736_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_016211112.1|1098791_1099439_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211115.1|1099631_1101584_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211114.1|1101716_1104647_+	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_075274672.1|1105012_1105606_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1105777_1106143_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1106088_1106664_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1106677_1106968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1106913_1107489_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212254.1|1107478_1108921_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016212252.1|1108958_1109117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|1109431_1110157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|1110361_1110733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211395.1|1111089_1111425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779999.1|1111340_1111772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211393.1|1111791_1113348_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_016211391.1|1113359_1113935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728317.1|1114001_1117367_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275098.1|1117557_1118487_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-24
WP_129556498.1|1118999_1119608_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210596.1|1119604_1121545_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.1e-72
WP_016210594.1|1121680_1122334_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210595.1|1122510_1123689_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210588.1|1124056_1125382_+	fimV domain protein	NA	NA	NA	NA	NA
WP_032126176.1|1125472_1126255_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210587.1|1126356_1127217_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_016210590.1|1127391_1128654_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210593.1|1128733_1129264_+	colicin V production protein	NA	NA	NA	NA	NA
WP_016210586.1|1129285_1130791_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210592.1|1130803_1131460_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016212005.1|1131849_1133610_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_129556499.1|1134510_1135663_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_032126856.1|1135968_1136310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377901.1|1136370_1137081_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275102.1|1137261_1137720_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211525.1|1138308_1141044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|1143343_1144159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046719.1|1146377_1146536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1146554_1146827_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1146838_1147675_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_129556510.1|1148198_1149302_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	7.3e-10
WP_054300405.1|1149403_1149904_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209947.1|1150425_1151088_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016209946.1|1151114_1152344_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209940.1|1152500_1155272_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_016209937.1|1155347_1155791_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209931.1|1155943_1157416_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209926.1|1157527_1158589_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209945.1|1158585_1159620_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209932.1|1159622_1160663_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209936.1|1160845_1161961_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.6	1.4e-93
WP_016209930.1|1161999_1162353_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_032126634.1|1162373_1164242_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209935.1|1164263_1165208_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_016209925.1|1165441_1165720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1165929_1166568_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209944.1|1166542_1167970_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209927.1|1168170_1168848_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209939.1|1168982_1170257_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209943.1|1170324_1171080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209948.1|1171131_1172049_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209929.1|1172157_1173051_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075274822.1|1174509_1175484_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016211771.1|1175776_1175965_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_016211770.1|1175978_1177112_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_075274823.1|1177311_1181322_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211823.1|1181356_1181545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1181585_1182206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1182537_1182891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1183104_1183299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1183964_1184492_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300400.1|1184548_1184791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1184935_1185202_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210885.1|1185543_1186425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1186482_1187079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1187111_1187885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1188418_1188715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210888.1|1188737_1188989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155053505.1|1188934_1189657_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210886.1|1189725_1190505_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210887.1|1190587_1191538_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210889.1|1192047_1194894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556636.1|1194911_1195220_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016212002.1|1196173_1196452_-	DNA-J related family protein	NA	NA	NA	NA	NA
WP_016212000.1|1196571_1197300_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016211998.1|1197430_1197994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211999.1|1197983_1198337_-	ras family protein	NA	NA	NA	NA	NA
WP_033923779.1|1198716_1199553_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1199564_1199837_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274825.1|1200114_1201176_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	1237990	1270999	3138668	tRNA,transposase	Bacillus_phage(16.67%)	30	NA	NA
WP_075274826.1|1237990_1238896_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1239152_1240424_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_016211218.1|1240448_1241186_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1241438_1242581_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1242597_1244199_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1244710_1244848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1244844_1246122_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1246471_1246654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126600.1|1246925_1247447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212250.1|1247569_1248220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212251.1|1248381_1248918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300384.1|1249079_1249895_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075274828.1|1250303_1251626_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.2e-11
WP_052133287.1|1251727_1252126_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212039.1|1252314_1252872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212040.1|1253048_1254398_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_054300162.1|1254601_1255684_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210803.1|1255758_1257057_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_016210808.1|1257234_1258086_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210805.1|1258094_1258766_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_032126141.1|1259175_1260450_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210804.1|1260514_1262434_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126139.1|1262440_1263370_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_033923779.1|1266038_1266875_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274829.1|1266886_1267159_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1267182_1268157_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300382.1|1268557_1268980_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377858.1|1269198_1269909_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1270112_1270478_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|1270492_1270999_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	1275367	1324413	3138668	tRNA,transposase	Bacillus_phage(15.38%)	49	NA	NA
WP_016211422.1|1275367_1275838_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032126143.1|1275926_1277198_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_075274832.1|1277297_1278272_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_016211838.1|1278583_1278757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211840.1|1279227_1279692_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211839.1|1279850_1281323_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211841.1|1281440_1281893_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|1282752_1283814_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1284116_1285199_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212483.1|1285209_1286007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1286003_1286579_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1286524_1286890_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300380.1|1286991_1287648_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556508.1|1287918_1288362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|1288423_1288717_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556507.1|1288833_1289520_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.3	5.5e-48
WP_075273327.1|1289509_1290085_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1290030_1290396_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212421.1|1290887_1291070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1291820_1292795_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556505.1|1292835_1293801_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211470.1|1294567_1295221_+	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_016211471.1|1295280_1297266_-	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
WP_032126343.1|1297396_1298209_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_032126344.1|1298329_1299418_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_016211467.1|1299420_1299987_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_075273298.1|1300061_1300637_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|1300582_1300948_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047029.1|1301115_1301457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1301529_1302591_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032127044.1|1302794_1302995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212482.1|1303209_1303353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|1303896_1304190_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556503.1|1305251_1306118_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	5.6e-58
WP_016210508.1|1306126_1307824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|1308144_1308693_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_075273576.1|1308820_1309549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1309608_1313106_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_016210514.1|1313163_1314417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210515.1|1314525_1315428_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210512.1|1315481_1316519_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210506.1|1316654_1317893_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210510.1|1317885_1318614_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_081007040.1|1318644_1319301_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211831.1|1319438_1321166_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|1321466_1321820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1322235_1322736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047133.1|1323387_1323834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1323837_1324413_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	1345212	1383768	3138668	tRNA,transposase,protease	Klosneuvirus(28.57%)	33	NA	NA
WP_016210928.1|1345212_1345518_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_054300375.1|1345732_1345933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728346.1|1346739_1347072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372539.1|1347089_1347953_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556501.1|1347985_1348561_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1348506_1348872_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211651.1|1349105_1350641_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016211650.1|1350765_1352250_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211648.1|1352909_1353449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|1354652_1354859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075278621.1|1355047_1355389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126641.1|1355424_1357995_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_016209840.1|1358102_1358588_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_016209844.1|1358760_1359801_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209835.1|1359778_1360261_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209848.1|1360257_1362852_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209832.1|1363158_1363422_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209831.1|1363700_1364399_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|1364618_1364813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209827.1|1364888_1366448_-	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_129556633.1|1366766_1367663_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|1367879_1369355_-	APC family permease	NA	NA	NA	NA	NA
WP_016209826.1|1369877_1370900_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209830.1|1371230_1372598_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209846.1|1372833_1373088_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126639.1|1373103_1374390_+	GTPase HflX	NA	NA	NA	NA	NA
WP_016209836.1|1374409_1375624_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_016209838.1|1375623_1376517_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209839.1|1376714_1378013_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209829.1|1379392_1381792_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209834.1|1381788_1382547_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209842.1|1382723_1383113_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_075273327.1|1383192_1383768_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	1414557	1459748	3138668	integrase,tRNA,transposase	Tupanvirus(28.57%)	45	1422353:1422412	1470158:1470512
WP_016211285.1|1414557_1415337_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211286.1|1415354_1415702_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211289.1|1415813_1416086_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211767.1|1417414_1418224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211764.1|1418774_1419596_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126803.1|1419796_1421029_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_081377862.1|1421515_1422352_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
1422353:1422412	attL	TCGTTTATCCTCTATATCGGTAGCTTTTTTTCCACAACATCTTTCAAAGCCTCAATTTCT	NA	NA	NA	NA
WP_032126239.1|1422363_1422636_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211806.1|1423425_1424151_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_016211805.1|1424193_1425732_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211804.1|1425738_1427124_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_032126599.1|1427818_1429162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1429801_1430485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273555.1|1430762_1431296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210332.1|1431426_1432170_-	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_016210330.1|1432267_1432651_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210333.1|1432854_1433484_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_032126607.1|1433557_1434841_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_016210326.1|1435180_1436479_+	ankyrin repeats family protein	NA	NA	NA	NA	NA
WP_016210325.1|1436632_1438009_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210327.1|1438144_1439476_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210329.1|1439536_1440055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210321.1|1440103_1441072_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_129556511.1|1441268_1442705_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210323.1|1442887_1443598_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.7	6.3e-39
WP_032126606.1|1443509_1444031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210320.1|1444180_1445254_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_016210322.1|1445390_1446287_-	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016211334.1|1446904_1447093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211336.1|1447141_1447756_+	chorismate mutase	NA	NA	NA	NA	NA
WP_032126265.1|1447821_1448739_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016211328.1|1449062_1449524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082827.1|1449631_1450933_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_016211330.1|1451107_1452208_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_032126267.1|1452555_1452798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211335.1|1452791_1453109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664859.1|1453218_1453806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1453974_1454232_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774189.1|1454231_1455239_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_051307372.1|1455286_1455676_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016212275.1|1455791_1456775_+	MFS transporter	NA	NA	NA	NA	NA
WP_129556512.1|1456764_1457340_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300363.1|1457285_1457633_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212589.1|1458056_1458494_+	MFS transporter	NA	NA	NA	NA	NA
WP_129556637.1|1458968_1459748_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1470158:1470512	attR	AGAAATTGAGGCTTTGAAAGATGTTGTGGAAAAAAAGCTACCGATATAGAGGATAAACGAATGCTCGCTACTTACCTCAAAGATGAACATAAGCTAAGCCTCGTGGTTGCTTGTAATTTAGTCACTCTTCCAAGAGCAAGCTATTACCGAAAAAAACAGCATCAATCTGATAATGCTGAAATAATTTCAGAGCTAAAGACGTTAGCGAGCAAACACAAACGCTGGGGTTGCGACAAAATGGTCGCATATTTAAAAAACAAAGGTAAGCCTTGGAACCATAAGCGCATTCGTCGAGTCTATATTGAAATGGGCTTAAACATAAGCTGTAAACCAAAGCATCACTACGTCAAAAACG	NA	NA	NA	NA
>prophage 18
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	1468874	1518360	3138668	transposase,protease	Staphylococcus_phage(35.71%)	52	NA	NA
WP_054300271.1|1468874_1469849_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126239.1|1469933_1470206_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1470217_1471054_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_081377864.1|1471067_1471307_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211148.1|1471388_1472717_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1472980_1473550_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211151.1|1473565_1473877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1473886_1474843_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1474955_1475309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211153.1|1475312_1476377_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211145.1|1476377_1478117_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211152.1|1478123_1478546_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211144.1|1478529_1479159_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075273474.1|1479715_1480690_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_075274844.1|1480870_1481122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1481130_1481967_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1481978_1482251_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556515.1|1482269_1482629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046727.1|1483454_1483799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1484042_1485017_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075275108.1|1484993_1485599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556516.1|1485957_1486461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1486555_1486828_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1486839_1487676_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_080664876.1|1487988_1489851_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_081377865.1|1490209_1490494_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556638.1|1491838_1492519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273551.1|1492518_1492821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211974.1|1492920_1494042_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075274847.1|1494324_1495200_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212011.1|1495433_1496555_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_016212013.1|1496776_1497160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|1497175_1497853_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300271.1|1498089_1499064_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300271.1|1499711_1500686_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556517.1|1501083_1501371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1501389_1502226_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1502237_1502510_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274849.1|1502635_1503379_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212348.1|1503373_1504603_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_016211994.1|1506021_1506558_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_032126537.1|1506594_1506780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211991.1|1507020_1507926_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126538.1|1508834_1510253_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_081007034.1|1510517_1510802_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_080728343.1|1510783_1510924_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_016211561.1|1511005_1514872_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_016211564.1|1515037_1515913_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211563.1|1515945_1516107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274852.1|1516317_1516761_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046728.1|1516889_1517864_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	6.8e-28
WP_052047138.1|1518126_1518360_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	1536763	1602976	3138668	tRNA,transposase	Staphylococcus_phage(11.11%)	57	NA	NA
WP_016210106.1|1536763_1537855_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210105.1|1537874_1538195_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210099.1|1538278_1539556_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_017377579.1|1539577_1540414_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210111.1|1540420_1542055_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_016210117.1|1542475_1542835_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210103.1|1543116_1544475_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_081377868.1|1544550_1545207_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211627.1|1545512_1545677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211632.1|1545902_1546757_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211634.1|1546792_1547614_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211631.1|1547869_1548676_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_155049127.1|1548934_1550113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|1550198_1550492_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_075273327.1|1550567_1551143_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1551088_1551454_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556520.1|1551414_1552311_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.8e-54
WP_129556521.1|1552261_1552450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1552983_1553870_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300349.1|1555021_1556746_-	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_032126825.1|1557297_1558611_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_016211481.1|1558843_1559986_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_098082850.1|1560060_1560237_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_032126824.1|1560272_1560932_-	MarC family protein	NA	NA	NA	NA	NA
WP_032126823.1|1561015_1561738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211482.1|1561726_1564000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273804.1|1564135_1564474_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1564433_1564889_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212267.1|1565055_1565415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1565695_1566343_+	LysE family translocator	NA	NA	NA	NA	NA
WP_155046730.1|1566610_1566751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274856.1|1566969_1567995_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211733.1|1569750_1570575_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_016211731.1|1570630_1571737_-	protein kinase	NA	NA	NA	NA	NA
WP_016211734.1|1571752_1572022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1572443_1573142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211398.1|1573746_1574034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211399.1|1574180_1574924_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211403.1|1574937_1575981_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211405.1|1576116_1577889_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_129556522.1|1578095_1579328_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211669.1|1582436_1582787_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211666.1|1582941_1585761_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211664.1|1586133_1586862_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211555.1|1587398_1588757_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_032126677.1|1588831_1589395_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211557.1|1589589_1590819_-	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_016211554.1|1590864_1591491_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_032126678.1|1591817_1592828_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_075274857.1|1592838_1593714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274858.1|1595293_1596379_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1596515_1596881_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1596826_1597402_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1598092_1599067_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1599621_1600683_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1600780_1601755_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_129556523.1|1602090_1602976_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	1631003	1662275	3138668	transposase	uncultured_virus(25.0%)	29	NA	NA
WP_081377870.1|1631003_1631522_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	31.0	1.6e-07
WP_081007030.1|1631557_1632529_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307341.1|1633222_1634821_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_016210848.1|1634987_1636172_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1636467_1637022_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210850.1|1637270_1638524_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210851.1|1638508_1639180_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210847.1|1639202_1640207_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_155049131.1|1640235_1641684_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210855.1|1641801_1642779_+	DMT family transporter	NA	NA	NA	NA	NA
WP_129556525.1|1642932_1643752_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1643828_1644803_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212475.1|1645000_1645207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211182.1|1646191_1646521_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_032126448.1|1646552_1646933_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211178.1|1647023_1648052_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016211180.1|1648114_1648579_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_032126449.1|1648599_1649523_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016211185.1|1649589_1650198_+	smr domain protein	NA	NA	NA	NA	NA
WP_032126450.1|1650310_1652305_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211177.1|1652672_1653893_+	amino acid permease	NA	NA	NA	NA	NA
WP_155046970.1|1655317_1655566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046971.1|1655643_1656189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126783.1|1656299_1657541_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211741.1|1657686_1658463_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211738.1|1658939_1659584_-	membrane protein	NA	NA	NA	NA	NA
WP_032126790.1|1659654_1660560_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1661521_1661860_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1661819_1662275_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	1665855	1731761	3138668	transposase	Staphylococcus_phage(16.67%)	58	NA	NA
WP_054300271.1|1665855_1666830_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556640.1|1667096_1668323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211351.1|1668398_1668737_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_032127067.1|1668733_1669336_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211349.1|1669332_1671327_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211350.1|1671390_1672329_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211352.1|1673007_1673448_+	universal stress protein	NA	NA	NA	NA	NA
WP_075273313.1|1673621_1673960_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1673919_1674375_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210793.1|1674376_1675057_+	OmpW family protein	NA	NA	NA	NA	NA
WP_016210801.1|1675379_1676351_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210795.1|1676332_1677304_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_051307339.1|1677409_1678216_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210791.1|1678590_1678791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210799.1|1679217_1680171_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_129556527.1|1680632_1680893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273540.1|1681077_1681689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210800.1|1682055_1682883_+	DsbA family protein	NA	NA	NA	NA	NA
WP_080750117.1|1683018_1684659_+	APC family permease	NA	NA	NA	NA	NA
WP_052047040.1|1684684_1685623_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1685692_1685950_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556528.1|1686371_1686800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1688323_1688812_-	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_051307365.1|1688831_1689092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211834.1|1689348_1689663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664871.1|1689753_1691376_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.9	1.9e-27
WP_032126362.1|1691807_1692173_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1692118_1692694_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212185.1|1692787_1693777_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1694110_1694296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1694975_1696931_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016210749.1|1697229_1697691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210752.1|1697860_1698658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556641.1|1701034_1702297_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_032126362.1|1706171_1706537_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1706482_1707058_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211454.1|1707198_1707669_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_016211452.1|1708419_1709907_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211455.1|1709968_1711426_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_122942091.1|1711531_1711927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1711954_1712533_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_054300325.1|1713154_1713427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046732.1|1713620_1713791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274862.1|1713905_1714502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1714673_1715267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211728.1|1715654_1717589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1717627_1718542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1720112_1720379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1720455_1721112_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1721286_1721742_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1721701_1722040_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556531.1|1722002_1722200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211752.1|1722404_1723550_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211748.1|1723565_1725170_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211749.1|1725249_1726443_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_032126540.1|1726651_1727515_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212346.1|1727748_1727895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274864.1|1730735_1731761_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	1738545	1794831	3138668	tRNA,transposase,integrase	Acinetobacter_phage(100.0%)	49	1738168:1738227	1783094:1784055
1738168:1738227	attL	TTATAGCGCTGGATTAACAGTTTCTGACATAATATCAGTAGGTTAAAAAATACAATAAGG	NA	NA	NA	NA
WP_075273327.1|1738545_1739121_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212485.1|1739977_1740511_+	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_129556532.1|1740807_1740990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664820.1|1741298_1741469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209620.1|1741451_1744508_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209619.1|1744594_1746043_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209621.1|1746475_1747480_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209617.1|1747600_1747999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209627.1|1748038_1749862_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_033923701.1|1749858_1753161_+	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209616.1|1753191_1754106_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016209618.1|1754176_1754806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|1754850_1755285_-	lipoprotein	NA	NA	NA	NA	NA
WP_016209630.1|1755265_1756006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|1756019_1757417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|1757419_1760368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|1760367_1762089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209636.1|1762103_1762508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209631.1|1762508_1765382_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075273639.1|1765384_1766101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|1766468_1768361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209637.1|1768392_1770930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274867.1|1770961_1772134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209624.1|1772130_1772742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209623.1|1772763_1774263_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209615.1|1774279_1774786_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_155046733.1|1776027_1776165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046734.1|1776309_1776447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377829.1|1777102_1777837_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_129556535.1|1778281_1779167_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1779357_1779615_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377871.1|1779819_1780512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556536.1|1780514_1781668_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155049181.1|1781627_1782137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274873.1|1782641_1783139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1783160_1783526_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1783471_1784047_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274874.1|1784047_1784416_+	hypothetical protein	NA	NA	NA	NA	NA
1783094:1784055	attR	TTATAGCGCTGGATTAACAGTTTCTGACATAATATCAGTAGGTTAAAAAATACAATAAGGAAAAACGATGCCTTCTCCTTACAGTTATGACTTAAGAATTCGAGCACTAAAAATGATTGATGAAGGGATACCTATTACACAAATTTCCAAGCTCTTAAAAATCAGTCGAGACACTCTGCATCGTTGGAAAAATAGGCGTGATCATACAGGAGACGTCAAAGCAAGGTTTGGCTACCAAACGGGCTATAACCATAAAATCAGTGATATGAAAGAATTTCAAAAATTTATTGATCAGAATCCGGGTAAAACTCATCAACAACTCGCTGATCTTTACCCTGTAGAAATGAGTGCAAAAACCATGGGAGTGTGGATTAAAAAATTAGGCTATACCAGAAAAAAAAGAGCTTCAGATACCAAGAACGTGATGCATTAAAGCGGAAAGCTTTCCTGGAAAAAGTCGAGAAAATCGATAACGACAAAATTGTTTATATGGACGAAGCGGGTATGGATGATACTGAGCGTTACGCTTATGGCCACTCTGCTAAAGGTAAACGGTGCTATGCAGAGAAGCCAGGTAAAAAATCAATACGAATTAACTTTATAGGTGGTTTGCGCGGCAAGCAATTTATCGCACCAATGATGGTTGAAGGTTATTGCAATGCTAACGTTTGTCAGGCTTATATCGATCAGTGCTTAATTCCCTGTTTATCTCCTGGAGAGACTGTAATCATGGATAATGCCTCTTTTCACAAATCAAAAGGGGTTAAGGAAGCGATTGAAGATGCGGGTTGTCACTTATTATTTTTACCCCCTTATTCTCCTGATTTAAACCCGATAGAGCATGTATGGTCACCGCTTAAAAATAGGGTTCGCATGAAGCTTGATCAAGATGAAATAAATTTAGAGACAGCGCTTAGTCAAGTAATGAAGTCAATGTCAGAAACTATTCGTTGAGTGCTATA	NA	NA	NA	NA
WP_032126786.1|1784714_1787795_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016211319.1|1787812_1788865_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211316.1|1789397_1790048_+	porin family protein	NA	NA	NA	NA	NA
WP_016211315.1|1790382_1791027_+	porin family protein	NA	NA	NA	NA	NA
WP_054300314.1|1791214_1791550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273532.1|1791510_1792098_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126997.1|1792315_1792555_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_032126998.1|1792876_1793224_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_036774554.1|1793322_1793601_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1793653_1793941_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1793944_1794831_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	1814742	1992709	3138668	integrase,transposase,protease,tRNA	Leptospira_phage(15.79%)	167	1874656:1874715	1942507:1943392
WP_054300307.1|1814742_1815471_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_129556539.1|1815539_1815884_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211983.1|1816131_1816791_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556643.1|1816886_1818251_+	histidine kinase	NA	NA	NA	NA	NA
WP_016212551.1|1818708_1819203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|1819544_1820120_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1820065_1820356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1820369_1820945_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1820890_1821256_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211946.1|1822476_1823232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556540.1|1823450_1823846_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211947.1|1823838_1824984_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_075274878.1|1825386_1826262_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212202.1|1826673_1827921_+	glutaminase	NA	NA	NA	NA	NA
WP_016209473.1|1828882_1829266_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_016209489.1|1829262_1829994_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_016209497.1|1829996_1830740_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_016209492.1|1830753_1831653_-	GTPase Era	NA	NA	NA	NA	NA
WP_016209466.1|1831658_1832333_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	34.5	8.9e-27
WP_129556644.1|1832738_1833626_-	signal peptidase I	NA	NA	NA	NA	NA
WP_016209482.1|1833676_1835479_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	39.2	5.1e-21
WP_016209457.1|1835778_1836360_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_016209458.1|1836503_1838078_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_129556541.1|1838085_1838400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209486.1|1838524_1838776_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_080664819.1|1838817_1839855_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_016209471.1|1840001_1840328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209462.1|1840337_1840481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209474.1|1840490_1840901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664818.1|1841042_1841378_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016209494.1|1842059_1844084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069172.1|1844153_1845179_-	FUSC family protein	NA	NA	NA	NA	NA
WP_016209455.1|1845171_1846218_-	membrane protein	NA	NA	NA	NA	NA
WP_075273528.1|1846398_1847364_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_016209459.1|1847623_1848790_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016209478.1|1848953_1849907_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_129556645.1|1849998_1851948_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_016209490.1|1852038_1852362_-	YqcC family protein	NA	NA	NA	NA	NA
WP_016209463.1|1852788_1853172_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032126730.1|1853526_1854015_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_016209472.1|1854117_1855488_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_016209456.1|1855601_1856333_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	M1IDP9	Pelagibacter_phage	35.8	5.3e-09
WP_016209491.1|1856357_1857455_-	alanine racemase	NA	NA	NA	NA	NA
WP_016209475.1|1857487_1858909_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	1.7e-152
WP_016209484.1|1859118_1859571_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|1859582_1859810_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_016209481.1|1859859_1860186_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_052047096.1|1860388_1861078_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016209488.1|1861227_1861716_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_129556542.1|1861756_1862860_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_016209460.1|1862903_1863986_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.1	1.0e-72
WP_052133284.1|1863975_1864542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126728.1|1864532_1865837_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209485.1|1865889_1866912_-	chorismate mutase	NA	NA	NA	NA	NA
WP_080664817.1|1866936_1867710_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209496.1|1867739_1867952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209453.1|1868119_1868269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556543.1|1868378_1868861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1868952_1869225_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377873.1|1869236_1870073_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.6e-41
WP_016212058.1|1870715_1872266_-	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_075274880.1|1872421_1873387_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1874382_1874655_+|transposase	transposase	transposase	NA	NA	NA	NA
1874656:1874715	attL	AGGATAAACGAATGCTCGCTACTTACCTCAAAGATGAACATAAGCTAAGCCTCGTGGTTG	NA	NA	NA	NA
WP_033923779.1|1874666_1875503_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_098082828.1|1876000_1876258_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1876257_1877265_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212247.1|1877631_1878387_+	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1879014_1879989_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300162.1|1880328_1881411_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212246.1|1881514_1882171_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_075274882.1|1883106_1883703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556544.1|1883817_1884174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1884236_1885319_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210771.1|1885410_1888812_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_016210773.1|1888808_1891502_-	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210769.1|1891805_1893308_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_033923762.1|1893608_1893842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1893969_1894779_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_016210772.1|1894862_1896416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1896548_1896848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|1896837_1897002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|1897058_1897424_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210397.1|1897613_1899788_+	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210388.1|1899784_1900459_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210399.1|1900484_1902476_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210390.1|1902490_1902832_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_032126670.1|1902836_1903274_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210394.1|1903299_1904685_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_122940572.1|1904795_1905221_-	flaG family protein	NA	NA	NA	NA	NA
WP_032126669.1|1905339_1906917_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210398.1|1907141_1908734_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210393.1|1908934_1911136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210391.1|1911229_1912180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210396.1|1912247_1912436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211164.1|1912573_1912951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1912993_1913509_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211169.1|1913508_1914456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211168.1|1914439_1915099_-	wbqC-like family protein	NA	NA	NA	NA	NA
WP_016211165.1|1915095_1915824_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307350.1|1915813_1916560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664856.1|1916543_1917608_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_016211172.1|1917796_1918993_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211167.1|1919042_1920164_-	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	1.5e-10
WP_016211170.1|1920795_1920966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126750.1|1921124_1921922_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_054300295.1|1922202_1922427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556646.1|1923237_1924623_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_016211278.1|1924674_1925934_-	threonine synthase	NA	NA	NA	NA	NA
WP_016211277.1|1925920_1926889_-	homoserine kinase	NA	NA	NA	NA	NA
WP_016211279.1|1926902_1929371_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_075274886.1|1930114_1931176_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274888.1|1931447_1931783_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081007004.1|1931787_1932243_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1932202_1932541_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|1932698_1932863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1932852_1933152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212209.1|1933607_1934609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556545.1|1934863_1935205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274890.1|1935409_1936090_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_098082828.1|1936159_1936417_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377874.1|1936585_1937053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049141.1|1937513_1938699_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.6e-58
WP_129556547.1|1939125_1939686_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_054300287.1|1940094_1940424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1940445_1940811_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1940756_1941332_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274733.1|1941350_1941668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1941718_1942555_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1942566_1942839_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211421.1|1943697_1943922_-	hypothetical protein	NA	NA	NA	NA	NA
1942507:1943392	attR	CAACCACGAGGCTTAGCTTATGTTCATCTTTGAGGTAAGTAGCGAGCATTCGTTTATCCTCTATATCGGTAGCTTTTTTTCCACAACATCTTTCAAAGCCTCAATTTCTATTTGAGAATCAGCATACATTCTCTTAAGTTGCTGGTTCTCTTTCTCTAATTGTTTTAGCCTTTTTAGCTGAGAGATATCCATTGCCCCATAACGTTCTTTTAAGGTGTAATACGTGCTAGTTGAGATTCCGTAGTCTCTTGCTGTGGTTTCTATATCTGCTCCAGCCTCAACACGCTTAAGCAACTCTACGATTTTTGATTCACTTAATTTGCTCTTTTTCATATGCTCTCCTGTTTGAAAATGTTAACAGAAGATTCCAGTTATGAGTTGTCTCATTTTAAGGGAGGGTTACCACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGGTTGAGGCGTTTATTGAGCGATTGACACAACATATACCAGAAAAGTTTTTCAAAATGATACGGTATTACGGCTTTTTAGCGAATCGAGTCAGAAAAACCTTGTTACCAAAAGTCTATGATTTATTAGATCAGACCATTGAAGCTGCTCAGTCTGTTACCTATTCCAGCCTGATGAAAGCCAATTATGCAGTAGATCCTCTCATTTGCATACTTTGTGGCAGTGAAATGAGACTCTCTGGATTCACAAACTCAACCCCTTTATGGCAGTTGCGTCAACATCATGAAAAGCTTGCGAAGATGAAGGAGGTCCGGCTTTAAT	NA	NA	NA	NA
WP_032126790.1|1944018_1944924_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016210013.1|1945109_1946777_-	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_122941582.1|1946933_1947917_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_122941592.1|1948011_1948863_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_016210019.1|1949120_1950155_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_032126616.1|1950219_1950579_-	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210007.1|1950634_1951207_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210023.1|1951184_1953242_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210021.1|1953238_1954564_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210004.1|1954824_1955466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1955665_1956421_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210027.1|1956810_1957407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210005.1|1957486_1960291_+	response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	2.4e-57
WP_016210012.1|1960271_1960943_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210009.1|1961018_1961225_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_016210025.1|1961217_1962588_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210020.1|1962852_1963008_-	putative membrane protein	NA	NA	NA	NA	NA
WP_155053573.1|1963596_1964568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273518.1|1964734_1965028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210017.1|1965103_1965487_-	hpt domain protein	NA	NA	NA	NA	NA
WP_016210010.1|1965662_1965839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556549.1|1968508_1969395_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210524.1|1969933_1970464_-	exsB family protein	NA	NA	NA	NA	NA
WP_016210522.1|1970474_1971527_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210518.1|1971542_1973582_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210525.1|1973568_1974387_-	ZipA protein	NA	NA	NA	NA	NA
WP_032126504.1|1974453_1977993_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210517.1|1978106_1978826_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_016210521.1|1979839_1981777_+	his Kinase A domain protein	NA	NA	NA	NA	NA
WP_016210519.1|1982012_1982780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|1982769_1983114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274897.1|1983626_1984493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1984733_1985099_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155069173.1|1985772_1986321_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155069174.1|1987508_1988969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209448.1|1989410_1990742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209432.1|1990999_1992709_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 24
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	2025222	2077388	3138668	tRNA,protease,transposase	Orpheovirus(18.18%)	52	NA	NA
WP_016209424.1|2025222_2026500_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209433.1|2026599_2026974_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209412.1|2027058_2027946_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209436.1|2028003_2028732_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_129556555.1|2028728_2029859_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209444.1|2029989_2030418_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_032126508.1|2030512_2030872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209447.1|2030861_2032073_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016209421.1|2032069_2032858_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209411.1|2033020_2033815_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_054300271.1|2034020_2034995_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046761.1|2035421_2035595_+	phosphatase	NA	NA	NA	NA	NA
WP_075274901.1|2035739_2036753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2036756_2037056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2037045_2037210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2037266_2037632_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211553.1|2037971_2038712_-	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_016211549.1|2038715_2041220_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211548.1|2041482_2042439_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211550.1|2042422_2043184_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_075274903.1|2043261_2044137_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2044261_2044507_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016211262.1|2044566_2046840_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_075273504.1|2046894_2047248_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|2047437_2047731_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_032126515.1|2047903_2048083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307354.1|2048158_2048734_-	DedA family protein	NA	NA	NA	NA	NA
WP_032126514.1|2049016_2050333_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2050343_2050712_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016211265.1|2050742_2051405_-	adenylate kinase	NA	NA	NA	NA	NA
WP_032126362.1|2051579_2051945_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556556.1|2051890_2052466_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126519.1|2052633_2053353_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_016211478.1|2053332_2054148_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126518.1|2054164_2056366_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211474.1|2056448_2057798_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_016211473.1|2057872_2058472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211476.1|2058455_2058665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211931.1|2058982_2060170_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211932.1|2060365_2061655_+	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_054300152.1|2062065_2062431_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210558.1|2064067_2064823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210562.1|2064896_2066549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300273.1|2066577_2068116_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.2	5.1e-70
WP_016210560.1|2068115_2069816_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_081007068.1|2069904_2071080_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_016210559.1|2071118_2072081_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_016210566.1|2072441_2072864_-	universal stress protein	NA	NA	NA	NA	NA
WP_016210568.1|2073169_2073811_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210561.1|2073938_2075273_+	dihydroorotase	NA	NA	NA	NA	NA
WP_032126397.1|2075387_2075978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2076326_2077388_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	2085232	2129938	3138668	tRNA,transposase	Staphylococcus_phage(22.22%)	47	NA	NA
WP_129556558.1|2085232_2086126_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126170.1|2086289_2086562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211040.1|2086789_2088001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211037.1|2088351_2088981_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211042.1|2089029_2090046_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211035.1|2090292_2090508_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211043.1|2090560_2091010_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211039.1|2091089_2092835_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211036.1|2092926_2094798_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_054300271.1|2095145_2096120_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211094.1|2096139_2096463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|2097527_2100008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211092.1|2100051_2101344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307348.1|2101579_2104336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211519.1|2105491_2105911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|2105911_2106613_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|2106873_2107080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|2107309_2107615_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|2107793_2109791_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2109774_2110821_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|2111528_2112380_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|2112380_2113301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|2113711_2113996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377876.1|2113987_2114443_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2114402_2114741_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2114953_2115883_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2116039_2116468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556560.1|2116548_2117085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2117054_2117960_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2118150_2118759_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_081007013.1|2118799_2119099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2119088_2119253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274909.1|2119636_2119963_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2120061_2120637_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2120582_2120948_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556499.1|2121118_2122271_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211971.1|2122477_2123089_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2123109_2124306_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2124402_2124543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2124555_2124960_-	SufE family protein	NA	NA	NA	NA	NA
WP_075273313.1|2125085_2125424_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556562.1|2125383_2125686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|2125830_2126016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|2126585_2127167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556649.1|2127194_2128052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|2128591_2129119_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_075273327.1|2129362_2129938_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	2151137	2200885	3138668	tRNA,protease,transposase	Staphylococcus_phage(33.33%)	48	NA	NA
WP_016209884.1|2151137_2151761_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2151837_2152038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2152179_2152878_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2153024_2153594_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2153908_2154532_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2154740_2155343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|2155414_2155780_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046744.1|2155836_2156010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556564.1|2157179_2157509_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273603.1|2158665_2158842_+	phosphatase	NA	NA	NA	NA	NA
WP_129556565.1|2158965_2159361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126686.1|2160830_2161415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274914.1|2161965_2162841_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_059372565.1|2162889_2163261_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556566.1|2163169_2163373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210465.1|2163880_2164723_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2164773_2165121_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2165311_2166199_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2166313_2166916_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2166912_2167632_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_075275113.1|2167700_2169410_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_016210464.1|2169560_2171498_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2171606_2172659_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2172658_2172934_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2173014_2173563_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210459.1|2176637_2177156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212492.1|2177360_2178215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049145.1|2178264_2179239_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_033923740.1|2179297_2179585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069175.1|2179832_2180648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069176.1|2180622_2180757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211716.1|2180770_2181694_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126595.1|2181641_2182298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|2182600_2183428_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_052133280.1|2183868_2184240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126590.1|2184432_2185965_+	nuclease	NA	NA	NA	NA	NA
WP_032126591.1|2186027_2187365_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_016210313.1|2187507_2188974_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210314.1|2188970_2190020_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_016210306.1|2190143_2192252_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|2192416_2192821_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2192881_2193607_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210307.1|2193692_2194583_+	YicC family protein	NA	NA	NA	NA	NA
WP_032126592.1|2194623_2195244_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.3	2.5e-20
WP_016210310.1|2195304_2195511_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_016210316.1|2195532_2197686_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.1e-12
WP_016210317.1|2197692_2199675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2199910_2200885_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 27
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	2207614	2253537	3138668	transposase	Staphylococcus_phage(50.0%)	52	NA	NA
WP_075274916.1|2207614_2208676_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212177.1|2209671_2209845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2209921_2210179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2210291_2210867_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2210812_2211178_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2212212_2212788_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274918.1|2212733_2213099_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212205.1|2213782_2213962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|2214101_2215547_+	MFS transporter	NA	NA	NA	NA	NA
WP_016212319.1|2216105_2216333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2216319_2216646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2216647_2217079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|2217607_2218669_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210831.1|2218763_2219309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2219578_2220598_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2220584_2221007_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2221008_2221482_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|2221597_2222221_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|2222250_2222925_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2222930_2224079_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2224075_2224537_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2224612_2225863_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2225989_2227669_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2227778_2228645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274920.1|2230075_2230810_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	4.8e-10
WP_016211000.1|2230905_2231691_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2231834_2232521_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2232554_2232953_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2233116_2233422_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|2233499_2233754_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2233907_2235569_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2235628_2236312_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2236311_2237400_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2237448_2240085_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300237.1|2240497_2241559_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556568.1|2241748_2243230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2243266_2243842_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|2243787_2244078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2244091_2244667_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2244612_2244978_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212450.1|2245133_2246036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2246079_2247054_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211507.1|2247367_2248687_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|2248690_2249407_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|2249403_2250045_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_075274921.1|2250037_2250136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274922.1|2250113_2250410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211503.1|2250420_2250876_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|2250930_2251275_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2251304_2252348_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|2252762_2252972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2252961_2253537_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	2322740	2382351	3138668	tRNA,transposase	Planktothrix_phage(16.67%)	57	NA	NA
WP_129556571.1|2322740_2323451_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2323479_2323884_+	RidA family protein	NA	NA	NA	NA	NA
WP_016209567.1|2324999_2325617_-	MFS transporter	NA	NA	NA	NA	NA
WP_155046949.1|2325687_2325858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126712.1|2326051_2326510_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2327254_2328265_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2328749_2329661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2329986_2333481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2333518_2334358_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_016209564.1|2334544_2334760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2334808_2335384_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2335380_2335719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2335887_2336877_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2336877_2337840_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_016209559.1|2337849_2338752_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300271.1|2338795_2339770_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2339907_2340141_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2340234_2340600_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2340656_2340821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2340810_2341110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212572.1|2341167_2341560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2341689_2342055_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2342111_2342420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2342511_2343087_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2343032_2343398_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|2343550_2343823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212514.1|2344233_2344371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2344389_2345226_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2345237_2345510_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126774.1|2345665_2346001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2346160_2347693_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2347725_2348565_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2348561_2349059_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211412.1|2349062_2350055_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211408.1|2350169_2351516_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2351739_2352801_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2352879_2354025_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|2360124_2360982_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2360968_2361892_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211368.1|2362088_2363480_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2363526_2364570_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2364612_2365056_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2365188_2366379_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2366433_2366580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|2367131_2368049_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2368316_2368610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2368686_2368881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212197.1|2369899_2370817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2371282_2372125_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2372192_2372843_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|2372857_2373898_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|2374020_2375106_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2375132_2376242_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2376258_2376576_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2376572_2376932_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_080664847.1|2380263_2381217_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_075274927.1|2381289_2382351_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	2420336	2483964	3138668	tRNA,transposase	Staphylococcus_phage(37.5%)	60	NA	NA
WP_036771330.1|2420336_2421311_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_129556574.1|2421607_2421961_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211760.1|2422013_2423393_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211761.1|2423499_2425491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274928.1|2425906_2426881_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	5.2e-28
WP_016209674.1|2427110_2427944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126406.1|2428127_2429606_-	nuclease	NA	NA	NA	NA	NA
WP_155049159.1|2430046_2431843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209671.1|2431925_2432153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556575.1|2432220_2433189_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_032126407.1|2433164_2433575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209685.1|2433579_2433915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556656.1|2433916_2434444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556657.1|2434929_2435370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209678.1|2435471_2438690_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_129556576.1|2438729_2439584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209670.1|2439552_2442561_-	ATPase AAA	NA	NA	NA	NA	NA
WP_032126408.1|2442563_2442989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209688.1|2443020_2443602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209684.1|2443601_2444645_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_016209692.1|2444647_2445127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047060.1|2445135_2447439_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_032126410.1|2447467_2447707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209677.1|2447727_2448834_-	type II/IV secretion system family protein	NA	NA	NA	NA	NA
WP_016209693.1|2448826_2449573_-	type IV secretion system protein DotC	NA	NA	NA	NA	NA
WP_016209695.1|2449565_2450069_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_032126411.1|2450132_2450567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209680.1|2450581_2451619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209681.1|2451634_2452615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556659.1|2452620_2453766_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209676.1|2453822_2454662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209672.1|2455175_2455601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209690.1|2455703_2458391_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_016211689.1|2458977_2460117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211690.1|2460192_2462349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556660.1|2462634_2463387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211688.1|2463572_2463791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211600.1|2463939_2464458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211601.1|2464793_2465216_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	37.3	1.1e-22
WP_016211597.1|2465521_2466892_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.8	2.6e-110
WP_016211595.1|2467249_2467717_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211599.1|2467729_2468740_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_080664865.1|2468935_2469412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2469408_2470245_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2470256_2470529_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211743.1|2470595_2470958_-	ABC transporter membrane domain protein	NA	NA	NA	NA	NA
WP_129556577.1|2470944_2471973_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	4.8e-16
WP_016211744.1|2471950_2472355_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_016211742.1|2472585_2474565_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054300202.1|2474844_2475573_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|2475662_2476274_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016210955.1|2476630_2476885_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2476983_2478768_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_016210956.1|2478856_2479576_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|2479758_2479965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210948.1|2479964_2480201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2480213_2480591_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2481097_2481916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210947.1|2482009_2482207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|2483235_2483964_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
>prophage 30
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	2487599	2595435	3138668	integrase,transposase,protease,tRNA	Escherichia_phage(34.15%)	102	2570294:2570353	2578535:2578822
WP_075274931.1|2487599_2488328_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_032126570.1|2489084_2489384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211816.1|2489396_2489750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2489791_2491405_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2491626_2491848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274933.1|2492156_2492885_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2493501_2494599_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2494632_2495883_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_075274934.1|2496370_2497039_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.0	2.8e-41
WP_016212193.1|2497161_2497500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2497567_2497954_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2497950_2498196_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300202.1|2498604_2499333_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211625.1|2499816_2500686_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_016211621.1|2500682_2502032_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	4.6e-75
WP_016211623.1|2502144_2503785_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_016211987.1|2505606_2507343_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_054300202.1|2507846_2508575_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_098082825.1|2508638_2508947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2508939_2509272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2509275_2509845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211655.1|2509973_2510387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211652.1|2510646_2511852_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211653.1|2511959_2512985_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_054300202.1|2513076_2513805_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_033923779.1|2514017_2514854_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2514865_2515138_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049161.1|2515188_2515698_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036780855.1|2515672_2516170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|2516935_2517664_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155049878.1|2517706_2518282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211047.1|2518360_2519995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2520356_2520860_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2520822_2521530_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2521598_2522459_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_016211045.1|2522439_2523213_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2523243_2524497_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2524496_2525459_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2525502_2526255_+	ComF family protein	NA	NA	NA	NA	NA
WP_016210615.1|2528630_2529101_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2529146_2529386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274938.1|2529404_2529911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2530074_2531499_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|2531563_2532613_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2532879_2533659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2533702_2534605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210625.1|2534663_2535410_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_016210616.1|2535658_2538469_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_129556661.1|2538769_2539333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2539321_2540050_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2540139_2540346_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212263.1|2540508_2541102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212264.1|2541147_2541741_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	5.4e-28
WP_016212238.1|2542256_2543546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274939.1|2543575_2544304_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.8e-42
WP_087910645.1|2544416_2545569_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274940.1|2545597_2546278_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	2.0e-42
WP_016211997.1|2546633_2547743_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.5	4.4e-07
WP_016211996.1|2547744_2548692_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_075274941.1|2549075_2549804_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.2e-42
WP_075275114.1|2549833_2550196_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212339.1|2550348_2551095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274942.1|2551113_2551842_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	2.7e-45
WP_032127022.1|2552518_2554705_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2554766_2555920_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2556205_2556730_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|2556920_2557088_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|2557032_2557749_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
WP_032126817.1|2558105_2558927_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211722.1|2558936_2562239_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_016211321.1|2562619_2563780_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211323.1|2563953_2565051_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211325.1|2565040_2566561_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211322.1|2566623_2567214_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211324.1|2567749_2568304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066186.1|2569061_2569541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274945.1|2569685_2570036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|2570260_2570410_+	hypothetical protein	NA	NA	NA	NA	NA
2570294:2570353	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_016212659.1|2570554_2570800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046748.1|2570887_2571193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212294.1|2571544_2571889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274946.1|2571902_2572346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|2572567_2572792_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_016212230.1|2572847_2574296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2575829_2576018_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556589.1|2577419_2577695_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2577697_2578300_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_155046749.1|2578363_2578651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|2579195_2580275_+	hypothetical protein	NA	NA	NA	NA	NA
2578535:2578822	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_016211874.1|2580593_2582312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2582355_2583261_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046750.1|2584505_2584643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2585829_2586405_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_016210050.1|2586480_2587356_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210054.1|2587420_2587942_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210069.1|2587926_2589009_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.6e-20
WP_016210051.1|2589249_2589654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2590078_2590810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2591066_2592368_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2592509_2593178_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2593621_2594218_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2594238_2595435_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
>prophage 31
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	2624075	2658529	3138668	tRNA,transposase	Microbacterium_phage(20.0%)	38	NA	NA
WP_054300282.1|2624075_2624540_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377880.1|2624596_2625076_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2625933_2626329_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|2626325_2627120_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211756.1|2627298_2628024_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2628269_2629457_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_081377344.1|2629811_2630939_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210935.1|2631269_2631812_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2631808_2632495_-	acireductone synthase	NA	NA	NA	NA	NA
WP_016210942.1|2632498_2633110_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2633156_2634176_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2634277_2635072_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2635109_2635916_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2635994_2637044_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2637241_2638501_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2638547_2639225_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2639310_2639592_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|2639683_2640871_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_129556549.1|2640978_2641865_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210820.1|2642066_2643008_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2643511_2643736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2644027_2644732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|2645195_2645834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2646168_2646699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779158.1|2646695_2648228_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2648224_2649175_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2649594_2650227_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2650469_2650667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2651016_2651445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307340.1|2651522_2652221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274949.1|2652198_2653260_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2653484_2653781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|2653885_2654542_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2654765_2655263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377881.1|2656179_2656347_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377882.1|2656353_2656635_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2656594_2656933_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210986.1|2656990_2658529_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	1.3e-86
>prophage 32
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	2716226	2799833	3138668	tRNA,transposase,protease	unidentified_phage(21.43%)	81	NA	NA
WP_075273298.1|2716226_2716802_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923659.1|2716939_2717548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307321.1|2717610_2718159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209980.1|2718245_2719412_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.7e-25
WP_032126286.1|2719717_2722516_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	4.9e-180
WP_016209981.1|2722574_2723795_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	8.5e-36
WP_016209998.1|2723824_2724226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209994.1|2724892_2725180_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_016209985.1|2725336_2725675_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_016209995.1|2725709_2727347_-	response regulator	NA	NA	NA	NA	NA
WP_016209992.1|2727448_2728498_+	WD domain, G-beta repeat family protein	NA	NA	NA	NA	NA
WP_016209988.1|2728570_2729215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556662.1|2729211_2730459_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_016209986.1|2730464_2731754_-	ubiquinone biosynthesis hydroxylase UbiH/UbiF/VisC/COQ6 family protein	NA	NA	NA	NA	NA
WP_016209989.1|2731778_2732369_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_016209996.1|2732513_2732738_+	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_016209991.1|2732718_2733048_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_033923658.1|2733273_2733837_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209997.1|2733871_2734333_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_016209977.1|2734409_2736095_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_032126288.1|2736144_2736945_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_016210000.1|2736971_2737520_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_016209993.1|2737649_2738042_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016209990.1|2738098_2738503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556594.1|2738535_2739303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2739768_2740830_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2740920_2741667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274953.1|2741791_2742655_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2742898_2743261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377902.1|2743447_2743975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2744119_2744536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2746307_2747219_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2747270_2748119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2748563_2749274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2749365_2750334_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2750321_2750969_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_016210370.1|2750997_2751849_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2751863_2753141_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2753181_2753697_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210372.1|2753775_2754837_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2754858_2755947_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_016210378.1|2755991_2757827_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2757869_2758340_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2758376_2758712_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2758724_2759441_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2759377_2760394_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2760390_2760870_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2760953_2763434_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2763496_2763862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273456.1|2764239_2764539_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2764498_2764954_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2764968_2765259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210570.1|2765324_2766923_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2767053_2767389_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_016210578.1|2767416_2769081_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	7.1e-33
WP_016210581.1|2769077_2769722_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2769721_2770465_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2770523_2770763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2770913_2772281_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126278.1|2773211_2774195_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2774316_2776074_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2776296_2776887_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2776974_2777394_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_016210580.1|2777534_2777795_+	methyltransferase	NA	NA	NA	NA	NA
WP_075274955.1|2777870_2778845_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_075274956.1|2778887_2779256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2779316_2780102_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075274955.1|2781487_2782462_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212084.1|2782743_2783760_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2783759_2784275_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2784316_2784790_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_052133268.1|2784947_2785229_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	40.2	3.1e-10
WP_129556741.1|2785250_2785922_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.4	3.4e-10
WP_016212306.1|2785957_2786488_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2786517_2786973_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_129556598.1|2789522_2792036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211935.1|2792970_2795619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274958.1|2796067_2797129_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2797155_2797731_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2797676_2798042_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556599.1|2798680_2799833_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 33
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	2912395	2956741	3138668	transposase,protease	Acanthamoeba_polyphaga_lentillevirus(14.29%)	43	NA	NA
WP_016209259.1|2912395_2913244_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_016209274.1|2913360_2914272_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_075274963.1|2914990_2916052_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212454.1|2916271_2916952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211192.1|2917740_2919099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211189.1|2919143_2919602_-	NfeD family protein	NA	NA	NA	NA	NA
WP_016211187.1|2919626_2920547_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_016211186.1|2920673_2921456_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.3	8.2e-32
WP_016211190.1|2921545_2923045_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_016211188.1|2923366_2925250_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_075273298.1|2925323_2925899_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2925844_2926210_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211157.1|2926774_2927431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211161.1|2927538_2928648_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2928659_2929304_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2929322_2930309_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2930388_2931465_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2931667_2932492_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2932808_2933813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2934021_2934987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274965.1|2935125_2936001_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2936297_2937350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2937617_2938046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2938259_2938751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2938806_2940057_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2940159_2940378_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_052104629.1|2940820_2941846_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080728341.1|2942295_2942466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212561.1|2942437_2942578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210728.1|2943492_2943963_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2944251_2945631_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2945658_2946117_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2946094_2947312_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2947503_2947740_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2947753_2947909_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2947989_2948952_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2949111_2950428_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2950437_2951106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2951468_2953283_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_081007013.1|2953703_2954003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2953992_2954157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2954213_2954579_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052104629.1|2955715_2956741_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	2989763	3052950	3138668	tRNA,transposase	Acinetobacter_phage(50.0%)	55	NA	NA
WP_054300164.1|2989763_2990783_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556602.1|2991181_2991391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274966.1|2993382_2994444_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|2994524_2994833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|2994947_2996264_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664857.1|2996725_2998012_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|2998084_2998981_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|2999067_3000066_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|3000174_3000699_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|3000946_3002185_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|3002732_3003206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|3003202_3003598_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3004527_3005103_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3005048_3005414_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211610.1|3005678_3008009_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_129556603.1|3008129_3010145_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075274967.1|3010328_3013721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3013785_3014091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274968.1|3014260_3015361_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|3015755_3016865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209721.1|3017803_3019201_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.3e-77
WP_051307313.1|3019320_3020268_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3020264_3020780_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3020766_3021966_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3021962_3022286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3022287_3023517_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3023516_3024560_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3024559_3025243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3025239_3027729_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3027745_3028000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3028000_3028357_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3029136_3030300_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3030319_3033427_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3033428_3034934_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3034961_3035243_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3035391_3035733_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3035852_3037733_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3037817_3039416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3039433_3040549_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3040676_3041675_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|3041678_3042437_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3042438_3043638_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3043621_3044293_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3044314_3045091_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3045094_3046093_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3046094_3046673_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3046669_3048139_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3048182_3048470_-	trp operon repressor	NA	NA	NA	NA	NA
WP_016209699.1|3048670_3049267_+	DMT family transporter	NA	NA	NA	NA	NA
WP_075274970.1|3049476_3049947_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3050003_3050159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274971.1|3050303_3050756_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3050941_3051163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|3051278_3051911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274972.1|3051888_3052950_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP038972	Piscirickettsia salmonis strain Psal-069 chromosome, complete genome	3138668	3059805	3108620	3138668	tRNA,transposase	Staphylococcus_phage(42.86%)	51	NA	NA
WP_016211231.1|3059805_3060756_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3060755_3062834_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3062981_3063497_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3063505_3064069_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3064049_3064796_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3064935_3065388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3065811_3066648_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3066644_3067541_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3067573_3068641_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3068659_3069028_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3069053_3070502_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3070511_3071891_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3071931_3073263_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3073234_3074194_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3074286_3074790_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3074924_3076076_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3076072_3076552_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3076698_3079020_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3078964_3079591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3079595_3080495_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3080567_3081146_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3081446_3081704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556611.1|3081712_3082866_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046758.1|3084002_3084134_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3084278_3084434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212051.1|3084761_3085535_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126148.1|3086076_3086259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3086862_3087837_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3088931_3089270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212337.1|3089286_3089997_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_016212336.1|3089984_3090179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|3090337_3090637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3090626_3090791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3090847_3091213_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3092517_3093213_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3093209_3094637_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3094662_3094926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3095286_3096261_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556612.1|3096319_3097170_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3097207_3097552_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3097548_3098385_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3098385_3098727_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3098728_3099334_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3099330_3101325_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3101344_3102286_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211292.1|3102513_3103938_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3104450_3105425_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3105483_3106140_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126480.1|3106186_3106870_-	methyltransferase	NA	NA	NA	NA	NA
WP_080664873.1|3107415_3107730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556613.1|3107624_3108620_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038973	Piscirickettsia salmonis strain Psal-069 plasmid unnamed1, complete sequence	158592	2892	100910	158592	transposase,capsid,head,tail,integrase	Streptococcus_phage(26.67%)	112	NA	NA
WP_054300202.1|2892_3621_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155049199.1|3589_3835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047019.1|4324_4477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273751.1|4489_6220_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300477.1|6379_7108_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	7.1e-38
WP_155047020.1|7264_8188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275154.1|8428_9085_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.7	7.6e-31
WP_054300202.1|9214_9943_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155049201.1|10187_10808_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_054300202.1|10855_11584_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126843.1|11887_12067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126844.1|12285_12582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212118.1|12676_13138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|15300_16275_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556704.1|16768_17098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|17600_18437_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|18448_18721_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212122.1|19208_19910_+	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_016212121.1|19863_20787_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_032126205.1|21220_21586_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556705.1|21531_22032_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	28.0	9.9e-07
WP_036771330.1|22090_23065_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_054300162.1|23577_24660_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212151.1|25024_25987_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|26010_26325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923686.1|26381_27431_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|27539_28580_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|28593_29223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|29313_29613_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211886.1|29609_30038_-	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_054300202.1|30826_31555_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126832.1|31799_32708_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_054300202.1|32818_33547_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046765.1|33658_33853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|34739_35468_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|35671_38248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|38653_39628_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075274931.1|39828_40557_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.4e-38
WP_016212137.1|41000_42062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212139.1|42137_42383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307371.1|42354_42969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|43786_44761_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_155069177.1|45120_45462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069178.1|45606_45843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|47056_48210_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126239.1|48354_48627_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|48638_49475_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075275144.1|49507_50239_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|50336_50750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212017.1|51044_51443_+	hypothetical protein	NA	W8VUR5	Pseudomonas_phage	38.8	2.3e-06
WP_047927838.1|51472_51718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|51714_52014_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016212019.1|52170_52866_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_081377351.1|53679_54459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|54542_54695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|54647_54980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|55144_55522_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|55828_56212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|56681_57410_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_129556708.1|57525_57861_-	mRNA-degrading endonuclease	NA	A9D9Y1	Lactobacillus_prophage	35.6	2.6e-11
WP_016212365.1|57853_58096_-	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_054300271.1|58304_59279_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075275142.1|59914_60643_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_075275141.1|60925_62611_+	protein kinase	NA	NA	NA	NA	NA
WP_129556709.1|62822_62912_+	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_129556710.1|62992_63463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275140.1|63616_64351_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.1e-38
WP_075275139.1|64977_65208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212404.1|65822_66056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126756.1|66176_66620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275138.1|66764_67073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047124.1|67277_68939_+	AAA family ATPase	NA	A0A0K2FLP8	Brevibacillus_phage	31.5	9.1e-65
WP_016212457.1|68948_69350_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_016212456.1|69346_69634_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_075275137.1|69677_70091_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126239.1|70146_70419_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|70430_71267_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_016212579.1|72197_72395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|73900_74101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|74111_74687_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|74632_74998_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|75829_77872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|78776_79142_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|79087_79663_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_081377872.1|79676_79967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|79912_80488_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075274752.1|80484_80784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|80819_81973_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_052047048.1|82153_82654_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|82653_82815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211937.1|83084_83474_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211936.1|83963_84986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211938.1|85480_86041_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275133.1|86612_86921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|87453_88607_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273327.1|88855_89431_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075275128.1|89376_89742_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556696.1|89841_90858_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.0	3.0e-18
WP_052133287.1|90959_91358_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556716.1|91491_91782_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_016210655.1|91795_92392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210663.1|92710_93022_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210667.1|93018_93342_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210658.1|93334_93730_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210651.1|93726_94077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210664.1|94076_94499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210669.1|94500_94824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|94880_95147_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075273774.1|97348_98506_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275128.1|98647_99013_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|98958_99534_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126790.1|100004_100910_+|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
>prophage 2
NZ_CP038973	Piscirickettsia salmonis strain Psal-069 plasmid unnamed1, complete sequence	158592	105582	151886	158592	transposase,protease,integrase	Streptococcus_phage(18.18%)	60	114022:114081	137793:138764
WP_075273327.1|105582_106158_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126360.1|106364_107099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|107221_108280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|108788_109535_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|109535_109940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|110333_111149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|111753_112482_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212298.1|112923_113250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|113490_113967_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
114022:114081	attL	TGATCAGGCTACCCTATTCCGGACAAATAAATTACAATAATCCGAGCCGGAGGAATCACA	NA	NA	NA	NA
WP_075275158.1|114081_114375_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377916.1|114491_115016_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.4	2.5e-29
WP_098082791.1|115220_115523_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.6	8.6e-14
WP_129556698.1|115531_116233_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_016211912.1|116322_116913_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_032126795.1|117185_117446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|117449_117722_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_016211913.1|118047_119169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273786.1|119601_120000_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377915.1|120008_120566_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	2.9e-47
WP_081377914.1|120710_121040_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|121156_121450_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_016212499.1|122448_122823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|123027_123201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|123448_123898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212412.1|123890_124055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|124355_124982_+	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_054300202.1|125087_125816_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_054300590.1|125845_126070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556699.1|126377_126578_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211871.1|126571_126907_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_032126138.1|127472_127736_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211872.1|128290_129094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|129214_129739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273798.1|129847_130072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126346.1|130163_130406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|130472_131213_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_016212413.1|131260_131689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|132022_132751_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_129556700.1|132927_133173_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|133132_133588_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_054300148.1|133693_134755_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728342.1|134794_135298_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032126739.1|135612_135945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556701.1|136191_136716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275159.1|137124_137832_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	32.0	3.8e-12
WP_129556702.1|137852_139005_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
137793:138764	attR	TGATCAGGCTACCCTATTCCGGACAAATAAATTACAATAATCCGAGCCGGAGGAATCACAATGGGAAAGCGTCACGTCACCAAGTACACCGAAGAATTTAAAAAATCATCTGCCAAGCTTGCAGTCGATTCAAATCAAGCAATCAGTCATACAGCACAGGAATTGGGTATTCACTCAAGTACACTGCATGGTTGGGTCAATAAATATCATCCAAACAGTCCAAATACTGTTAAAGATGAAGTTAGTGATATGGCTGCTGAAATAAAACAGTTAAAAAAAGAGTTGGCTAGAGTGACACAGGAACGTGAAATGCTAAAAAAAGCGTCGGCGTACTTTGCAAGCGAAACACAGTAAAGTATGCCTGGATCAAAGAAAATAAATGTGTTTTTCCAGTAGATAGGGTGTGCTCAATCTTAGGTGTTAGCCGATCAGGTTATTACAGTTGGTTAAAGGTACAGCCTTCCAAGCGAATGATAGAGAACCAAAAATTAGCTAGGCGAATCAAGGAAATATTCATCGAAAGCCGTGCAACCTATGGTACTCGAAGAATTAGAAAACAGTTGGCAACACAGGAAATTTCTGTAAGCCGTAAGCGAGTTGGCCGTTTAATGAAGCAGAACCAGCTTTGCTGCAAGATAAAGCGTAAATTCAAAGTAACTACGGATTCTAAACATCGATTGCCAATTGCGAAAAACGTGTTGGACCGGAATTTTTCAGCAACAGGCCCTAACCAAAAATATGTTGGTGATATTACCTACATACGGACCCAACAAGGCTGGTTGTACTTGGCTGTTGTGATTGACTTATTCTCACGAAAAGTTGTTGGCTGGGCCATGGAGGATCATATGGAAGCATCACTCGTCAATGATGCTCTGTTGATGGCCTTATGGAAACGAAAGCCTAAAGCTGGGTTAATTTGGCATTCAGATCGCGGAAGCCAATATGCTTCAGAAAGTCATCGTGAGATTCTTA	NA	NA	NA	NA
WP_075273327.1|139989_140565_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|140510_140876_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212398.1|142223_142685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|142947_143784_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_129556717.1|144109_145336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|145990_146965_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_016212260.1|147122_147395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|147414_147639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|147975_148179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212255.1|148175_148346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|148532_149615_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_075273822.1|149771_150272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274741.1|150373_150631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556718.1|150699_151886_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
>prophage 1
NZ_CP038974	Piscirickettsia salmonis strain Psal-069 plasmid unnamed2, complete sequence	78730	4083	42287	78730	transposase	Streptococcus_phage(20.0%)	46	NA	NA
WP_155069179.1|4083_4800_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	7.5e-40
WP_032126239.1|4930_5203_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664877.1|5269_5611_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	31.4	4.4e-06
WP_054300202.1|7023_7752_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212288.1|8041_9292_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300173.1|9955_11017_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275207.1|11064_11514_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126388.1|11640_12666_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211377.1|13426_14449_+	AAA family ATPase	NA	A0A1V0DZZ0	Clostridioides_phage	27.5	3.2e-12
WP_016211383.1|14472_15342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|15647_15911_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211378.1|16158_16587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211376.1|16586_17024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211382.1|17023_17677_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_016211381.1|17688_18180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046731.1|18250_19136_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	23.1	9.0e-11
WP_016212400.1|19186_19786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212399.1|19785_20046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|20175_21328_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212392.1|21356_22364_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	26.4	1.2e-06
WP_075273802.1|22427_23156_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_016212131.1|23339_23687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212135.1|24125_25310_+	3-methylitaconate isomerase	NA	NA	NA	NA	NA
WP_075275202.1|25553_26255_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	6.0e-10
WP_075275201.1|26257_26986_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_016212164.1|27114_28143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211443.1|29166_29853_+	Fic family protein	NA	NA	NA	NA	NA
WP_016211439.1|29856_30411_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	40.6	1.0e-20
WP_016211436.1|30455_31394_+	fic/DOC family protein	NA	S4TP71	Salmonella_phage	37.2	5.2e-25
WP_016211434.1|31366_31558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211445.1|31735_32086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211437.1|32102_32729_-	zinc-ribbon domain-containing protein	NA	A0A1S5XYQ1	Kurlavirus	28.2	4.4e-12
WP_032126541.1|32735_33128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211440.1|33138_34053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211444.1|34322_34829_+	antirestriction protein ArdA	NA	A0A222YZE5	Mycobacterium_phage	33.7	2.8e-17
WP_051307358.1|34977_35361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556729.1|35644_35875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212541.1|35861_36086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212539.1|36145_36295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212090.1|37308_37488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212087.1|37487_37916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126714.1|38083_38623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212089.1|38859_39090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126713.1|39188_40226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|40695_41721_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275198.1|41747_42287_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	40.2	8.4e-12
>prophage 2
NZ_CP038974	Piscirickettsia salmonis strain Psal-069 plasmid unnamed2, complete sequence	78730	50630	71311	78730	tail,portal,terminase,capsid,protease,head	Pseudomonas_phage(11.76%)	29	NA	NA
WP_129556725.1|50630_51311_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	39.3	3.3e-37
WP_016210977.1|51489_51783_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_129556724.1|52000_52183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046773.1|52327_52507_-	phosphatase	NA	NA	NA	NA	NA
WP_129556723.1|52601_52919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126134.1|53219_53603_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	5.6e-26
WP_016212234.1|53690_54170_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_016212231.1|54173_54383_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	43.1	1.3e-08
WP_080743047.1|54398_54755_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	61.3	5.4e-23
WP_081377926.1|54773_55856_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	1.2e-89
WP_016211136.1|55852_57094_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	46.0	3.1e-86
WP_080664855.1|57041_57713_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_016211140.1|57770_58964_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_016211133.1|59084_60419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|60609_60921_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211132.1|60917_61241_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211139.1|61233_61629_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211129.1|61625_61976_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|61975_62398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126913.1|62399_62723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|62779_63046_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_032126912.1|63049_65128_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.0	2.5e-56
WP_016210657.1|65120_65462_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|65458_66130_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|66098_66845_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_016210665.1|66834_67392_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_016210662.1|67398_67686_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	2.5e-15
WP_016210670.1|67675_67930_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_016210653.1|68023_71311_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	33.5	5.2e-112
