The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	45566	89679	3155351	transposase	Moraxella_phage(16.67%)	45	NA	NA
WP_129556427.1|45566_46142_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46087_46453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46651_47413_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_016211195.1|47714_49241_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49612_50452_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50491_51799_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51773_52943_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|52997_53723_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54001_54391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54550_55456_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55531_55675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274979.1|55722_56562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|56554_56890_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_155046698.1|57068_57230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|57346_57640_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_016210704.1|58534_60481_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61135_64198_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64194_65259_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65614_66568_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66599_67763_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67768_68368_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68555_69056_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69073_70162_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70588_71833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71829_72672_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016211096.1|72651_73461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73639_73867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73867_74818_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74873_75425_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75551_75974_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75966_76713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76755_77454_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77464_78289_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78618_78987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274980.1|78981_80043_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|80092_80323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80452_81667_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81967_83029_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_016211249.1|83042_84770_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_016211245.1|84803_85535_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85534_86323_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86427_87051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273383.1|87738_88311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046699.1|88515_89088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274981.1|89082_89679_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	136473	178470	3155351	transposase	Staphylococcus_phage(50.0%)	46	NA	NA
WP_054300271.1|136473_137448_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|137949_139362_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|139854_140862_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|140881_142402_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_129556430.1|142458_142665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211018.1|143640_144957_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145060_145444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069049.1|145578_148644_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	1.1e-52
WP_016211017.1|148712_149816_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|149839_150394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150508_151078_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151197_151953_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_054300545.1|152119_153181_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|153575_153971_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|153992_154358_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154414_154579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|154568_154868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|155120_155486_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|155431_156007_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212607.1|156007_156364_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|156452_157028_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|156973_157339_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|157818_158385_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|158396_159182_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|159813_160737_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|160788_161784_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|161815_162310_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|162401_162659_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|162748_163171_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|163489_164206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|164249_164501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556431.1|164514_165942_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|165969_167412_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|167499_167838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|167922_168453_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|168513_170706_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|170748_171234_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|171503_171935_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_016210245.1|171952_172783_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|172797_172941_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|172971_173856_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|173827_174049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|174222_174501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|175471_176377_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556686.1|176779_177661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|177894_178470_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	182276	239530	3155351	tail,transposase,tRNA,protease	Escherichia_phage(12.5%)	56	NA	NA
WP_075273327.1|182276_182852_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274985.1|182797_183163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|183226_183499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212441.1|183766_183991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372761.1|185006_185456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|185519_186248_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210779.1|186290_187220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|187512_188106_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|188074_188728_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|188905_189877_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|189899_190796_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|190954_191401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210787.1|191397_192039_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|192148_192727_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|193202_193640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|193964_195305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|195568_196963_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075274986.1|198411_199479_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|199531_199954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|200194_200638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|200692_200950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|200927_201554_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|201631_203614_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|203823_205167_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|205433_208103_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|208126_210046_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|210215_211637_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|211782_212757_+	phospholipase A	NA	NA	NA	NA	NA
WP_016209855.1|212788_213184_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209859.1|213186_213408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|213571_215233_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|215305_215596_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_016209861.1|215821_216277_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|216341_216806_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216898_218245_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|218244_219150_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|219211_220198_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|220190_220433_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|220554_222099_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|222145_223432_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|223474_224869_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224892_225072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|225068_225644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|225589_225955_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274988.1|226016_228251_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016210079.1|228672_229170_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|229340_230036_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|230138_231701_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|232016_233810_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233895_234168_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|234173_234800_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234786_236217_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236549_237605_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237573_238251_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|238240_239077_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|239236_239530_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	256927	301979	3155351	transposase,tRNA	Acinetobacter_phage(40.0%)	48	NA	NA
WP_075274991.1|256927_257503_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377888.1|257506_258067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556436.1|258122_259009_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046701.1|259035_259185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|259329_259530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|259577_260039_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|260462_261944_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|262006_263116_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|263213_265175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|265704_266109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|266161_267223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046702.1|267348_267504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270449_271602_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556437.1|271644_272067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069054.1|272336_273899_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_032126861.1|274102_274417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046703.1|274610_274748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|274751_275638_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212538.1|275809_276250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210630.1|276779_277895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664846.1|277833_278520_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032126366.1|278513_279491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210638.1|279529_280693_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210640.1|281157_281382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|281767_282055_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210633.1|282229_282985_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|282990_283446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210637.1|283421_283898_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210636.1|283904_285482_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_032126367.1|285485_286250_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210629.1|286303_286840_+	tim44-like domain protein	NA	NA	NA	NA	NA
WP_016210634.1|286836_287568_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_032126368.1|287676_288831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275120.1|288975_289287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664872.1|289610_290591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211898.1|290832_291456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211899.1|291783_292077_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_105962625.1|292173_293060_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274996.1|293468_294569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126374.1|294677_295649_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664866.1|295680_296097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211609.1|296711_297020_+	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_032126373.1|297052_299239_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	2.7e-141
WP_016211605.1|299342_299576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|299792_300323_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211607.1|300351_300576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|300758_301574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300526.1|301682_301979_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	329554	375109	3155351	transposase	Hokovirus(33.33%)	46	NA	NA
WP_075273298.1|329554_330130_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210127.1|330182_331208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|331301_331565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|331931_332750_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|332822_335195_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_016210125.1|335907_337335_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|337369_338392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|338408_338786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126491.1|339143_339461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210122.1|339627_340320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|340946_341921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|341910_343683_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|343683_344031_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_032126493.1|344280_345507_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|345596_346895_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664834.1|346928_347288_-	VUT family protein	NA	NA	NA	NA	NA
WP_080664833.1|347333_347678_-	VUT family protein	NA	NA	NA	NA	NA
WP_016210137.1|347658_348210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664832.1|348436_349735_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|349851_350142_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_016212281.1|350453_351908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|352107_352683_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|352628_352994_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212359.1|353729_353948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|354315_355290_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212044.1|355828_356083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|356805_357792_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|357929_358124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664870.1|358806_359454_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_129556444.1|359446_359869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211797.1|360030_361434_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|361484_362060_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|362005_362320_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556445.1|362360_363247_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126227.1|363885_364176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212008.1|364213_364912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212010.1|364928_365225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212007.1|365348_366494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273619.1|366766_367342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211273.1|367399_368233_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.0	3.5e-17
WP_016211268.1|368348_369533_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211271.1|369551_370496_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016211269.1|370800_371586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211272.1|371703_372072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211270.1|372299_373877_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_054300173.1|374047_375109_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	447721	555318	3155351	integrase,transposase,tRNA	Escherichia_phage(45.95%)	103	512831:512890	545954:546334
WP_075275004.1|447721_448585_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|448801_450361_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|450382_451417_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|451465_452035_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|452170_453142_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|453153_454731_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|454796_455783_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016210646.1|456114_457224_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|457329_458514_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|458591_460580_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|460788_460944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|461201_461501_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_075275005.1|461659_461995_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|462911_464318_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|464335_465322_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|465324_466479_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|466475_467171_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|467305_468796_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|468816_469866_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|469932_471327_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|472205_474137_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|474141_474672_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|474706_474901_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|474943_475303_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|475722_476718_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_032126132.1|476730_479112_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|479117_479405_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|479676_480153_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|480297_480495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|480619_481594_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|482494_482593_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210477.1|483077_484367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126626.1|484603_485296_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|485337_486111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|486112_487054_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|487186_488764_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|488973_490731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|491279_492038_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|492245_492818_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|492921_493470_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|493771_494017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|494045_494342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|494609_495533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556451.1|496011_496269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275008.1|496332_497061_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	3.3e-43
WP_098082828.1|497375_497633_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275009.1|497764_498472_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.8	1.3e-44
WP_075275011.1|498515_499244_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.2e-42
WP_032126799.1|499435_500248_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_155047058.1|501309_501672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|501674_503414_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300501.1|503918_504647_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_016212066.1|505007_505784_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016212069.1|505995_506163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212070.1|506137_506737_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_054300500.1|507146_507875_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_054300501.1|508223_508952_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|508963_509356_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|509352_509598_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300307.1|510701_511430_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300307.1|512036_512765_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
512831:512890	attL	GATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCG	NA	NA	NA	NA
WP_016212268.1|513409_513994_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|513997_514681_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|514963_515692_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_052104629.1|516028_517054_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212159.1|517197_517395_-	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_016212158.1|517662_518577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275019.1|518686_519391_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	9.2e-43
WP_105962625.1|519354_520241_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211714.1|520615_523960_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_144019196.1|523992_524649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|524704_525433_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_075275021.1|525500_526442_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556625.1|526656_527214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126478.1|527206_527545_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.7e-24
WP_032126479.1|527531_527885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212114.1|527881_528112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212110.1|528115_528586_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	62.5	7.6e-33
WP_054300201.1|529232_529961_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_016212024.1|530356_530605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212021.1|530601_531201_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|531200_531419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|531905_532898_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|532894_533629_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_129556453.1|534048_534480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047116.1|534624_534804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069056.1|535505_536234_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.6e-42
WP_051307368.1|536891_538172_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|538171_539140_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_032126737.1|541651_542380_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_032126738.1|542580_542853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|542845_543124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212425.1|543327_543918_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.4	1.1e-20
WP_032126150.1|544066_544300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|544398_545373_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_075275025.1|546888_548904_-	DUF1561 family protein	NA	NA	NA	NA	NA
545954:546334	attR	GATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTTTTTCAAAAAGGCAATCGCCCAACCTTATGTGAAATCACCGCGTGTTGTGAATGTCGACAAGCACGCTTCATTTCCACCCGCTCACCAAAAAGCCAAAGATGAAGGTCTCTTTTCTAGTCAGTGTAAACTCAGGCGAGTGAAGTATTTAAACAACTGCATTGAAAATGATCACAAAGCGGTAAAGCGCAAATCCCGTTTCCGCCAATGGTACCAATCACTTTCTACAGCACGGCCTACCATTGACATAATGGAAGCGATGCGCATGGTTCAAAAAGGTCAATTACGTTATATTAAAAAACAGAATATCTGTGCC	NA	NA	NA	NA
WP_016211807.1|549153_549375_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728351.1|549262_549421_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556454.1|549684_551697_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_075275029.1|551865_552594_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	9.6e-43
WP_075275032.1|553337_554147_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	1.1e-15
WP_032126239.1|554197_554470_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|554481_555318_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
>prophage 7
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	560246	604213	3155351	transposase,tRNA	Escherichia_phage(22.22%)	47	NA	NA
WP_054300202.1|560246_560975_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211235.1|561469_561907_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|562336_563725_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211238.1|564167_565661_+	amino acid permease	NA	NA	NA	NA	NA
WP_129556456.1|565862_566612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556457.1|566655_567594_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016211244.1|567577_568273_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_036776715.1|568674_569403_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|569496_570162_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|570226_571183_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|571441_572140_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|572182_573295_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|573899_574475_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|574420_574786_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|574873_575224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|575959_577021_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556458.1|577396_577630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210908.1|578521_579337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|579427_580411_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|580581_581103_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_016210914.1|581136_581388_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210909.1|581393_582671_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|583363_583891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|584010_586323_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|586451_587267_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|587464_587929_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275036.1|588058_589120_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|589380_589677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|589959_591423_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|591425_592478_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211494.1|592467_592923_+	arginine repressor	NA	NA	NA	NA	NA
WP_016211487.1|592947_593271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|593618_593930_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_032126201.1|594059_594806_+	lipoprotein	NA	NA	NA	NA	NA
WP_054300148.1|594827_595889_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|595999_596974_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126197.1|597114_598068_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|598181_598379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|598624_598825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212072.1|598854_599052_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212074.1|599138_599360_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|599386_599752_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275038.1|599697_600288_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046713.1|600425_600590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|600884_602321_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|602362_603814_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|603925_604213_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	640174	740803	3155351	transposase,plate,tRNA,protease	Prochlorococcus_phage(17.65%)	104	NA	NA
WP_016209523.1|640174_641524_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|641574_642012_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|642273_643785_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_032126188.1|643790_645017_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|645010_646039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|646016_646709_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_155049805.1|646710_648183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556464.1|648172_648664_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|648669_650142_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|650141_650540_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|650536_652225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|652206_653163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|653205_653721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|653825_654758_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|654977_655364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|655380_656025_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|656205_657045_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|657120_657723_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|657723_658578_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|658934_659246_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|659270_660662_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|660817_661549_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_129556465.1|661545_662118_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|662104_662662_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|662667_663648_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|663787_664588_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_036780687.1|664591_665359_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|665355_665820_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|665842_666496_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|666499_666847_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|666880_667132_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|667206_668475_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|668477_669236_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|669297_670188_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|670238_670922_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|671007_671265_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_075275046.1|671537_673751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|673742_674615_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|674782_676612_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|676775_677417_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|677658_678189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|678206_678380_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|678438_679488_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|679494_680445_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|680498_681443_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|681470_682208_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|682296_682539_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|682613_683837_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|683868_684717_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|684713_685766_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|685886_686507_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_016210407.1|686522_687509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080743011.1|687619_688075_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556469.1|688034_688343_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|689136_690042_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275050.1|690117_690813_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275052.1|690957_691467_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|691516_691726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|692960_693407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|693410_693986_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275054.1|693931_694297_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|694417_694603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|694706_695741_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|695737_696448_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|696922_697441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|697558_697891_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209920.1|697920_700875_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209912.1|700920_701418_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|701477_701894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|701985_702846_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|702928_703495_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|703527_704382_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_016209914.1|704423_707330_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|707390_707588_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|707594_708605_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|708601_709660_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|709653_710454_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|710456_711275_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|711286_712234_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|712241_713543_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|713721_714825_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|714821_715214_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|715225_716602_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|716595_718065_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209916.1|718256_719228_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	3.7e-34
WP_129556470.1|719464_720351_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|720650_720896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|721444_722179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|722303_723365_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|723687_724392_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|724485_725199_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|725281_726373_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|726444_727026_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|727031_727658_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|727754_728690_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|729049_729721_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210598.1|729862_730522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|730690_731950_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|731946_733032_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|733024_733906_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|733894_735145_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_075275125.1|736736_737780_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|739916_740282_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|740227_740803_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	776233	822913	3155351	transposase,tRNA	Staphylococcus_phage(28.57%)	39	NA	NA
WP_016209374.1|776233_777685_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|777720_779250_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_016209380.1|779825_780248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556473.1|780380_781469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126585.1|782010_782931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|783281_784097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|784388_787079_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_080664814.1|787327_788548_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|788715_790422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|791020_792247_+	MFS transporter	NA	NA	NA	NA	NA
WP_075274832.1|792823_793798_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_075273456.1|793920_794220_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|794179_794635_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212416.1|794636_795167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212417.1|795290_795536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|795586_795952_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|795897_796473_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052047106.1|796546_797023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|797738_798104_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|798049_798625_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300173.1|798651_799713_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556627.1|799765_800371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211819.1|800589_800820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|801116_801617_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|801819_803076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211822.1|803432_803846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|804155_805217_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275065.1|805516_806191_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.9e-10
WP_016212172.1|807081_808554_+	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|808573_809548_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|809698_809974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|810139_810760_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_016210737.1|811078_813055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|813210_814668_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|814736_816317_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210744.1|816357_816843_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|816939_820836_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|820842_821166_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300173.1|821851_822913_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	839600	896162	3155351	transposase,protease	Staphylococcus_phage(21.43%)	46	NA	NA
WP_033923708.1|839600_840476_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|840731_841376_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|841406_843212_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|843235_843811_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556476.1|844355_845366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|845461_846436_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016209640.1|846854_847874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|848332_849298_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|849342_849918_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|849948_851223_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|851849_852563_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|852642_853380_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|853500_854856_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|855032_855704_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|855819_856695_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|857298_858603_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|858715_859321_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|859402_860704_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|860771_863204_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|863307_863580_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_032126162.1|863683_865561_+	SurA domain-containing protein	NA	NA	NA	NA	NA
WP_016209643.1|865592_866477_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|866485_866881_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|867308_869456_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|869427_870777_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|870773_872894_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|872890_874594_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209654.1|874712_875855_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|875919_876948_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_129556477.1|877107_878589_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|878678_879164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275067.1|879496_880564_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273512.1|881319_881664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|881800_882775_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126362.1|882946_883312_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051307360.1|884151_885081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780074.1|886172_886979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|887321_889214_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|889500_889905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923634.1|890109_890658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|890647_891534_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|891872_892283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556479.1|892496_892679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274918.1|893166_893532_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|893477_894053_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|895187_896162_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 11
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	901409	964246	3155351	integrase,transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(14.29%)	58	895150:895209	940493:941597
895150:895209	attL	ATCGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCT	NA	NA	NA	NA
WP_032126152.1|901409_902000_-|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016212424.1|902202_902481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|902473_902746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|902890_903973_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211300.1|904023_905064_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_129556480.1|905575_911065_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|911088_912063_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212302.1|912376_912676_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_129556481.1|912860_913292_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_054300162.1|913549_914632_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211579.1|914855_915341_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|915408_916317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211581.1|916593_917364_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.9	8.9e-31
WP_016211585.1|917482_918040_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016211582.1|918101_918881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|918978_919332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|919398_919593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|919608_919953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|920310_920886_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|920831_921197_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275068.1|921281_921872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047108.1|921973_922372_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212107.1|923183_924320_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046716.1|924724_924871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|925568_926123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|926559_926742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210541.1|926806_927034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|927264_928011_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|928237_928531_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|928602_929208_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|929356_930334_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_032126547.1|930430_931873_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|931899_932553_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_016210552.1|932677_933244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|933598_935377_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_016210542.1|935448_937155_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.9	2.5e-25
WP_054300262.1|937146_937437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|937899_938265_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|938210_938786_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|938789_939164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|939539_940514_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300264.1|940616_940955_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300265.1|941099_941360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556469.1|941319_941628_-|transposase	transposase	transposase	NA	NA	NA	NA
940493:941597	attR	AGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGATATCGTAATAGTGCGACCGCTTAATGCATAAAAATATGAGTTAAAAACTAGGCTCCGTTGACATTTCACCTTAACCATAAGATAGTGCTTGCAATTTTCAAAAAGGATAAATATCTGCAAGCCCTTTTTTCAAAACGTGAAAAAACTCTTCTAAATTGTTTTAACTTGCCAATGCAGCACTCTATCAAATGCCTTTCCTTGTAAACATGCTGATCGTGGTCAAATTTATTAATCCTATTTGATTTAGAAGGAATAATACACTTAGCCCCCTTTTTGACAACTAACTCTCTTATCTTTATGTCATCATAAGCTTTATCGGCAATAATTTGATCAAACGCCACTGAAGTGAGTAACCCCTGAGCCTGAGGAGCATCATGCGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTGCTTGCCCTCGTGTCAGTACAAAATCTACAGGATAACCCAACCCCTCTGTTAAAATATGGACTTTTGTACTAAAGCCTCCACAGCTACGATCTAAGGCTTGGTTAATCCCTTTGTCTTTTTTTATATCCCGCAGAGCACGCATGAGCTCGAATCACTGTTGAATCAACCATACCTGAGTCTAGTTCAGGTGTTTGCACAGATGTAAAAAGAGCATCCCAAACGCCTCGGTTATCCCAACGACTAAACCGTTTATAAACACTATTCCAATATCCATAATCTTCCGGTAGGTAACGCCATTGGGAGCCTGTACGGAGAACCATATAACGGCTTCGATAAATAAACGACATTTCCTTTCTGAGCCACAGTAAATCCCTGGAAA	NA	NA	NA	NA
WP_129556484.1|942129_943590_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_016211426.1|943933_945376_+	MFS transporter	NA	NA	NA	NA	NA
WP_075273490.1|946358_947651_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_054300148.1|947891_948953_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556485.1|949105_951664_+	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.6	6.3e-73
WP_032126554.1|951683_952769_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_016210417.1|953210_953648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210423.1|953644_954529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210416.1|954618_955149_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_016210420.1|955219_956398_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.1	2.0e-50
WP_016210425.1|956546_960395_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_016210422.1|960381_961884_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_016210418.1|962434_963070_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_081377899.1|963382_964246_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	968318	1073021	3155351	transposase,tRNA	uncultured_Mediterranean_phage(10.0%)	113	NA	NA
WP_075275075.1|968318_969380_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|969374_969545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|969534_969699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|969755_970121_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|970142_970511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210898.1|971422_971773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|971861_972152_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|972626_972929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210897.1|973269_974250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|974328_975666_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|975784_976156_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|976376_977027_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|977069_978152_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|978205_980089_+	APC family permease	NA	NA	NA	NA	NA
WP_032126790.1|980588_981494_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275077.1|981578_982415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212218.1|982559_982910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|984360_985422_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|985547_986630_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_032126801.1|987300_987810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275079.1|987857_988919_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556488.1|989067_989917_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126540.1|991066_991930_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|992810_993176_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|993121_993697_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|993927_994293_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|994238_994814_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126869.1|995334_995574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|995551_996613_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212290.1|996729_998055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556523.1|998058_998945_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212326.1|999170_999368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122941816.1|999454_999763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212323.1|999839_1000112_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_075274676.1|1000186_1000384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046717.1|1000542_1000692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|1002948_1004985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664853.1|1005708_1007451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211090.1|1007410_1009045_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|1009057_1010101_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|1010079_1010541_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_016211081.1|1010581_1011517_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211087.1|1011544_1012540_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211088.1|1012759_1013722_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126778.1|1013900_1014095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075285940.1|1014309_1015131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377357.1|1015215_1015617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212611.1|1016100_1016421_+	histidine kinase	NA	NA	NA	NA	NA
WP_075275084.1|1016468_1017530_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212519.1|1017604_1017985_+	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_052047081.1|1018255_1018693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212356.1|1018743_1019589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275086.1|1019566_1020565_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1020525_1020891_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1020836_1021412_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155069059.1|1021439_1021583_+	phosphatase	NA	NA	NA	NA	NA
WP_075274822.1|1022069_1023044_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016212585.1|1023155_1023476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1023994_1024267_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1024278_1025115_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_155069061.1|1025133_1025409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1025405_1025981_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1025926_1026292_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126498.1|1026353_1026914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211126.1|1027046_1027436_-	lipoprotein	NA	NA	NA	NA	NA
WP_016211125.1|1027605_1028436_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211128.1|1028658_1029564_-	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211119.1|1029727_1030489_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211122.1|1030492_1031359_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126499.1|1031455_1032067_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211118.1|1032445_1033693_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126500.1|1033829_1034546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275089.1|1034679_1035012_-	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	37.3	8.0e-05
WP_129556631.1|1035156_1035324_-	phosphatase	NA	NA	NA	NA	NA
WP_075275091.1|1036332_1036818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|1037088_1037499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300412.1|1037643_1037958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210280.1|1038194_1039289_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_016210284.1|1039370_1039892_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210276.1|1039946_1040423_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210275.1|1040478_1040781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210273.1|1040845_1041553_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210274.1|1041925_1042324_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_032126334.1|1042363_1042795_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210271.1|1042805_1043489_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1043573_1045769_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_129556492.1|1045866_1046610_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210283.1|1046637_1047423_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_016210272.1|1047462_1048173_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210279.1|1048160_1049327_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210277.1|1049380_1050214_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210270.1|1050283_1053271_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210281.1|1053312_1054704_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210269.1|1054717_1055068_-	L,D-transpeptidase catalytic domain protein	NA	NA	NA	NA	NA
WP_032126362.1|1055105_1055471_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1055416_1055992_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664860.1|1055955_1056393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211367.1|1056548_1057331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126330.1|1057478_1058438_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_032126331.1|1058492_1060502_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_016211366.1|1060557_1060845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126332.1|1061097_1062297_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_075273327.1|1062943_1063519_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1063464_1063830_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|1063963_1064827_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1065057_1065351_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556495.1|1066331_1066589_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211589.1|1066711_1067944_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_016211592.1|1067933_1068596_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_129556496.1|1068870_1070109_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_032126329.1|1070294_1070924_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211588.1|1070999_1071701_+	cyclase family protein	NA	NA	NA	NA	NA
WP_105962623.1|1071868_1073021_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 13
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	1102478	1208994	3155351	transposase,tRNA	uncultured_Mediterranean_phage(22.22%)	96	NA	NA
WP_075275097.1|1102478_1103054_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1102999_1103365_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300408.1|1103415_1104072_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_080664854.1|1104408_1104990_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_032126179.1|1104947_1105199_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_016211113.1|1105228_1106554_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_016211112.1|1106609_1107257_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211115.1|1107449_1109402_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211114.1|1109534_1112465_+	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_075274672.1|1112830_1113424_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1113595_1113961_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1113906_1114482_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1114495_1114786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1114731_1115307_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212254.1|1115296_1116739_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016212252.1|1116776_1116935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|1117249_1117975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|1118179_1118551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211395.1|1118907_1119243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779999.1|1119158_1119590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211393.1|1119609_1121166_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_016211391.1|1121177_1121753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728317.1|1121819_1125185_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275098.1|1125375_1126305_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-24
WP_129556498.1|1126817_1127426_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210596.1|1127422_1129363_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.1e-72
WP_016210594.1|1129498_1130152_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210595.1|1130328_1131507_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210588.1|1131874_1133200_+	fimV domain protein	NA	NA	NA	NA	NA
WP_032126176.1|1133290_1134073_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210587.1|1134174_1135035_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_016210590.1|1135209_1136472_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210593.1|1136551_1137082_+	colicin V production protein	NA	NA	NA	NA	NA
WP_016210586.1|1137103_1138609_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210592.1|1138621_1139278_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016212005.1|1139667_1141428_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_155049815.1|1141993_1142146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1142328_1143481_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_032126856.1|1143786_1144128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377901.1|1144188_1144899_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275102.1|1145079_1145538_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211525.1|1146126_1148862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|1151161_1151977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046719.1|1154195_1154354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1154372_1154645_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1154656_1155493_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_129556510.1|1156016_1157120_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	7.3e-10
WP_054300405.1|1157221_1157722_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209947.1|1158243_1158906_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016209946.1|1158932_1160162_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209940.1|1160318_1163090_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_016209937.1|1163165_1163609_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209931.1|1163761_1165234_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209926.1|1165345_1166407_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209945.1|1166403_1167438_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209932.1|1167440_1168481_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209936.1|1168663_1169779_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.6	1.4e-93
WP_016209930.1|1169817_1170171_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_032126634.1|1170191_1172060_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209935.1|1172081_1173026_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_016209925.1|1173259_1173538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1173747_1174386_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_155069063.1|1174360_1175788_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	30.0	1.9e-42
WP_016209927.1|1175988_1176666_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209939.1|1176800_1178075_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209943.1|1178142_1178898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209948.1|1178949_1179867_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209929.1|1179975_1180869_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075274822.1|1182327_1183302_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016211771.1|1183594_1183783_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_016211770.1|1183796_1184930_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_075274823.1|1185129_1189140_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211823.1|1189174_1189363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1189403_1190024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1190355_1190709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1190922_1191117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1191782_1192310_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300400.1|1192366_1192609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1192753_1193020_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210885.1|1193361_1194243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1194300_1194897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1194929_1195703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1196236_1196533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210888.1|1196555_1196807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155053505.1|1196752_1197475_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210886.1|1197543_1198323_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210887.1|1198405_1199356_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210889.1|1199865_1202712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556636.1|1202729_1203038_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016212002.1|1203991_1204270_-	DNA-J related family protein	NA	NA	NA	NA	NA
WP_016212000.1|1204389_1205118_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016211998.1|1205248_1205812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211999.1|1205801_1206155_-	ras family protein	NA	NA	NA	NA	NA
WP_033923779.1|1206534_1207371_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1207382_1207655_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274825.1|1207932_1208994_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	1245808	1340832	3155351	transposase,tRNA	Bacillus_phage(15.0%)	90	NA	NA
WP_075274826.1|1245808_1246714_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1246970_1248242_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_016211218.1|1248266_1249004_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1249256_1250399_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1250415_1252017_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1252528_1252666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1252662_1253940_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_155069065.1|1254330_1254543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211682.1|1255161_1256844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211680.1|1256891_1259291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274826.1|1259521_1260427_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1260683_1261955_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_016211218.1|1261979_1262717_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1262969_1264112_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1264128_1265730_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1266241_1266379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1266375_1267653_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_155069065.1|1268043_1268256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126600.1|1268456_1268978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212250.1|1269100_1269751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212251.1|1269912_1270449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300384.1|1270610_1271426_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075274828.1|1271834_1273157_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.2e-11
WP_052133287.1|1273258_1273657_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212039.1|1273845_1274403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212040.1|1274579_1275929_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_054300162.1|1276132_1277215_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210803.1|1277289_1278588_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_016210808.1|1278765_1279617_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210805.1|1279625_1280297_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_032126141.1|1280706_1281981_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_155069067.1|1282045_1283965_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	33.8	2.7e-84
WP_032126139.1|1283971_1284901_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_033923779.1|1287569_1288406_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274829.1|1288417_1288690_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1288713_1289688_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046725.1|1289731_1289872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300382.1|1290088_1290511_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377858.1|1290729_1291440_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1291643_1292009_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|1292023_1292530_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211414.1|1292745_1293564_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|1293671_1294133_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211415.1|1294149_1295073_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211417.1|1295096_1296146_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_051307357.1|1296282_1296876_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211422.1|1296898_1297369_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032126143.1|1297457_1298729_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_075274832.1|1298828_1299803_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_016211838.1|1300114_1300288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211840.1|1300758_1301223_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211839.1|1301381_1302854_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211841.1|1302971_1303424_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|1304283_1305345_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1305647_1306730_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212483.1|1306740_1307538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1307534_1308110_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1308055_1308421_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300380.1|1308522_1309179_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556508.1|1309449_1309893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|1309954_1310248_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556507.1|1310364_1311051_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.3	5.5e-48
WP_075273327.1|1311040_1311616_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1311561_1311927_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212421.1|1312418_1312601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1313351_1314326_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556505.1|1314366_1315332_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211470.1|1316098_1316752_+	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_016211471.1|1316811_1318797_-	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
WP_032126343.1|1318927_1319740_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_032126344.1|1319860_1320949_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_016211467.1|1320951_1321518_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_075273298.1|1321592_1322168_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|1322113_1322479_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047029.1|1322646_1322988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1323060_1324122_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032127044.1|1324325_1324526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212482.1|1324740_1324884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|1325427_1325721_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556503.1|1326782_1327649_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	5.6e-58
WP_016210508.1|1327657_1329355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|1329675_1330224_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_075273576.1|1330351_1331080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1331139_1334637_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_016210514.1|1334694_1335948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210515.1|1336056_1336959_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210512.1|1337012_1338050_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210506.1|1338185_1339424_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210510.1|1339416_1340145_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_081007040.1|1340175_1340832_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	1345368	1398049	3155351	transposase,tRNA,protease	Klosneuvirus(28.57%)	48	NA	NA
WP_075273327.1|1345368_1345944_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1345889_1346255_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126565.1|1346465_1346738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211013.1|1347055_1349422_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_016211011.1|1349482_1350679_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_016211010.1|1350957_1353387_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_016211008.1|1353479_1354982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211012.1|1355090_1355663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273571.1|1355812_1356490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556502.1|1356598_1357162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210926.1|1357421_1358891_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016210918.1|1358975_1359725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210930.1|1359728_1360502_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210927.1|1360562_1361513_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210917.1|1361637_1363080_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	5.4e-21
WP_032126561.1|1363293_1364478_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210925.1|1364601_1365288_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.5	9.7e-29
WP_016210921.1|1365379_1365964_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_155046724.1|1366188_1366356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210929.1|1366352_1366709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|1366743_1367049_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_054300375.1|1367263_1367464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728346.1|1368270_1368603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372539.1|1368620_1369484_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556501.1|1369516_1370092_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1370037_1370403_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211651.1|1370636_1372172_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016211650.1|1372296_1373781_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211648.1|1374440_1374980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|1376183_1376390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126642.1|1376459_1376921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126641.1|1376956_1379527_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_016209840.1|1379634_1380120_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_016209844.1|1380292_1381333_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209835.1|1381310_1381793_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209848.1|1381789_1384384_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209832.1|1384690_1384954_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209831.1|1385232_1385931_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|1386150_1386345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209827.1|1386420_1387980_-	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_129556633.1|1388298_1389195_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|1389411_1390887_-	APC family permease	NA	NA	NA	NA	NA
WP_016209826.1|1391409_1392432_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209830.1|1392762_1394130_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209846.1|1394365_1394620_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126639.1|1394635_1395922_+	GTPase HflX	NA	NA	NA	NA	NA
WP_016209836.1|1395941_1397156_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_016209838.1|1397155_1398049_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 16
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	1435121	1480312	3155351	integrase,transposase,tRNA	Tupanvirus(28.57%)	45	1442917:1442976	1490722:1491076
WP_016211285.1|1435121_1435901_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211286.1|1435918_1436266_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211289.1|1436377_1436650_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211767.1|1437978_1438788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211764.1|1439338_1440160_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126803.1|1440360_1441593_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_081377862.1|1442079_1442916_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
1442917:1442976	attL	TCGTTTATCCTCTATATCGGTAGCTTTTTTTCCACAACATCTTTCAAAGCCTCAATTTCT	NA	NA	NA	NA
WP_032126239.1|1442927_1443200_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211806.1|1443989_1444715_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_016211805.1|1444757_1446296_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211804.1|1446302_1447688_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_032126599.1|1448382_1449726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1450365_1451049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273555.1|1451326_1451860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210332.1|1451990_1452734_-	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_016210330.1|1452831_1453215_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210333.1|1453418_1454048_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_032126607.1|1454121_1455405_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_016210326.1|1455744_1457043_+	ankyrin repeats family protein	NA	NA	NA	NA	NA
WP_016210325.1|1457196_1458573_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210327.1|1458708_1460040_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210329.1|1460100_1460619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210321.1|1460667_1461636_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_129556511.1|1461832_1463269_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210323.1|1463451_1464162_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.7	6.3e-39
WP_032126606.1|1464073_1464595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210320.1|1464744_1465818_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_016210322.1|1465954_1466851_-	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016211334.1|1467468_1467657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211336.1|1467705_1468320_+	chorismate mutase	NA	NA	NA	NA	NA
WP_032126265.1|1468385_1469303_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016211328.1|1469626_1470088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082827.1|1470195_1471497_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_016211330.1|1471671_1472772_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_032126267.1|1473119_1473362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211335.1|1473355_1473673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664859.1|1473782_1474370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1474538_1474796_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774189.1|1474795_1475803_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_051307372.1|1475850_1476240_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016212275.1|1476355_1477339_+	MFS transporter	NA	NA	NA	NA	NA
WP_129556512.1|1477328_1477904_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300363.1|1477849_1478197_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212589.1|1478620_1479058_+	MFS transporter	NA	NA	NA	NA	NA
WP_129556637.1|1479532_1480312_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1490722:1491076	attR	AGAAATTGAGGCTTTGAAAGATGTTGTGGAAAAAAAGCTACCGATATAGAGGATAAACGAATGCTCGCTACTTACCTCAAAGATGAACATAAGCTAAGCCTCGTGGTTGCTTGTAATTTAGTCACTCTTCCAAGAGCAAGCTATTACCGAAAAAAACAGCATCAATCTGATAATGCTGAAATAATTTCAGAGCTAAAGACGTTAGCGAGCAAACACAAACGCTGGGGTTGCGACAAAATGGTCGCATATTTAAAAAACAAAGGTAAGCCTTGGAACCATAAGCGCATTCGTCGAGTCTATATTGAAATGGGCTTAAACATAAGCTGTAAACCAAAGCATCACTACGTCAAAAACG	NA	NA	NA	NA
>prophage 17
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	1489438	1533453	3155351	integrase,transposase,protease	Staphylococcus_phage(38.46%)	49	1489401:1489460	1519597:1520623
1489401:1489460	attL	TCCGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCT	NA	NA	NA	NA
WP_054300271.1|1489438_1490413_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126239.1|1490497_1490770_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274843.1|1490781_1491408_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	36.0	5.2e-29
WP_032126239.1|1491478_1491751_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1491762_1492599_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_081377864.1|1492612_1492852_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211148.1|1492933_1494262_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1494525_1495095_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211151.1|1495110_1495422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1495431_1496388_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1496500_1496854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211153.1|1496857_1497922_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211145.1|1497922_1499662_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211152.1|1499668_1500091_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211144.1|1500074_1500704_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075273474.1|1501260_1502235_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_075274844.1|1502415_1502667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1502675_1503512_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1503523_1503796_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556515.1|1503814_1504174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046727.1|1504999_1505344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1505587_1506562_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075275108.1|1506538_1507144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556516.1|1507502_1508006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1508100_1508373_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1508384_1509221_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_080664876.1|1509533_1511396_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_081377865.1|1511754_1512039_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556638.1|1513383_1514064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273551.1|1514063_1514366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211974.1|1514465_1515587_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075274847.1|1515869_1516745_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212011.1|1516978_1518100_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_016212013.1|1518321_1518705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|1518720_1519398_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300271.1|1519634_1520609_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300271.1|1521256_1522231_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
1519597:1520623	attR	TCCGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTTTCACTCACCTGGATATCATGCTCTCGTATAAGTTCCTGACTGATAACATCGGGGGATGTATGGGTGCTTAACCGTTGATGGATCAACATTTTTGCCTCCTCTGAAATTTGTCGAAAAGCTTGACCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCACAGCGAGAAGTAAGCCGGTGACAGTAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAAGTGCTCTAGCAATTGATCTGAGCGAGTCTCCCTCTGATAACCGTTGTTCGATATAAAAACGATCTTTTTCATTTAAGTGCCGATAAACCATCTCTACCCTCTAAG	NA	NA	NA	NA
WP_129556517.1|1522628_1522916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1522934_1523771_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1523782_1524055_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274849.1|1524180_1524924_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155069070.1|1524918_1525068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1525091_1526066_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155069072.1|1526141_1527254_-	DUF4131 domain-containing protein	NA	NA	NA	NA	NA
WP_016211994.1|1528672_1529209_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_032126537.1|1529245_1529431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211991.1|1529671_1530577_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126538.1|1531485_1532904_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_081007034.1|1533168_1533453_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	1617944	1667454	3155351	transposase	Staphylococcus_phage(27.27%)	47	NA	NA
WP_075274858.1|1617944_1619030_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1619166_1619532_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1619477_1620053_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1620743_1621718_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1622272_1623334_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1623431_1624406_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_129556523.1|1624741_1625627_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209772.1|1626646_1627198_-	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_016209778.1|1627216_1627591_-	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209796.1|1627621_1628839_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_080664823.1|1628862_1630263_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209795.1|1630243_1630999_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_016209793.1|1631039_1632488_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_032126436.1|1632503_1632959_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209771.1|1633665_1634388_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016209791.1|1634552_1635275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307317.1|1635411_1635705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209798.1|1635766_1637791_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_016209769.1|1637803_1638547_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_017377132.1|1638588_1638972_-	response regulator	NA	NA	NA	NA	NA
WP_016209784.1|1639058_1639781_-	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_129556524.1|1639777_1640665_-	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_016209767.1|1640645_1642106_-	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_016209770.1|1642136_1644230_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_016209786.1|1644264_1645398_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_016209787.1|1645411_1646197_-	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_016209776.1|1646212_1646482_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_080664822.1|1646511_1647261_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_016209797.1|1647257_1647749_-	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_016209775.1|1647745_1648201_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_129556639.1|1648217_1648628_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209790.1|1648923_1649382_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209788.1|1649433_1650186_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016209785.1|1650307_1652251_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	23.9	1.1e-05
WP_016209794.1|1652296_1652920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377870.1|1653654_1654173_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	31.0	1.6e-07
WP_081007030.1|1654208_1655180_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307341.1|1655873_1657472_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_016210848.1|1657638_1658823_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1659118_1659673_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210850.1|1659921_1661175_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210851.1|1661159_1661831_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210847.1|1661853_1662858_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210849.1|1662886_1664335_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210855.1|1664452_1665430_+	DMT family transporter	NA	NA	NA	NA	NA
WP_129556525.1|1665583_1666403_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1666479_1667454_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 20
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	1682277	1849198	3155351	integrase,transposase,tRNA	Staphylococcus_phage(15.38%)	151	1728754:1728813	1805742:1806705
WP_032126790.1|1682277_1683183_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1684172_1684511_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1684470_1684926_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126602.1|1685078_1686386_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211857.1|1686636_1687515_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016211855.1|1687511_1687979_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|1688105_1688291_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_054300271.1|1688506_1689481_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556640.1|1689747_1690974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211351.1|1691049_1691388_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_032127067.1|1691384_1691987_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211349.1|1691983_1693978_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211350.1|1694041_1694980_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211352.1|1695658_1696099_+	universal stress protein	NA	NA	NA	NA	NA
WP_075273313.1|1696272_1696611_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1696570_1697026_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210793.1|1697027_1697708_+	OmpW family protein	NA	NA	NA	NA	NA
WP_016210801.1|1698030_1699002_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210795.1|1698983_1699955_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_051307339.1|1700060_1700867_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210791.1|1701241_1701442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210799.1|1701868_1702822_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_129556527.1|1703283_1703544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273540.1|1703728_1704340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210800.1|1704706_1705534_+	DsbA family protein	NA	NA	NA	NA	NA
WP_051307338.1|1705743_1707309_+	APC family permease	NA	NA	NA	NA	NA
WP_052047040.1|1707334_1708273_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1708342_1708600_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556528.1|1709021_1709450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1710973_1711462_-	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_051307365.1|1711481_1711742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211834.1|1711998_1712313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664871.1|1712403_1714026_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.9	1.9e-27
WP_032126362.1|1714457_1714823_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1714768_1715344_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212185.1|1715437_1716427_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1716760_1716946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1717625_1719581_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016210749.1|1719879_1720341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210752.1|1720510_1721308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556641.1|1723684_1724947_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
1728754:1728813	attL	ATTATAGCGCTGGATTAACAGTTTCTGACATAATATCAGTAGGTTAAAAAATACAATAAG	NA	NA	NA	NA
WP_032126362.1|1728821_1729187_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1729132_1729708_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211454.1|1729848_1730319_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_016211452.1|1731069_1732557_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211455.1|1732618_1734076_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_122942091.1|1734181_1734577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1734604_1735183_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_054300325.1|1735804_1736077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046732.1|1736270_1736441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274862.1|1736555_1737152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1737323_1737917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211728.1|1738304_1740239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1740277_1741192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1742762_1743029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1743105_1743762_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1743936_1744392_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1744351_1744690_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556531.1|1744652_1744850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211752.1|1745054_1746200_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211748.1|1746215_1747820_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211749.1|1747899_1749093_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_032126540.1|1749301_1750165_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212346.1|1750398_1750545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274864.1|1753385_1754411_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047087.1|1754582_1754801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211462.1|1754961_1755942_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211465.1|1756569_1757553_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211464.1|1757703_1758051_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_032126752.1|1758047_1758650_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211466.1|1758737_1760258_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126753.1|1760327_1760792_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_032126362.1|1760884_1761250_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1761195_1761771_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212485.1|1762626_1763160_+	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_129556532.1|1763456_1763639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664820.1|1763947_1764118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209620.1|1764100_1767157_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209619.1|1767243_1768692_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209621.1|1769124_1770129_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209617.1|1770249_1770648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209627.1|1770687_1772511_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_033923701.1|1772507_1775810_+	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209616.1|1775840_1776755_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016209618.1|1776825_1777455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|1777499_1777934_-	lipoprotein	NA	NA	NA	NA	NA
WP_016209630.1|1777914_1778655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|1778668_1780066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|1780068_1783017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|1783016_1784738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209636.1|1784752_1785157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209631.1|1785157_1788031_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075273639.1|1788033_1788750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|1789117_1791010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209637.1|1791041_1793579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274867.1|1793610_1794783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209624.1|1794779_1795391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209623.1|1795412_1796912_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209615.1|1796928_1797435_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_155046733.1|1798676_1798814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046734.1|1798958_1799096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377829.1|1799751_1800486_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_129556535.1|1800930_1801816_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1802006_1802264_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377871.1|1802468_1803161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556536.1|1803163_1804317_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556537.1|1804276_1804801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274873.1|1805290_1805788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1805809_1806175_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1806120_1806696_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274874.1|1806696_1807065_+	hypothetical protein	NA	NA	NA	NA	NA
1805742:1806705	attR	ATTATAGCGCTGGATTAACAGTTTCTGACATAATATCAGTAGGTTAAAAAATACAATAAGGAAAAACGATGCCTTCTCCTTACAGTTATGACTTAAGAATTCGAGCACTAAAAATGATTGATGAAGGGATACCTATTACACAAATTTCCAAGCTCTTAAAAATCAGTCGAGACACTCTGCATCGTTGGAAAAATAGGCGTGATCATACAGGAGACGTCAAAGCAAGGTTTGGCTACCAAACGGGCTATAACCATAAAATCAGTGATATGAAAGAATTTCAAAAATTTATTGATCAGAATCCGGGTAAAACTCATCAACAACTCGCTGATCTTTACCCTGTAGAAATGAGTGCAAAAACCATGGGAGTGTGGATTAAAAAATTAGGCTATACCAGAAAAAAAAGAGCTTCAGATACCAAGAACGTGATGCATTAAAGCGGAAAGCTTTCCTGGAAAAAGTCGAGAAAATCGATAACGACAAAATTGTTTATATGGACGAAGCGGGTATGGATGATACTGAGCGTTACGCTTATGGCCACTCTGCTAAAGGTAAACGGTGCTATGCAGAGAAGCCAGGTAAAAAATCAATACGAATTAACTTTATAGGTGGTTTGCGCGGCAAGCAATTTATCGCACCAATGATGGTTGAAGGTTATTGCAATGCTAACGTTTGTCAGGCTTATATCGATCAGTGCTTAATTCCCTGTTTATCTCCTGGAGAGACTGTAATCATGGATAATGCCTCTTTTCACAAATCAAAAGGGGTTAAGGAAGCGATTGAAGATGCGGGTTGTCACTTATTATTTTTACCCCCTTATTCTCCTGATTTAAACCCGATAGAGCATGTATGGTCACCGCTTAAAAATAGGGTTCGCATGAAGCTTGATCAAGATGAAATAAATTTAGAGACAGCGCTTAGTCAAGTAATGAAGTCAATGTCAGAAACTATTCGTTGAGTGCTATAC	NA	NA	NA	NA
WP_032126786.1|1807363_1810444_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016211319.1|1810461_1811514_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211316.1|1812046_1812697_+	porin family protein	NA	NA	NA	NA	NA
WP_016211315.1|1813031_1813676_+	porin family protein	NA	NA	NA	NA	NA
WP_054300314.1|1813863_1814199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273532.1|1814159_1814747_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126997.1|1814964_1815204_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_032126998.1|1815525_1815873_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_036774554.1|1815971_1816250_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1816302_1816590_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1816593_1817480_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211346.1|1818629_1819271_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_016211340.1|1819298_1819520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211347.1|1819512_1820496_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211344.1|1820709_1821528_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211342.1|1821688_1823371_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.1e-32
WP_016211343.1|1823378_1824401_-	YHYH protein	NA	NA	NA	NA	NA
WP_016211341.1|1824599_1824770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1824914_1825889_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211940.1|1826002_1826335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1826455_1827715_-	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211214.1|1829477_1830041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211210.1|1830143_1831625_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211213.1|1831631_1831838_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211211.1|1831886_1832966_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211215.1|1833157_1835128_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211212.1|1835488_1837048_+	APC family permease	NA	NA	NA	NA	NA
WP_075274875.1|1837330_1837633_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300307.1|1837679_1838408_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_129556539.1|1838476_1838821_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211983.1|1839068_1839728_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556643.1|1839823_1841188_+	histidine kinase	NA	NA	NA	NA	NA
WP_016212551.1|1841645_1842140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|1842481_1843057_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1843002_1843293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046731.1|1843306_1844192_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211946.1|1845412_1846168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556540.1|1846386_1846782_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211947.1|1846774_1847920_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_075274878.1|1848322_1849198_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	1891888	1908255	3155351	transposase	Leptospira_phage(40.0%)	15	NA	NA
WP_032126239.1|1891888_1892161_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377873.1|1892172_1893009_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.6e-41
WP_016212058.1|1893651_1895202_-	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_075274880.1|1895357_1896323_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1897318_1897591_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1897602_1898439_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_098082828.1|1898936_1899194_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1899193_1900201_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212247.1|1900567_1901323_+	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1901950_1902925_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300162.1|1903264_1904347_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212246.1|1904450_1905107_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_075274882.1|1906042_1906639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556544.1|1906753_1907110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1907172_1908255_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 22
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	1953050	1994463	3155351	integrase,transposase,protease	Acinetobacter_phage(25.0%)	45	1943786:1943845	1990145:1990433
1943786:1943845	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_075274886.1|1953050_1954112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274888.1|1954383_1954719_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081007004.1|1954723_1955179_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1955138_1955477_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|1955634_1955799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1955788_1956088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212209.1|1956543_1957545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556545.1|1957799_1958141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274890.1|1958345_1959026_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_098082828.1|1959095_1959353_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377874.1|1959521_1959989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049141.1|1960449_1961635_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.6e-58
WP_155046738.1|1961644_1961785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556547.1|1962061_1962622_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_054300287.1|1963030_1963360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1963381_1963747_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1963692_1964268_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274733.1|1964286_1964604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1964654_1965491_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1965502_1965775_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211421.1|1966633_1966858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1966954_1967860_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016210013.1|1968045_1969713_-	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_122941582.1|1969869_1970853_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_122941592.1|1970947_1971799_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_016210019.1|1972056_1973091_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_032126616.1|1973155_1973515_-	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210007.1|1973570_1974143_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210023.1|1974120_1976178_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210021.1|1976174_1977500_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210004.1|1977760_1978402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1978601_1979357_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210027.1|1979746_1980343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210005.1|1980422_1983227_+	response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	2.4e-57
WP_016210012.1|1983207_1983879_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210009.1|1983954_1984161_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_016210025.1|1984153_1985524_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210020.1|1985788_1985944_-	putative membrane protein	NA	NA	NA	NA	NA
WP_016210016.1|1986544_1987504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273518.1|1987670_1987964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210017.1|1988039_1988423_-	hpt domain protein	NA	NA	NA	NA	NA
WP_016210010.1|1988598_1988775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556549.1|1991444_1992331_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
1990145:1990433	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGA	NA	NA	NA	NA
WP_016210524.1|1992869_1993400_-	exsB family protein	NA	NA	NA	NA	NA
WP_016210522.1|1993410_1994463_-|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 23
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	2047582	2099748	3155351	transposase,tRNA,protease	Orpheovirus(18.18%)	52	NA	NA
WP_016209424.1|2047582_2048860_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209433.1|2048959_2049334_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209412.1|2049418_2050306_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209436.1|2050363_2051092_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_129556555.1|2051088_2052219_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209444.1|2052349_2052778_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_032126508.1|2052872_2053232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209447.1|2053221_2054433_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016209421.1|2054429_2055218_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209411.1|2055380_2056175_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_054300271.1|2056380_2057355_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046761.1|2057781_2057955_+	phosphatase	NA	NA	NA	NA	NA
WP_075274901.1|2058099_2059113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2059116_2059416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2059405_2059570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2059626_2059992_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211553.1|2060331_2061072_-	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_016211549.1|2061075_2063580_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211548.1|2063842_2064799_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211550.1|2064782_2065544_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_075274903.1|2065621_2066497_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2066621_2066867_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016211262.1|2066926_2069200_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_075273504.1|2069254_2069608_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|2069797_2070091_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_032126515.1|2070263_2070443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307354.1|2070518_2071094_-	DedA family protein	NA	NA	NA	NA	NA
WP_032126514.1|2071376_2072693_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2072703_2073072_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016211265.1|2073102_2073765_-	adenylate kinase	NA	NA	NA	NA	NA
WP_032126362.1|2073939_2074305_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2074250_2074826_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126519.1|2074993_2075713_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_016211478.1|2075692_2076508_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126518.1|2076524_2078726_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211474.1|2078808_2080158_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_016211473.1|2080232_2080832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211476.1|2080815_2081025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211931.1|2081342_2082530_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211932.1|2082725_2084015_+	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_054300152.1|2084425_2084791_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210558.1|2086427_2087183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210562.1|2087256_2088909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300273.1|2088937_2090476_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.2	5.1e-70
WP_016210560.1|2090475_2092176_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_081007068.1|2092264_2093440_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_016210559.1|2093478_2094441_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_016210566.1|2094801_2095224_-	universal stress protein	NA	NA	NA	NA	NA
WP_016210568.1|2095529_2096171_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210561.1|2096298_2097633_+	dihydroorotase	NA	NA	NA	NA	NA
WP_032126397.1|2097747_2098338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2098686_2099748_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	2107592	2152297	3155351	transposase,tRNA	Staphylococcus_phage(22.22%)	46	NA	NA
WP_129556558.1|2107592_2108486_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126170.1|2108649_2108922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211040.1|2109149_2110361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211037.1|2110711_2111341_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211042.1|2111389_2112406_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211035.1|2112652_2112868_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211043.1|2112920_2113370_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211039.1|2113449_2115195_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211036.1|2115286_2117158_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_054300271.1|2117505_2118480_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211094.1|2118499_2118823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|2119887_2122368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211092.1|2122411_2123704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307348.1|2123939_2126696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211519.1|2127851_2128271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|2128271_2128973_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|2129233_2129440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|2129669_2129975_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|2130153_2132151_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2132134_2133181_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|2133888_2134740_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|2134740_2135661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|2136071_2136356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377876.1|2136347_2136803_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2136762_2137101_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2137313_2138243_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2138399_2138828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556560.1|2138908_2139445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2139414_2140320_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2140510_2141119_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_081007013.1|2141159_2141459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2141448_2141613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274909.1|2141996_2142323_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2142421_2142997_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2142942_2143308_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556561.1|2143478_2144631_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	2.6e-58
WP_016211971.1|2144837_2145449_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2145469_2146666_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2146762_2146903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2146915_2147320_-	SufE family protein	NA	NA	NA	NA	NA
WP_075273313.1|2147445_2147784_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556562.1|2147743_2148046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|2148190_2148376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556649.1|2149553_2150411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|2150950_2151478_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_075273327.1|2151721_2152297_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	2173487	2223233	3155351	transposase,tRNA,protease	Staphylococcus_phage(33.33%)	47	NA	NA
WP_016209884.1|2173487_2174111_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2174187_2174388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2174529_2175228_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2175374_2175944_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2176258_2176882_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2177090_2177693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|2177764_2178130_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046744.1|2178186_2178360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556564.1|2179529_2179859_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273603.1|2181015_2181192_+	phosphatase	NA	NA	NA	NA	NA
WP_129556565.1|2181315_2181711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126686.1|2183180_2183765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274914.1|2184315_2185191_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_059372565.1|2185239_2185611_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556566.1|2185519_2185723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210465.1|2186230_2187073_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2187123_2187471_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2187661_2188549_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2188663_2189266_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2189262_2189982_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_075275113.1|2190050_2191760_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_016210464.1|2191910_2193848_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2193956_2195009_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2195008_2195284_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2195364_2195913_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210459.1|2198986_2199505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212492.1|2199709_2200564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2200613_2201588_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_033923740.1|2201646_2201934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211720.1|2202181_2203105_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211716.1|2203118_2204042_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126595.1|2203989_2204646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|2204948_2205776_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_052133280.1|2206216_2206588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126590.1|2206780_2208313_+	nuclease	NA	NA	NA	NA	NA
WP_032126591.1|2208375_2209713_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_016210313.1|2209855_2211322_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210314.1|2211318_2212368_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_016210306.1|2212491_2214600_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|2214764_2215169_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2215229_2215955_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210307.1|2216040_2216931_+	YicC family protein	NA	NA	NA	NA	NA
WP_032126592.1|2216971_2217592_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.3	2.5e-20
WP_016210310.1|2217652_2217859_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_016210316.1|2217880_2220034_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.1e-12
WP_016210317.1|2220040_2222023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2222258_2223233_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 26
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	2229425	2274926	3155351	transposase	Staphylococcus_phage(50.0%)	52	NA	NA
WP_054300443.1|2229425_2229704_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|2229756_2230005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|2229962_2231024_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212177.1|2232019_2232193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2232269_2232527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2233601_2234177_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274918.1|2234122_2234488_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212205.1|2235171_2235351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|2235490_2236936_+	MFS transporter	NA	NA	NA	NA	NA
WP_016212319.1|2237494_2237722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2237708_2238035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2238036_2238468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|2238996_2240058_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210831.1|2240152_2240698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2240967_2241987_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2241973_2242396_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2242397_2242871_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|2242986_2243610_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|2243639_2244314_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2244319_2245468_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2245464_2245926_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2246001_2247252_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2247378_2249058_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2249167_2250034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274920.1|2251464_2252199_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	4.8e-10
WP_016211000.1|2252294_2253080_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2253223_2253910_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2253943_2254342_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2254505_2254811_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|2254888_2255143_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2255296_2256958_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2257017_2257701_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2257700_2258789_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2258837_2261474_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300237.1|2261886_2262948_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556568.1|2263137_2264619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2264655_2265231_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|2265176_2265467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2265480_2266056_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2266001_2266367_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212450.1|2266522_2267425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2267468_2268443_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211507.1|2268756_2270076_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|2270079_2270796_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|2270792_2271434_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_075274921.1|2271426_2271525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274922.1|2271502_2271799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211503.1|2271809_2272265_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|2272319_2272664_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2272693_2273737_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|2274151_2274361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2274350_2274926_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	2344129	2403741	3155351	transposase,tRNA	Planktothrix_phage(16.67%)	56	NA	NA
WP_129556571.1|2344129_2344840_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2344868_2345273_+	RidA family protein	NA	NA	NA	NA	NA
WP_016209567.1|2346388_2347006_-	MFS transporter	NA	NA	NA	NA	NA
WP_155046949.1|2347076_2347247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126712.1|2347440_2347899_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2348643_2349654_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2350138_2351050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2351375_2354870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2354907_2355747_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_016209564.1|2355933_2356149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2356197_2356773_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2356769_2357108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2357276_2358266_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2358266_2359229_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_016209559.1|2359238_2360141_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300271.1|2360184_2361159_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2361296_2361530_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2361623_2361989_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2362045_2362210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2362199_2362499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212572.1|2362556_2362949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2363078_2363444_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2363500_2363809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2363900_2364476_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2364421_2364787_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|2364939_2365212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212514.1|2365622_2365760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2365778_2366615_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2366626_2366899_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126774.1|2367054_2367390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2367549_2369082_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2369114_2369954_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2369950_2370448_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211412.1|2370451_2371444_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211408.1|2371558_2372905_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2373128_2374190_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2374268_2375414_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|2381513_2382371_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2382357_2383281_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211368.1|2383477_2384869_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2384915_2385959_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2386001_2386445_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2386577_2387768_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2387822_2387969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|2388520_2389438_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2389705_2389999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2390075_2390270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2392672_2393515_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2393582_2394233_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|2394247_2395288_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|2395410_2396496_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2396522_2397632_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2397648_2397966_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2397962_2398322_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_080664847.1|2401653_2402607_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_075274927.1|2402679_2403741_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	2490798	2575971	3155351	transposase,tRNA	Escherichia_phage(42.86%)	87	NA	NA
WP_033923779.1|2490798_2491635_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2491646_2491919_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211743.1|2491985_2492348_-	ABC transporter membrane domain protein	NA	NA	NA	NA	NA
WP_129556577.1|2492334_2493363_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	4.8e-16
WP_016211744.1|2493340_2493745_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_016211742.1|2493975_2495955_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054300202.1|2496234_2496963_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|2497052_2497664_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016210955.1|2498020_2498275_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2498373_2500158_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_016210956.1|2500246_2500966_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|2501148_2501355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210948.1|2501354_2501591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2501603_2501981_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2502487_2503306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210947.1|2503399_2503597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|2503691_2505077_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|2505203_2505794_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_075274930.1|2506604_2507024_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274931.1|2507053_2507782_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_032126570.1|2508539_2508839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211816.1|2508851_2509205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2509246_2510860_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2511081_2511303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274933.1|2511611_2512340_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2512956_2514054_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2514087_2515338_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_075274934.1|2515825_2516494_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.0	2.8e-41
WP_016212193.1|2516616_2516955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2517022_2517409_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2517405_2517651_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300202.1|2518059_2518788_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211625.1|2519271_2520141_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_016211621.1|2520137_2521487_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	4.6e-75
WP_016211623.1|2521599_2523240_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_054300202.1|2524054_2524783_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211987.1|2525062_2526799_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_144019359.1|2526960_2527158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2527302_2528031_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_098082825.1|2528094_2528403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2528395_2528728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2528731_2529301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211655.1|2529429_2529843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211652.1|2530102_2531308_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211653.1|2531415_2532441_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_054300202.1|2532532_2533261_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212214.1|2533419_2533920_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036780855.1|2533894_2534392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|2535157_2535886_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211053.1|2535928_2536495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211047.1|2536582_2538217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2538578_2539082_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2539044_2539752_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2539820_2540681_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_016211045.1|2540661_2541435_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2541465_2542719_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2542718_2543681_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2543724_2544477_+	ComF family protein	NA	NA	NA	NA	NA
WP_016210615.1|2546852_2547323_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2547368_2547608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274938.1|2547626_2548133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2548296_2549721_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|2549785_2550835_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2551101_2551881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2551924_2552827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210625.1|2552885_2553632_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_155069076.1|2553880_2556691_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_129556661.1|2556991_2557555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2557543_2558272_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2558361_2558568_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212263.1|2558730_2559324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212264.1|2559369_2559963_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	5.4e-28
WP_016212238.1|2560478_2561768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274939.1|2561797_2562526_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.8e-42
WP_087910645.1|2562638_2563791_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274940.1|2563819_2564500_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	2.0e-42
WP_016211997.1|2564855_2565965_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.5	4.4e-07
WP_016211996.1|2565966_2566914_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_075274941.1|2567297_2568026_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.2e-42
WP_075275114.1|2568055_2568418_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212339.1|2568570_2569317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069078.1|2569335_2570064_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	2.1e-45
WP_032127022.1|2570740_2572927_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2572988_2574142_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2574427_2574952_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|2575142_2575310_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|2575254_2575971_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
>prophage 29
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	2590789	2613657	3155351	integrase,transposase,tRNA,protease	Bacillus_phage(16.67%)	20	2588516:2588575	2596757:2597044
2588516:2588575	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_081377879.1|2590789_2591014_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_016212230.1|2591069_2592518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2594051_2594240_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556589.1|2595641_2595917_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2595919_2596522_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_155046749.1|2596585_2596873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|2597417_2598497_+	hypothetical protein	NA	NA	NA	NA	NA
2596757:2597044	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_016211874.1|2598815_2600534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2600577_2601483_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046750.1|2602727_2602865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2604051_2604627_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_016210050.1|2604702_2605578_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210054.1|2605642_2606164_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210069.1|2606148_2607231_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.6e-20
WP_016210051.1|2607471_2607876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2608300_2609032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2609288_2610590_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2610731_2611400_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2611843_2612440_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2612460_2613657_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
>prophage 30
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	2642297	2694930	3155351	transposase,tRNA	Microbacterium_phage(12.5%)	56	NA	NA
WP_054300282.1|2642297_2642762_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377880.1|2642818_2643298_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2644155_2644551_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_016211756.1|2645519_2646245_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2646490_2647678_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_081377344.1|2648032_2649160_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210935.1|2649490_2650033_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2650029_2650716_-	acireductone synthase	NA	NA	NA	NA	NA
WP_016210942.1|2650719_2651331_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2651377_2652397_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2652498_2653293_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2653330_2654137_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2654215_2655265_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2655462_2656722_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2656768_2657446_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2657531_2657813_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|2657904_2659092_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_129556549.1|2659199_2660086_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210820.1|2660287_2661229_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2661732_2661957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2662248_2662953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|2663402_2664041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2664375_2664906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779158.1|2664902_2666435_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2666431_2667382_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2667801_2668434_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2668676_2668874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2669223_2669652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307340.1|2669729_2670428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274949.1|2670405_2671467_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2671691_2671988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|2672092_2672749_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2672972_2673470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377881.1|2674386_2674554_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377882.1|2674560_2674842_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2674801_2675140_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210986.1|2675197_2676736_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	1.3e-86
WP_098082804.1|2676847_2677946_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2678183_2679383_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2679412_2680051_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|2680066_2682250_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|2682487_2682832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210984.1|2682845_2683796_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_052104666.1|2683960_2684419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|2685006_2686134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2686257_2686920_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2687011_2687257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211962.1|2687554_2688070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2688618_2689278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2689379_2690030_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|2690142_2690463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2690521_2691496_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2691746_2691968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212027.1|2691990_2693214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212028.1|2693708_2693957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2694044_2694930_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	2734433	2817752	3155351	transposase,tRNA,protease	unidentified_phage(21.43%)	83	NA	NA
WP_075273298.1|2734433_2735009_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923659.1|2735146_2735755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307321.1|2735817_2736366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209980.1|2736452_2737619_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.7e-25
WP_032126286.1|2737924_2740723_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	4.9e-180
WP_016209981.1|2740781_2742002_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	8.5e-36
WP_016209998.1|2742031_2742433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209994.1|2743099_2743387_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_016209985.1|2743543_2743882_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_016209995.1|2743916_2745554_-	response regulator	NA	NA	NA	NA	NA
WP_016209992.1|2745655_2746705_+	WD domain, G-beta repeat family protein	NA	NA	NA	NA	NA
WP_016209988.1|2746777_2747422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556662.1|2747418_2748666_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_016209986.1|2748671_2749961_-	ubiquinone biosynthesis hydroxylase UbiH/UbiF/VisC/COQ6 family protein	NA	NA	NA	NA	NA
WP_016209989.1|2749985_2750576_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_016209996.1|2750720_2750945_+	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_016209991.1|2750925_2751255_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_033923658.1|2751480_2752044_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209997.1|2752078_2752540_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_016209977.1|2752616_2754302_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_032126288.1|2754351_2755152_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_016210000.1|2755178_2755727_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_016209993.1|2755856_2756249_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016209990.1|2756305_2756710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144019123.1|2756742_2757486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2757975_2759037_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2759127_2759874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274953.1|2759998_2760862_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2761105_2761468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377902.1|2761654_2762182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2762326_2762743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2764514_2765426_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2765477_2766326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2766770_2767481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2767572_2768541_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2768528_2769176_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_016210370.1|2769204_2770056_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2770070_2771348_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2771388_2771904_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210372.1|2771982_2773044_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2773065_2774154_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_016210378.1|2774198_2776034_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2776076_2776547_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2776583_2776919_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2776931_2777648_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2777584_2778601_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2778597_2779077_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2779160_2781641_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2781703_2782069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273456.1|2782446_2782746_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2782705_2783161_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2783175_2783466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210570.1|2783531_2785130_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2785260_2785596_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_016210578.1|2785623_2787288_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	7.1e-33
WP_016210581.1|2787284_2787929_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2787928_2788672_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2788730_2788970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2789120_2790488_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2790498_2791050_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2791130_2792114_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2792235_2793993_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2794215_2794806_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2794893_2795313_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_016210580.1|2795453_2795714_+	methyltransferase	NA	NA	NA	NA	NA
WP_075274955.1|2795789_2796764_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_075274956.1|2796806_2797175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2797235_2798021_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075274955.1|2799406_2800381_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212084.1|2800662_2801679_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2801678_2802194_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2802235_2802709_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_052133268.1|2802866_2803148_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	40.2	3.1e-10
WP_129556741.1|2803169_2803841_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.4	3.4e-10
WP_016212306.1|2803876_2804407_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2804436_2804892_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_129556598.1|2807441_2809955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211935.1|2810889_2813538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274958.1|2813986_2815048_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2815074_2815650_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2815595_2815961_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046755.1|2816032_2816209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556599.1|2816599_2817752_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 32
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	2930314	2973712	3155351	transposase,protease	Acanthamoeba_polyphaga_lentillevirus(14.29%)	41	NA	NA
WP_016209259.1|2930314_2931163_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_016209274.1|2931279_2932191_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_075274963.1|2932909_2933971_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212454.1|2934190_2934871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211192.1|2935659_2937018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211189.1|2937062_2937521_-	NfeD family protein	NA	NA	NA	NA	NA
WP_016211187.1|2937545_2938466_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_016211186.1|2938592_2939375_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.3	8.2e-32
WP_016211190.1|2939464_2940964_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_016211188.1|2941285_2943169_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_075273298.1|2943242_2943818_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2943763_2944129_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211157.1|2944693_2945350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211161.1|2945457_2946567_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2946578_2947223_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2947241_2948228_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2948307_2949384_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2949586_2950411_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2950727_2951732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2951940_2952906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274965.1|2953044_2953920_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2954216_2955269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2955536_2955965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2956178_2956670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2956725_2957976_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2958078_2958297_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_052104629.1|2958739_2959765_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080728341.1|2960214_2960385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212561.1|2960356_2960497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210728.1|2961411_2961882_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2962170_2963550_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2963577_2964036_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2964013_2965231_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2965422_2965659_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2965672_2965828_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2965908_2966871_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2967030_2968347_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2968356_2969025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2969387_2971202_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_129556601.1|2971319_2972096_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_052104629.1|2972686_2973712_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP038932	Piscirickettsia salmonis strain Psal-025 chromosome, complete genome	3155351	3005396	3122823	3155351	transposase,tRNA	Staphylococcus_phage(33.33%)	112	NA	NA
WP_054300271.1|3005396_3006371_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|3006446_3007466_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047000.1|3007513_3007660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556602.1|3007864_3008074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274966.1|3010065_3011127_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|3011207_3011516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|3011630_3012947_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664857.1|3013408_3014695_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|3014767_3015664_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|3015750_3016749_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|3016857_3017382_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|3017629_3018868_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|3019415_3019889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|3019885_3020281_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3021210_3021786_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3021731_3022097_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211610.1|3022361_3024692_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_129556603.1|3024812_3026828_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075274967.1|3027011_3030404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3030468_3030774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274968.1|3030943_3032044_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049897.1|3032291_3033548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209721.1|3034486_3035884_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.3e-77
WP_051307313.1|3036003_3036951_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3036947_3037463_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3037449_3038649_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3038645_3038969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3038970_3040200_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3040199_3041243_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3041242_3041926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3041922_3044412_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3044428_3044683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3044683_3045040_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3045819_3046983_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3047002_3050110_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3050111_3051617_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3051644_3051926_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3052074_3052416_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3052535_3054416_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3054500_3056099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3056116_3057232_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_155069083.1|3057359_3058358_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|3058361_3059120_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3059121_3060321_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3060304_3060976_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3060997_3061774_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3061777_3062776_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3062777_3063356_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3063352_3064822_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3064865_3065153_-	trp operon repressor	NA	NA	NA	NA	NA
WP_016209699.1|3065353_3065950_+	DMT family transporter	NA	NA	NA	NA	NA
WP_075274970.1|3066159_3066630_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3066686_3066842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274971.1|3066986_3067439_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3067624_3067846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|3067961_3068594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274972.1|3068571_3069633_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211865.1|3070072_3070612_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3070696_3071233_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3071884_3072187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3072636_3072945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274973.1|3073535_3074003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3074285_3074996_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3075222_3075621_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|3076488_3077439_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3077438_3079517_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3079664_3080180_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3080188_3080752_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3080732_3081479_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3081618_3082071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3082494_3083331_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3083327_3084224_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3084256_3085324_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3085342_3085711_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3085736_3087185_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3087194_3088574_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3088614_3089946_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3089917_3090877_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3090969_3091473_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3091607_3092759_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3092755_3093235_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3093381_3095703_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3095647_3096274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3096278_3097178_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3097250_3097829_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3098129_3098387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556611.1|3098395_3099549_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046758.1|3100685_3100817_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3100961_3101117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212051.1|3101444_3102218_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126148.1|3102759_3102942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3103545_3104520_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3105614_3105953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212337.1|3105969_3106680_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_051307375.1|3106667_3106859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|3107020_3107320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3107309_3107474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3107530_3107896_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3109200_3109896_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3109892_3111320_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3111345_3111609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3111969_3112944_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556612.1|3113002_3113853_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3113890_3114235_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3114231_3115068_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3115068_3115410_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3115411_3116017_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3116013_3118008_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3118027_3118969_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211292.1|3119196_3120621_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3121133_3122108_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3122166_3122823_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038933	Piscirickettsia salmonis strain Psal-025 plasmid unnamed1, complete sequence	225323	2323	29979	225323	transposase,integrase	Streptococcus_phage(36.36%)	27	NA	NA
WP_129556705.1|2323_2824_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	28.0	9.9e-07
WP_036771330.1|2882_3857_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_054300162.1|4369_5452_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212151.1|5816_6779_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|6802_7117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923686.1|7173_8223_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|8331_9372_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|9385_10015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|10105_10405_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211886.1|10401_10830_-	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_054300202.1|11618_12347_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126832.1|12591_13500_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_054300202.1|13610_14339_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046765.1|14450_14645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|15531_16260_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|16463_19040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046766.1|19264_19402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|19445_20420_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075274931.1|20620_21349_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.4e-38
WP_016212137.1|21792_22854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212139.1|22929_23175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307371.1|23146_23761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|24578_25553_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556707.1|25912_26932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|27560_28714_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126239.1|28858_29131_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|29142_29979_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
>prophage 2
NZ_CP038933	Piscirickettsia salmonis strain Psal-025 plasmid unnamed1, complete sequence	225323	63202	161004	225323	head,integrase,protease,transposase,tail,capsid	Streptococcus_phage(13.04%)	117	63550:63609	164577:165439
WP_054300162.1|63202_64285_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
63550:63609	attL	GATGTTCTATCTTGCCGCAATACTCTGTTCCCCGATCAGTTAAAATGCGTAGCAATGGAG	NA	NA	NA	NA
WP_047927050.1|64408_65197_-	hypothetical protein	NA	NA	NA	NA	NA
63550:63609	attL	GATGTTCTATCTTGCCGCAATACTCTGTTCCCCGATCAGTTAAAATGCGTAGCAATGGAG	NA	NA	NA	NA
WP_036816706.1|65256_65820_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_047927049.1|65888_66260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242580.1|66707_66941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242581.1|67117_69304_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.3	1.1e-73
WP_027242582.1|69313_69715_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.9	6.0e-23
WP_027242583.1|69711_70023_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	38.7	2.3e-14
WP_144420830.1|70379_70685_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_027242576.1|70790_72653_+	AAA family ATPase	NA	A0A088C4M0	Shewanella_sp._phage	30.9	1.0e-56
WP_155046642.1|72680_73172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046643.1|73405_73558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774189.1|73605_74613_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|74612_74870_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774631.1|76136_76601_+	hypothetical protein	NA	H6WFS7	Cyanophage	38.2	2.9e-21
WP_080963647.1|76939_77110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242602.1|78085_78358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|78683_78956_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|78959_79220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242600.1|79492_80083_+|integrase	site-specific integrase	integrase	K4K327	Caulobacter_virus	32.3	3.9e-18
WP_048876031.1|80110_81514_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927063.1|83610_84735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927062.1|84734_85061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856777.1|85577_85799_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_047927060.1|85788_86649_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	25.3	9.3e-13
WP_036774869.1|86645_87494_+	ParB/RepB/Spo0J family partition protein	NA	Q331U1	Clostridium_botulinum_C_phage	25.7	7.1e-05
WP_032126239.1|88733_89006_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|89017_89854_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075275144.1|89886_90618_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|90715_91129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212017.1|91423_91822_+	hypothetical protein	NA	W8VUR5	Pseudomonas_phage	38.8	2.3e-06
WP_047927838.1|91851_92097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|92093_92393_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016212019.1|92549_93245_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_081377351.1|94058_94838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|94921_95074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|95026_95359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|95523_95901_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|96207_96591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|97060_97789_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_129556708.1|97904_98240_-	mRNA-degrading endonuclease	NA	A9D9Y1	Lactobacillus_prophage	35.6	2.6e-11
WP_016212365.1|98232_98475_-	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_054300271.1|98683_99658_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075275142.1|100293_101022_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_075275141.1|101304_102990_+	protein kinase	NA	NA	NA	NA	NA
WP_129556709.1|103201_103291_+	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_129556710.1|103371_103842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275140.1|103995_104730_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.1e-38
WP_075275139.1|105356_105587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212404.1|106201_106435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126756.1|106555_106999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275138.1|107143_107452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047124.1|107656_109318_+	AAA family ATPase	NA	A0A0K2FLP8	Brevibacillus_phage	31.5	9.1e-65
WP_016212457.1|109327_109729_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_016212456.1|109725_110013_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_075275137.1|110056_110470_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126239.1|110525_110798_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|110809_111646_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_016212579.1|112576_112774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|114279_114480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|114490_115066_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|115011_115377_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|116208_118251_-	hypothetical protein	NA	NA	NA	NA	NA
115910:116211	attR	CTCCATTGCTACGCATTTTAACTGATCGGGGAACAGAGTATTGCGGCAAGATAGAACATCGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACTACTGTGCTCTCACATGACTCTACGATTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGCCTTTCACAACTCCGCTCTGCTAAAAACCCGAACCTA	NA	NA	NA	NA
WP_032126362.1|119155_119521_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
115910:116211	attR	CTCCATTGCTACGCATTTTAACTGATCGGGGAACAGAGTATTGCGGCAAGATAGAACATCGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACTACTGTGCTCTCACATGACTCTACGATTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGCCTTTCACAACTCCGCTCTGCTAAAAACCCGAACCTA	NA	NA	NA	NA
WP_075273327.1|119466_120042_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075274752.1|120038_120338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|120373_121527_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_052047048.1|121707_122208_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|122207_122369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211937.1|122638_123028_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211936.1|123517_124540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211938.1|125034_125595_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275133.1|126166_126475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|127007_128161_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273327.1|128409_128985_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075275128.1|128930_129296_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556696.1|129395_130412_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.0	3.0e-18
WP_052133287.1|130513_130912_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556716.1|131045_131336_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_016210655.1|131349_131946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210663.1|132264_132576_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210667.1|132572_132896_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210658.1|132888_133284_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210651.1|133280_133631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210664.1|133630_134053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210669.1|134054_134378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|134434_134701_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075273774.1|136902_138060_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275128.1|138201_138567_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|138512_139088_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126790.1|139530_140436_-|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_129556697.1|140848_141241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211776.1|141723_143061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|143228_143597_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211773.1|143698_144373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|144825_145191_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|145136_145712_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126360.1|145918_146653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|146775_147834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|148342_149089_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|149089_149494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|149887_150703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|151307_152036_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212298.1|152477_152804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|153044_153521_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_075275158.1|153635_153929_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377916.1|154045_154570_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.4	2.5e-29
WP_098082791.1|154774_155077_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.6	8.6e-14
WP_129556698.1|155085_155787_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_016211912.1|155876_156467_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_032126795.1|156739_157000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|157003_157276_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_016211913.1|157601_158723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273786.1|159155_159554_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377915.1|159562_160120_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	2.9e-47
WP_081377914.1|160264_160594_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|160710_161004_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
164577:165439	attR	GGCACTGTTGCGAAAAATTATAGTGAACTTCAGAAAGGTTATTTTCTTGTGCTCTCTGCTTAGAATTAAGCAGCTAATCCAAATAATTTATCAATGAGCTGATTTTGGGCACAGATATTCTGTTTTTTAATATAACGTAATTGACCTTTTTGAACCATGCGCATCGCTTCCATTATGTCAATGGTAGGCCGTGCTGTAGAAAGTGATTGGTACCATTGGCGGAAACGGGATTTGCGCTTTACCGCTTTGTGATCATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACACTGACTAGAAAAGACACCTTCATCTTTGGCTTTTTGGTGAGCGGGTGGAAATGAAGCGTGCTTGTCGACATTCACAACACGCGGTGATTTCACATAAGGTTGGGCGATTGCCTTTTTGAAAAAGCGCATCGCCGCTTTGGCATTTTGCTGTCGGCTGAGCATCCAGTCCAAAGTATGGCCATATTTATCAATGGCTCGATAAAGGTAATACCAACGACCTTTGATTTTCACCAACGTTTCATCTAACCGCCAAGAGGCACACGTTTGACGAAAGTGGGGCCTCAGCCGTTTGGCGATCTGCGAGCCATACTCGTGCACCCAGCGACAAATGGTTGAACGCTCAATCTCAAGACCTCTTTCAGCTGCTATTTCTTTGAGATCACGGTAAGATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATGATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTCTACCCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCCG	NA	NA	NA	NA
>prophage 3
NZ_CP038933	Piscirickettsia salmonis strain Psal-025 plasmid unnamed1, complete sequence	225323	164641	211063	225323	transposase,integrase	Streptococcus_phage(26.32%)	55	190513:190572	209993:210947
WP_054300202.1|164641_165370_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_054300590.1|165399_165624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556699.1|165931_166132_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211871.1|166125_166461_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_032126138.1|167026_167290_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211872.1|167844_168648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|168768_169293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273798.1|169401_169626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126346.1|169717_169960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|170026_170767_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_016212413.1|170814_171243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|171576_172305_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155062493.1|172418_172727_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|172686_173142_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_054300148.1|173247_174309_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728342.1|174348_174852_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032126739.1|175166_175499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556701.1|175745_176270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275159.1|176678_177386_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	32.0	3.8e-12
WP_129556702.1|177406_178559_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273327.1|179543_180119_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|180064_180430_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212398.1|181777_182239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|182501_183338_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_129556717.1|183663_184890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|185544_186519_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_016212260.1|186676_186949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|186968_187193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|187529_187733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212255.1|187729_187900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|188086_189169_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_075273822.1|189325_189826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274741.1|189927_190185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556718.1|190253_191440_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
190513:190572	attL	CTTTCTGAAGCATATTGGCTTCCGCGATCTGAATGCCAAATTAACCCAGCTTTAGGCTTT	NA	NA	NA	NA
WP_155046769.1|192689_192860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|193189_194005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372616.1|194250_194841_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	38.8	6.8e-23
WP_016211879.1|195806_196826_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211878.1|196838_198179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046770.1|198475_198643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|198698_199427_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155049199.1|199395_199641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047019.1|200130_200283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273751.1|200295_202026_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300477.1|202185_202914_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	7.1e-38
WP_155047020.1|203070_203994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275154.1|204234_204891_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.7	7.6e-31
WP_054300202.1|205020_205749_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075275153.1|205993_206791_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_075275152.1|206900_207770_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155069099.1|207766_208351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275150.1|208551_209040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377912.1|209088_209451_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.5	1.3e-05
WP_081377345.1|209567_210092_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.5	1.4e-27
WP_036774259.1|210088_211063_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
209993:210947	attR	AAAGCCTAAAGCTGGGTTAATTTGGCATTCAGATCGCGGAAGCCAATATGCTTCAGAAAGCGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCGATAATTCAAACTCGCTCTTCTTCTGGTATTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAACTTCATTAAAATCCGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGTTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCGGCAAATTCTGTTCCGTTGTCAGAAGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGGTCACGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGTTGTTCAATACCAACGCGATTAGGTATTTTTGTTTGATCACCACGACTCACCTTCTTCTTATAAGGTTTTCCTGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCTCGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTCTCACTCACCTGAATATTATGCTCACGTATAAGTTCTTGACTGATAACATCGGGGGATGTATGAGTGCTTAACCGCTGATGAATCAACATTTTTTCCTCTTCTGAAATTTGTTGAAAAGCTTGTCCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCACAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGG	NA	NA	NA	NA
>prophage 1
NZ_CP038934	Piscirickettsia salmonis strain Psal-025 plasmid unnamed2, complete sequence	80231	4824	28863	80231	transposase	Streptococcus_phage(16.67%)	33	NA	NA
WP_075273327.1|4824_5400_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|5345_5711_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212400.1|5761_6361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046771.1|6360_6594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|6750_7903_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212392.1|7931_8939_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	26.4	1.2e-06
WP_075273802.1|9002_9731_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_016212131.1|9914_10262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212135.1|10700_11885_+	3-methylitaconate isomerase	NA	NA	NA	NA	NA
WP_075275202.1|12128_12830_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	6.0e-10
WP_075275201.1|12832_13561_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_016212164.1|13689_14718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211443.1|15741_16428_+	Fic family protein	NA	NA	NA	NA	NA
WP_016211439.1|16431_16986_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	40.6	1.0e-20
WP_016211436.1|17030_17969_+	fic/DOC family protein	NA	S4TP71	Salmonella_phage	37.2	5.2e-25
WP_016211434.1|17941_18133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211445.1|18310_18661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211437.1|18677_19304_-	zinc-ribbon domain-containing protein	NA	A0A1S5XYQ1	Kurlavirus	28.2	4.4e-12
WP_032126541.1|19310_19703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211440.1|19713_20628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211444.1|20897_21404_+	antirestriction protein ArdA	NA	A0A222YZE5	Mycobacterium_phage	33.7	2.8e-17
WP_051307358.1|21552_21936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556729.1|22219_22450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212541.1|22436_22661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212539.1|22720_22870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|22866_23841_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212090.1|23884_24064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212087.1|24063_24492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126714.1|24659_25199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212089.1|25435_25666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126713.1|25764_26802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|27271_28297_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275198.1|28323_28863_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	40.2	8.4e-12
>prophage 2
NZ_CP038934	Piscirickettsia salmonis strain Psal-025 plasmid unnamed2, complete sequence	80231	37206	58175	80231	terminase,portal,head,capsid,tail	Pseudomonas_phage(11.11%)	30	NA	NA
WP_129556725.1|37206_37887_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	39.3	3.3e-37
WP_016210977.1|38065_38359_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_129556724.1|38576_38759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046773.1|38903_39083_-	phosphatase	NA	NA	NA	NA	NA
WP_129556723.1|39177_39495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126134.1|39795_40179_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	5.6e-26
WP_016212234.1|40266_40746_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_016212231.1|40749_40959_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	43.1	1.3e-08
WP_080743047.1|40974_41331_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	61.3	5.4e-23
WP_081377926.1|41349_42432_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	1.2e-89
WP_016211136.1|42428_43670_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	46.0	3.1e-86
WP_155069102.1|43632_43977_+	hypothetical protein	NA	K7PKX4	Enterobacterial_phage	57.9	1.2e-16
WP_155069103.1|44121_44577_+	hypothetical protein	NA	A0A2I7SCY8	Paenibacillus_phage	43.0	4.9e-21
WP_016211140.1|44634_45828_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_016211133.1|45948_47283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|47473_47785_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211132.1|47781_48105_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211139.1|48097_48493_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211129.1|48489_48840_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|48839_49262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126913.1|49263_49587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|49643_49910_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_032126912.1|49913_51992_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.0	2.5e-56
WP_016210657.1|51984_52326_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|52322_52994_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|52962_53709_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_016210665.1|53698_54256_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_016210662.1|54262_54550_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	2.5e-15
WP_016210670.1|54539_54794_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_016210653.1|54887_58175_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	33.5	5.2e-112
>prophage 1
NZ_CP038935	Piscirickettsia salmonis strain Psal-025 plasmid unnamed3, complete sequence	38756	17458	25469	38756	transposase,integrase	unidentified_phage(33.33%)	10	11063:11122	24791:24982
11063:11122	attL	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTA	NA	NA	NA	NA
WP_129556741.1|17458_18130_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.4	3.4e-10
WP_052133268.1|18151_18433_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	38.7	8.3e-11
WP_016212274.1|18505_18970_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032126154.1|18980_19175_-	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_032126152.1|19390_19981_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
WP_129556740.1|20044_20413_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155046774.1|20624_20801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300579.1|21019_22021_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	1.3e-26
WP_155069108.1|22668_24711_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_129556739.1|24740_25469_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
24791:24982	attR	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTACCGTGATCTCAAAGAAATAGCAGCTGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGTTGGGTGCACGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTC	NA	NA	NA	NA
