The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	45576	89169	3142147	transposase	Moraxella_phage(20.0%)	43	NA	NA
WP_075273371.1|45576_46152_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46097_46463_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036776493.1|46661_47423_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_036779326.1|47724_49251_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49622_50462_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50501_51809_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51783_52953_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|53007_53733_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54011_54401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54588_55494_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55541_55685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047031.1|55732_56329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|56563_57717_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016210704.1|58611_60558_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61212_64275_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64271_65336_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65691_66645_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66676_67840_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67845_68445_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68632_69133_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69150_70239_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70377_71622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71618_72461_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_036777711.1|72440_73250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73417_73645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73645_74596_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74651_75203_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75329_75752_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75744_76491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76533_77232_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77242_78067_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78396_78765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|78759_79821_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|79870_80101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80230_81445_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81745_82807_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_036777695.1|82820_84548_+	oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_016211245.1|84581_85313_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85312_86101_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86205_86829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87148_87361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047032.1|87516_88578_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047033.1|88572_89169_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	127259	181540	3142147	transposase	Staphylococcus_phage(42.86%)	58	NA	NA
WP_054300271.1|127259_128234_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209611.1|128482_128674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047035.1|128753_128933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209580.1|129024_129549_+	ankyrin repeat family protein	NA	NA	NA	NA	NA
WP_016209612.1|129932_130301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209595.1|130338_130611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300576.1|130701_131997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211692.1|132632_133535_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.4	1.6e-18
WP_051307362.1|133591_134443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211694.1|135022_137032_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	3.0e-110
WP_054300271.1|137069_138044_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|138545_139958_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|140450_141458_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|141477_142998_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_016211018.1|143948_145265_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145368_145752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145886_148952_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|149020_150124_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|150147_150702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150816_151386_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151505_152261_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_155047036.1|152427_153327_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047037.1|153471_153777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082829.1|154171_154567_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|154588_154954_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|155010_155175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|155164_155464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300544.1|155554_156001_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|156496_157063_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|157074_157860_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|158491_159415_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|159466_160462_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|160493_160988_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_036778333.1|161079_161337_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|161426_161849_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|162167_162884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|162927_163179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778330.1|163183_164620_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|164647_166090_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|166177_166516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|166600_167131_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|167191_169384_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_098082837.1|169426_169918_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|170187_170619_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036778324.1|170636_171467_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|171481_171625_-	lipoprotein	NA	NA	NA	NA	NA
WP_052104672.1|171655_172540_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|172511_172733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|172906_173185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|174155_175061_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_036780891.1|175117_176296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|176292_176868_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155053570.1|176966_177179_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300541.1|177506_178286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126848.1|178819_179620_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_052104671.1|179838_180597_+	ion transporter	NA	NA	NA	NA	NA
WP_016211859.1|180673_180961_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_075273327.1|180964_181540_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	200556	271553	3142147	transposase,tail,protease,tRNA	Acinetobacter_phage(25.0%)	58	NA	NA
WP_016209871.1|200556_202539_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|202748_204092_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|204358_207028_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|207051_208971_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|209140_210562_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|210707_211682_+	phospholipase A	NA	NA	NA	NA	NA
WP_054300537.1|211713_212121_+	glyoxalase	NA	NA	NA	NA	NA
WP_016209859.1|212399_212621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|212784_214446_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|214518_214809_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_036776911.1|215034_215490_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|215554_216019_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216111_217458_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|217457_218363_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|218424_219411_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|219403_219646_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|219767_221312_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_036776914.1|221358_222645_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|222687_224082_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224105_224285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|224281_224461_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300181.1|224464_224746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|224802_225168_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210079.1|228173_228671_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|228841_229537_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|229639_231202_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|231517_233311_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233396_233669_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|233674_234301_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234287_235718_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236050_237106_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237074_237752_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|237741_238578_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|238737_239031_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|239137_239944_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|240248_241103_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_036776920.1|241257_242307_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_036776924.1|242357_243014_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|243031_244312_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|244585_245947_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_032126863.1|246346_246898_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016211802.1|252329_253601_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036778206.1|253657_254641_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|254637_255423_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_032126362.1|256119_256485_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|256430_257006_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300535.1|257009_257729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|257873_258074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|258121_258583_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|259006_260488_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|260550_261660_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|261757_263719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|264248_264653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047045.1|264705_265401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|265377_266352_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_098082809.1|266522_266873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|267815_268898_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556499.1|270400_271553_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 4
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	300567	360427	3142147	transposase	Bodo_saltans_virus(20.0%)	57	NA	NA
WP_054300526.1|300567_300864_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962174.1|301012_301177_-	phosphatase	NA	NA	NA	NA	NA
WP_016211026.1|301275_301680_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075273367.1|301972_302749_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_155047049.1|302757_304839_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	4.0e-17
WP_016211031.1|305003_305483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211032.1|305792_306590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211033.1|306701_307994_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_032126377.1|308159_309161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211034.1|309277_309457_+	rubredoxin	NA	NA	NA	NA	NA
WP_016211023.1|309467_309902_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_016211029.1|310115_310478_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.6e-25
WP_016212102.1|310651_312292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|313802_314955_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556441.1|318383_319610_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126490.1|319958_320924_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_016210868.1|320920_321220_+	pilZ domain protein	NA	NA	NA	NA	NA
WP_036778898.1|321251_322031_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_016210861.1|322056_322287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|322438_322684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210870.1|322835_323627_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016212128.1|324540_325287_+	solute symporter family protein	NA	NA	NA	NA	NA
WP_032126495.1|325377_326262_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_054300397.1|326667_326913_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046705.1|327153_327321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|327266_327842_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047050.1|327894_328632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777815.1|328635_328920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|329013_329277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|329643_330462_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|330534_332907_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_036777812.1|333619_335047_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|335081_336104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|336120_336498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|337460_337826_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|337771_338347_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210122.1|338586_339279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|339905_340880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|340869_342642_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|342642_342990_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036777821.1|343239_344466_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|344555_345854_-	MFS transporter	NA	NA	NA	NA	NA
WP_081007061.1|345887_346637_-	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	30.4	3.9e-15
WP_016210137.1|346617_347169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007060.1|347395_348694_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|348810_349101_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_155047051.1|349412_350282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047052.1|350426_351155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777801.1|352017_352236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212044.1|353009_353264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|353986_354973_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|355110_355305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007059.1|355987_357049_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_016211797.1|357210_358614_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|358664_359240_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|359185_359500_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047053.1|359540_360427_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	444659	546001	3142147	transposase,integrase,tRNA	Escherichia_phage(45.45%)	109	511446:511505	525657:525830
WP_054300513.1|444659_445523_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|445739_447299_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|447320_448355_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|448403_448973_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|449108_450080_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|450091_451669_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|451734_452721_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054300512.1|453052_454162_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|454267_455452_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|455529_457518_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|457726_457882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047055.1|458152_458440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|458477_458843_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|458788_459364_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047056.1|459353_459716_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|460632_462039_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|462056_463043_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|463045_464200_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|464196_464892_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|465026_466517_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_036777447.1|466537_467587_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|467653_469048_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_036777444.1|469926_471858_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	1.0e-120
WP_075273353.1|471862_472393_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|472427_472622_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|472664_473024_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|473443_474439_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_036777440.1|474451_476833_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|476838_477126_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|477397_477874_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|478018_478216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|478340_479315_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|480215_480314_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780545.1|480798_481509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047057.1|481672_482089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|482325_483018_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|483059_483833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|483834_484776_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|484908_486486_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|486695_488453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|489001_489760_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|489967_490540_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|490643_491192_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|491493_491739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|491767_492064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779353.1|492331_493243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300506.1|493733_494141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|494212_494941_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126799.1|495021_495834_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_155047058.1|496895_497258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|497260_499000_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046941.1|499401_499665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300500.1|500336_501065_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_016212070.1|501474_502074_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_016212069.1|502048_502216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212066.1|502427_503204_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_054300501.1|503564_504293_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|504304_504697_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|504693_504939_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|505099_505828_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211714.1|505902_509247_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|510495_511071_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|511016_511382_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
511446:511505	attL	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCT	NA	NA	NA	NA
WP_155047059.1|511660_512575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212159.1|512842_513040_+	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_054300201.1|513399_514128_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_155047060.1|514157_514832_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	45.9	5.2e-27
WP_016212024.1|514976_515225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|515221_515821_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|515820_516039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|516813_517806_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|517802_518537_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_155047061.1|518797_519064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047062.1|519208_519367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047063.1|519389_519641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300477.1|520090_520819_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_051307368.1|521525_522806_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|522805_523774_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211646.1|524145_524385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|524377_524731_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|525033_525762_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047064.1|526231_526540_-	hypothetical protein	NA	NA	NA	NA	NA
525657:525830	attR	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTTTTACCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCC	NA	NA	NA	NA
WP_155047065.1|526701_527379_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.1	7.0e-40
WP_155047066.1|527872_528601_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.5e-43
WP_016212269.1|528769_529453_+	Fic family protein	NA	NA	NA	NA	NA
WP_016212268.1|529456_530041_+	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_017375910.1|530197_530926_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047064.1|531394_531703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|531953_532556_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300203.1|532560_533019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781052.1|534395_534998_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211639.1|535377_535680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211644.1|535794_536061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104773.1|536168_536612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|536673_537559_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047067.1|537659_538553_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300202.1|538908_539637_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_155047069.1|539749_540103_-	hypothetical protein	NA	Q6DMU4	Streptococcus_phage	34.8	8.2e-08
WP_155047068.1|540190_540391_-	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	64.3	3.5e-16
WP_075274719.1|540876_541743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377363.1|542048_542405_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_036780395.1|542388_542643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274740.1|542787_543153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274718.1|543297_543768_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	64.3	1.3e-32
WP_075274717.1|543771_544002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274739.1|543998_544346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104771.1|544338_544677_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	54.9	5.4e-25
WP_155064787.1|545030_545243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|545272_546001_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 6
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	553700	601653	3142147	transposase,tRNA	Synechococcus_phage(33.33%)	51	NA	NA
WP_054300202.1|553700_554429_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|554522_555188_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|555252_556209_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|556467_557166_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|557208_558321_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|558925_559501_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|559446_559812_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|559899_560250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|560985_562047_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210908.1|563258_564074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|564164_565148_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|565318_565840_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_036779246.1|565873_566128_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.4e-20
WP_016210909.1|566130_567408_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|568100_568628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|568747_571060_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|571188_572004_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|572201_572666_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|572795_573857_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|574117_574414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|574696_576160_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|576162_577215_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_036779281.1|577204_577660_+	arginine repressor	NA	NA	NA	NA	NA
WP_155047071.1|577684_578008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|578355_578667_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_054300208.1|578796_579588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779278.1|580745_581699_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|581812_582010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|582255_582456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142396463.1|582566_582683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212074.1|582769_582991_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|583017_583383_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|583439_583604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047072.1|583593_583908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046713.1|584045_584210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|584504_585941_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|585982_587434_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|587545_587833_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|588022_589066_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210536.1|589081_589981_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210528.1|589977_590496_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210527.1|590565_591183_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_036776217.1|591192_592680_+	ribonuclease G	NA	NA	NA	NA	NA
WP_016210534.1|592689_596370_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_036776215.1|596443_597256_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210530.1|597252_597933_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_155047260.1|598773_598932_-	phosphatase	NA	NA	NA	NA	NA
WP_155047073.1|599124_599682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|599731_600022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300215.1|600825_601320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|601314_601653_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	623123	725719	3142147	transposase,protease,plate,tRNA	Prochlorococcus_phage(17.65%)	108	NA	NA
WP_016209523.1|623123_624473_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|624523_624961_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|625222_626734_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_036778935.1|626739_627966_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|627959_628988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|628965_629658_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_155049805.1|629659_631132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778941.1|631124_631613_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|631618_633091_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|633090_633489_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|633485_635174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|635155_636112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|636154_636670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|636774_637707_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|637926_638313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|638329_638974_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|639154_639994_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|640069_640672_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|640672_641527_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|641883_642195_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|642219_643611_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|643766_644498_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_129556465.1|644494_645067_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|645053_645611_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|645616_646597_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|646736_647537_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_036780687.1|647540_648308_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|648304_648769_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|648791_649445_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|649448_649796_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|649829_650081_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|650157_651426_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|651428_652187_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|652248_653139_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|653189_653873_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|653958_654216_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155047218.1|654488_656657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|656648_657521_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|657688_659518_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|659680_660322_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|660563_661094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|661111_661285_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|661343_662393_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|662399_663350_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|663403_664348_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|664375_665113_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|665201_665444_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|665518_666742_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|666773_667622_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|667618_668671_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|668791_669412_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_036780649.1|669427_670414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|670524_670980_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|670939_671278_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|672042_672948_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155047217.1|673022_674084_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|674133_674343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|675577_676024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|676027_676603_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|676548_676914_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|677034_677220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|677323_678358_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|678354_679065_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|679539_680058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|680175_680508_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_036777003.1|680537_683492_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_054300221.1|683537_684035_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|684094_684511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|684602_685463_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|685545_686112_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|686144_686999_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_155047216.1|687040_689947_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|690007_690205_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|690211_691222_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|691218_692277_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|692270_693071_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|693073_693892_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|693903_694851_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|694858_696160_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|696338_697442_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|697438_697831_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|697842_699219_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|699212_700682_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_032126362.1|701139_701505_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|701450_702026_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300223.1|702120_703092_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_129556478.1|703328_704215_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|704514_704760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|705722_706142_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046954.1|706248_706422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|706648_707383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|707507_708569_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|708891_709596_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|709689_710403_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|710485_711577_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|711648_712230_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|712235_712862_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|712958_713894_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|714253_714925_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_036778813.1|715066_715726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|715894_717154_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|717150_718236_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|718228_719110_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|719098_720349_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_054300237.1|721634_722696_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047215.1|722673_723927_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_032126362.1|724832_725198_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|725143_725719_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	761136	809061	3142147	transposase,tRNA	Staphylococcus_phage(42.86%)	37	NA	NA
WP_016209374.1|761136_762588_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|762623_764153_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_155047212.1|764728_766372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047211.1|766913_767855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|768205_769021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|769312_772003_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_081007011.1|772251_773472_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|773639_775346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|775944_777171_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|777723_778698_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273456.1|778820_779120_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047210.1|779079_779442_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|779503_780389_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047266.1|781497_781929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|782644_783010_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|782955_783531_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|783557_784619_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556478.1|784733_785620_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047209.1|785969_786524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211819.1|786742_786973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|787269_787770_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|787972_789229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777316.1|789585_789999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|790308_791193_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300240.1|791449_791653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|791952_792927_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047208.1|793229_794702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|794721_795696_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|795846_796122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|796287_796908_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_054300241.1|797226_799203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|799358_800816_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|800884_802465_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_054300242.1|802505_803042_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|803087_806984_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|806990_807314_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300237.1|807999_809061_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	825742	934526	3142147	transposase,integrase,protease	Staphylococcus_phage(26.67%)	102	888207:888266	909401:910503
WP_033923708.1|825742_826618_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|826873_827518_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|827548_829354_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|829377_829953_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_155047207.1|830497_831571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|831680_832655_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046989.1|832887_833952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|834044_835019_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046989.1|835251_836316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|836806_837172_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047206.1|837186_837696_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|837731_838706_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300250.1|838788_839448_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_016209640.1|839866_840886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|841344_842310_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|842354_842930_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|842960_844235_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|844880_845594_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|845673_846411_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|846531_847887_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|848063_848735_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|848850_849726_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|850329_851634_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|851746_852352_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|852433_853735_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|853802_856235_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|856338_856611_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075273480.1|856693_858592_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209643.1|858623_859508_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|859516_859912_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|860339_862487_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|862458_863808_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|863804_865925_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|865921_867625_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209654.1|867743_868886_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|868950_869979_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_036776625.1|870105_871620_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|871709_872195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275067.1|872527_873595_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|874657_875563_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_051307360.1|875679_876609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780074.1|877700_878507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|878849_880742_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|881028_881433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923634.1|881637_882186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|882175_883062_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|883400_883811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047205.1|883985_884207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|884694_885060_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|885005_885581_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664862.1|886754_887453_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_016211528.1|887433_887739_+	hypothetical protein	NA	NA	NA	NA	NA
888207:888266	attL	CGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACT	NA	NA	NA	NA
WP_054300271.1|888298_889273_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300253.1|889491_890442_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	34.7	6.9e-09
WP_016211534.1|890428_890938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211530.1|890943_891840_-	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211531.1|892193_892874_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155047204.1|892937_893495_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0V4T7	Roseobacter_phage	33.3	8.4e-15
WP_054300271.1|893518_894493_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212424.1|894836_895115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|895107_895380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|895497_896580_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036780532.1|896657_897698_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_081007067.1|898209_903684_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_016212302.1|903904_904204_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_155047203.1|904504_905566_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036781361.1|905585_905975_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_155047202.1|906257_907322_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.2	4.7e-139
WP_016211579.1|907826_908312_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|908379_909288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|909492_910467_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211584.1|910639_910993_+	hypothetical protein	NA	NA	NA	NA	NA
909401:910503	attR	CGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_016211586.1|911059_911254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|911269_911614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|911683_912259_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|912204_912570_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155049808.1|912654_913263_+	DNA polymerase	NA	NA	NA	NA	NA
WP_052047108.1|913347_913746_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046984.1|914557_915676_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046716.1|916097_916244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|916941_917496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|917932_918115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|918179_918407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|918637_919384_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|919610_919904_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|919975_920581_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|920729_921707_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_155047199.1|921803_923246_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|923272_923926_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_036779374.1|924050_924617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|924971_926750_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_052104721.1|926821_928528_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_054300262.1|928519_928810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|929272_929638_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|929583_930159_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|930162_930537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|930912_931887_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_054300263.1|931958_932399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047198.1|932386_932554_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|932698_932959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|932918_933257_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|933640_934526_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	955068	1000191	3142147	transposase,tRNA	Escherichia_phage(16.67%)	44	NA	NA
WP_054300173.1|955068_956130_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211781.1|956346_957594_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036779112.1|957816_959253_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_129556486.1|959338_959686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273492.1|959776_959896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|960004_961066_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|961060_961231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|961220_961385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|961441_961807_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|961828_962197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047196.1|962341_962923_-	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_017375910.1|962993_963722_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016210898.1|963978_964329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|964417_964708_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|965182_965485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300270.1|965825_966803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|966881_968219_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|968337_968709_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|968930_969581_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|969623_970706_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|970759_972643_+	APC family permease	NA	NA	NA	NA	NA
WP_033923708.1|973252_974128_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155047195.1|974140_975043_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211091.1|975117_977598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273494.1|978662_979223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|979813_980875_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275207.1|980922_981372_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211036.1|981719_983591_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_036779409.1|983682_985428_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211043.1|985507_985957_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211035.1|986009_986225_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211042.1|986471_987488_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211037.1|987536_988166_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211040.1|988516_989728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126170.1|989955_990228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047067.1|990391_991285_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556557.1|991429_991741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104774.1|991788_992421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047009.1|992565_992739_-	phosphatase	NA	NA	NA	NA	NA
WP_016211450.1|993514_994537_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211448.1|994635_995844_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211446.1|995833_997561_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036776407.1|997744_998881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|999129_1000191_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	1012699	1067588	3142147	transposase,protease,tRNA	Orpheovirus(16.67%)	56	NA	NA
WP_129556478.1|1012699_1013586_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211932.1|1013996_1015286_-	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_036777061.1|1015481_1016669_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211476.1|1016986_1017196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211473.1|1017179_1017779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211474.1|1017853_1019203_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_032126518.1|1019285_1021487_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211478.1|1021503_1022319_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126519.1|1022298_1023018_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_075273327.1|1023185_1023761_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1023706_1024072_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211265.1|1024246_1024909_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1024939_1025308_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_032126514.1|1025318_1026635_-	MFS transporter	NA	NA	NA	NA	NA
WP_051307354.1|1026917_1027493_+	DedA family protein	NA	NA	NA	NA	NA
WP_032126515.1|1027568_1027748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|1027920_1028214_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_075273504.1|1028403_1028757_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211262.1|1028811_1031085_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_016211259.1|1031144_1031390_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_054300275.1|1031514_1032390_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211550.1|1032467_1033229_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_016211548.1|1033212_1034169_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211549.1|1034431_1036936_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211553.1|1036939_1037680_+	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_054300209.1|1038019_1038385_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1038441_1038606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1038595_1038895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049809.1|1038898_1040194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1040368_1041343_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209411.1|1041548_1042343_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_016209421.1|1042505_1043294_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_036776605.1|1043290_1044502_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_032126508.1|1044491_1044851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209444.1|1044945_1045374_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_129556555.1|1045504_1046635_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209436.1|1046631_1047360_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_016209412.1|1047417_1048305_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209433.1|1048389_1048764_+	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209424.1|1048863_1050141_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_080664816.1|1050152_1050884_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_052047073.1|1050870_1052121_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_016209427.1|1052214_1053618_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_016209408.1|1053771_1053942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209406.1|1054256_1055078_+	ParA family protein	NA	Q8JL10	Natrialba_phage	32.2	5.0e-16
WP_016209405.1|1055074_1055968_+	cheW-like domain protein	NA	NA	NA	NA	NA
WP_016209443.1|1056013_1056535_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_036776598.1|1056609_1057095_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_155047194.1|1057383_1058142_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_016209404.1|1058131_1058995_-	chemotaxis phosphatase CheX family protein	NA	NA	NA	NA	NA
WP_016209435.1|1059021_1059393_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_016209445.1|1059493_1060450_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_054300277.1|1060932_1063614_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_016209439.1|1063694_1064321_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_129556553.1|1064484_1066077_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_016209434.1|1066166_1067588_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	1082627	1211843	3142147	transposase,protease,tRNA	Staphylococcus_phage(21.43%)	103	NA	NA
WP_016209432.1|1082627_1084337_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209448.1|1084594_1085926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209449.1|1086367_1087840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1088555_1088921_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273508.1|1089161_1090028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|1090540_1090885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776562.1|1091037_1091229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1091472_1092048_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1091993_1092359_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300283.1|1092599_1093241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1093708_1094683_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047193.1|1095896_1097285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780476.1|1097520_1099458_-	histidine kinase	NA	NA	NA	NA	NA
WP_016210517.1|1100471_1101191_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|1101304_1104844_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|1104910_1105729_+	ZipA protein	NA	NA	NA	NA	NA
WP_016210518.1|1105715_1107755_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210522.1|1107770_1108823_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210524.1|1108833_1109364_+	exsB family protein	NA	NA	NA	NA	NA
WP_016210010.1|1111001_1111178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780418.1|1111353_1111737_+	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_075273518.1|1111812_1112106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047192.1|1112272_1113229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|1113962_1114118_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|1114382_1115753_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_052104723.1|1115745_1116699_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036779556.1|1116679_1119484_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.0	3.1e-57
WP_016210027.1|1119563_1120160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1120549_1121305_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155047191.1|1121702_1122434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|1122694_1124020_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210023.1|1124016_1126074_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210007.1|1126051_1126624_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|1126679_1127039_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|1127103_1128138_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|1128395_1129247_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|1129341_1130325_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|1130481_1132149_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_155047190.1|1133087_1133405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556556.1|1133423_1133999_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1133944_1134310_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|1134331_1134661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047175.1|1135069_1136392_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_032126362.1|1136922_1137288_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1137233_1137809_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047189.1|1137868_1138042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047265.1|1138331_1138925_+	reverse transcriptase	NA	A0A0N7AE80	Bacillus_phage	28.9	4.0e-07
WP_105962623.1|1138933_1140087_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_081007015.1|1140579_1141005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1141216_1141474_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1141473_1142481_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300292.1|1142735_1143737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|1144192_1144345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|1144317_1144491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047188.1|1144480_1144645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300293.1|1144701_1145067_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300294.1|1145338_1146400_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211279.1|1147143_1149612_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_016211277.1|1149625_1150594_+	homoserine kinase	NA	NA	NA	NA	NA
WP_016211278.1|1150580_1151840_+	threonine synthase	NA	NA	NA	NA	NA
WP_129556646.1|1151891_1153277_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_036781047.1|1154594_1155452_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_036778145.1|1156064_1157186_+	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	8.7e-11
WP_016211172.1|1157235_1158432_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_080664856.1|1158620_1159685_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_051307350.1|1159668_1160415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778066.1|1160404_1161133_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211168.1|1161129_1161789_+	wbqC-like family protein	NA	NA	NA	NA	NA
WP_155046736.1|1161766_1162720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1162719_1163235_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778065.1|1163277_1164711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210393.1|1164804_1167006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210398.1|1167494_1169087_+	B-type flagellin	NA	NA	NA	NA	NA
WP_032126669.1|1169311_1170889_+	B-type flagellin	NA	NA	NA	NA	NA
WP_122940572.1|1171000_1171426_+	flaG family protein	NA	NA	NA	NA	NA
WP_016210394.1|1171536_1172922_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032126670.1|1172947_1173385_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210390.1|1173389_1173731_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_016210399.1|1173745_1175737_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210388.1|1175762_1176437_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210397.1|1176433_1178608_-	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210772.1|1179816_1181370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1181453_1182263_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_033923762.1|1182390_1182624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210769.1|1182924_1184427_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_016210773.1|1184730_1187424_+	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210771.1|1187420_1190822_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_054300162.1|1190913_1191996_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300297.1|1192058_1193126_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212246.1|1194061_1194718_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|1194821_1195904_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300271.1|1196243_1197218_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212247.1|1197845_1198601_-	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_036779544.1|1198967_1199975_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1199974_1200232_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047187.1|1200595_1201570_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_075273524.1|1201610_1202576_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|1202731_1204282_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_054300299.1|1206483_1207566_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049810.1|1207652_1207832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1208830_1209694_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155047186.1|1209723_1210953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047185.1|1210956_1211843_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	1252515	1428412	3142147	transposase,integrase,tRNA	Staphylococcus_phage(17.65%)	153	1284769:1284828	1360874:1361237
WP_054300304.1|1252515_1252794_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047180.1|1252846_1253050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776195.1|1253692_1254940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923708.1|1255351_1256227_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211947.1|1256341_1257487_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_129556540.1|1257479_1257875_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211946.1|1258093_1258849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212551.1|1260204_1260699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556643.1|1261156_1262521_-	histidine kinase	NA	NA	NA	NA	NA
WP_016211983.1|1262616_1263276_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_155047179.1|1263523_1263868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047178.1|1263936_1264665_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.5e-43
WP_155047177.1|1264711_1264858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300189.1|1264914_1265280_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036779232.1|1265574_1267134_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|1267494_1269465_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|1269656_1270736_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_052104715.1|1270784_1270991_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211210.1|1270997_1272479_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211214.1|1272581_1273145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1274906_1276166_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211940.1|1276286_1276619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1276732_1277707_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_155047176.1|1277851_1278004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300312.1|1278221_1279244_+	YHYH protein	NA	NA	NA	NA	NA
WP_036778055.1|1279251_1280934_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.7e-32
WP_016211344.1|1281094_1281913_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|1282126_1283110_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|1283102_1283324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|1283351_1283993_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_033923708.1|1284236_1285112_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1284769:1284828	attL	TACCTGAAATTGCTCAAGGTCTGACAGGTAAGATTATTGGTGATAAAGGTTACATTTCAC	NA	NA	NA	NA
WP_129556490.1|1287574_1288460_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1288464_1288752_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|1288804_1289083_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|1289181_1289529_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|1289850_1290090_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|1290307_1290895_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|1290855_1291191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|1291378_1292023_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|1292357_1293008_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|1293540_1294593_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032126786.1|1294610_1297691_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_054300384.1|1297989_1298805_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047175.1|1299213_1300536_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_155047174.1|1301444_1302089_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.4	1.1e-39
WP_155047173.1|1302144_1302354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209615.1|1303706_1304213_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016209623.1|1304229_1305729_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209624.1|1305750_1306362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209622.1|1306367_1307531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777073.1|1307562_1310100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|1310131_1312024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273639.1|1312391_1313108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777070.1|1313110_1315984_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_016209636.1|1315984_1316389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|1316403_1318125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|1318124_1321073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|1321075_1322473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209630.1|1322486_1323227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|1323207_1323642_+	lipoprotein	NA	NA	NA	NA	NA
WP_016209618.1|1323686_1324316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209616.1|1324386_1325301_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_033923701.1|1325331_1328634_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209627.1|1328630_1330454_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_016209617.1|1330493_1330892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209621.1|1331012_1332017_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|1332449_1333898_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_036777066.1|1333984_1337041_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081007073.1|1337023_1337194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046976.1|1337259_1337397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212485.1|1337693_1338227_-	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_032126753.1|1339039_1339504_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|1339573_1341094_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126752.1|1341181_1341784_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|1341780_1342128_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|1342278_1343262_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_122942160.1|1343889_1344870_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052047087.1|1345030_1345249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047172.1|1345420_1346446_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300320.1|1347591_1348191_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300321.1|1348408_1348780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212346.1|1349574_1349721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1349954_1350818_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211748.1|1352299_1353904_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211752.1|1353919_1355065_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_075273313.1|1355141_1355480_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1355439_1355895_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212445.1|1356140_1356407_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047171.1|1356481_1357045_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	39.9	3.2e-30
WP_155047170.1|1357249_1357531_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047169.1|1357565_1358174_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212534.1|1358586_1358853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1359980_1360346_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1360291_1360867_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047168.1|1361376_1362297_+	hypothetical protein	NA	NA	NA	NA	NA
1360874:1361237	attR	TACCTGAAATTGCTCAAGGTCTGACAGGTAAGATTATTGGTGATAAAGGTTACATTTCACAAGATTTATTTAACAGGCTTTATGAAAAAGGACTGCAATTAATCAATAAAATTCGCAAGAATATGAAAAATAGGCTCATGCCTATCATCGATAAAATTTTACTCAGAAAACGTGGAATTATTGAAAGTGTATTTGATCAACTTAAAAACATCTCACAAATCGAGCACTCTAGGCATCGTAGTGTCAACAACTTTATGGTCAATATTCTTGCTGGATTAGCAGCCTACTGTCTTCAGGAGAAGAAGCCATCGCTTAATATCCAGCGTAATCTATTGACCAGCTGAGTTATATCGAACTCACGTTA	NA	NA	NA	NA
WP_054300322.1|1362335_1364270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1364657_1365251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273534.1|1366882_1367764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1367957_1368230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300326.1|1368331_1368796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046975.1|1369209_1369659_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_016212459.1|1369778_1370159_+	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_054300328.1|1370296_1371073_-	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_155047167.1|1371183_1372701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047166.1|1372750_1373812_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211456.1|1374433_1375012_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_122942091.1|1375039_1375435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211455.1|1375540_1376998_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_016211452.1|1377059_1378547_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211454.1|1379297_1379768_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|1381642_1381915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1382067_1382433_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1382378_1382954_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556641.1|1385036_1386299_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016210751.1|1386386_1388192_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_016210752.1|1388675_1389473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210749.1|1389642_1390104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1390402_1392358_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1393039_1393225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|1393558_1394548_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016211834.1|1397921_1398236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307365.1|1398493_1398754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1398773_1399262_+	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_155046972.1|1400785_1401376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047040.1|1401964_1402903_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047165.1|1402928_1404494_-	amino acid permease	NA	NA	NA	NA	NA
WP_036778182.1|1404700_1405528_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_075273540.1|1405894_1406506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556527.1|1406690_1406951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047164.1|1407943_1408366_+	response regulator	NA	NA	NA	NA	NA
WP_036777256.1|1408788_1408989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104738.1|1409363_1410170_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210795.1|1410275_1411247_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210801.1|1411228_1412200_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155047264.1|1412522_1412882_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_054300271.1|1412921_1413896_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007028.1|1414311_1414767_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1414726_1415065_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|1415238_1415679_-	universal stress protein	NA	NA	NA	NA	NA
WP_032126362.1|1416145_1416511_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1416456_1417032_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211350.1|1417316_1418255_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211349.1|1418318_1420313_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|1420309_1420912_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_036779888.1|1420908_1421247_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|1421322_1422549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300339.1|1423106_1424078_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.2e-25
WP_016211856.1|1424293_1424479_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|1424605_1425073_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|1425069_1425948_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|1426198_1427506_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007028.1|1427658_1428114_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1428073_1428412_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	1444027	1550294	3142147	transposase,tRNA	Staphylococcus_phage(14.81%)	102	NA	NA
WP_054300271.1|1444027_1445002_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047162.1|1445021_1445459_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|1445473_1445839_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210855.1|1445992_1446970_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210849.1|1447087_1448536_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210847.1|1448564_1449569_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210851.1|1449591_1450263_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210850.1|1450247_1451501_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1451749_1452304_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210848.1|1452887_1454072_+	MFS transporter	NA	NA	NA	NA	NA
WP_051307341.1|1454238_1455837_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_155047161.1|1456530_1457502_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300343.1|1457537_1457765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1457768_1458655_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007031.1|1458742_1459015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209794.1|1459749_1460373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776664.1|1460418_1462362_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	23.9	1.1e-05
WP_016209788.1|1462483_1463236_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016209790.1|1463287_1463746_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_129556639.1|1464041_1464452_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209775.1|1464468_1464924_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_016209797.1|1464920_1465412_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_080664822.1|1465408_1466158_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_016209776.1|1466187_1466457_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_036776670.1|1466472_1467258_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_016209786.1|1467271_1468405_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_016209770.1|1468439_1470533_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_016209767.1|1470563_1472024_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_129556524.1|1472004_1472892_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_016209784.1|1472888_1473611_+	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_017377132.1|1473697_1474081_+	response regulator	NA	NA	NA	NA	NA
WP_036776675.1|1474122_1474866_+	chemotaxis protein CheZ	NA	NA	NA	NA	NA
WP_036776682.1|1474878_1476903_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_051307317.1|1476964_1477258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209791.1|1477394_1478117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209771.1|1478281_1479004_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126436.1|1479710_1480166_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209793.1|1480181_1481630_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_016209795.1|1481670_1482426_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_080664823.1|1482406_1483807_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209796.1|1483830_1485048_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_016209778.1|1485078_1485453_+	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209772.1|1485471_1486023_+	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_054300271.1|1487304_1488279_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1488376_1489438_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1489992_1490967_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212424.1|1491310_1491589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|1491581_1491854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1491971_1493054_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300346.1|1493200_1494076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126678.1|1494086_1495097_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_016211554.1|1495423_1496050_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_016211557.1|1496095_1497325_+	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_032126677.1|1497519_1498083_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211555.1|1498157_1499516_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_016211664.1|1500052_1500781_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211666.1|1501153_1503973_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211669.1|1504127_1504478_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1505302_1506277_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556522.1|1507587_1508820_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211405.1|1509026_1510799_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_016211403.1|1510934_1511978_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_036777261.1|1511991_1512735_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_155047160.1|1512869_1513169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1513773_1514472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047159.1|1514893_1516285_+	protein kinase	NA	NA	NA	NA	NA
WP_016211733.1|1516340_1517165_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_054300173.1|1517779_1518841_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046730.1|1519059_1519200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1519467_1520115_-	LysE family translocator	NA	NA	NA	NA	NA
WP_016212267.1|1520395_1520755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|1520921_1521377_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1521336_1521675_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047158.1|1521810_1524084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126823.1|1524072_1524795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104609.1|1524905_1525538_+	MarC family protein	NA	NA	NA	NA	NA
WP_098082850.1|1525573_1525750_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_016211481.1|1525824_1526967_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_155049129.1|1527045_1527183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126825.1|1527199_1528513_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_054300349.1|1529064_1530789_+	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_155046942.1|1531849_1532735_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046942.1|1532899_1533785_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556521.1|1534319_1534508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1534458_1535612_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047157.1|1535676_1536081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047156.1|1536252_1536876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211631.1|1537134_1537941_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_054300351.1|1538196_1539018_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211632.1|1539053_1539908_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211627.1|1540133_1540298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1540603_1541260_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1541343_1541709_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300181.1|1541765_1542047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|1542050_1542230_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016210103.1|1542582_1543941_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_016210117.1|1544222_1544582_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210111.1|1545002_1546637_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_017377579.1|1546643_1547480_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210099.1|1547501_1548779_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_016210105.1|1548862_1549183_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210106.1|1549202_1550294_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	1568692	1612646	3142147	transposase,integrase,protease	Staphylococcus_phage(45.45%)	48	1568597:1568656	1595409:1595497
1568597:1568656	attL	GGTAACCCTCCCTTAAAATAGTACAAGTGATAAGTGGAATCTTCTGTTAAATTAACTTAG	NA	NA	NA	NA
WP_054300353.1|1568692_1568920_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300354.1|1569066_1569585_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	42.9	1.3e-30
WP_155047155.1|1569530_1569680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1569723_1570698_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047154.1|1570770_1571151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1571111_1571477_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1571422_1571998_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300355.1|1571987_1572173_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211563.1|1572383_1572545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211564.1|1572577_1573453_-	ParA family protein	NA	NA	NA	NA	NA
WP_052104693.1|1573618_1577485_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_080728343.1|1577566_1577707_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_081007034.1|1577688_1577973_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_155064791.1|1578258_1579656_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_016211991.1|1580564_1581470_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126537.1|1581710_1581896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211994.1|1581932_1582469_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_155047152.1|1582671_1583394_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1583433_1584408_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047151.1|1584404_1584944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047150.1|1584993_1586220_+	DUF4131 domain-containing protein	NA	NA	NA	NA	NA
WP_155047149.1|1586214_1586430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|1586453_1587428_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016212012.1|1587471_1588149_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016212013.1|1588164_1588548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212011.1|1588769_1589891_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_054300357.1|1590124_1591000_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211974.1|1591282_1592404_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075273551.1|1592503_1592806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556638.1|1592805_1593486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377865.1|1594830_1595115_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664876.1|1595473_1597336_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
1595409:1595497	attR	CTAAGTTAATTTAACAGAAGATTCCACTTATCACTTGTACTATTTTAAGGGAGGGTTACCGATGGTTATTTCACTAGATGAATTTTATT	NA	NA	NA	NA
WP_054300359.1|1597560_1598133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047148.1|1598491_1599529_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047147.1|1600058_1601033_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_054300361.1|1601186_1601483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377353.1|1601460_1602126_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1602165_1603140_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211144.1|1603696_1604326_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_036779218.1|1604309_1604732_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|1604738_1606478_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|1606478_1607543_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1607546_1607900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1608012_1608969_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|1608978_1609290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1609305_1609875_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|1610138_1611467_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1611671_1612646_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 16
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	1621534	1668938	3142147	transposase,integrase,tRNA	Staphylococcus_phage(25.0%)	43	1611581:1611640	1654406:1655507
1611581:1611640	attL	GCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTC	NA	NA	NA	NA
WP_129556637.1|1621534_1622314_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|1622788_1623226_-	MFS transporter	NA	NA	NA	NA	NA
WP_155047262.1|1623614_1623731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300363.1|1624122_1624470_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047145.1|1624415_1624991_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273553.1|1624980_1625907_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300364.1|1626080_1626959_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155064793.1|1627214_1627385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126267.1|1627378_1627621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211330.1|1627968_1629069_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_098082827.1|1629243_1630545_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_052104656.1|1630621_1631125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126265.1|1631448_1632366_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016211336.1|1632431_1633046_-	chorismate mutase	NA	NA	NA	NA	NA
WP_016211334.1|1633094_1633283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210322.1|1633900_1634797_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016210320.1|1634933_1636007_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_054300366.1|1636156_1636570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300568.1|1636590_1637301_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.3	4.1e-38
WP_129556511.1|1637483_1638920_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210321.1|1639116_1640085_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_016210325.1|1642755_1644132_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210326.1|1644285_1645584_-	ankyrin repeats family protein	NA	NA	NA	NA	NA
WP_036778577.1|1645923_1647207_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_016210333.1|1647280_1647910_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_016210330.1|1648113_1648497_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210332.1|1648594_1649338_+	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_075273555.1|1649468_1650002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1650279_1650963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|1651716_1652691_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_155047144.1|1652726_1654052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1654496_1655471_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211804.1|1655853_1657239_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
1654406:1655507	attR	GCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_081007037.1|1657245_1658784_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211806.1|1658826_1659552_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032126804.1|1659716_1660592_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1660751_1661657_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_032126803.1|1661890_1663123_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_016211764.1|1663323_1664145_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211767.1|1664983_1665793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211289.1|1667409_1667682_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211286.1|1667793_1668141_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_036777656.1|1668158_1668938_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 17
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	1694999	1739345	3142147	transposase,protease,tRNA	Staphylococcus_phage(22.22%)	39	NA	NA
WP_054300173.1|1694999_1696061_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046721.1|1696241_1696409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1696580_1697555_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300373.1|1697551_1698409_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209842.1|1699136_1699526_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209834.1|1699702_1700461_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209829.1|1700457_1702857_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209839.1|1704236_1705535_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209838.1|1705732_1706626_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|1706625_1707840_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|1707859_1709146_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|1709161_1709416_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_036777393.1|1709651_1711019_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|1711349_1712372_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_155064795.1|1713200_1714658_+	amino acid permease	NA	NA	NA	NA	NA
WP_054300271.1|1714897_1715872_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556633.1|1715980_1716877_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209827.1|1717195_1718755_+	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_075273569.1|1718830_1719037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209831.1|1719244_1719943_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|1720221_1720485_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_036777412.1|1720791_1723386_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209835.1|1723382_1723865_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209844.1|1723842_1724883_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209840.1|1725055_1725541_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_032126641.1|1725648_1728219_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_032126642.1|1728254_1728716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047141.1|1728785_1728992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|1730195_1730735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|1731682_1733167_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|1733291_1734827_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|1735060_1735426_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047140.1|1735371_1735956_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047139.1|1735979_1736384_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047138.1|1736359_1736842_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728346.1|1736859_1737192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046723.1|1738099_1738255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|1738413_1738719_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_075273327.1|1738769_1739345_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	1760765	1816291	3142147	transposase,tRNA	Staphylococcus_phage(15.38%)	55	NA	NA
WP_075273298.1|1760765_1761341_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046962.1|1761344_1761791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1762442_1762943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|1763358_1763712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211831.1|1764012_1765740_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_081007040.1|1765877_1766534_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210510.1|1766564_1767293_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_016210506.1|1767285_1768524_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210512.1|1768659_1769697_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210515.1|1769750_1770653_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210514.1|1770761_1772015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1772072_1775570_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075273576.1|1775629_1776358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778516.1|1776485_1777034_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016210508.1|1777354_1779052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1779060_1780214_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_036781272.1|1780809_1781028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047136.1|1781120_1781552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1781719_1782085_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047135.1|1782030_1782606_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211467.1|1782680_1783247_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_032126344.1|1783249_1784338_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032126343.1|1784458_1785271_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|1785401_1787387_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211470.1|1787446_1788100_-	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_155047134.1|1788866_1789889_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047133.1|1790160_1791135_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.6e-27
WP_016212421.1|1791885_1792068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|1792419_1792644_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155047132.1|1792788_1793451_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.6	5.3e-32
WP_032126637.1|1793567_1793861_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556508.1|1793922_1794366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047131.1|1794636_1795293_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047130.1|1795480_1796239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1796301_1797363_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211841.1|1798222_1798675_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211839.1|1798792_1800265_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|1800423_1800888_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|1801358_1801532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1802241_1802607_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1802552_1803128_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300250.1|1803117_1803777_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_032126143.1|1803876_1805148_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_016211422.1|1805236_1805707_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_051307357.1|1805729_1806323_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211417.1|1806459_1807509_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_016211415.1|1807532_1808456_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1808472_1808934_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211414.1|1809041_1809860_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_129556449.1|1810075_1810582_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1810596_1810962_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047129.1|1811165_1811822_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300382.1|1812092_1812515_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300383.1|1812785_1815266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126139.1|1815361_1816291_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 19
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	1823056	1881973	3142147	transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(33.33%)	58	NA	NA
WP_054300162.1|1823056_1824139_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212040.1|1824344_1825694_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_016212039.1|1825870_1826428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133287.1|1826616_1827015_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047128.1|1827070_1828438_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.6e-12
WP_155047127.1|1828846_1829662_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212251.1|1829823_1830360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046960.1|1830521_1831175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047126.1|1831294_1831786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|1832057_1832240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1832589_1833867_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_080664858.1|1833863_1834001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211223.1|1834512_1836114_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211221.1|1836130_1837273_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211218.1|1837525_1838263_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|1838287_1839559_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_032126790.1|1839787_1840693_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_054300387.1|1840951_1843351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300388.1|1843398_1845081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209976.1|1845950_1846184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007074.1|1846417_1847005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209969.1|1846971_1847937_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016209951.1|1847927_1848338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209957.1|1848344_1848680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556634.1|1848680_1849223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209950.1|1849527_1850319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209973.1|1850355_1853460_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_016209965.1|1853489_1854287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209956.1|1854291_1857282_-	ATPase AAA	NA	NA	NA	NA	NA
WP_036776383.1|1857287_1857719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209972.1|1857769_1858336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036776381.1|1858335_1859379_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_016209954.1|1859384_1859909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209953.1|1859930_1862237_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_016209962.1|1862283_1862523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209958.1|1862524_1863652_-	type II/IV secretion system family protein	NA	NA	NA	NA	NA
WP_016209964.1|1863651_1864404_-	dotC-like type IV secretion system protein	NA	NA	NA	NA	NA
WP_051307320.1|1864396_1864903_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_016209959.1|1864927_1865335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556635.1|1865362_1866370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155064797.1|1866428_1867334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209955.1|1867340_1868534_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_155047125.1|1868530_1869457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209960.1|1870074_1870227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211310.1|1870431_1871145_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SEW9	Cyanophage	39.1	2.2e-39
WP_016211308.1|1871220_1871499_-	lipoprotein	NA	NA	NA	NA	NA
WP_032126213.1|1871543_1872434_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_016211307.1|1872518_1872992_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_016211313.1|1873127_1873649_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016211309.1|1873689_1874484_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016211305.1|1874486_1874768_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155047124.1|1874764_1875742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211312.1|1876447_1877194_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|1877315_1878377_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780082.1|1878920_1879826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|1879956_1880685_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|1880804_1881083_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_129556478.1|1881086_1881973_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	1892764	1948197	3142147	transposase,tRNA	uncultured_Mediterranean_phage(30.77%)	47	NA	NA
WP_081007041.1|1892764_1893292_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|1893957_1894152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1894365_1894719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1895050_1895671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211823.1|1895711_1895900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047122.1|1895934_1900026_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211770.1|1900225_1901359_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|1901372_1901561_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_054300276.1|1901853_1902828_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_075273594.1|1902867_1904238_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300404.1|1904310_1905204_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|1905312_1906230_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_036777569.1|1906281_1907037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|1907104_1908379_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_036777566.1|1908513_1909191_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209944.1|1909391_1910819_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|1910793_1911432_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|1911641_1911920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|1912153_1913098_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_036777561.1|1913119_1914988_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|1915008_1915362_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777579.1|1915400_1916516_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209932.1|1916698_1917739_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|1917741_1918776_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|1918772_1919834_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|1919945_1921418_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_052104625.1|1921570_1922014_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209940.1|1922089_1924861_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_036777555.1|1925017_1926247_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1926273_1926936_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|1927457_1927958_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047121.1|1928059_1929163_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	9.5e-10
WP_075274669.1|1929367_1929670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300286.1|1930054_1930519_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962623.1|1930682_1931835_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047120.1|1931844_1932189_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047119.1|1932473_1933796_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_081007042.1|1934204_1935020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300406.1|1937573_1940309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1940609_1941671_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126856.1|1941731_1942073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1942377_1943531_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_155049815.1|1943713_1943866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1944165_1944531_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1944476_1945052_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212005.1|1945390_1947151_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_016210592.1|1947540_1948197_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	1952745	2066466	3142147	transposase,tRNA	Staphylococcus_phage(17.65%)	107	NA	NA
WP_032126176.1|1952745_1953528_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210588.1|1953618_1954944_-	fimV domain protein	NA	NA	NA	NA	NA
WP_016210595.1|1955311_1956490_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210594.1|1956666_1957320_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_036778626.1|1957455_1959396_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_129556498.1|1959392_1960001_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054300271.1|1960180_1961155_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080728317.1|1961345_1964711_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211391.1|1964777_1965353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779996.1|1965364_1966921_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_036779999.1|1966940_1967372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780001.1|1967358_1967622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|1967978_1968350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|1968554_1969280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212252.1|1969594_1969753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047118.1|1969790_1971233_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_075273327.1|1971222_1971798_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1971743_1972109_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274672.1|1972146_1972740_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211114.1|1973105_1976036_-	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_016211115.1|1976168_1978121_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211112.1|1978313_1978961_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211113.1|1979016_1980342_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_032126179.1|1980371_1980623_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_080664854.1|1980580_1981162_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300408.1|1981498_1982155_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_032126362.1|1982205_1982571_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1982516_1983092_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209823.1|1984313_1984757_-	response regulator	NA	NA	NA	NA	NA
WP_016209809.1|1985181_1985670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|1985776_1986745_+	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_155047117.1|1987446_1990746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209810.1|1992335_1994249_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209822.1|1994305_1994953_-	methyltransferase domain protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_036777933.1|1995088_1996213_-	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_016209800.1|1996209_1996806_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209821.1|1996836_1997169_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209812.1|1997258_1999082_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_036777937.1|1999528_2001241_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	4.3e-25
WP_016209815.1|2001558_2002098_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016209799.1|2002484_2002901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209818.1|2002996_2003812_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209805.1|2003944_2005438_+	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_032126324.1|2005616_2006039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209801.1|2006038_2008093_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016209813.1|2008377_2009193_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_036778458.1|2009293_2010112_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209808.1|2010108_2010477_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016209806.1|2010819_2010969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212343.1|2011781_2012588_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_129556499.1|2012826_2013980_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211588.1|2014147_2014849_-	cyclase family protein	NA	NA	NA	NA	NA
WP_032126329.1|2014924_2015554_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_129556496.1|2015739_2016978_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_036778365.1|2017252_2017915_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_016211589.1|2017904_2019137_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_129556495.1|2019259_2019517_+	VOC family protein	NA	NA	NA	NA	NA
WP_032126637.1|2020497_2020791_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126540.1|2021021_2021885_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046995.1|2022018_2022904_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126332.1|2023551_2024751_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_016211366.1|2025003_2025291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779263.1|2025346_2027356_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_032126330.1|2027698_2028658_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_016211367.1|2028805_2029588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273303.1|2029743_2030460_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016210281.1|2030473_2031865_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210270.1|2031906_2034894_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210277.1|2034963_2035797_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210279.1|2035850_2037017_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210272.1|2037004_2037715_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210283.1|2037754_2038540_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_129556492.1|2038567_2039311_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|2039408_2041604_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_016210271.1|2041680_2042364_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_032126334.1|2042374_2042806_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_036778186.1|2042845_2043244_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_016210273.1|2043616_2044324_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210275.1|2044388_2044691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210276.1|2044746_2045223_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210284.1|2045277_2045799_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210280.1|2045880_2046975_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_075273327.1|2047386_2047962_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2047907_2048273_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047116.1|2048233_2048485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300415.1|2049074_2049776_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_032126500.1|2049909_2050626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|2050762_2052010_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126499.1|2052388_2053000_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211122.1|2053096_2053963_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2053966_2054728_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_036779309.1|2054891_2055797_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211125.1|2056019_2056850_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|2057019_2057409_+	lipoprotein	NA	NA	NA	NA	NA
WP_016211123.1|2057610_2058102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|2058163_2058529_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2058543_2059050_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047115.1|2059046_2059451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212585.1|2059745_2060066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2060177_2061152_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|2061521_2062097_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2062042_2062408_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274673.1|2062368_2063367_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780900.1|2063537_2064191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047081.1|2064241_2064679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212519.1|2064949_2065330_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300173.1|2065404_2066466_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	2084219	2126854	3142147	transposase	Staphylococcus_phage(25.0%)	44	NA	NA
WP_129556490.1|2084219_2085105_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047111.1|2085109_2086438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047110.1|2086554_2087616_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126869.1|2087593_2087833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2088353_2088929_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2088874_2089240_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047109.1|2089301_2089715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556488.1|2090895_2091746_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275079.1|2091894_2092956_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126801.1|2093003_2093513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274679.1|2094181_2095243_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212218.1|2096694_2097045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285943.1|2097189_2098026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|2098079_2099372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104686.1|2099607_2102364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046955.1|2103519_2103699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|2103940_2104642_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|2104902_2105109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|2105338_2105644_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|2105822_2107820_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2107803_2108850_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|2109570_2110422_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|2110422_2111343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|2111753_2112038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2112029_2112485_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2112444_2112783_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2112995_2113925_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2114081_2114510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047107.1|2114590_2115043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2115068_2115974_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2116170_2116779_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155047106.1|2116819_2117706_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556499.1|2117902_2119055_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211971.1|2119261_2119873_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2119893_2121090_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2121186_2121327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2121339_2121744_-	SufE family protein	NA	NA	NA	NA	NA
WP_075273313.1|2121869_2122208_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300431.1|2122167_2122470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|2122614_2122800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|2123369_2123951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300573.1|2123978_2125112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|2125375_2125903_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_081007045.1|2126224_2126854_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	2148559	2201565	3142147	transposase,protease,tRNA	Leptospira_phage(16.67%)	56	NA	NA
WP_016209884.1|2148559_2149183_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2149259_2149460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2149601_2150300_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2150446_2151016_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2151330_2151954_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2152162_2152765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2152836_2153722_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|2153945_2154832_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273603.1|2154911_2155088_+	phosphatase	NA	NA	NA	NA	NA
WP_016212526.1|2155211_2155745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047105.1|2155915_2156797_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	3.4e-50
WP_016212445.1|2157039_2157306_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|2157364_2157949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274681.1|2158499_2159375_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063519.1|2159423_2159840_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210465.1|2160126_2160969_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2161019_2161367_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2161557_2162445_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2162559_2163162_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2163158_2163878_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_052104601.1|2163946_2165659_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_036777098.1|2165806_2167744_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2167852_2168905_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2168904_2169180_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2169260_2169809_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_051307322.1|2170082_2170262_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_155047104.1|2170265_2170547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2170603_2170969_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047103.1|2171084_2172206_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_155049817.1|2173000_2173887_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036780722.1|2173948_2174923_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_016210459.1|2175087_2175606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047101.1|2175810_2176929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211720.1|2177176_2178100_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211716.1|2178113_2179037_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036778439.1|2178984_2179641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|2179943_2180771_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_155047100.1|2181211_2181571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047099.1|2181715_2181871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126590.1|2182063_2183596_+	nuclease	NA	NA	NA	NA	NA
WP_032126591.1|2183658_2184996_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_016210313.1|2185138_2186605_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210314.1|2186601_2187651_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_036778435.1|2187774_2189889_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|2190053_2190458_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2190518_2191244_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210307.1|2191329_2192220_+	YicC family protein	NA	NA	NA	NA	NA
WP_032126592.1|2192260_2192881_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.3	2.5e-20
WP_016210310.1|2192941_2193148_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_016210316.1|2193169_2195323_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.1e-12
WP_054300439.1|2195329_2197312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780594.1|2197583_2198066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2198069_2198645_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2198590_2198956_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036780787.1|2199154_2200114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2200482_2201565_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 24
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	2205488	2250539	3142147	transposase	Staphylococcus_phage(50.0%)	51	NA	NA
WP_054300443.1|2205488_2205767_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|2205819_2206068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|2206025_2207087_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212179.1|2207507_2207660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|2208082_2208256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2208332_2208590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781320.1|2210808_2211036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2211022_2211349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2211350_2211782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2212310_2213372_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300445.1|2213466_2214018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2214287_2215307_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2215293_2215716_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2215717_2216191_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|2216306_2216930_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|2216959_2217634_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2217639_2218788_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2218784_2219246_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2219321_2220572_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2220698_2222378_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2222487_2223354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2224256_2225231_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_036781250.1|2225326_2226112_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2226255_2226942_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2226975_2227374_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2227537_2227843_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|2227920_2228175_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2228328_2229990_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2230049_2230733_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2230732_2231821_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2231869_2234506_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300173.1|2234918_2235980_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300448.1|2236169_2238539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2238582_2239557_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300449.1|2239576_2240356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2240485_2240824_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2240783_2241239_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211507.1|2241564_2242884_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|2242887_2243604_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|2243600_2244242_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_081007048.1|2244234_2244333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2244673_2245039_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2244984_2245560_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047096.1|2245591_2245864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047095.1|2245920_2246061_+	phosphatase	NA	NA	NA	NA	NA
WP_155047094.1|2246205_2246673_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211503.1|2246823_2247279_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|2247333_2247678_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2247707_2248751_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|2249453_2249663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2249652_2250539_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	2320727	2383069	3142147	transposase,tRNA	Planktothrix_phage(18.18%)	56	NA	NA
WP_129556571.1|2320727_2321438_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2321466_2321871_+	RidA family protein	NA	NA	NA	NA	NA
WP_036777168.1|2321895_2322855_-	response regulator	NA	NA	NA	NA	NA
WP_016209567.1|2322986_2323604_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126712.1|2324038_2324497_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2325241_2326252_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2326736_2327648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2327973_2331468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2331505_2332345_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_036777155.1|2332531_2332747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2332795_2333371_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2333367_2333706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2333874_2334864_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2334864_2335827_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_054300271.1|2336782_2337757_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2337894_2338128_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2338221_2338587_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2338601_2339108_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212572.1|2339165_2339558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2339687_2340053_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2340109_2340418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2340509_2341085_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2341030_2341396_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|2341548_2341821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126774.1|2342429_2342765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2342924_2344457_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2344489_2345329_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2345325_2345823_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_036779082.1|2345826_2346819_-	AAA family ATPase	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_155047091.1|2346933_2348280_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2348503_2349565_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2349643_2350789_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|2356596_2357454_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2357440_2358364_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_036778204.1|2358560_2359952_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2359998_2361042_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2361084_2361528_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2361660_2362851_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2362905_2363052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|2363602_2364520_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2364787_2365081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2365157_2365352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300462.1|2366370_2367288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2367753_2368596_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2368663_2369314_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|2369328_2370369_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|2370491_2371577_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2371603_2372713_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2372729_2373047_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2373043_2373403_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_080664847.1|2376734_2377688_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300173.1|2377760_2378822_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212048.1|2379585_2380143_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_032126664.1|2380336_2381020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126663.1|2381738_2381981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|2382007_2383069_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	2472962	2555673	3142147	transposase,tRNA	Escherichia_phage(37.93%)	82	NA	NA
WP_054300202.1|2472962_2473691_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|2473780_2474392_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_036779399.1|2474748_2475003_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2475101_2476886_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779389.1|2476974_2477694_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|2477876_2478083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779393.1|2478082_2478319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2478331_2478709_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2479215_2480034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779396.1|2480127_2480325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|2480419_2481805_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|2481931_2482522_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_155047083.1|2484713_2485442_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	4.3e-43
WP_016211816.1|2486510_2486864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2486905_2488519_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2488740_2488962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2489270_2489999_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2490615_2491713_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2491746_2492997_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_054300202.1|2493136_2493865_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212193.1|2493987_2494326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2494393_2494780_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2494776_2495022_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300475.1|2495430_2496159_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211625.1|2496642_2497512_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_036779883.1|2497508_2498858_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211623.1|2498970_2500611_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_054300202.1|2501425_2502154_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300478.1|2502433_2504170_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_155047082.1|2504331_2504511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300477.1|2504673_2505402_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016212214.1|2505560_2506061_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016212213.1|2506035_2506545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2507298_2508027_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300479.1|2508177_2509218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211653.1|2509415_2510441_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_016211652.1|2510548_2511754_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211655.1|2512013_2512427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2512555_2513125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2513128_2513461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300480.1|2513453_2514293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047081.1|2514380_2515928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2516377_2516881_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2516843_2517551_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2517619_2518480_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_036777969.1|2518460_2519234_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2519264_2520518_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2520517_2521480_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2521523_2522276_+	ComF family protein	NA	NA	NA	NA	NA
WP_036777977.1|2522329_2524210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|2524357_2524828_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2524873_2525113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777984.1|2525131_2525581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2525801_2527226_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|2527290_2528340_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2528606_2529386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2529437_2530340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047080.1|2530398_2531145_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	4.4e-19
WP_016210616.1|2531393_2534204_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_081007053.1|2534438_2535299_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_155047079.1|2536141_2536384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2536538_2537691_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047078.1|2537877_2538213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2538305_2538605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2538594_2538759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047077.1|2538990_2540143_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	4.4e-58
WP_155047076.1|2540152_2540428_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212641.1|2540623_2541070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049820.1|2541034_2541490_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273369.1|2541598_2542414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047075.1|2542487_2543408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2543419_2544148_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2544237_2544444_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007054.1|2544606_2545839_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_054300482.1|2546354_2547644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049821.1|2548802_2548991_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047219.1|2549037_2549766_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032127022.1|2550442_2552629_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2552690_2553844_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2554129_2554654_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|2554844_2555012_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|2554956_2555673_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
>prophage 27
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	2571014	2599201	3142147	transposase,integrase,protease,tRNA	Acinetobacter_phage(12.5%)	26	2568403:2568462	2586243:2586531
2568403:2568462	attL	ACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTT	NA	NA	NA	NA
WP_155047267.1|2571014_2571224_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007057.1|2572551_2572968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|2573025_2574178_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016212230.1|2574234_2575683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2577216_2577405_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046946.1|2578806_2579082_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2579084_2579687_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_016212522.1|2579783_2580038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|2580582_2581662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780431.1|2581980_2583699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2583742_2584648_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155049822.1|2585118_2585274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047221.1|2585665_2586145_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	42.0	1.7e-11
WP_155047222.1|2586253_2586928_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.8	2.2e-09
2586243:2586531	attR	AAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTT	NA	NA	NA	NA
WP_155047223.1|2586971_2587217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2587847_2588423_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_036778086.1|2588498_2589374_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_052104629.1|2589774_2590800_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047224.1|2590943_2591420_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778088.1|2591404_2592487_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.0e-20
WP_036777829.1|2592727_2593132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2593844_2594576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2594832_2596134_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2596275_2596944_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2597387_2597984_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2598004_2599201_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
>prophage 28
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	2628417	2680869	3142147	transposase,tRNA	Microbacterium_phage(12.5%)	56	NA	NA
WP_054300282.1|2628417_2628882_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047228.1|2628938_2629421_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2630275_2630671_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|2630667_2631462_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_036778479.1|2631640_2632366_-	D-Ala-D-Ala dipeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2632611_2633799_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016210935.1|2634375_2634918_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2634914_2635601_-	acireductone synthase	NA	NA	NA	NA	NA
WP_036778484.1|2635604_2636216_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2636262_2637282_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2637383_2638178_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2638215_2639022_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2639100_2640150_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2640347_2641607_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2641653_2642331_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2642416_2642698_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|2642789_2643977_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_016210820.1|2644213_2645155_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2645658_2645883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2646173_2646878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|2647341_2647980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2648314_2648845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779158.1|2648841_2650374_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2650370_2651321_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2651741_2652374_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2652616_2652814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2653188_2653554_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2653610_2653775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2653764_2654064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2654111_2654540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300194.1|2654617_2655316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2655293_2656355_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2656579_2656876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|2656980_2657637_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2657860_2658358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047229.1|2659567_2660029_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2659988_2660327_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036778253.1|2660384_2661923_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_098082804.1|2662034_2663133_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2663370_2664570_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2664599_2665238_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|2665253_2667437_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|2667674_2668019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|2669064_2669271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|2669435_2669894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|2670481_2671609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2671732_2672395_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2672486_2672732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2673805_2674465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2674566_2675217_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_054300271.1|2675708_2676683_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2676933_2677155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047230.1|2677443_2677866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047231.1|2677866_2678400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300190.1|2678894_2679857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046995.1|2679983_2680869_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	2741748	2799781	3142147	transposase,protease,tRNA	Staphylococcus_phage(37.5%)	57	NA	NA
WP_054300271.1|2741748_2742723_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047235.1|2742742_2743729_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2743819_2744566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275004.1|2744690_2745554_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2745797_2746160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273422.1|2746346_2746874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2747018_2747435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2749531_2750443_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2750494_2751343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2751787_2752498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2752589_2753558_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2753545_2754193_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036779767.1|2754221_2755073_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2755087_2756365_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2756405_2756921_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_054300183.1|2756999_2758061_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2758082_2759171_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_036777788.1|2759215_2761051_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2761093_2761564_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2761600_2761936_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2761948_2762665_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2762601_2763618_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2763614_2764094_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2764177_2766658_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2766720_2767086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2767424_2767763_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2767722_2768178_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2768192_2768483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777784.1|2768548_2770147_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2770277_2770613_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777781.1|2770640_2772305_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210581.1|2772301_2772946_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2772945_2773689_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2773747_2773987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2774137_2775505_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2775515_2776067_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2776147_2777131_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2777252_2779010_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2779232_2779823_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_155049840.1|2779911_2780331_-	DksA protein	NA	NA	NA	NA	NA
WP_075273416.1|2780471_2781086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2781146_2781932_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075273313.1|2782185_2782524_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007003.1|2782483_2782945_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2783317_2784292_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212084.1|2784573_2785590_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2785589_2786105_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2786146_2786620_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_155047236.1|2786675_2787218_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2787241_2787697_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_155046996.1|2789470_2791984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046997.1|2792918_2795441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2796015_2797077_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2797103_2797679_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2797624_2797990_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046755.1|2798061_2798238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2798628_2799781_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 30
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	2924641	2988770	3142147	transposase	Staphylococcus_phage(16.67%)	53	NA	NA
WP_054300271.1|2924641_2925616_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211161.1|2926198_2927308_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2927319_2927964_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2927982_2928969_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2929048_2930125_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2930327_2931152_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2931468_2932473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2932681_2933647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047242.1|2933785_2934661_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2934957_2936010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2936277_2936706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2936919_2937411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2937466_2938717_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2938819_2939038_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_036777591.1|2939495_2940350_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016210728.1|2940404_2940875_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2941259_2942639_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2942666_2943125_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2943102_2944320_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2944511_2944748_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2944761_2944917_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2944997_2945960_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2946119_2947436_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2947445_2948114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2948476_2950291_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_054300166.1|2950408_2951197_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211543.1|2951777_2953529_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|2953539_2954340_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|2954442_2954931_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_032126435.1|2955104_2955419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375799.1|2956439_2956784_+	DMT family protein	NA	NA	NA	NA	NA
WP_016210038.1|2962477_2963440_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|2963626_2964886_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|2965109_2965436_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|2965630_2966581_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|2966638_2968705_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|2968710_2969706_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|2970291_2971872_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|2972028_2973438_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|2973497_2974631_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|2974770_2975595_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|2975822_2976452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|2976788_2977160_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|2977463_2977751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|2977902_2978751_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|2978878_2979919_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_155047244.1|2979991_2981929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|2982212_2982872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2983026_2984001_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2984076_2985096_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556602.1|2985494_2985704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|2986578_2987661_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_054300161.1|2987708_2988770_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP038962	Piscirickettsia salmonis strain Psal-051 chromosome, complete genome	3142147	2996655	3110575	3142147	transposase,tRNA	Staphylococcus_phage(33.33%)	113	NA	NA
WP_155047053.1|2996655_2997541_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212222.1|2998017_2998491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|2998487_2998883_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2999812_3000388_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3000333_3000699_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036778680.1|3000963_3003294_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_129556603.1|3003414_3005430_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300160.1|3005613_3009006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3009070_3009376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|3009566_3009746_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_155047245.1|3009749_3009938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|3009961_3010936_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	1.8e-28
WP_032126362.1|3011193_3011559_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047247.1|3011622_3011991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|3011994_3012881_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047248.1|3012944_3013631_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047249.1|3013883_3014984_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|3015378_3016488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|3017530_3017896_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047002.1|3017910_3018516_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036776867.1|3018886_3020284_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_051307313.1|3020403_3021351_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3021347_3021863_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3021849_3023049_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3023045_3023369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3023370_3024600_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3024599_3025643_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3025642_3026326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3026322_3028812_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3028828_3029083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3029083_3029440_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3030219_3031383_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3031402_3034510_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3034511_3036017_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3036044_3036326_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3036474_3036816_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3036935_3038816_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3038900_3040499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3040516_3041632_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3041759_3042758_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_052104582.1|3042761_3043520_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3043521_3044721_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3044704_3045376_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3045397_3046174_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3046177_3047176_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3047177_3047756_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3047752_3049222_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3049265_3049553_-	trp operon repressor	NA	NA	NA	NA	NA
WP_155047250.1|3049753_3050350_+	EamA family transporter	NA	NA	NA	NA	NA
WP_054300152.1|3050376_3050742_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3050798_3050954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273401.1|3051098_3051551_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047251.1|3051588_3051813_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155047003.1|3053408_3054294_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3054480_3054702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047252.1|3054817_3055396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047253.1|3055540_3055735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3055793_3056768_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|3056821_3057883_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776841.1|3058610_3059150_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3059234_3059771_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3060422_3060725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3061174_3061483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|3062091_3062541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3062823_3063534_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3063760_3064159_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_036778156.1|3065026_3065977_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3065976_3068055_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3068202_3068718_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3068726_3069290_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3069270_3070017_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3070156_3070609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3071032_3071869_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3071865_3072762_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3072794_3073862_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3073880_3074249_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3074274_3075723_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3075732_3077112_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3077152_3078484_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3078455_3079415_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3079507_3080011_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3080145_3081297_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3081293_3081773_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3081919_3084241_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3084185_3084812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3084816_3085716_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3085788_3086367_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3086667_3086925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556718.1|3086933_3088120_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_155046758.1|3088934_3089066_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3089210_3089366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777721.1|3089693_3090467_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155047254.1|3091403_3091541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3091584_3092559_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3093653_3093992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007065.1|3094008_3094848_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_081007013.1|3095060_3095360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3095349_3095514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3095570_3095936_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3097240_3097936_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3097932_3099360_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3099385_3099649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3099721_3100696_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047005.1|3100754_3101605_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3101642_3101987_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3101983_3102820_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3102820_3103162_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3103163_3103769_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3103765_3105760_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3105779_3106721_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052104719.1|3106948_3108373_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3108885_3109860_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3109918_3110575_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038963	Piscirickettsia salmonis strain Psal-051 plasmid unnamed1, complete sequence	181949	2012	48760	181949	integrase,transposase	Acinetobacter_phage(21.43%)	54	NA	NA
WP_105962625.1|2012_2898_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.7	4.5e-10
WP_016212151.1|3500_4463_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|4486_4801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|4864_5839_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_033923686.1|5963_7013_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|7121_8162_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|8175_8805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|8895_9195_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_081377909.1|9191_9656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104769.1|10617_11541_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_105962623.1|12685_13838_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274741.1|13907_14165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273822.1|14266_14767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|15211_16294_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212255.1|16480_16651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|16647_16851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|17187_17412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212260.1|17431_17704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|17861_18836_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_129556717.1|19490_20717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|21042_21879_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_016212398.1|22141_22603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047268.1|22769_23150_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|24238_24604_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|24549_25125_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_105962623.1|26108_27262_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273810.1|27282_27990_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	34.2	1.4e-11
WP_081007042.1|30149_30965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728342.1|31279_31783_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_105962174.1|31926_32091_+	phosphatase	NA	NA	NA	NA	NA
WP_155047269.1|32239_32635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273806.1|32896_33460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|33565_34021_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_075273804.1|33980_34319_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|34403_35132_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_016212413.1|35465_35894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|35941_36682_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_032126346.1|36748_36991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273798.1|37082_37307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|37415_37940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047270.1|38060_38207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047297.1|38351_38498_-	phosphatase	NA	NA	NA	NA	NA
WP_032126138.1|39706_39970_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211871.1|40535_40871_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_129556699.1|40864_41065_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300590.1|41372_41597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|42213_43239_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273790.1|43783_44086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|44075_44702_-	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_016212412.1|45002_45167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|45159_45609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|45856_46030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212499.1|46234_46609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|47607_48760_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 2
NZ_CP038963	Piscirickettsia salmonis strain Psal-051 plasmid unnamed1, complete sequence	181949	51856	169547	181949	integrase,transposase,protease,head,tail,capsid	Streptococcus_phage(19.23%)	120	46910:46969	165207:166451
46910:46969	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_016211912.1|51856_52447_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
46910:46969	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_129556698.1|52536_53238_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_054300249.1|53351_53717_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|53731_54238_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	1.0e-06
WP_155047271.1|54241_55359_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	3.6e-57
WP_051307374.1|55473_55950_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_016212298.1|56190_56517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|57183_58209_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047272.1|58418_59147_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_054300594.1|59509_60535_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047273.1|60665_60803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046942.1|60941_61828_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.8	2.6e-10
WP_155047274.1|61912_62119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|62458_63274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211897.1|63667_64072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|64072_64819_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211895.1|65327_66386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126360.1|66508_67243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211773.1|67829_68504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|68605_68974_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211776.1|69141_70479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556697.1|70961_71354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|71738_72644_-|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_016210664.1|72941_73364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210651.1|73363_73714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210658.1|73710_74106_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210667.1|74098_74422_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210663.1|74418_74730_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210655.1|75048_75645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556716.1|75658_75949_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_052047108.1|76082_76481_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047275.1|76536_77034_-	DNA polymerase	NA	NA	NA	NA	NA
WP_155047276.1|77030_77810_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	31.7	1.8e-18
WP_129556718.1|77838_79024_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_081377350.1|79557_80373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047277.1|80437_81046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211936.1|81780_82803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047278.1|83292_83694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|83811_84837_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|85411_85573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|85572_86073_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273747.1|86334_86925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|86987_87281_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155049832.1|87363_88239_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	3.7e-57
WP_052104629.1|88356_89382_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047281.1|89608_89938_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.8	5.5e-06
WP_155047018.1|90005_90809_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.9e-55
WP_075274752.1|90844_91144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|91140_91716_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|91661_92027_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|92931_94974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|95743_95944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|96084_97059_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.0	1.9e-25
WP_016212579.1|98555_98753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|99352_100327_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
99317:99955	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCT	NA	NA	NA	NA
WP_016212456.1|100370_100658_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
99317:99955	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCT	NA	NA	NA	NA
WP_036779532.1|100654_101056_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_075273881.1|101065_103252_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.2	9.2e-73
WP_016212404.1|103372_103606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273857.1|104382_105117_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	8.4e-39
WP_129556710.1|105270_105741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556709.1|105821_105911_-	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_052047129.1|106122_107706_-	protein kinase	NA	NA	NA	NA	NA
WP_075274745.1|107988_108717_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_016212365.1|109429_109672_+	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_036781349.1|109673_110000_+	potassium ABC transporter ATPase	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.1e-11
WP_054300202.1|110115_110844_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212152.1|111313_111697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|112003_112381_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_155047283.1|112545_112878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|112830_112983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377351.1|113066_113846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047298.1|114375_114561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212019.1|114947_115643_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_105962690.1|116111_116387_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|116383_116629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047016.1|116658_116886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212014.1|117289_117703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|117800_118529_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_105962623.1|118595_119748_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047284.1|120377_121406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|121685_122839_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273826.1|122798_123926_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	30.3	1.9e-18
WP_155047013.1|124146_124293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|124622_125438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780064.1|125683_126274_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	38.3	2.0e-22
WP_016211879.1|127228_128248_+	ParA family protein	NA	NA	NA	NA	NA
WP_075274742.1|128260_129142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|129171_129900_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155064809.1|130103_131975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|132054_133032_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155064810.1|133148_133916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|133919_134897_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047285.1|134915_135173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774631.1|136306_136771_+	hypothetical protein	NA	H6WFS7	Cyanophage	38.2	2.9e-21
WP_080963647.1|137109_137280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|138950_139679_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155047299.1|139862_141221_-	DEAD/DEAH box helicase	NA	D2J050	Enterococcus_phage	50.5	2.6e-126
WP_155047286.1|141310_141877_-	helix-turn-helix domain-containing protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	35.0	1.4e-20
WP_017377658.1|141880_142567_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|142814_143543_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_129556703.1|145924_146413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211956.1|146470_147199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211955.1|147655_148636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275154.1|148772_149429_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.7	7.6e-31
WP_036771347.1|149791_150769_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_027242575.1|151398_151884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242576.1|151917_153780_-	AAA family ATPase	NA	A0A088C4M0	Shewanella_sp._phage	30.9	1.0e-56
WP_036771347.1|153972_154950_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047288.1|154964_155090_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047289.1|155022_155199_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275025.1|155448_157464_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155047291.1|159125_161156_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|161290_162268_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047292.1|162345_163263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|164052_165206_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273751.1|165555_167286_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155047019.1|167298_167451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047293.1|167940_168666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|168818_169547_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
>prophage 1
NZ_CP038964	Piscirickettsia salmonis strain Psal-051 plasmid unnamed2, complete sequence	58528	2671	47766	58528	transposase,portal,integrase,tail,capsid,protease,head	Streptococcus_phage(13.64%)	57	NA	NA
WP_052104629.1|2671_3697_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047304.1|3967_4099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047313.1|4825_5179_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_016211142.1|6767_7034_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075274761.1|7090_7414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047305.1|7415_7838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274762.1|7837_8188_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_075274763.1|8184_8580_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	39.1	6.0e-07
WP_075274764.1|8572_8896_-|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	41.7	5.4e-14
WP_075274765.1|8892_9204_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.7	2.5e-08
WP_155064811.1|9541_10105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047306.1|10140_11307_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	38.7	1.2e-66
WP_081007077.1|11362_12034_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	45.8	5.5e-45
WP_054300593.1|11981_13223_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	43.6	2.7e-85
WP_155047307.1|13219_13816_-	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.3	2.0e-38
WP_155047308.1|13859_14834_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	8.3e-26
WP_155047309.1|14853_15783_-	hypothetical protein	NA	A0A1W6JP18	Morganella_phage	52.0	1.5e-85
WP_155047310.1|16011_16494_-	hypothetical protein	NA	Q9B019	Phage_GMSE-1	33.3	1.1e-13
WP_032126915.1|16580_16964_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	4.7e-25
WP_052047121.1|17142_17544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126916.1|17688_18159_-	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	48.8	1.5e-33
WP_155047311.1|18146_18449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923627.1|18445_18733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210963.1|18828_19068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047315.1|19064_19412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047314.1|19404_19767_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.9e-24
WP_036780304.1|19735_20272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211080.1|20312_21299_-	helix-turn-helix domain-containing protein	NA	A0A0S2MVA0	Bacillus_phage	45.4	4.3e-14
WP_036780299.1|21337_21640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211079.1|21794_22100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211067.1|22309_23053_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211077.1|23185_23971_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300594.1|24403_25429_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036780005.1|25576_26224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211069.1|26207_26639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047030.1|26663_26807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211075.1|27021_28263_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211068.1|28266_29079_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080664851.1|29075_29885_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|30087_31062_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047312.1|31097_31439_-	toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.7	2.0e-11
WP_027242955.1|31431_31692_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211925.1|32191_32977_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	28.7	9.7e-17
WP_016211928.1|32969_33410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|33960_34224_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_054300276.1|35154_36129_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.8	2.4e-25
WP_016212188.1|37218_37959_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155047301.1|38136_38409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|39029_39605_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	6.0e-08
WP_032126136.1|39670_40216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|41249_42275_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047302.1|42928_44008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212274.1|44538_45003_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032126154.1|45013_45208_-	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_032126152.1|45423_46014_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
WP_081007075.1|46077_46419_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155047303.1|46764_47766_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.3e-29
>prophage 1
NZ_CP038965	Piscirickettsia salmonis strain Psal-051 plasmid unnamed3, complete sequence	38376	6445	19646	38376	terminase,transposase,protease,head,tail,capsid,portal	Erysipelothrix_phage(25.0%)	15	NA	NA
WP_054300271.1|6445_7420_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047317.1|7554_8391_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_016211139.1|8470_8866_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211132.1|8858_9182_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211137.1|9178_9490_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_155047318.1|9680_11015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211140.1|11135_12329_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_080664855.1|12386_13058_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_155047319.1|13005_13626_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	50.9	5.5e-39
WP_052104629.1|13828_14854_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047320.1|14984_15707_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	40.8	2.6e-40
WP_155047321.1|15703_17386_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	45.7	6.9e-137
WP_016212234.1|17388_17868_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_155047322.1|17944_18337_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	4.4e-26
WP_054300271.1|18671_19646_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
>prophage 1
NZ_CP038966	Piscirickettsia salmonis strain Psal-051 plasmid unnamed4, complete sequence	33277	10315	26969	33277	tail,transposase	Indivirus(18.18%)	20	NA	NA
WP_036781073.1|10315_10576_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	A0A1S5NR91	Burkholderia_phage	48.8	2.1e-13
WP_081007079.1|10646_10919_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_129556478.1|11130_12017_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	5.8e-10
WP_016212315.1|13555_13990_+	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	39.7	9.1e-25
WP_032126346.1|14089_14332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047334.1|14398_14839_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	37.6	1.1e-06
WP_054300249.1|14799_15165_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047335.1|15179_15623_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	5.1e-07
WP_054300271.1|16632_17607_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047336.1|17603_17888_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047337.1|17906_18269_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|18268_18691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275196.1|18692_19016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|19072_19339_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075275195.1|19342_21421_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.4	2.5e-56
WP_036776958.1|21413_21755_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|21751_22423_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|22391_23138_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_054300696.1|23127_23685_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_075275194.1|23681_26969_+	host specificity protein J	NA	A0A0R6PIC0	Moraxella_phage	33.2	5.2e-112
