The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	45576	89169	3147033	transposase	Moraxella_phage(20.0%)	43	NA	NA
WP_075273371.1|45576_46152_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46097_46463_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036776493.1|46661_47423_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_036779326.1|47724_49251_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49622_50462_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50501_51809_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51783_52953_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|53007_53733_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54011_54401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54588_55494_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55541_55685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047031.1|55732_56329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|56563_57717_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016210704.1|58611_60558_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61212_64275_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64271_65336_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65691_66645_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66676_67840_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67845_68445_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68632_69133_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69150_70239_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70377_71622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71618_72461_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_036777711.1|72440_73250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73417_73645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73645_74596_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74651_75203_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75329_75752_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75744_76491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76533_77232_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77242_78067_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78396_78765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|78759_79821_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|79870_80101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80230_81445_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81745_82807_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_036777695.1|82820_84548_+	oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_016211245.1|84581_85313_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85312_86101_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86205_86829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87148_87361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047032.1|87516_88578_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047033.1|88572_89169_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	127259	181534	3147033	transposase	Staphylococcus_phage(42.86%)	58	NA	NA
WP_054300271.1|127259_128234_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209611.1|128482_128674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047035.1|128753_128933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209580.1|129024_129549_+	ankyrin repeat family protein	NA	NA	NA	NA	NA
WP_016209612.1|129932_130301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209595.1|130338_130611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300576.1|130701_131997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211692.1|132632_133535_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.4	1.6e-18
WP_051307362.1|133591_134443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211694.1|135022_137032_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	3.0e-110
WP_054300271.1|137069_138044_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|138545_139958_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|140450_141458_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|141477_142998_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_016211018.1|143948_145265_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145368_145752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145886_148952_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|149020_150124_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|150147_150702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150816_151386_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151505_152261_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_155047036.1|152427_153327_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047037.1|153471_153777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082829.1|154171_154567_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|154588_154954_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|155010_155175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|155164_155464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300544.1|155554_156001_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|156496_157063_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|157074_157860_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|158491_159415_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|159466_160462_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|160493_160988_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_036778333.1|161079_161337_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|161426_161849_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|162167_162884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|162927_163179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778330.1|163183_164620_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|164647_166090_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|166177_166516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|166600_167131_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|167191_169384_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|169426_169912_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|170181_170613_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036778324.1|170630_171461_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|171475_171619_-	lipoprotein	NA	NA	NA	NA	NA
WP_052104672.1|171649_172534_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|172505_172727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|172900_173179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|174149_175055_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_036780891.1|175111_176290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|176286_176862_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|176807_177173_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300541.1|177500_178280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126848.1|178813_179614_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_052104671.1|179832_180591_+	ion transporter	NA	NA	NA	NA	NA
WP_016211859.1|180667_180955_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_075273327.1|180958_181534_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	200550	271547	3147033	transposase,tRNA,tail,protease	Acinetobacter_phage(25.0%)	58	NA	NA
WP_016209871.1|200550_202533_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|202742_204086_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|204352_207022_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|207045_208965_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|209134_210556_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|210701_211676_+	phospholipase A	NA	NA	NA	NA	NA
WP_054300537.1|211707_212115_+	glyoxalase	NA	NA	NA	NA	NA
WP_016209859.1|212393_212615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|212778_214440_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|214512_214803_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_036776911.1|215028_215484_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|215548_216013_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216105_217452_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|217451_218357_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|218418_219405_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|219397_219640_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|219761_221306_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_036776914.1|221352_222639_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|222681_224076_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224099_224279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|224275_224455_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300181.1|224458_224740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|224796_225162_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210079.1|228167_228665_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|228835_229531_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|229633_231196_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|231511_233305_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233390_233663_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|233668_234295_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234281_235712_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236044_237100_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237068_237746_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|237735_238572_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|238731_239025_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|239131_239938_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|240242_241097_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_036776920.1|241251_242301_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_036776924.1|242351_243008_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|243025_244306_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|244579_245941_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_032126863.1|246340_246892_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016211802.1|252323_253595_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036778206.1|253651_254635_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|254631_255417_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_032126362.1|256113_256479_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|256424_257000_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300535.1|257003_257723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|257867_258068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|258115_258577_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|259000_260482_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|260544_261654_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|261751_263713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|264242_264647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047045.1|264699_265395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|265371_266346_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_098082809.1|266516_266867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|267809_268892_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556499.1|270394_271547_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 4
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	300472	360332	3147033	transposase	Bodo_saltans_virus(20.0%)	57	NA	NA
WP_054300526.1|300472_300769_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962174.1|300917_301082_-	phosphatase	NA	NA	NA	NA	NA
WP_016211026.1|301180_301585_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075273367.1|301877_302654_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_155047049.1|302662_304744_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	4.0e-17
WP_016211031.1|304908_305388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211032.1|305697_306495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211033.1|306606_307899_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_032126377.1|308064_309066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211034.1|309182_309362_+	rubredoxin	NA	NA	NA	NA	NA
WP_016211023.1|309372_309807_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_016211029.1|310020_310383_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.6e-25
WP_016212102.1|310556_312197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|313707_314860_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556441.1|318288_319515_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126490.1|319863_320829_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_016210868.1|320825_321125_+	pilZ domain protein	NA	NA	NA	NA	NA
WP_036778898.1|321156_321936_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_016210861.1|321961_322192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|322343_322589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210870.1|322740_323532_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016212128.1|324445_325192_+	solute symporter family protein	NA	NA	NA	NA	NA
WP_032126495.1|325282_326167_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_054300397.1|326572_326818_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046705.1|327058_327226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|327171_327747_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047050.1|327799_328537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777815.1|328540_328825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|328918_329182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|329548_330367_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|330439_332812_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_036777812.1|333524_334952_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|334986_336009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|336025_336403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|337365_337731_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|337676_338252_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210122.1|338491_339184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|339810_340785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|340774_342547_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|342547_342895_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036777821.1|343144_344371_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|344460_345759_-	MFS transporter	NA	NA	NA	NA	NA
WP_081007061.1|345792_346542_-	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	30.4	3.9e-15
WP_016210137.1|346522_347074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007060.1|347300_348599_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|348715_349006_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_155047051.1|349317_350187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047052.1|350331_351060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777801.1|351922_352141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212044.1|352914_353169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|353891_354878_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|355015_355210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007059.1|355892_356954_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_016211797.1|357115_358519_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|358569_359145_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|359090_359405_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047053.1|359445_360332_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	444564	545036	3147033	transposase,integrase,tRNA	Escherichia_phage(43.75%)	108	511351:511410	525562:525735
WP_054300513.1|444564_445428_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|445644_447204_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|447225_448260_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|448308_448878_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|449013_449985_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|449996_451574_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|451639_452626_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054300512.1|452957_454067_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|454172_455357_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|455434_457423_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|457631_457787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047055.1|458057_458345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|458382_458748_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|458693_459269_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047056.1|459258_459621_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|460537_461944_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|461961_462948_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|462950_464105_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|464101_464797_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|464931_466422_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_036777447.1|466442_467492_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|467558_468953_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_036777444.1|469831_471763_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	1.0e-120
WP_075273353.1|471767_472298_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|472332_472527_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|472569_472929_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|473348_474344_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_036777440.1|474356_476738_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|476743_477031_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|477302_477779_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|477923_478121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|478245_479220_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|480120_480219_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780545.1|480703_481414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047057.1|481577_481994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|482230_482923_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|482964_483738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|483739_484681_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|484813_486391_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|486600_488358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|488906_489665_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|489872_490445_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|490548_491097_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|491398_491644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|491672_491969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779353.1|492236_493148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300506.1|493638_494046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|494117_494846_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126799.1|494926_495739_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_155047058.1|496800_497163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|497165_498905_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046941.1|499306_499570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300500.1|500241_500970_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_016212070.1|501379_501979_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_016212069.1|501953_502121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212066.1|502332_503109_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_054300501.1|503469_504198_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|504209_504602_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|504598_504844_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|505004_505733_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211714.1|505807_509152_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|510400_510976_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|510921_511287_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
511351:511410	attL	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCT	NA	NA	NA	NA
WP_155047059.1|511565_512480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212159.1|512747_512945_+	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_054300201.1|513304_514033_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_155047060.1|514062_514737_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	45.9	5.2e-27
WP_016212024.1|514881_515130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|515126_515726_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|515725_515944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|516718_517711_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|517707_518442_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_155047061.1|518702_518969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047062.1|519113_519272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047063.1|519294_519546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300477.1|519995_520724_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_051307368.1|521430_522711_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|522710_523679_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211646.1|524050_524290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|524282_524636_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|524938_525667_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047064.1|526136_526445_-	hypothetical protein	NA	NA	NA	NA	NA
525562:525735	attR	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTTTTACCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCC	NA	NA	NA	NA
WP_155047065.1|526606_527284_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.1	7.0e-40
WP_155047066.1|527777_528506_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.5e-43
WP_016212269.1|528674_529358_+	Fic family protein	NA	NA	NA	NA	NA
WP_016212268.1|529361_529946_+	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_017375910.1|530102_530831_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047064.1|531299_531608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|531858_532461_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300203.1|532465_532924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781052.1|534300_534903_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211639.1|535282_535585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211644.1|535699_535966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104773.1|536073_536517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|536578_537464_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047067.1|537564_538458_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047259.1|538602_538818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104771.1|539267_539606_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	54.9	5.4e-25
WP_075274739.1|539598_539946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274717.1|539942_540173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274718.1|540176_540647_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	64.3	1.3e-32
WP_075274740.1|540791_541157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780395.1|541301_541556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377363.1|541539_541896_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_075274719.1|542201_543068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047068.1|543553_543754_+	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	64.3	3.5e-16
WP_155047069.1|543841_544195_+	hypothetical protein	NA	Q6DMU4	Streptococcus_phage	34.8	8.2e-08
WP_054300202.1|544307_545036_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 6
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	552735	600688	3147033	transposase,tRNA	Synechococcus_phage(33.33%)	51	NA	NA
WP_054300202.1|552735_553464_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|553557_554223_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|554287_555244_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|555502_556201_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|556243_557356_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|557960_558536_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|558481_558847_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|558934_559285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|560020_561082_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210908.1|562293_563109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|563199_564183_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|564353_564875_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_036779246.1|564908_565163_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.4e-20
WP_016210909.1|565165_566443_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|567135_567663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|567782_570095_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|570223_571039_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|571236_571701_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|571830_572892_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|573152_573449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|573731_575195_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|575197_576250_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_036779281.1|576239_576695_+	arginine repressor	NA	NA	NA	NA	NA
WP_155047071.1|576719_577043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|577390_577702_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_054300208.1|577831_578623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779278.1|579780_580734_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|580847_581045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|581290_581491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142396463.1|581601_581718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212074.1|581804_582026_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|582052_582418_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|582474_582639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047072.1|582628_582943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046713.1|583080_583245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|583539_584976_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|585017_586469_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|586580_586868_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|587057_588101_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210536.1|588116_589016_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210528.1|589012_589531_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210527.1|589600_590218_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_036776217.1|590227_591715_+	ribonuclease G	NA	NA	NA	NA	NA
WP_016210534.1|591724_595405_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_036776215.1|595478_596291_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210530.1|596287_596968_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_155047260.1|597808_597967_-	phosphatase	NA	NA	NA	NA	NA
WP_155047073.1|598159_598717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|598766_599057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300215.1|599860_600355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|600349_600688_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	622158	724754	3147033	plate,transposase,tRNA,protease	Prochlorococcus_phage(17.65%)	108	NA	NA
WP_016209523.1|622158_623508_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|623558_623996_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|624257_625769_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_036778935.1|625774_627001_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|626994_628023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|628000_628693_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_155049805.1|628694_630167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778941.1|630159_630648_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|630653_632126_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|632125_632524_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|632520_634209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|634190_635147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|635189_635705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|635809_636742_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|636961_637348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|637364_638009_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|638189_639029_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|639104_639707_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|639707_640562_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|640918_641230_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|641254_642646_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|642801_643533_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_129556465.1|643529_644102_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|644088_644646_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|644651_645632_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|645771_646572_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_036780687.1|646575_647343_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|647339_647804_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|647826_648480_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|648483_648831_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|648864_649116_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|649192_650461_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|650463_651222_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|651283_652174_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|652224_652908_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|652993_653251_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155047218.1|653523_655692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|655683_656556_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|656723_658553_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|658715_659357_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|659598_660129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|660146_660320_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|660378_661428_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|661434_662385_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|662438_663383_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|663410_664148_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|664236_664479_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|664553_665777_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|665808_666657_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|666653_667706_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|667826_668447_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_036780649.1|668462_669449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|669559_670015_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|669974_670313_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|671077_671983_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155047217.1|672057_673119_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|673168_673378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|674612_675059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|675062_675638_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|675583_675949_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|676069_676255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|676358_677393_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|677389_678100_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|678574_679093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|679210_679543_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_036777003.1|679572_682527_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_054300221.1|682572_683070_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|683129_683546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|683637_684498_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|684580_685147_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|685179_686034_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_155047216.1|686075_688982_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|689042_689240_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|689246_690257_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|690253_691312_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|691305_692106_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|692108_692927_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|692938_693886_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|693893_695195_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|695373_696477_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|696473_696866_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|696877_698254_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|698247_699717_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_032126362.1|700174_700540_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|700485_701061_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300223.1|701155_702127_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_129556478.1|702363_703250_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|703549_703795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|704757_705177_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046954.1|705283_705457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|705683_706418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|706542_707604_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|707926_708631_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|708724_709438_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|709520_710612_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|710683_711265_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|711270_711897_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|711993_712929_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|713288_713960_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_036778813.1|714101_714761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|714929_716189_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|716185_717271_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|717263_718145_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|718133_719384_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_054300237.1|720669_721731_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047215.1|721708_722962_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_032126362.1|723867_724233_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|724178_724754_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	760171	808096	3147033	transposase,tRNA	Staphylococcus_phage(42.86%)	37	NA	NA
WP_016209374.1|760171_761623_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|761658_763188_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_155047212.1|763763_765407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047211.1|765948_766890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|767240_768056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|768347_771038_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_081007011.1|771286_772507_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|772674_774381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|774979_776206_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|776758_777733_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273456.1|777855_778155_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047210.1|778114_778477_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|778538_779424_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047266.1|780532_780964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|781679_782045_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|781990_782566_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|782592_783654_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556478.1|783768_784655_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047209.1|785004_785559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211819.1|785777_786008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|786304_786805_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|787007_788264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777316.1|788620_789034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|789343_790228_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300240.1|790484_790688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|790987_791962_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047208.1|792264_793737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|793756_794731_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|794881_795157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|795322_795943_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_054300241.1|796261_798238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|798393_799851_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|799919_801500_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_054300242.1|801540_802077_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|802122_806019_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|806025_806349_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300237.1|807034_808096_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	824777	938191	3147033	transposase,integrase,protease	Staphylococcus_phage(30.3%)	107	887242:887301	908436:909538
WP_033923708.1|824777_825653_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|825908_826553_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|826583_828389_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|828412_828988_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_155047207.1|829532_830606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|830715_831690_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046989.1|831922_832987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|833079_834054_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046989.1|834286_835351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|835841_836207_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047206.1|836221_836731_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|836766_837741_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300250.1|837823_838483_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_016209640.1|838901_839921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|840379_841345_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|841389_841965_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|841995_843270_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|843915_844629_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|844708_845446_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|845566_846922_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|847098_847770_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|847885_848761_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|849364_850669_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|850781_851387_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|851468_852770_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|852837_855270_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|855373_855646_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075273480.1|855728_857627_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209643.1|857658_858543_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|858551_858947_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|859374_861522_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|861493_862843_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|862839_864960_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|864956_866660_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209654.1|866778_867921_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|867985_869014_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_036776625.1|869140_870655_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|870744_871230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275067.1|871562_872630_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|873692_874598_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_051307360.1|874714_875644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780074.1|876735_877542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|877884_879777_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|880063_880468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923634.1|880672_881221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|881210_882097_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|882435_882846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047205.1|883020_883242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|883729_884095_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|884040_884616_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664862.1|885789_886488_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_016211528.1|886468_886774_+	hypothetical protein	NA	NA	NA	NA	NA
887242:887301	attL	CGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACT	NA	NA	NA	NA
WP_054300271.1|887333_888308_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300253.1|888526_889477_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	34.7	6.9e-09
WP_016211534.1|889463_889973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211530.1|889978_890875_-	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211531.1|891228_891909_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155047204.1|891972_892530_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0V4T7	Roseobacter_phage	33.3	8.4e-15
WP_054300271.1|892553_893528_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212424.1|893871_894150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|894142_894415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|894532_895615_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036780532.1|895692_896733_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_081007067.1|897244_902719_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_016212302.1|902939_903239_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_155047203.1|903539_904601_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036781361.1|904620_905010_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_155047202.1|905292_906357_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.2	4.7e-139
WP_016211579.1|906861_907347_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|907414_908323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|908527_909502_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300257.1|909706_910516_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.6	1.8e-29
908436:909538	attR	CGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_075273486.1|910492_911467_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.2e-29
WP_016211585.1|911701_912259_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_155047201.1|912320_913082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|913157_914132_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211584.1|914304_914658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|914724_914919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|914934_915279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|915348_915924_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|915869_916235_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155049808.1|916319_916928_+	DNA polymerase	NA	NA	NA	NA	NA
WP_052047108.1|917012_917411_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046984.1|918222_919341_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046716.1|919762_919909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|920606_921161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|921597_921780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|921844_922072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|922302_923049_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|923275_923569_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|923640_924246_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|924394_925372_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_155047199.1|925468_926911_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|926937_927591_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_036779374.1|927715_928282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|928636_930415_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_052104721.1|930486_932193_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_054300262.1|932184_932475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|932937_933303_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|933248_933824_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|933827_934202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|934577_935552_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_054300263.1|935623_936064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047198.1|936051_936219_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|936363_936624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|936583_936922_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|937305_938191_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	958733	1003856	3147033	transposase,tRNA	Escherichia_phage(16.67%)	44	NA	NA
WP_054300173.1|958733_959795_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211781.1|960011_961259_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036779112.1|961481_962918_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_129556486.1|963003_963351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273492.1|963441_963561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|963669_964731_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|964725_964896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|964885_965050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|965106_965472_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|965493_965862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047196.1|966006_966588_-	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_017375910.1|966658_967387_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016210898.1|967643_967994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|968082_968373_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|968847_969150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300270.1|969490_970468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|970546_971884_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|972002_972374_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|972595_973246_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|973288_974371_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|974424_976308_+	APC family permease	NA	NA	NA	NA	NA
WP_033923708.1|976917_977793_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155047195.1|977805_978708_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211091.1|978782_981263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273494.1|982327_982888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|983478_984540_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275207.1|984587_985037_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211036.1|985384_987256_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_036779409.1|987347_989093_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211043.1|989172_989622_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211035.1|989674_989890_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211042.1|990136_991153_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211037.1|991201_991831_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211040.1|992181_993393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126170.1|993620_993893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047067.1|994056_994950_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556557.1|995094_995406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104774.1|995453_996086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047009.1|996230_996404_-	phosphatase	NA	NA	NA	NA	NA
WP_016211450.1|997179_998202_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211448.1|998300_999509_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211446.1|999498_1001226_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036776407.1|1001409_1002546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|1002794_1003856_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	1016364	1053806	3147033	transposase,tRNA,protease	Orpheovirus(20.0%)	40	NA	NA
WP_129556478.1|1016364_1017251_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211932.1|1017661_1018951_-	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_036777061.1|1019146_1020334_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211476.1|1020651_1020861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211473.1|1020844_1021444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211474.1|1021518_1022868_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_032126518.1|1022950_1025152_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211478.1|1025168_1025984_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126519.1|1025963_1026683_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_075273327.1|1026850_1027426_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1027371_1027737_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211265.1|1027911_1028574_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1028604_1028973_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_032126514.1|1028983_1030300_-	MFS transporter	NA	NA	NA	NA	NA
WP_051307354.1|1030582_1031158_+	DedA family protein	NA	NA	NA	NA	NA
WP_032126515.1|1031233_1031413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|1031585_1031879_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_075273504.1|1032068_1032422_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211262.1|1032476_1034750_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_016211259.1|1034809_1035055_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_054300275.1|1035179_1036055_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211550.1|1036132_1036894_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_016211548.1|1036877_1037834_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211549.1|1038096_1040601_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211553.1|1040604_1041345_+	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_054300209.1|1041684_1042050_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1042106_1042271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1042260_1042560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126933.1|1042563_1043865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1044033_1045008_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209411.1|1045213_1046008_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_016209421.1|1046170_1046959_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_036776605.1|1046955_1048167_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_032126508.1|1048156_1048516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209444.1|1048610_1049039_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_129556555.1|1049169_1050300_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209436.1|1050296_1051025_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_016209412.1|1051082_1051970_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209433.1|1052054_1052429_+	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209424.1|1052528_1053806_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
>prophage 12
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	1086292	1216968	3147033	transposase,integrase,tRNA,protease	Staphylococcus_phage(21.43%)	105	1144640:1144699	1205540:1206037
WP_016209432.1|1086292_1088002_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209448.1|1088259_1089591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209449.1|1090032_1091505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1092220_1092586_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273508.1|1092826_1093693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|1094205_1094550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776562.1|1094702_1094894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1095137_1095713_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1095658_1096024_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300283.1|1096264_1096906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1097373_1098348_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047193.1|1099561_1100950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780476.1|1101185_1103123_-	histidine kinase	NA	NA	NA	NA	NA
WP_016210517.1|1104136_1104856_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|1104969_1108509_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|1108575_1109394_+	ZipA protein	NA	NA	NA	NA	NA
WP_016210518.1|1109380_1111420_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210522.1|1111435_1112488_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210524.1|1112498_1113029_+	exsB family protein	NA	NA	NA	NA	NA
WP_016210010.1|1114666_1114843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780418.1|1115018_1115402_+	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_075273518.1|1115477_1115771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047192.1|1115937_1116894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|1117627_1117783_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|1118047_1119418_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_052104723.1|1119410_1120364_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036779556.1|1120344_1123149_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.0	3.1e-57
WP_016210027.1|1123228_1123825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1124214_1124970_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155047191.1|1125367_1126099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|1126359_1127685_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210023.1|1127681_1129739_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210007.1|1129716_1130289_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|1130344_1130704_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|1130768_1131803_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|1132060_1132912_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|1133006_1133990_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|1134146_1135814_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_155047190.1|1136752_1137070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556556.1|1137088_1137664_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1137609_1137975_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|1137996_1138326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047175.1|1138734_1140057_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_032126362.1|1140587_1140953_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1140898_1141474_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047189.1|1141533_1141707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047265.1|1141996_1142590_+	reverse transcriptase	NA	A0A0N7AE80	Bacillus_phage	28.9	4.0e-07
WP_105962623.1|1142598_1143752_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_081007015.1|1144244_1144670_-	hypothetical protein	NA	NA	NA	NA	NA
1144640:1144699	attL	CCCTCTGTGCCAGCCAAAGTGAGACAAAAATGTGCTAAAAGATAAGAACATTTAGGCGGT	NA	NA	NA	NA
WP_098082828.1|1144881_1145139_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049836.1|1145138_1145774_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_052104629.1|1145917_1146943_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155049842.1|1147198_1147606_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300292.1|1147860_1148862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|1149317_1149470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|1149442_1149616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047188.1|1149605_1149770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300293.1|1149826_1150192_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300294.1|1150463_1151525_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211279.1|1152268_1154737_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_016211277.1|1154750_1155719_+	homoserine kinase	NA	NA	NA	NA	NA
WP_016211278.1|1155705_1156965_+	threonine synthase	NA	NA	NA	NA	NA
WP_129556646.1|1157016_1158402_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_036781047.1|1159719_1160577_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_036778145.1|1161189_1162311_+	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	8.7e-11
WP_016211172.1|1162360_1163557_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_080664856.1|1163745_1164810_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_051307350.1|1164793_1165540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778066.1|1165529_1166258_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211168.1|1166254_1166914_+	wbqC-like family protein	NA	NA	NA	NA	NA
WP_155046736.1|1166891_1167845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1167844_1168360_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778065.1|1168402_1169836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210393.1|1169929_1172131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210398.1|1172619_1174212_+	B-type flagellin	NA	NA	NA	NA	NA
WP_032126669.1|1174436_1176014_+	B-type flagellin	NA	NA	NA	NA	NA
WP_122940572.1|1176125_1176551_+	flaG family protein	NA	NA	NA	NA	NA
WP_016210394.1|1176661_1178047_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032126670.1|1178072_1178510_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210390.1|1178514_1178856_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_016210399.1|1178870_1180862_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210388.1|1180887_1181562_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210397.1|1181558_1183733_-	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210772.1|1184941_1186495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1186578_1187388_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_033923762.1|1187515_1187749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210769.1|1188049_1189552_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_016210773.1|1189855_1192549_+	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210771.1|1192545_1195947_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_054300162.1|1196038_1197121_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300297.1|1197183_1198251_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212246.1|1199186_1199843_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|1199946_1201029_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300271.1|1201368_1202343_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212247.1|1202970_1203726_-	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_036779544.1|1204092_1205100_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1205099_1205357_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047187.1|1205720_1206695_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
1205540:1206037	attR	ACCGCCTAAATGTTCTTATCTTTTAGCACATTTTTGTCTCACTTTGGCTGGCACAGAGGGAACAGGACTTTCAGATTTACTGGAAGGAGCGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGACACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACG	NA	NA	NA	NA
WP_075273524.1|1206735_1207701_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|1207856_1209407_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_054300299.1|1211608_1212691_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046981.1|1212780_1212957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1213955_1214819_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155047186.1|1214848_1216078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047185.1|1216081_1216968_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	1257640	1433559	3147033	transposase,integrase,tRNA	Staphylococcus_phage(17.65%)	153	1289894:1289953	1366021:1366384
WP_054300304.1|1257640_1257919_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047180.1|1257971_1258175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776195.1|1258817_1260065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923708.1|1260476_1261352_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211947.1|1261466_1262612_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_129556540.1|1262604_1263000_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211946.1|1263218_1263974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212551.1|1265329_1265824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556643.1|1266281_1267646_-	histidine kinase	NA	NA	NA	NA	NA
WP_016211983.1|1267741_1268401_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_155047179.1|1268648_1268993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047178.1|1269061_1269790_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.5e-43
WP_155047177.1|1269836_1269983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300189.1|1270039_1270405_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036779232.1|1270699_1272259_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|1272619_1274590_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|1274781_1275861_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_052104715.1|1275909_1276116_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211210.1|1276122_1277604_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211214.1|1277706_1278270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1280031_1281291_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211940.1|1281411_1281744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1281857_1282832_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_155047176.1|1282976_1283129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300312.1|1283346_1284369_+	YHYH protein	NA	NA	NA	NA	NA
WP_036778055.1|1284376_1286059_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.7e-32
WP_016211344.1|1286219_1287038_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|1287251_1288235_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|1288227_1288449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|1288476_1289118_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_033923708.1|1289361_1290237_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1289894:1289953	attL	TACCTGAAATTGCTCAAGGTCTGACAGGTAAGATTATTGGTGATAAAGGTTACATTTCAC	NA	NA	NA	NA
WP_129556490.1|1292699_1293585_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1293589_1293877_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|1293929_1294208_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|1294306_1294654_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|1294975_1295215_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|1295432_1296020_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|1295980_1296316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|1296503_1297148_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|1297482_1298133_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|1298665_1299718_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032126786.1|1299735_1302816_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_054300384.1|1303114_1303930_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047175.1|1304338_1305661_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_155047174.1|1306569_1307214_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.4	1.1e-39
WP_155047173.1|1307269_1307479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209615.1|1308831_1309338_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016209623.1|1309354_1310854_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209624.1|1310875_1311487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209622.1|1311492_1312656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777073.1|1312687_1315225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|1315256_1317149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273639.1|1317516_1318233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777070.1|1318235_1321109_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_016209636.1|1321109_1321514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|1321528_1323250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|1323249_1326198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|1326200_1327598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209630.1|1327611_1328352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|1328332_1328767_+	lipoprotein	NA	NA	NA	NA	NA
WP_016209618.1|1328811_1329441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209616.1|1329511_1330426_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_033923701.1|1330456_1333759_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209627.1|1333755_1335579_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_016209617.1|1335618_1336017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209621.1|1336137_1337142_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|1337574_1339023_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_036777066.1|1339109_1342166_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081007073.1|1342148_1342319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046976.1|1342384_1342522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212485.1|1342818_1343352_-	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_032126753.1|1344186_1344651_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|1344720_1346241_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126752.1|1346328_1346931_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|1346927_1347275_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|1347425_1348409_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_122942160.1|1349036_1350017_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052047087.1|1350177_1350396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047172.1|1350567_1351593_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300320.1|1352738_1353338_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300321.1|1353555_1353927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212346.1|1354721_1354868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1355101_1355965_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211748.1|1357446_1359051_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211752.1|1359066_1360212_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_075273313.1|1360288_1360627_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1360586_1361042_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212445.1|1361287_1361554_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047171.1|1361628_1362192_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	39.9	3.2e-30
WP_155047170.1|1362396_1362678_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047169.1|1362712_1363321_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212534.1|1363733_1364000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1365127_1365493_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1365438_1366014_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047168.1|1366523_1367444_+	hypothetical protein	NA	NA	NA	NA	NA
1366021:1366384	attR	TACCTGAAATTGCTCAAGGTCTGACAGGTAAGATTATTGGTGATAAAGGTTACATTTCACAAGATTTATTTAACAGGCTTTATGAAAAAGGACTGCAATTAATCAATAAAATTCGCAAGAATATGAAAAATAGGCTCATGCCTATCATCGATAAAATTTTACTCAGAAAACGTGGAATTATTGAAAGTGTATTTGATCAACTTAAAAACATCTCACAAATCGAGCACTCTAGGCATCGTAGTGTCAACAACTTTATGGTCAATATTCTTGCTGGATTAGCAGCCTACTGTCTTCAGGAGAAGAAGCCATCGCTTAATATCCAGCGTAATCTATTGACCAGCTGAGTTATATCGAACTCACGTTA	NA	NA	NA	NA
WP_054300322.1|1367482_1369417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1369804_1370398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273534.1|1372029_1372911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1373104_1373377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300326.1|1373478_1373943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046975.1|1374356_1374806_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_016212459.1|1374925_1375306_+	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_054300328.1|1375443_1376220_-	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_155047167.1|1376330_1377848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047166.1|1377897_1378959_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211456.1|1379580_1380159_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_122942091.1|1380186_1380582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211455.1|1380687_1382145_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_016211452.1|1382206_1383694_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211454.1|1384444_1384915_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|1386789_1387062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1387214_1387580_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1387525_1388101_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556641.1|1390183_1391446_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016210751.1|1391533_1393339_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_016210752.1|1393822_1394620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210749.1|1394789_1395251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1395549_1397505_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1398186_1398372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|1398705_1399695_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016211834.1|1403068_1403383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307365.1|1403640_1403901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1403920_1404409_+	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_155046972.1|1405932_1406523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047040.1|1407111_1408050_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047165.1|1408075_1409641_-	amino acid permease	NA	NA	NA	NA	NA
WP_036778182.1|1409847_1410675_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_075273540.1|1411041_1411653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556527.1|1411837_1412098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047164.1|1413090_1413513_+	response regulator	NA	NA	NA	NA	NA
WP_036777256.1|1413935_1414136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104738.1|1414510_1415317_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210795.1|1415422_1416394_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210801.1|1416375_1417347_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155047264.1|1417669_1418029_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_054300271.1|1418068_1419043_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007028.1|1419458_1419914_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1419873_1420212_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|1420385_1420826_-	universal stress protein	NA	NA	NA	NA	NA
WP_032126362.1|1421292_1421658_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1421603_1422179_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211350.1|1422463_1423402_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211349.1|1423465_1425460_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|1425456_1426059_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_036779888.1|1426055_1426394_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|1426469_1427696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300339.1|1428253_1429225_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.2e-25
WP_016211856.1|1429440_1429626_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|1429752_1430220_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|1430216_1431095_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|1431345_1432653_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007028.1|1432805_1433261_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1433220_1433559_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	1449174	1555441	3147033	transposase,tRNA	Staphylococcus_phage(14.81%)	103	NA	NA
WP_054300271.1|1449174_1450149_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047162.1|1450168_1450606_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|1450620_1450986_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210855.1|1451139_1452117_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210849.1|1452234_1453683_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210847.1|1453711_1454716_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210851.1|1454738_1455410_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210850.1|1455394_1456648_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1456896_1457451_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210848.1|1458034_1459219_+	MFS transporter	NA	NA	NA	NA	NA
WP_051307341.1|1459385_1460984_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_155047161.1|1461677_1462649_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300343.1|1462684_1462912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1462915_1463802_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007031.1|1463889_1464162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209794.1|1464896_1465520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776664.1|1465565_1467509_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	23.9	1.1e-05
WP_016209788.1|1467630_1468383_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016209790.1|1468434_1468893_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_129556639.1|1469188_1469599_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209775.1|1469615_1470071_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_016209797.1|1470067_1470559_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_080664822.1|1470555_1471305_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_016209776.1|1471334_1471604_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_036776670.1|1471619_1472405_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_016209786.1|1472418_1473552_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_016209770.1|1473586_1475680_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_016209767.1|1475710_1477171_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_129556524.1|1477151_1478039_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_016209784.1|1478035_1478758_+	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_017377132.1|1478844_1479228_+	response regulator	NA	NA	NA	NA	NA
WP_036776675.1|1479269_1480013_+	chemotaxis protein CheZ	NA	NA	NA	NA	NA
WP_036776682.1|1480025_1482050_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_051307317.1|1482111_1482405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209791.1|1482541_1483264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209771.1|1483428_1484151_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126436.1|1484857_1485313_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209793.1|1485328_1486777_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_016209795.1|1486817_1487573_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_080664823.1|1487553_1488954_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209796.1|1488977_1490195_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_016209778.1|1490225_1490600_+	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209772.1|1490618_1491170_+	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_054300271.1|1492451_1493426_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1493523_1494585_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1495139_1496114_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212424.1|1496457_1496736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|1496728_1497001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1497118_1498201_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300346.1|1498347_1499223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126678.1|1499233_1500244_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_016211554.1|1500570_1501197_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_016211557.1|1501242_1502472_+	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_032126677.1|1502666_1503230_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211555.1|1503304_1504663_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_016211664.1|1505199_1505928_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211666.1|1506300_1509120_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211669.1|1509274_1509625_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1510449_1511424_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556522.1|1512734_1513967_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211405.1|1514173_1515946_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_016211403.1|1516081_1517125_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_036777261.1|1517138_1517882_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_155047160.1|1518016_1518316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144019306.1|1518377_1518557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1518920_1519619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047159.1|1520040_1521432_+	protein kinase	NA	NA	NA	NA	NA
WP_016211733.1|1521487_1522312_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_054300173.1|1522926_1523988_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046730.1|1524206_1524347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1524614_1525262_-	LysE family translocator	NA	NA	NA	NA	NA
WP_016212267.1|1525542_1525902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|1526068_1526524_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1526483_1526822_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047158.1|1526957_1529231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126823.1|1529219_1529942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104609.1|1530052_1530685_+	MarC family protein	NA	NA	NA	NA	NA
WP_098082850.1|1530720_1530897_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_016211481.1|1530971_1532114_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_155049129.1|1532192_1532330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126825.1|1532346_1533660_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_054300349.1|1534211_1535936_+	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_155046942.1|1536996_1537882_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046942.1|1538046_1538932_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556521.1|1539466_1539655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1539605_1540759_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047157.1|1540823_1541228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047156.1|1541399_1542023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211631.1|1542281_1543088_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_054300351.1|1543343_1544165_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211632.1|1544200_1545055_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211627.1|1545280_1545445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1545750_1546407_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1546490_1546856_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300181.1|1546912_1547194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|1547197_1547377_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016210103.1|1547729_1549088_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_016210117.1|1549369_1549729_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210111.1|1550149_1551784_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_017377579.1|1551790_1552627_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210099.1|1552648_1553926_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_016210105.1|1554009_1554330_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210106.1|1554349_1555441_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	1573839	1617793	3147033	transposase,integrase,protease	Staphylococcus_phage(45.45%)	48	1573744:1573803	1600556:1600644
1573744:1573803	attL	GGTAACCCTCCCTTAAAATAGTACAAGTGATAAGTGGAATCTTCTGTTAAATTAACTTAG	NA	NA	NA	NA
WP_054300353.1|1573839_1574067_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300354.1|1574213_1574732_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	42.9	1.3e-30
WP_155047155.1|1574677_1574827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1574870_1575845_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047154.1|1575917_1576298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1576258_1576624_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1576569_1577145_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300355.1|1577134_1577320_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211563.1|1577530_1577692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211564.1|1577724_1578600_-	ParA family protein	NA	NA	NA	NA	NA
WP_052104693.1|1578765_1582632_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_080728343.1|1582713_1582854_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_081007034.1|1582835_1583120_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_155047153.1|1583384_1584803_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_016211991.1|1585711_1586617_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126537.1|1586857_1587043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211994.1|1587079_1587616_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_155047152.1|1587818_1588541_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1588580_1589555_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047151.1|1589551_1590091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047150.1|1590140_1591367_+	DUF4131 domain-containing protein	NA	NA	NA	NA	NA
WP_155047149.1|1591361_1591577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|1591600_1592575_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016212012.1|1592618_1593296_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016212013.1|1593311_1593695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212011.1|1593916_1595038_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_054300357.1|1595271_1596147_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211974.1|1596429_1597551_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075273551.1|1597650_1597953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556638.1|1597952_1598633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377865.1|1599977_1600262_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664876.1|1600620_1602483_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
1600556:1600644	attR	CTAAGTTAATTTAACAGAAGATTCCACTTATCACTTGTACTATTTTAAGGGAGGGTTACCGATGGTTATTTCACTAGATGAATTTTATT	NA	NA	NA	NA
WP_054300359.1|1602707_1603280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047148.1|1603638_1604676_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047147.1|1605205_1606180_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_054300361.1|1606333_1606630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377353.1|1606607_1607273_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1607312_1608287_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211144.1|1608843_1609473_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_036779218.1|1609456_1609879_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|1609885_1611625_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|1611625_1612690_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1612693_1613047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1613159_1614116_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|1614125_1614437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1614452_1615022_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|1615285_1616614_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1616818_1617793_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 16
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	1626681	1674085	3147033	transposase,integrase,tRNA	Staphylococcus_phage(25.0%)	42	1616728:1616787	1659553:1660654
1616728:1616787	attL	GCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTC	NA	NA	NA	NA
WP_129556637.1|1626681_1627461_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|1627935_1628373_-	MFS transporter	NA	NA	NA	NA	NA
WP_155047262.1|1628761_1628878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300363.1|1629269_1629617_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047145.1|1629562_1630138_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273553.1|1630127_1631054_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300364.1|1631227_1632106_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126267.1|1632525_1632768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211330.1|1633115_1634216_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_098082827.1|1634390_1635692_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_052104656.1|1635768_1636272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126265.1|1636595_1637513_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016211336.1|1637578_1638193_-	chorismate mutase	NA	NA	NA	NA	NA
WP_016211334.1|1638241_1638430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210322.1|1639047_1639944_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016210320.1|1640080_1641154_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_054300366.1|1641303_1641717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300568.1|1641737_1642448_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.3	4.1e-38
WP_129556511.1|1642630_1644067_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210321.1|1644263_1645232_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_016210325.1|1647902_1649279_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210326.1|1649432_1650731_-	ankyrin repeats family protein	NA	NA	NA	NA	NA
WP_036778577.1|1651070_1652354_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_016210333.1|1652427_1653057_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_016210330.1|1653260_1653644_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210332.1|1653741_1654485_+	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_075273555.1|1654615_1655149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1655426_1656110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|1656863_1657838_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_155047144.1|1657873_1659199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1659643_1660618_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211804.1|1661000_1662386_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
1659553:1660654	attR	GCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_081007037.1|1662392_1663931_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211806.1|1663973_1664699_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032126804.1|1664863_1665739_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1665898_1666804_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_032126803.1|1667037_1668270_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_016211764.1|1668470_1669292_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211767.1|1670130_1670940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211289.1|1672556_1672829_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211286.1|1672940_1673288_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_036777656.1|1673305_1674085_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 17
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	1700146	1744204	3147033	transposase,tRNA,protease	Staphylococcus_phage(22.22%)	39	NA	NA
WP_054300173.1|1700146_1701208_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046721.1|1701388_1701556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1701727_1702702_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300373.1|1702698_1703556_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209842.1|1704283_1704673_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209834.1|1704849_1705608_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209829.1|1705604_1708004_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209839.1|1709383_1710682_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209838.1|1710879_1711773_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|1711772_1712987_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|1713006_1714293_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|1714308_1714563_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_036777393.1|1714798_1716166_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|1716496_1717519_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|1718041_1719517_+	APC family permease	NA	NA	NA	NA	NA
WP_054300271.1|1719756_1720731_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556633.1|1720839_1721736_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209827.1|1722054_1723614_+	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_075273569.1|1723689_1723896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209831.1|1724103_1724802_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|1725080_1725344_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_036777412.1|1725650_1728245_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209835.1|1728241_1728724_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209844.1|1728701_1729742_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209840.1|1729914_1730400_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_032126641.1|1730507_1733078_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_032126642.1|1733113_1733575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049837.1|1733644_1733836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|1735054_1735594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|1736541_1738026_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|1738150_1739686_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|1739919_1740285_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047140.1|1740230_1740815_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047139.1|1740838_1741243_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047138.1|1741218_1741701_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728346.1|1741718_1742051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046723.1|1742958_1743114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|1743272_1743578_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_075273327.1|1743628_1744204_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	1765624	1821150	3147033	transposase,tRNA	Staphylococcus_phage(15.38%)	55	NA	NA
WP_075273298.1|1765624_1766200_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046962.1|1766203_1766650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1767301_1767802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|1768217_1768571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211831.1|1768871_1770599_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_081007040.1|1770736_1771393_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210510.1|1771423_1772152_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_016210506.1|1772144_1773383_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210512.1|1773518_1774556_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210515.1|1774609_1775512_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210514.1|1775620_1776874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1776931_1780429_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075273576.1|1780488_1781217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778516.1|1781344_1781893_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016210508.1|1782213_1783911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1783919_1785073_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_036781272.1|1785668_1785887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047136.1|1785979_1786411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1786578_1786944_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047135.1|1786889_1787465_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211467.1|1787539_1788106_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_032126344.1|1788108_1789197_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032126343.1|1789317_1790130_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|1790260_1792246_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211470.1|1792305_1792959_-	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_155047134.1|1793725_1794748_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047133.1|1795019_1795994_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.6e-27
WP_016212421.1|1796744_1796927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|1797278_1797503_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155047132.1|1797647_1798310_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.6	5.3e-32
WP_032126637.1|1798426_1798720_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556508.1|1798781_1799225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047131.1|1799495_1800152_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047130.1|1800339_1801098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1801160_1802222_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211841.1|1803081_1803534_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211839.1|1803651_1805124_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|1805282_1805747_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|1806217_1806391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1807100_1807466_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1807411_1807987_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300250.1|1807976_1808636_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_032126143.1|1808735_1810007_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_016211422.1|1810095_1810566_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_051307357.1|1810588_1811182_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211417.1|1811318_1812368_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_016211415.1|1812391_1813315_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1813331_1813793_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211414.1|1813900_1814719_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_129556449.1|1814934_1815441_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1815455_1815821_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047129.1|1816024_1816681_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300382.1|1816951_1817374_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300383.1|1817644_1820125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126139.1|1820220_1821150_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 19
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	1827915	1886832	3147033	transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(33.33%)	57	NA	NA
WP_054300162.1|1827915_1828998_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212040.1|1829203_1830553_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_016212039.1|1830729_1831287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133287.1|1831475_1831874_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047128.1|1831929_1833297_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.6e-12
WP_155047127.1|1833705_1834521_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212251.1|1834682_1835219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046960.1|1835380_1836034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047126.1|1836153_1836645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|1836916_1837099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1837448_1838726_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_080664858.1|1838722_1838860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211223.1|1839371_1840973_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211221.1|1840989_1842132_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211218.1|1842384_1843122_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|1843146_1844418_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_032126790.1|1844646_1845552_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_054300387.1|1845810_1848210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300388.1|1848257_1849940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209976.1|1850809_1851043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007074.1|1851276_1851864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209969.1|1851830_1852796_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016209951.1|1852786_1853197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209957.1|1853203_1853539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556634.1|1853539_1854082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209950.1|1854386_1855178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209973.1|1855214_1858319_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_016209965.1|1858348_1859146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209956.1|1859150_1862141_-	ATPase AAA	NA	NA	NA	NA	NA
WP_036776383.1|1862146_1862578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209972.1|1862628_1863195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036776381.1|1863194_1864238_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_016209954.1|1864243_1864768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209953.1|1864789_1867096_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_016209962.1|1867142_1867382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209958.1|1867383_1868511_-	type II/IV secretion system family protein	NA	NA	NA	NA	NA
WP_016209964.1|1868510_1869263_-	dotC-like type IV secretion system protein	NA	NA	NA	NA	NA
WP_051307320.1|1869255_1869762_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_016209959.1|1869786_1870194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556635.1|1870221_1871229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209971.1|1871287_1872193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209955.1|1872199_1873393_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_155047125.1|1873389_1874316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211310.1|1875290_1876004_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SEW9	Cyanophage	39.1	2.2e-39
WP_016211308.1|1876079_1876358_-	lipoprotein	NA	NA	NA	NA	NA
WP_032126213.1|1876402_1877293_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_016211307.1|1877377_1877851_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_016211313.1|1877986_1878508_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016211309.1|1878548_1879343_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016211305.1|1879345_1879627_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155047124.1|1879623_1880601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211312.1|1881306_1882053_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|1882174_1883236_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780082.1|1883779_1884685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|1884815_1885544_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|1885663_1885942_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_129556478.1|1885945_1886832_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	1897623	1953056	3147033	transposase,tRNA	uncultured_Mediterranean_phage(30.77%)	47	NA	NA
WP_081007041.1|1897623_1898151_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|1898816_1899011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1899224_1899578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1899909_1900530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211823.1|1900570_1900759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047122.1|1900793_1904885_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211770.1|1905084_1906218_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|1906231_1906420_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_054300276.1|1906712_1907687_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_075273594.1|1907726_1909097_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300404.1|1909169_1910063_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|1910171_1911089_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_036777569.1|1911140_1911896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|1911963_1913238_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_036777566.1|1913372_1914050_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209944.1|1914250_1915678_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|1915652_1916291_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|1916500_1916779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|1917012_1917957_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_036777561.1|1917978_1919847_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|1919867_1920221_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777579.1|1920259_1921375_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209932.1|1921557_1922598_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|1922600_1923635_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|1923631_1924693_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|1924804_1926277_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_052104625.1|1926429_1926873_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209940.1|1926948_1929720_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_036777555.1|1929876_1931106_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1931132_1931795_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|1932316_1932817_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047121.1|1932918_1934022_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	9.5e-10
WP_075274669.1|1934226_1934529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300286.1|1934913_1935378_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962623.1|1935541_1936694_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047120.1|1936703_1937048_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047119.1|1937332_1938655_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_081007042.1|1939063_1939879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300406.1|1942432_1945168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1945468_1946530_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126856.1|1946590_1946932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1947236_1948390_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_155049815.1|1948572_1948725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1949024_1949390_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1949335_1949911_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212005.1|1950249_1952010_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_016210592.1|1952399_1953056_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	1957604	2018839	3147033	transposase,tRNA	Tupanvirus(18.18%)	51	NA	NA
WP_032126176.1|1957604_1958387_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210588.1|1958477_1959803_-	fimV domain protein	NA	NA	NA	NA	NA
WP_016210595.1|1960170_1961349_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210594.1|1961525_1962179_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_036778626.1|1962314_1964255_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_129556498.1|1964251_1964860_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054300271.1|1965039_1966014_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080728317.1|1966204_1969570_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211391.1|1969636_1970212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779996.1|1970223_1971780_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_036779999.1|1971799_1972231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780001.1|1972217_1972481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|1972837_1973209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|1973413_1974139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212252.1|1974453_1974612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047118.1|1974649_1976092_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_075273327.1|1976081_1976657_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1976602_1976968_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274672.1|1977005_1977599_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211114.1|1977964_1980895_-	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_016211115.1|1981027_1982980_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211112.1|1983172_1983820_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211113.1|1983875_1985201_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_032126179.1|1985230_1985482_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_080664854.1|1985439_1986021_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300408.1|1986357_1987014_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_032126362.1|1987064_1987430_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1987375_1987951_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209823.1|1989172_1989616_-	response regulator	NA	NA	NA	NA	NA
WP_016209809.1|1990040_1990529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|1990635_1991604_+	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_155047117.1|1992305_1995605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209810.1|1997194_1999108_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209822.1|1999164_1999812_-	methyltransferase domain protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_036777933.1|1999947_2001072_-	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_016209800.1|2001068_2001665_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209821.1|2001695_2002028_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209812.1|2002117_2003941_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_036777937.1|2004387_2006100_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	4.3e-25
WP_016209815.1|2006417_2006957_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016209799.1|2007343_2007760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209818.1|2007855_2008671_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209805.1|2008803_2010297_+	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_032126324.1|2010475_2010898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209801.1|2010897_2012952_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016209813.1|2013236_2014052_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_036778458.1|2014152_2014971_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209808.1|2014967_2015336_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016209806.1|2015678_2015828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212343.1|2016640_2017447_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_129556499.1|2017685_2018839_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 22
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	2025356	2071325	3147033	transposase,tRNA	Bacillus_phage(20.0%)	50	NA	NA
WP_032126637.1|2025356_2025650_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126540.1|2025880_2026744_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046995.1|2026877_2027763_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126332.1|2028410_2029610_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_016211366.1|2029862_2030150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779263.1|2030205_2032215_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_032126330.1|2032557_2033517_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_016211367.1|2033664_2034447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273303.1|2034602_2035319_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016210281.1|2035332_2036724_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210270.1|2036765_2039753_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210277.1|2039822_2040656_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210279.1|2040709_2041876_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210272.1|2041863_2042574_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210283.1|2042613_2043399_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_129556492.1|2043426_2044170_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|2044267_2046463_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_016210271.1|2046539_2047223_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_032126334.1|2047233_2047665_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_036778186.1|2047704_2048103_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_016210273.1|2048475_2049183_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210275.1|2049247_2049550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210276.1|2049605_2050082_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210284.1|2050136_2050658_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210280.1|2050739_2051834_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_075273327.1|2052245_2052821_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2052766_2053132_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047116.1|2053092_2053344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300415.1|2053933_2054635_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_032126500.1|2054768_2055485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|2055621_2056869_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126499.1|2057247_2057859_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211122.1|2057955_2058822_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2058825_2059587_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_036779309.1|2059750_2060656_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211125.1|2060878_2061709_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|2061878_2062268_+	lipoprotein	NA	NA	NA	NA	NA
WP_032126498.1|2062400_2062961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|2063022_2063388_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2063402_2063909_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047115.1|2063905_2064310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212585.1|2064604_2064925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2065036_2066011_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|2066380_2066956_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2066901_2067267_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274673.1|2067227_2068226_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780900.1|2068396_2069050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047081.1|2069100_2069538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212519.1|2069808_2070189_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300173.1|2070263_2071325_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	2089078	2131713	3147033	transposase	Staphylococcus_phage(25.0%)	44	NA	NA
WP_129556490.1|2089078_2089964_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047111.1|2089968_2091297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047110.1|2091413_2092475_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126869.1|2092452_2092692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2093212_2093788_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2093733_2094099_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047109.1|2094160_2094574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556488.1|2095754_2096605_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275079.1|2096753_2097815_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126801.1|2097862_2098372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274679.1|2099040_2100102_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212218.1|2101553_2101904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285943.1|2102048_2102885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|2102938_2104231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104686.1|2104466_2107223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046955.1|2108378_2108558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|2108799_2109501_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|2109761_2109968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|2110197_2110503_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|2110681_2112679_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2112662_2113709_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|2114429_2115281_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|2115281_2116202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|2116612_2116897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2116888_2117344_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2117303_2117642_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2117854_2118784_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2118940_2119369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047107.1|2119449_2119902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2119927_2120833_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2121029_2121638_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155047106.1|2121678_2122565_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556499.1|2122761_2123914_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211971.1|2124120_2124732_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2124752_2125949_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2126045_2126186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2126198_2126603_-	SufE family protein	NA	NA	NA	NA	NA
WP_075273313.1|2126728_2127067_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300431.1|2127026_2127329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|2127473_2127659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|2128228_2128810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300573.1|2128837_2129971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|2130234_2130762_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_081007045.1|2131083_2131713_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	2153418	2255398	3147033	transposase,tRNA,protease	Staphylococcus_phage(29.41%)	110	NA	NA
WP_016209884.1|2153418_2154042_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2154118_2154319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2154460_2155159_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2155305_2155875_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2156189_2156813_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2157021_2157624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2157695_2158581_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|2158804_2159691_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273603.1|2159770_2159947_+	phosphatase	NA	NA	NA	NA	NA
WP_129556565.1|2160070_2160466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047105.1|2160774_2161656_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	3.4e-50
WP_016212445.1|2161898_2162165_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|2162223_2162808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274681.1|2163358_2164234_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063519.1|2164282_2164699_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210465.1|2164985_2165828_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2165878_2166226_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2166416_2167304_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2167418_2168021_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2168017_2168737_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_052104601.1|2168805_2170518_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_036777098.1|2170665_2172603_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2172711_2173764_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2173763_2174039_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2174119_2174668_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_051307322.1|2174941_2175121_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_155047104.1|2175124_2175406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2175462_2175828_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047103.1|2175943_2177065_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_155049817.1|2177859_2178746_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036780722.1|2178807_2179782_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_016210459.1|2179946_2180465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047101.1|2180669_2181788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211720.1|2182035_2182959_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211716.1|2182972_2183896_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036778439.1|2183843_2184500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|2184802_2185630_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_155047100.1|2186070_2186430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047099.1|2186574_2186730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126590.1|2186922_2188455_+	nuclease	NA	NA	NA	NA	NA
WP_032126591.1|2188517_2189855_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_016210313.1|2189997_2191464_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210314.1|2191460_2192510_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_036778435.1|2192633_2194748_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|2194912_2195317_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2195377_2196103_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210307.1|2196188_2197079_+	YicC family protein	NA	NA	NA	NA	NA
WP_032126592.1|2197119_2197740_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.3	2.5e-20
WP_016210310.1|2197800_2198007_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_016210316.1|2198028_2200182_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.1e-12
WP_054300439.1|2200188_2202171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780594.1|2202442_2202925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2202928_2203504_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2203449_2203815_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036780787.1|2204013_2204973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2205341_2206424_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_155047098.1|2206439_2207732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049838.1|2207807_2208476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211538.1|2209185_2210109_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_054300443.1|2210347_2210626_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|2210678_2210927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|2210884_2211946_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212179.1|2212366_2212519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|2212941_2213115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2213191_2213449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781320.1|2215667_2215895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2215881_2216208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2216209_2216641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2217169_2218231_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300445.1|2218325_2218877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2219146_2220166_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2220152_2220575_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2220576_2221050_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|2221165_2221789_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|2221818_2222493_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2222498_2223647_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2223643_2224105_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2224180_2225431_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2225557_2227237_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2227346_2228213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2229115_2230090_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_036781250.1|2230185_2230971_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2231114_2231801_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2231834_2232233_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2232396_2232702_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|2232779_2233034_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2233187_2234849_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2234908_2235592_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2235591_2236680_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2236728_2239365_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300173.1|2239777_2240839_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300448.1|2241028_2243398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2243441_2244416_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300449.1|2244435_2245215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2245344_2245683_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2245642_2246098_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211507.1|2246423_2247743_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|2247746_2248463_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|2248459_2249101_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_081007048.1|2249093_2249192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2249532_2249898_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2249843_2250419_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047096.1|2250450_2250723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047095.1|2250779_2250920_+	phosphatase	NA	NA	NA	NA	NA
WP_155047094.1|2251064_2251532_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211503.1|2251682_2252138_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|2252192_2252537_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2252566_2253610_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|2254312_2254522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2254511_2255398_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	2325585	2387927	3147033	transposase,tRNA	Planktothrix_phage(18.18%)	56	NA	NA
WP_129556571.1|2325585_2326296_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2326324_2326729_+	RidA family protein	NA	NA	NA	NA	NA
WP_036777168.1|2326753_2327713_-	response regulator	NA	NA	NA	NA	NA
WP_155049839.1|2327844_2328366_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126712.1|2328896_2329355_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2330099_2331110_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2331594_2332506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2332831_2336326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2336363_2337203_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_036777155.1|2337389_2337605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2337653_2338229_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2338225_2338564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2338732_2339722_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2339722_2340685_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_054300271.1|2341640_2342615_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2342752_2342986_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2343079_2343445_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2343459_2343966_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212572.1|2344023_2344416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2344545_2344911_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2344967_2345276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2345367_2345943_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2345888_2346254_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|2346406_2346679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126774.1|2347287_2347623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2347782_2349315_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2349347_2350187_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2350183_2350681_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_036779082.1|2350684_2351677_-	AAA family ATPase	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_155047091.1|2351791_2353138_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2353361_2354423_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2354501_2355647_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|2361454_2362312_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2362298_2363222_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_036778204.1|2363418_2364810_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2364856_2365900_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2365942_2366386_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2366518_2367709_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2367763_2367910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|2368460_2369378_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2369645_2369939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2370015_2370210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300462.1|2371228_2372146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2372611_2373454_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2373521_2374172_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|2374186_2375227_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|2375349_2376435_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2376461_2377571_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2377587_2377905_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2377901_2378261_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_080664847.1|2381592_2382546_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300173.1|2382618_2383680_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212048.1|2384443_2385001_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_032126664.1|2385194_2385878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126663.1|2386596_2386839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|2386865_2387927_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	2477820	2560531	3147033	transposase,tRNA	Escherichia_phage(37.93%)	82	NA	NA
WP_054300202.1|2477820_2478549_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|2478638_2479250_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_036779399.1|2479606_2479861_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2479959_2481744_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779389.1|2481832_2482552_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|2482734_2482941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779393.1|2482940_2483177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2483189_2483567_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2484073_2484892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779396.1|2484985_2485183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|2485277_2486663_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|2486789_2487380_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_155047083.1|2489571_2490300_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	4.3e-43
WP_016211816.1|2491368_2491722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2491763_2493377_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2493598_2493820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2494128_2494857_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2495473_2496571_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2496604_2497855_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_054300202.1|2497994_2498723_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212193.1|2498845_2499184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2499251_2499638_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2499634_2499880_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300475.1|2500288_2501017_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211625.1|2501500_2502370_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_036779883.1|2502366_2503716_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211623.1|2503828_2505469_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_054300202.1|2506283_2507012_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300478.1|2507291_2509028_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_155047082.1|2509189_2509369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300477.1|2509531_2510260_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016212214.1|2510418_2510919_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016212213.1|2510893_2511403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2512156_2512885_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300479.1|2513035_2514076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211653.1|2514273_2515299_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_016211652.1|2515406_2516612_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211655.1|2516871_2517285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2517413_2517983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2517986_2518319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300480.1|2518311_2519151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047081.1|2519238_2520786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2521235_2521739_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2521701_2522409_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2522477_2523338_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_036777969.1|2523318_2524092_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2524122_2525376_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2525375_2526338_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2526381_2527134_+	ComF family protein	NA	NA	NA	NA	NA
WP_036777977.1|2527187_2529068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|2529215_2529686_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2529731_2529971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777984.1|2529989_2530439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2530659_2532084_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|2532148_2533198_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2533464_2534244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2534295_2535198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047080.1|2535256_2536003_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	4.4e-19
WP_016210616.1|2536251_2539062_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_081007053.1|2539296_2540157_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_155047079.1|2540999_2541242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2541396_2542549_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047078.1|2542735_2543071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2543163_2543463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2543452_2543617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047077.1|2543848_2545001_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	4.4e-58
WP_155047076.1|2545010_2545286_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212641.1|2545481_2545928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049820.1|2545892_2546348_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273369.1|2546456_2547272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047075.1|2547345_2548266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2548277_2549006_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2549095_2549302_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007054.1|2549464_2550697_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_054300482.1|2551212_2552502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049821.1|2553660_2553849_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047219.1|2553895_2554624_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032127022.1|2555300_2557487_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2557548_2558702_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2558987_2559512_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|2559702_2559870_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|2559814_2560531_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
>prophage 27
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	2575872	2604059	3147033	transposase,integrase,tRNA,protease	Acinetobacter_phage(12.5%)	26	2573261:2573320	2591101:2591389
2573261:2573320	attL	ACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTT	NA	NA	NA	NA
WP_155047267.1|2575872_2576082_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007057.1|2577409_2577826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|2577883_2579036_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016212230.1|2579092_2580541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2582074_2582263_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046946.1|2583664_2583940_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2583942_2584545_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_155046749.1|2584608_2584896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|2585440_2586520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780431.1|2586838_2588557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2588600_2589506_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155049822.1|2589976_2590132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047221.1|2590523_2591003_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	42.0	1.7e-11
WP_155047222.1|2591111_2591786_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.8	2.2e-09
2591101:2591389	attR	AAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTT	NA	NA	NA	NA
WP_155047223.1|2591829_2592075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2592705_2593281_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_036778086.1|2593356_2594232_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_052104629.1|2594632_2595658_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047224.1|2595801_2596278_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778088.1|2596262_2597345_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.0e-20
WP_036777829.1|2597585_2597990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2598702_2599434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2599690_2600992_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2601133_2601802_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2602245_2602842_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2602862_2604059_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
>prophage 28
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	2633275	2685735	3147033	transposase,tRNA	Microbacterium_phage(12.5%)	56	NA	NA
WP_054300282.1|2633275_2633740_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047228.1|2633796_2634279_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2635133_2635529_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|2635525_2636320_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_036778479.1|2636498_2637224_-	D-Ala-D-Ala dipeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2637469_2638657_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016210935.1|2639233_2639776_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2639772_2640459_-	acireductone synthase	NA	NA	NA	NA	NA
WP_036778484.1|2640462_2641074_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2641120_2642140_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2642241_2643036_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2643073_2643880_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2643958_2645008_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2645205_2646465_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2646511_2647189_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2647274_2647556_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|2647647_2648835_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_016210820.1|2649071_2650013_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2650516_2650741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2651032_2651737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|2652207_2652846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2653180_2653711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779158.1|2653707_2655240_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2655236_2656187_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2656607_2657240_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2657482_2657680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2658054_2658420_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2658476_2658641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2658630_2658930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2658977_2659406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300194.1|2659483_2660182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2660159_2661221_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2661445_2661742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|2661846_2662503_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2662726_2663224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047229.1|2664433_2664895_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2664854_2665193_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036778253.1|2665250_2666789_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_098082804.1|2666900_2667999_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2668236_2669436_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2669465_2670104_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|2670119_2672303_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|2672540_2672885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|2673930_2674137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|2674301_2674760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|2675347_2676475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2676598_2677261_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2677352_2677598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2678671_2679331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2679432_2680083_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_054300271.1|2680574_2681549_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2681799_2682021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047230.1|2682309_2682732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047231.1|2682732_2683266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300190.1|2683760_2684723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046995.1|2684849_2685735_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	2746614	2804647	3147033	transposase,tRNA,protease	Staphylococcus_phage(37.5%)	57	NA	NA
WP_054300271.1|2746614_2747589_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047235.1|2747608_2748595_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2748685_2749432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275004.1|2749556_2750420_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2750663_2751026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273422.1|2751212_2751740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2751884_2752301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2754397_2755309_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2755360_2756209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2756653_2757364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2757455_2758424_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2758411_2759059_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036779767.1|2759087_2759939_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2759953_2761231_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2761271_2761787_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_054300183.1|2761865_2762927_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2762948_2764037_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_036777788.1|2764081_2765917_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2765959_2766430_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2766466_2766802_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2766814_2767531_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2767467_2768484_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2768480_2768960_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2769043_2771524_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2771586_2771952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2772290_2772629_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2772588_2773044_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2773058_2773349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777784.1|2773414_2775013_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2775143_2775479_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777781.1|2775506_2777171_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210581.1|2777167_2777812_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2777811_2778555_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2778613_2778853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2779003_2780371_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2780381_2780933_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2781013_2781997_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2782118_2783876_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2784098_2784689_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_155049840.1|2784777_2785197_-	DksA protein	NA	NA	NA	NA	NA
WP_075273416.1|2785337_2785952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2786012_2786798_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075273313.1|2787051_2787390_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007003.1|2787349_2787811_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2788183_2789158_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212084.1|2789439_2790456_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2790455_2790971_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2791012_2791486_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_155047236.1|2791541_2792084_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2792107_2792563_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_155046996.1|2794336_2796850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046997.1|2797784_2800307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2800881_2801943_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2801969_2802545_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2802490_2802856_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046755.1|2802927_2803104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2803494_2804647_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 30
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	2929515	2993656	3147033	transposase	Staphylococcus_phage(16.67%)	53	NA	NA
WP_054300271.1|2929515_2930490_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211161.1|2931072_2932182_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2932193_2932838_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2932856_2933843_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2933922_2934999_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2935201_2936026_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2936342_2937347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2937555_2938521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047242.1|2938659_2939535_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2939831_2940884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2941151_2941580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2941793_2942285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2942340_2943591_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2943693_2943912_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_036777591.1|2944369_2945224_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016210728.1|2945278_2945749_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2946145_2947525_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2947552_2948011_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2947988_2949206_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2949397_2949634_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2949647_2949803_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2949883_2950846_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2951005_2952322_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2952331_2953000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2953362_2955177_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_054300166.1|2955294_2956083_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211543.1|2956663_2958415_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|2958425_2959226_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|2959328_2959817_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_032126435.1|2959990_2960305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375799.1|2961325_2961670_+	DMT family protein	NA	NA	NA	NA	NA
WP_016210038.1|2967363_2968326_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|2968512_2969772_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|2969995_2970322_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|2970516_2971467_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|2971524_2973591_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|2973596_2974592_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|2975177_2976758_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|2976914_2978324_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|2978383_2979517_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|2979656_2980481_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|2980708_2981338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|2981674_2982046_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|2982349_2982637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|2982788_2983637_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|2983764_2984805_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_155047244.1|2984877_2986815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|2987098_2987758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2987912_2988887_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2988962_2989982_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556602.1|2990380_2990590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|2991464_2992547_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_054300161.1|2992594_2993656_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP038957	Piscirickettsia salmonis strain Psal-041 chromosome, complete genome	3147033	3001541	3115461	3147033	transposase,tRNA	Staphylococcus_phage(33.33%)	113	NA	NA
WP_155047053.1|3001541_3002427_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212222.1|3002903_3003377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|3003373_3003769_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3004698_3005274_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3005219_3005585_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036778680.1|3005849_3008180_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_129556603.1|3008300_3010316_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300160.1|3010499_3013892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3013956_3014262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|3014452_3014632_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_155047245.1|3014635_3014824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|3014847_3015822_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	1.8e-28
WP_032126362.1|3016079_3016445_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047247.1|3016508_3016877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|3016880_3017767_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047248.1|3017830_3018517_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047249.1|3018769_3019870_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|3020264_3021374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|3022416_3022782_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047002.1|3022796_3023402_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036776867.1|3023772_3025170_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_051307313.1|3025289_3026237_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3026233_3026749_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3026735_3027935_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3027931_3028255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3028256_3029486_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3029485_3030529_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3030528_3031212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3031208_3033698_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3033714_3033969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3033969_3034326_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3035105_3036269_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3036288_3039396_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3039397_3040903_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3040930_3041212_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3041360_3041702_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3041821_3043702_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3043786_3045385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3045402_3046518_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3046645_3047644_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_052104582.1|3047647_3048406_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3048407_3049607_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3049590_3050262_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3050283_3051060_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3051063_3052062_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3052063_3052642_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3052638_3054108_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3054151_3054439_-	trp operon repressor	NA	NA	NA	NA	NA
WP_155047250.1|3054639_3055236_+	EamA family transporter	NA	NA	NA	NA	NA
WP_054300152.1|3055262_3055628_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3055684_3055840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273401.1|3055984_3056437_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047251.1|3056474_3056699_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155047003.1|3058294_3059180_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3059366_3059588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047252.1|3059703_3060282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047253.1|3060426_3060621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3060679_3061654_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|3061707_3062769_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776841.1|3063496_3064036_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3064120_3064657_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3065308_3065611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3066060_3066369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274973.1|3066959_3067427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3067709_3068420_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3068646_3069045_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_036778156.1|3069912_3070863_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3070862_3072941_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3073088_3073604_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3073612_3074176_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3074156_3074903_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3075042_3075495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3075918_3076755_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3076751_3077648_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3077680_3078748_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3078766_3079135_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3079160_3080609_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3080618_3081998_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3082038_3083370_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3083341_3084301_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3084393_3084897_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3085031_3086183_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3086179_3086659_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3086805_3089127_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3089071_3089698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3089702_3090602_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3090674_3091253_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3091553_3091811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556718.1|3091819_3093006_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_155046758.1|3093820_3093952_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3094096_3094252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777721.1|3094579_3095353_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155047254.1|3096289_3096427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3096470_3097445_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3098539_3098878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007065.1|3098894_3099734_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_081007013.1|3099946_3100246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3100235_3100400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3100456_3100822_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3102126_3102822_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3102818_3104246_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3104271_3104535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3104607_3105582_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047005.1|3105640_3106491_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3106528_3106873_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3106869_3107706_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3107706_3108048_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3108049_3108655_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3108651_3110646_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3110665_3111607_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052104719.1|3111834_3113259_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3113771_3114746_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3114804_3115461_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038958	Piscirickettsia salmonis strain Psal-041 plasmid unnamed1, complete sequence	149109	1943	57013	149109	integrase,transposase	Streptococcus_phage(22.73%)	55	NA	NA
WP_054300202.1|1943_2672_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|2875_5452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|5568_6546_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047285.1|6564_6822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774631.1|7955_8420_+	hypothetical protein	NA	H6WFS7	Cyanophage	38.2	2.9e-21
WP_080963647.1|8758_8929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|10599_11328_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155047299.1|11511_12870_-	DEAD/DEAH box helicase	NA	D2J050	Enterococcus_phage	50.5	2.6e-126
WP_155047286.1|12959_13526_-	helix-turn-helix domain-containing protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	35.0	1.4e-20
WP_017377658.1|13529_14216_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|14463_15192_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155049843.1|15395_15647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275154.1|15783_16440_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.7	7.6e-31
WP_036771347.1|16802_17780_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047300.1|18203_18476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047296.1|18584_19220_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	42.5	1.4e-34
WP_155046765.1|20106_20301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047015.1|20681_21005_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212122.1|21881_22583_+	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_016212121.1|22536_23460_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_105962625.1|23893_24779_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.7	4.5e-10
WP_016212151.1|25381_26344_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|26367_26682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|26745_27720_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_033923686.1|27844_28894_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|29002_30043_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|30056_30686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|30776_31076_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_081377909.1|31072_31537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104769.1|32498_33422_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_105962623.1|34566_35719_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274741.1|35788_36046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273822.1|36147_36648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|37092_38175_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212255.1|38361_38532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|38528_38732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|39068_39293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212260.1|39312_39585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|39742_40717_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_129556717.1|41371_42598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|42923_43760_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_016212398.1|44022_44484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047268.1|44650_45031_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46119_46485_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|46430_47006_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_105962623.1|47989_49143_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273810.1|49163_49871_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	34.2	1.4e-11
WP_081007042.1|52030_52846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728342.1|53160_53664_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_105962174.1|53807_53972_+	phosphatase	NA	NA	NA	NA	NA
WP_155047269.1|54120_54516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273806.1|54777_55341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|55446_55902_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_075273804.1|55861_56200_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|56284_57013_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
>prophage 2
NZ_CP038958	Piscirickettsia salmonis strain Psal-041 plasmid unnamed1, complete sequence	149109	64094	107954	149109	transposase,head,capsid,tail,protease,integrase	Acinetobacter_phage(16.67%)	53	69429:69488	108809:109214
WP_054300594.1|64094_65120_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273790.1|65664_65967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|65956_66583_-	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_016212412.1|66883_67048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|67040_67490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|67737_67911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212499.1|68115_68490_-	hypothetical protein	NA	NA	NA	NA	NA
69429:69488	attL	TGATCAGGCTACCCTATTCCGGACAAATAAATTACAATAATCCGAGCCGGAGGAATCACA	NA	NA	NA	NA
WP_129556499.1|69488_70641_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_075273786.1|70650_71049_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211913.1|71481_72603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|72928_73201_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|73204_73465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211912.1|73737_74328_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_129556698.1|74417_75119_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_054300249.1|75232_75598_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|75612_76119_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	1.0e-06
WP_155047271.1|76122_77240_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	3.6e-57
WP_051307374.1|77354_77831_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_016212298.1|78071_78398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|79064_80090_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047272.1|80299_81028_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_054300594.1|81390_82416_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047273.1|82546_82684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046942.1|82822_83709_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.8	2.6e-10
WP_155047274.1|83793_84000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|84339_85155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211897.1|85548_85953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|85953_86700_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211895.1|87208_88267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126360.1|88389_89124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211773.1|89710_90385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|90486_90855_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211776.1|91022_92360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556697.1|92842_93235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|93619_94525_-|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_016210664.1|94822_95245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210651.1|95244_95595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210658.1|95591_95987_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210667.1|95979_96303_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210663.1|96299_96611_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210655.1|96929_97526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556716.1|97539_97830_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_052047108.1|97963_98362_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047275.1|98417_98915_-	DNA polymerase	NA	NA	NA	NA	NA
WP_155047276.1|98911_99691_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	31.7	1.8e-18
WP_129556718.1|99719_100905_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_081377350.1|101438_102254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047277.1|102318_102927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211936.1|103661_104684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047278.1|105173_105575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|105692_106718_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|107292_107454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|107453_107954_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
108809:109214	attR	TGATCAGGCTACCCTATTCCGGACAAATAAATTACAATAATCCGAGCCGGAGGAATCACAATGGGAAAGCGTCACGTCACCAAGTACACCGAAGAATTTAAAAAATCATCTGCCAAGCTTGCAGTCGATTCAAATCAAGCAATCAGTCATACAGCACAGGAATTGGGTATTCACTCAAGTACACTGCATGGTTGGGTCAATAAATATCATCCAAACAGTCCAAATACTGTTAAAGATGAAGTTAGTGATATGGCTGCTGAAATAAAACAGTTAAAAAAAGAGTTGGCTAGAGTGACACAGGAACGTGAAATACTAAAAAAAGCGGCGGCGTACTTTGCAAGCGAAACACAGTAAAGTATGCCTGGATCAAAGAAAATAAATGTGTTTTTCCAGTAGATAGGGTGTG	NA	NA	NA	NA
>prophage 1
NZ_CP038959	Piscirickettsia salmonis strain Psal-041 plasmid unnamed2, complete sequence	58528	2671	46014	58528	head,portal,integrase,tail,protease,capsid,transposase	Streptococcus_phage(14.29%)	55	NA	NA
WP_052104629.1|2671_3697_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047304.1|3967_4099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047313.1|4825_5179_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_016211142.1|6767_7034_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075274761.1|7090_7414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047305.1|7415_7838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274762.1|7837_8188_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_075274763.1|8184_8580_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	39.1	6.0e-07
WP_075274764.1|8572_8896_-|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	41.7	5.4e-14
WP_075274765.1|8892_9204_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.7	2.5e-08
WP_036778347.1|9523_10105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047306.1|10140_11307_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	38.7	1.2e-66
WP_081007077.1|11362_12034_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	45.8	5.5e-45
WP_054300593.1|11981_13223_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	43.6	2.7e-85
WP_155047307.1|13219_13816_-	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.3	2.0e-38
WP_155047308.1|13859_14834_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	8.3e-26
WP_155047309.1|14853_15783_-	hypothetical protein	NA	A0A1W6JP18	Morganella_phage	52.0	1.5e-85
WP_155047310.1|16011_16494_-	hypothetical protein	NA	Q9B019	Phage_GMSE-1	33.3	1.1e-13
WP_032126915.1|16580_16964_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	4.7e-25
WP_052047121.1|17142_17544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126916.1|17688_18159_-	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	48.8	1.5e-33
WP_155047311.1|18146_18449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923627.1|18445_18733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210963.1|18828_19068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047315.1|19064_19412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047314.1|19404_19767_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.9e-24
WP_036780304.1|19735_20272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211080.1|20312_21299_-	helix-turn-helix domain-containing protein	NA	A0A0S2MVA0	Bacillus_phage	45.4	4.3e-14
WP_036780299.1|21337_21640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211079.1|21794_22100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211067.1|22309_23053_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211077.1|23185_23971_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300594.1|24403_25429_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036780005.1|25576_26224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211069.1|26207_26639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047030.1|26663_26807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211075.1|27021_28263_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211068.1|28266_29079_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080664851.1|29075_29885_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|30087_31062_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047312.1|31097_31439_-	toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.7	2.0e-11
WP_027242955.1|31431_31692_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211925.1|32191_32977_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	28.7	9.7e-17
WP_016211928.1|32969_33410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|33960_34224_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_054300276.1|35154_36129_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.8	2.4e-25
WP_016212188.1|37218_37959_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155047301.1|38136_38409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|39029_39605_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	6.0e-08
WP_032126136.1|39670_40216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|41249_42275_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047302.1|42928_44008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212274.1|44538_45003_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032126154.1|45013_45208_-	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_032126152.1|45423_46014_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
>prophage 1
NZ_CP038960	Piscirickettsia salmonis strain Psal-041 plasmid unnamed3, complete sequence	38426	6465	19666	38426	head,protease,portal,tail,transposase,terminase,capsid	Erysipelothrix_phage(25.0%)	15	NA	NA
WP_054300271.1|6465_7440_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047317.1|7574_8411_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_016211139.1|8490_8886_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211132.1|8878_9202_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211137.1|9198_9510_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_155047318.1|9700_11035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211140.1|11155_12349_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_080664855.1|12406_13078_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_155047319.1|13025_13646_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	50.9	5.5e-39
WP_052104629.1|13848_14874_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047320.1|15004_15727_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	40.8	2.6e-40
WP_155047321.1|15723_17406_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	45.7	6.9e-137
WP_016212234.1|17408_17888_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_155047322.1|17964_18357_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	4.4e-26
WP_054300271.1|18691_19666_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
>prophage 1
NZ_CP038961	Piscirickettsia salmonis strain Psal-041 plasmid unnamed4, complete sequence	33277	10315	26969	33277	tail,transposase	Indivirus(18.18%)	20	NA	NA
WP_036781073.1|10315_10576_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	A0A1S5NR91	Burkholderia_phage	48.8	2.1e-13
WP_081007079.1|10646_10919_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_129556478.1|11130_12017_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	5.8e-10
WP_016212315.1|13555_13990_+	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	39.7	9.1e-25
WP_032126346.1|14089_14332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047334.1|14398_14839_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	37.6	1.1e-06
WP_054300249.1|14799_15165_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047335.1|15179_15623_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	5.1e-07
WP_054300271.1|16632_17607_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047336.1|17603_17888_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047337.1|17906_18269_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|18268_18691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275196.1|18692_19016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|19072_19339_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075275195.1|19342_21421_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.4	2.5e-56
WP_036776958.1|21413_21755_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|21751_22423_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|22391_23138_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_054300696.1|23127_23685_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_075275194.1|23681_26969_+	host specificity protein J	NA	A0A0R6PIC0	Moraxella_phage	33.2	5.2e-112
