The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	45576	89169	3158635	transposase	Moraxella_phage(20.0%)	43	NA	NA
WP_075273371.1|45576_46152_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46097_46463_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036776493.1|46661_47423_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_036779326.1|47724_49251_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49622_50462_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50501_51809_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51783_52953_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|53007_53733_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54011_54401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54588_55494_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55541_55685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047031.1|55732_56329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|56563_57717_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016210704.1|58611_60558_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61212_64275_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64271_65336_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65691_66645_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66676_67840_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67845_68445_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68632_69133_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69150_70239_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70377_71622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71618_72461_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_036777711.1|72440_73250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73417_73645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73645_74596_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74651_75203_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75329_75752_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75744_76491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76533_77232_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77242_78067_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78396_78765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|78759_79821_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|79870_80101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80230_81445_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81745_82807_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_036777695.1|82820_84548_+	oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_016211245.1|84581_85313_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85312_86101_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86205_86829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87148_87361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047032.1|87516_88578_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047033.1|88572_89169_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	118870	176861	3158635	protease,transposase	Staphylococcus_phage(37.5%)	60	NA	NA
WP_129556618.1|118870_119968_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.1	5.3e-21
WP_016209581.1|120033_120744_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556619.1|120826_122035_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_016209598.1|122101_122686_+	YggT family protein	NA	NA	NA	NA	NA
WP_032126223.1|122751_123411_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_016209604.1|123414_124341_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_016209605.1|124337_125129_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_129556620.1|125209_126094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047034.1|126095_127283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|127259_128234_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209611.1|128482_128674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047035.1|128753_128933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209580.1|129024_129549_+	ankyrin repeat family protein	NA	NA	NA	NA	NA
WP_016209612.1|129932_130301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209595.1|130338_130611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300576.1|130701_131997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211692.1|132632_133535_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.4	1.6e-18
WP_051307362.1|133591_134443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211694.1|135022_137032_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	3.0e-110
WP_054300271.1|137069_138044_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|138545_139958_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|140450_141458_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|141477_142998_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_016211018.1|143948_145265_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145368_145752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145886_148952_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|149020_150124_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|150147_150702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150816_151386_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155047036.1|152426_153326_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047037.1|153470_153776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082829.1|154170_154566_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|154587_154953_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|155009_155174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|155163_155463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300544.1|155553_156000_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|156495_157062_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|157073_157859_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|158490_159414_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|159465_160461_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|160492_160987_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_036778333.1|161078_161336_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|161425_161848_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|162166_162883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|162926_163178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778330.1|163182_164619_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|164646_166089_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|166176_166515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|166599_167130_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|167190_169383_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|169425_169911_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|170180_170612_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036778324.1|170629_171460_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|171474_171618_-	lipoprotein	NA	NA	NA	NA	NA
WP_052104672.1|171648_172533_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|172504_172726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|172899_173178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|174148_175054_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_036780891.1|175110_176289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|176285_176861_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	200549	271546	3158635	protease,tRNA,transposase,tail	Acinetobacter_phage(25.0%)	58	NA	NA
WP_016209871.1|200549_202532_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|202741_204085_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|204351_207021_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|207044_208964_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|209133_210555_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|210700_211675_+	phospholipase A	NA	NA	NA	NA	NA
WP_054300537.1|211706_212114_+	glyoxalase	NA	NA	NA	NA	NA
WP_016209859.1|212392_212614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|212777_214439_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|214511_214802_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_036776911.1|215027_215483_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|215547_216012_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216104_217451_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|217450_218356_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|218417_219404_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|219396_219639_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|219760_221305_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_036776914.1|221351_222638_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|222680_224075_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224098_224278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|224274_224454_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300181.1|224457_224739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|224795_225161_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210079.1|228166_228664_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|228834_229530_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|229632_231195_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|231510_233304_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233389_233662_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|233667_234294_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234280_235711_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236043_237099_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237067_237745_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|237734_238571_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|238730_239024_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|239130_239937_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|240241_241096_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_036776920.1|241250_242300_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_036776924.1|242350_243007_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|243024_244305_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|244578_245940_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_032126863.1|246339_246891_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016211802.1|252322_253594_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036778206.1|253650_254634_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|254630_255416_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_032126362.1|256112_256478_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|256423_256999_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300535.1|257002_257722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|257866_258067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|258114_258576_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|258999_260481_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|260543_261653_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|261750_263712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|264241_264646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047045.1|264698_265394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|265370_266345_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_098082809.1|266515_266866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|267808_268891_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556499.1|270393_271546_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 4
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	300159	360019	3158635	transposase	Bodo_saltans_virus(20.0%)	56	NA	NA
WP_054300526.1|300159_300456_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962174.1|300604_300769_-	phosphatase	NA	NA	NA	NA	NA
WP_016211026.1|300867_301272_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075273367.1|301564_302341_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_155047049.1|302349_304431_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	4.0e-17
WP_016211031.1|304595_305075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211032.1|305384_306182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211033.1|306293_307586_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_032126377.1|307751_308753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211034.1|308869_309049_+	rubredoxin	NA	NA	NA	NA	NA
WP_016211023.1|309059_309494_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_016211029.1|309707_310070_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.6e-25
WP_016212102.1|310243_311884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|313394_314547_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556441.1|317975_319202_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126490.1|319550_320516_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_016210868.1|320512_320812_+	pilZ domain protein	NA	NA	NA	NA	NA
WP_036778898.1|320843_321623_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_016210861.1|321648_321879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|322030_322276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210870.1|322427_323219_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016212128.1|324132_324879_+	solute symporter family protein	NA	NA	NA	NA	NA
WP_032126495.1|324969_325854_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_054300397.1|326259_326505_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046705.1|326745_326913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|326858_327434_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047050.1|327486_328224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777815.1|328227_328512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|329235_330054_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|330126_332499_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_036777812.1|333211_334639_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|334673_335696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|335712_336090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|337052_337418_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|337363_337939_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210122.1|338178_338871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|339497_340472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|340461_342234_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|342234_342582_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036777821.1|342831_344058_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|344147_345446_-	MFS transporter	NA	NA	NA	NA	NA
WP_081007061.1|345479_346229_-	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	30.4	3.9e-15
WP_016210137.1|346209_346761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007060.1|346987_348286_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|348402_348693_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_155047051.1|349004_349874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047052.1|350018_350747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777801.1|351609_351828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212044.1|352601_352856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|353578_354565_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|354702_354897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007059.1|355579_356641_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_016211797.1|356802_358206_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|358256_358832_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|358777_359092_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047053.1|359132_360019_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	444251	544723	3158635	integrase,tRNA,transposase	Escherichia_phage(43.75%)	109	511038:511097	525249:525422
WP_054300513.1|444251_445115_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|445331_446891_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|446912_447947_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|447995_448565_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|448700_449672_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|449683_451261_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|451326_452313_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054300512.1|452644_453754_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|453859_455044_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|455121_457110_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|457318_457474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047055.1|457744_458032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|458069_458435_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|458380_458956_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047056.1|458945_459308_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|460224_461631_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|461648_462635_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|462637_463792_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|463788_464484_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|464618_466109_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_036777447.1|466129_467179_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|467245_468640_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_036777444.1|469518_471450_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	1.0e-120
WP_075273353.1|471454_471985_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|472019_472214_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|472256_472616_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|473035_474031_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_036777440.1|474043_476425_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|476430_476718_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|476989_477466_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|477610_477808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|477932_478907_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|479807_479906_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780545.1|480390_481101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047057.1|481264_481681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|481917_482610_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|482651_483425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|483426_484368_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|484500_486078_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|486287_488045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|488593_489352_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|489559_490132_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|490235_490784_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|491085_491331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|491359_491656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779353.1|491923_492835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300506.1|493325_493733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|493804_494533_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126799.1|494613_495426_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_155047058.1|496487_496850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|496852_498592_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046941.1|498993_499257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300500.1|499928_500657_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_016212070.1|501066_501666_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_016212069.1|501640_501808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212066.1|502019_502796_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_054300501.1|503156_503885_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|503896_504289_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|504285_504531_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|504691_505420_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211714.1|505494_508839_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|510087_510663_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|510608_510974_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
511038:511097	attL	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCT	NA	NA	NA	NA
WP_155047059.1|511252_512167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212159.1|512434_512632_+	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_054300201.1|512991_513720_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_155047060.1|513749_514424_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	45.9	5.2e-27
WP_016212024.1|514568_514817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|514813_515413_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|515412_515631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|516405_517398_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|517394_518129_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_155047061.1|518389_518656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047062.1|518800_518959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047063.1|518981_519233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300477.1|519682_520411_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_051307368.1|521117_522398_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|522397_523366_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211646.1|523737_523977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|523969_524323_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|524625_525354_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047064.1|525823_526132_-	hypothetical protein	NA	NA	NA	NA	NA
525249:525422	attR	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTTTTACCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCC	NA	NA	NA	NA
WP_155047065.1|526293_526971_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.1	7.0e-40
WP_155047066.1|527464_528193_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.5e-43
WP_016212269.1|528361_529045_+	Fic family protein	NA	NA	NA	NA	NA
WP_016212268.1|529048_529633_+	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_017375910.1|529789_530518_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047064.1|530986_531295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|531545_532148_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300203.1|532152_532611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781052.1|533987_534590_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126808.1|534752_534962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211639.1|534969_535272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211644.1|535386_535653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104773.1|535760_536204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|536265_537151_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047067.1|537251_538145_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047259.1|538289_538505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104771.1|538954_539293_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	54.9	5.4e-25
WP_075274739.1|539285_539633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274717.1|539629_539860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274718.1|539863_540334_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	64.3	1.3e-32
WP_075274740.1|540478_540844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780395.1|540988_541243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377363.1|541226_541583_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_075274719.1|541888_542755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047068.1|543240_543441_+	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	64.3	3.5e-16
WP_155047069.1|543528_543882_+	hypothetical protein	NA	Q6DMU4	Streptococcus_phage	34.8	8.2e-08
WP_054300202.1|543994_544723_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 6
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	552422	600375	3158635	tRNA,transposase	Synechococcus_phage(33.33%)	51	NA	NA
WP_054300202.1|552422_553151_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|553244_553910_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|553974_554931_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|555189_555888_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|555930_557043_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|557647_558223_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|558168_558534_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|558621_558972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|559707_560769_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210908.1|561980_562796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|562886_563870_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|564040_564562_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_036779246.1|564595_564850_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.4e-20
WP_016210909.1|564852_566130_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|566822_567350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|567469_569782_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|569910_570726_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|570923_571388_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|571517_572579_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|572839_573136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|573418_574882_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|574884_575937_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_036779281.1|575926_576382_+	arginine repressor	NA	NA	NA	NA	NA
WP_155047071.1|576406_576730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|577077_577389_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_054300208.1|577518_578310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779278.1|579467_580421_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|580534_580732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|580977_581178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142396463.1|581288_581405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212074.1|581491_581713_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|581739_582105_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|582161_582326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047072.1|582315_582630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046713.1|582767_582932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|583226_584663_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|584704_586156_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|586267_586555_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|586744_587788_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210536.1|587803_588703_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210528.1|588699_589218_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210527.1|589287_589905_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_036776217.1|589914_591402_+	ribonuclease G	NA	NA	NA	NA	NA
WP_016210534.1|591411_595092_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_036776215.1|595165_595978_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210530.1|595974_596655_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_155047260.1|597495_597654_-	phosphatase	NA	NA	NA	NA	NA
WP_155047073.1|597846_598404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|598453_598744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300215.1|599547_600042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|600036_600375_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	621845	724426	3158635	protease,tRNA,transposase,plate	Prochlorococcus_phage(17.65%)	108	NA	NA
WP_016209523.1|621845_623195_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|623245_623683_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|623944_625456_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_036778935.1|625461_626688_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|626681_627710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|627687_628380_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_155049805.1|628381_629854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778941.1|629846_630335_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|630340_631813_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|631812_632211_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|632207_633896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|633877_634834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|634876_635392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|635496_636429_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|636648_637035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|637051_637696_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|637876_638716_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|638791_639394_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|639394_640249_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|640605_640917_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|640941_642333_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|642488_643220_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_129556465.1|643216_643789_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|643775_644333_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|644338_645319_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|645458_646259_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_036780687.1|646262_647030_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|647026_647491_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|647513_648167_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|648170_648518_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|648551_648803_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|648879_650148_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|650150_650909_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|650970_651861_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|651911_652595_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|652680_652938_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155049806.1|653210_655364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|655355_656228_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|656395_658225_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|658387_659029_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|659270_659801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|659818_659992_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|660050_661100_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|661106_662057_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|662110_663055_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|663082_663820_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|663908_664151_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|664225_665449_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|665480_666329_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|666325_667378_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|667498_668119_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_036780649.1|668134_669121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|669231_669687_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|669646_669985_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|670749_671655_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155047217.1|671729_672791_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|672840_673050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|674284_674731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|674734_675310_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|675255_675621_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|675741_675927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|676030_677065_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|677061_677772_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|678246_678765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|678882_679215_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_036777003.1|679244_682199_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_054300221.1|682244_682742_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|682801_683218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|683309_684170_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|684252_684819_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|684851_685706_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_155047216.1|685747_688654_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|688714_688912_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|688918_689929_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|689925_690984_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|690977_691778_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|691780_692599_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|692610_693558_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|693565_694867_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|695045_696149_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|696145_696538_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|696549_697926_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|697919_699389_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_032126362.1|699846_700212_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|700157_700733_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300223.1|700827_701799_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_129556478.1|702035_702922_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|703221_703467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|704429_704849_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046954.1|704955_705129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|705355_706090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|706214_707276_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|707598_708303_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|708396_709110_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|709192_710284_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|710355_710937_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|710942_711569_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|711665_712601_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|712960_713632_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_036778813.1|713773_714433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|714601_715861_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|715857_716943_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|716935_717817_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|717805_719056_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_054300237.1|720341_721403_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047215.1|721380_722634_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_032126362.1|723539_723905_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|723850_724426_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	759843	807780	3158635	tRNA,transposase	Staphylococcus_phage(42.86%)	37	NA	NA
WP_016209374.1|759843_761295_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|761330_762860_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_155047212.1|763435_765079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047211.1|765620_766562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|766912_767728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|768019_770710_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_081007011.1|770958_772179_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|772346_774053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|774651_775878_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|776442_777417_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273456.1|777539_777839_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047210.1|777798_778161_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|778222_779108_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047266.1|780216_780648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|781363_781729_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|781674_782250_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|782276_783338_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556478.1|783452_784339_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047209.1|784688_785243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211819.1|785461_785692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|785988_786489_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|786691_787948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777316.1|788304_788718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|789027_789912_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300240.1|790168_790372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|790671_791646_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047208.1|791948_793421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|793440_794415_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|794565_794841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|795006_795627_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_054300241.1|795945_797922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|798077_799535_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|799603_801184_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_054300242.1|801224_801761_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|801806_805703_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|805709_806033_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300237.1|806718_807780_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	824461	937875	3158635	protease,transposase,integrase	Staphylococcus_phage(30.3%)	107	886926:886985	908120:909222
WP_033923708.1|824461_825337_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|825592_826237_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|826267_828073_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|828096_828672_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556476.1|829216_830227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|830399_831374_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046989.1|831606_832671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|832763_833738_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046989.1|833970_835035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|835525_835891_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047206.1|835905_836415_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|836450_837425_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300250.1|837507_838167_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_016209640.1|838585_839605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|840063_841029_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|841073_841649_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|841679_842954_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|843599_844313_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|844392_845130_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|845250_846606_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|846782_847454_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|847569_848445_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|849048_850353_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|850465_851071_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|851152_852454_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|852521_854954_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|855057_855330_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075273480.1|855412_857311_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209643.1|857342_858227_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|858235_858631_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|859058_861206_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|861177_862527_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|862523_864644_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|864640_866344_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209654.1|866462_867605_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|867669_868698_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_036776625.1|868824_870339_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|870428_870914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275067.1|871246_872314_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|873376_874282_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_051307360.1|874398_875328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780074.1|876419_877226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|877568_879461_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|879747_880152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923634.1|880356_880905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|880894_881781_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|882119_882530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047205.1|882704_882926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|883413_883779_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|883724_884300_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664862.1|885473_886172_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_016211528.1|886152_886458_+	hypothetical protein	NA	NA	NA	NA	NA
886926:886985	attL	CGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACT	NA	NA	NA	NA
WP_054300271.1|887017_887992_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300253.1|888210_889161_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	34.7	6.9e-09
WP_016211534.1|889147_889657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211530.1|889662_890559_-	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211531.1|890912_891593_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155047204.1|891656_892214_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0V4T7	Roseobacter_phage	33.3	8.4e-15
WP_054300271.1|892237_893212_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212424.1|893555_893834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|893826_894099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|894216_895299_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036780532.1|895376_896417_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_081007067.1|896928_902403_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_016212302.1|902623_902923_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_155047203.1|903223_904285_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036781361.1|904304_904694_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_155047202.1|904976_906041_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.2	4.7e-139
WP_016211579.1|906545_907031_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|907098_908007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|908211_909186_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300257.1|909390_910200_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.6	1.8e-29
908120:909222	attR	CGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_075273486.1|910176_911151_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.2e-29
WP_016211585.1|911385_911943_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_155047201.1|912004_912766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|912841_913816_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211584.1|913988_914342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|914408_914603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|914618_914963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|915032_915608_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|915553_915919_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155049808.1|916003_916612_+	DNA polymerase	NA	NA	NA	NA	NA
WP_052047108.1|916696_917095_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046984.1|917906_919025_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046716.1|919446_919593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|920290_920845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|921281_921464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|921528_921756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|921986_922733_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|922959_923253_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|923324_923930_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|924078_925056_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_155047199.1|925152_926595_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|926621_927275_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_036779374.1|927399_927966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|928320_930099_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_052104721.1|930170_931877_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_054300262.1|931868_932159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|932621_932987_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|932932_933508_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|933511_933886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|934261_935236_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_054300263.1|935307_935748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047198.1|935735_935903_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|936047_936308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|936267_936606_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|936989_937875_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	958417	1002385	3158635	tRNA,transposase	Escherichia_phage(14.29%)	43	NA	NA
WP_054300173.1|958417_959479_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211781.1|959695_960943_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036779112.1|961165_962602_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_129556486.1|962687_963035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273492.1|963125_963245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|963353_964415_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|964409_964580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|964569_964734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|964790_965156_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|965177_965546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047196.1|965690_966272_-	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_017375910.1|966342_967071_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016210898.1|967327_967678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|967766_968057_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|968531_968834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300270.1|969174_970152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|970230_971568_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|971686_972058_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|972279_972930_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|972972_974055_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|974108_975992_+	APC family permease	NA	NA	NA	NA	NA
WP_033923708.1|976601_977477_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155047195.1|977489_978392_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211091.1|978466_980947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273494.1|982011_982572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|982591_983566_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211036.1|983913_985785_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_036779409.1|985876_987622_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211043.1|987701_988151_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211035.1|988203_988419_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211042.1|988665_989682_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211037.1|989730_990360_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211040.1|990710_991922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126170.1|992149_992422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047067.1|992585_993479_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556557.1|993623_993935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104774.1|993982_994615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047009.1|994759_994933_-	phosphatase	NA	NA	NA	NA	NA
WP_016211450.1|995708_996731_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211448.1|996829_998038_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211446.1|998027_999755_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036776407.1|999938_1001075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|1001323_1002385_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	1014923	1052365	3158635	protease,tRNA,transposase	Orpheovirus(20.0%)	40	NA	NA
WP_129556478.1|1014923_1015810_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211932.1|1016220_1017510_-	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_036777061.1|1017705_1018893_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211476.1|1019210_1019420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211473.1|1019403_1020003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211474.1|1020077_1021427_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_032126518.1|1021509_1023711_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211478.1|1023727_1024543_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126519.1|1024522_1025242_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_075273327.1|1025409_1025985_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1025930_1026296_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211265.1|1026470_1027133_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1027163_1027532_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_032126514.1|1027542_1028859_-	MFS transporter	NA	NA	NA	NA	NA
WP_051307354.1|1029141_1029717_+	DedA family protein	NA	NA	NA	NA	NA
WP_032126515.1|1029792_1029972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|1030144_1030438_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_075273504.1|1030627_1030981_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211262.1|1031035_1033309_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_016211259.1|1033368_1033614_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_054300275.1|1033738_1034614_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211550.1|1034691_1035453_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_016211548.1|1035436_1036393_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211549.1|1036655_1039160_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211553.1|1039163_1039904_+	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_054300209.1|1040243_1040609_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1040665_1040830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1040819_1041119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049809.1|1041122_1042418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1042592_1043567_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209411.1|1043772_1044567_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_016209421.1|1044729_1045518_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_036776605.1|1045514_1046726_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_032126508.1|1046715_1047075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209444.1|1047169_1047598_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_129556555.1|1047728_1048859_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209436.1|1048855_1049584_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_016209412.1|1049641_1050529_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209433.1|1050613_1050988_+	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209424.1|1051087_1052365_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
>prophage 12
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	1084851	1214067	3158635	protease,tRNA,transposase	Staphylococcus_phage(21.43%)	104	NA	NA
WP_016209432.1|1084851_1086561_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209448.1|1086818_1088150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209449.1|1088591_1090064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1090779_1091145_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273508.1|1091385_1092252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|1092764_1093109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776562.1|1093261_1093453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1093696_1094272_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1094217_1094583_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300283.1|1094823_1095465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1095932_1096907_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047193.1|1098120_1099509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780476.1|1099744_1101682_-	histidine kinase	NA	NA	NA	NA	NA
WP_016210517.1|1102695_1103415_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|1103528_1107068_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|1107134_1107953_+	ZipA protein	NA	NA	NA	NA	NA
WP_016210518.1|1107939_1109979_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210522.1|1109994_1111047_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210524.1|1111057_1111588_+	exsB family protein	NA	NA	NA	NA	NA
WP_016210010.1|1113225_1113402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780418.1|1113577_1113961_+	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_075273518.1|1114036_1114330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210016.1|1114496_1115456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|1116186_1116342_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|1116606_1117977_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_052104723.1|1117969_1118923_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036779556.1|1118903_1121708_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.0	3.1e-57
WP_016210027.1|1121787_1122384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1122773_1123529_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155047191.1|1123926_1124658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|1124918_1126244_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210023.1|1126240_1128298_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210007.1|1128275_1128848_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|1128903_1129263_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|1129327_1130362_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|1130619_1131471_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|1131565_1132549_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|1132705_1134373_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_155047190.1|1135311_1135629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556556.1|1135647_1136223_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1136168_1136534_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|1136555_1136885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047175.1|1137293_1138616_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_032126362.1|1139146_1139512_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1139457_1140033_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047189.1|1140092_1140266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047265.1|1140555_1141149_+	reverse transcriptase	NA	A0A0N7AE80	Bacillus_phage	28.9	4.0e-07
WP_105962623.1|1141157_1142311_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300290.1|1142444_1142702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007015.1|1142803_1143229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1143440_1143698_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1143697_1144705_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300292.1|1144959_1145961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|1146416_1146569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|1146541_1146715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047188.1|1146704_1146869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300293.1|1146925_1147291_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300294.1|1147562_1148624_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211279.1|1149367_1151836_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_016211277.1|1151849_1152818_+	homoserine kinase	NA	NA	NA	NA	NA
WP_016211278.1|1152804_1154064_+	threonine synthase	NA	NA	NA	NA	NA
WP_129556646.1|1154115_1155501_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_036781047.1|1156818_1157676_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_036778145.1|1158288_1159410_+	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	8.7e-11
WP_016211172.1|1159459_1160656_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_080664856.1|1160844_1161909_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_051307350.1|1161892_1162639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778066.1|1162628_1163357_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211168.1|1163353_1164013_+	wbqC-like family protein	NA	NA	NA	NA	NA
WP_155046736.1|1163990_1164944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1164943_1165459_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778065.1|1165501_1166935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210393.1|1167028_1169230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210398.1|1169718_1171311_+	B-type flagellin	NA	NA	NA	NA	NA
WP_032126669.1|1171535_1173113_+	B-type flagellin	NA	NA	NA	NA	NA
WP_122940572.1|1173224_1173650_+	flaG family protein	NA	NA	NA	NA	NA
WP_016210394.1|1173760_1175146_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032126670.1|1175171_1175609_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210390.1|1175613_1175955_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_016210399.1|1175969_1177961_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210388.1|1177986_1178661_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210397.1|1178657_1180832_-	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210772.1|1182040_1183594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1183677_1184487_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_033923762.1|1184614_1184848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210769.1|1185148_1186651_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_016210773.1|1186954_1189648_+	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210771.1|1189644_1193046_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_054300162.1|1193137_1194220_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300297.1|1194282_1195350_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212246.1|1196285_1196942_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|1197045_1198128_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300271.1|1198467_1199442_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212247.1|1200069_1200825_-	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_036779544.1|1201191_1202199_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1202198_1202456_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047187.1|1202819_1203794_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_075273524.1|1203834_1204800_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|1204955_1206506_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_054300299.1|1208707_1209790_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049810.1|1209876_1210056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1211054_1211918_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155047186.1|1211947_1213177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047185.1|1213180_1214067_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	1254739	1430603	3158635	integrase,tRNA,transposase	Staphylococcus_phage(17.65%)	153	1286993:1287052	1363065:1363428
WP_054300304.1|1254739_1255018_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047180.1|1255070_1255274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776195.1|1255916_1257164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923708.1|1257575_1258451_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211947.1|1258565_1259711_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_129556540.1|1259703_1260099_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211946.1|1260317_1261073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212551.1|1262428_1262923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556643.1|1263380_1264745_-	histidine kinase	NA	NA	NA	NA	NA
WP_016211983.1|1264840_1265500_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_155047179.1|1265747_1266092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047178.1|1266160_1266889_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.5e-43
WP_155047177.1|1266935_1267082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300189.1|1267138_1267504_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036779232.1|1267798_1269358_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|1269718_1271689_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|1271880_1272960_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_052104715.1|1273008_1273215_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_155049811.1|1273221_1274703_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211214.1|1274805_1275369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1277130_1278390_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211940.1|1278510_1278843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1278956_1279931_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_155047176.1|1280075_1280228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300312.1|1280445_1281468_+	YHYH protein	NA	NA	NA	NA	NA
WP_036778055.1|1281475_1283158_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.7e-32
WP_016211344.1|1283318_1284137_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|1284350_1285334_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|1285326_1285548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|1285575_1286217_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_033923708.1|1286460_1287336_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1286993:1287052	attL	TACCTGAAATTGCTCAAGGTCTGACAGGTAAGATTATTGGTGATAAAGGTTACATTTCAC	NA	NA	NA	NA
WP_129556490.1|1289798_1290684_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1290688_1290976_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|1291028_1291307_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|1291405_1291753_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|1292074_1292314_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|1292531_1293119_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|1293079_1293415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|1293602_1294247_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|1294581_1295232_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|1295764_1296817_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032126786.1|1296834_1299915_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_054300384.1|1300213_1301029_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_105962624.1|1301437_1302805_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.6e-12
WP_155047174.1|1303667_1304312_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.4	1.1e-39
WP_155047173.1|1304367_1304577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209615.1|1305929_1306436_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016209623.1|1306452_1307952_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209624.1|1307973_1308585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274867.1|1308581_1309754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777073.1|1309785_1312323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|1312354_1314247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273639.1|1314614_1315331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777070.1|1315333_1318207_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_016209636.1|1318207_1318612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|1318626_1320348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|1320347_1323296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|1323298_1324696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209630.1|1324709_1325450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|1325430_1325865_+	lipoprotein	NA	NA	NA	NA	NA
WP_016209618.1|1325909_1326539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209616.1|1326609_1327524_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_033923701.1|1327554_1330857_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209627.1|1330853_1332677_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_016209617.1|1332716_1333115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209621.1|1333235_1334240_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|1334672_1336121_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_036777066.1|1336207_1339264_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081007073.1|1339246_1339417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046976.1|1339482_1339620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212485.1|1339916_1340450_-	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_032126753.1|1341230_1341695_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|1341764_1343285_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126752.1|1343372_1343975_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|1343971_1344319_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|1344469_1345453_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_122942160.1|1346080_1347061_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052047087.1|1347221_1347440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047172.1|1347611_1348637_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300320.1|1349782_1350382_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300321.1|1350599_1350971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212346.1|1351765_1351912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1352145_1353009_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211748.1|1354490_1356095_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211752.1|1356110_1357256_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_075273313.1|1357332_1357671_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1357630_1358086_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212445.1|1358331_1358598_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047171.1|1358672_1359236_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	39.9	3.2e-30
WP_155047170.1|1359440_1359722_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047169.1|1359756_1360365_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212534.1|1360777_1361044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1362171_1362537_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1362482_1363058_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211725.1|1363573_1364488_+	hypothetical protein	NA	NA	NA	NA	NA
1363065:1363428	attR	TACCTGAAATTGCTCAAGGTCTGACAGGTAAGATTATTGGTGATAAAGGTTACATTTCACAAGATTTATTTAACAGGCTTTATGAAAAAGGACTGCAATTAATCAATAAAATTCGCAAGAATATGAAAAATAGGCTCATGCCTATCATCGATAAAATTTTACTCAGAAAACGTGGAATTATTGAAAGTGTATTTGATCAACTTAAAAACATCTCACAAATCGAGCACTCTAGGCATCGTAGTGTCAACAACTTTATGGTCAATATTCTTGCTGGATTAGCAGCCTACTGTCTTCAGGAGAAGAAGCCATCGCTTAATATCCAGCGTAATCTATTGACCAGCTGAGTTATATCGAACTCACGTTA	NA	NA	NA	NA
WP_054300322.1|1364526_1366461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1366848_1367442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273534.1|1369073_1369955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1370148_1370421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300326.1|1370522_1370987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046975.1|1371400_1371850_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_016212459.1|1371969_1372350_+	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_054300328.1|1372487_1373264_-	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_155047167.1|1373374_1374892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047166.1|1374941_1376003_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211456.1|1376624_1377203_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_122942091.1|1377230_1377626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211455.1|1377731_1379189_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_016211452.1|1379250_1380738_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211454.1|1381488_1381959_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|1383833_1384106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1384258_1384624_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1384569_1385145_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556641.1|1387227_1388490_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016210751.1|1388577_1390383_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_016210752.1|1390866_1391664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210749.1|1391833_1392295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1392593_1394549_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1395230_1395416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|1395749_1396739_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016211834.1|1400112_1400427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307365.1|1400684_1400945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1400964_1401453_+	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_155046972.1|1402976_1403567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047040.1|1404155_1405094_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047165.1|1405119_1406685_-	amino acid permease	NA	NA	NA	NA	NA
WP_036778182.1|1406891_1407719_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_075273540.1|1408085_1408697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556527.1|1408881_1409142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047164.1|1410134_1410557_+	response regulator	NA	NA	NA	NA	NA
WP_036777256.1|1410979_1411180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104738.1|1411554_1412361_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210795.1|1412466_1413438_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210801.1|1413419_1414391_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155047264.1|1414713_1415073_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_054300271.1|1415112_1416087_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007028.1|1416502_1416958_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1416917_1417256_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|1417429_1417870_-	universal stress protein	NA	NA	NA	NA	NA
WP_032126362.1|1418336_1418702_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1418647_1419223_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211350.1|1419507_1420446_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211349.1|1420509_1422504_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|1422500_1423103_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_036779888.1|1423099_1423438_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|1423513_1424740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300339.1|1425297_1426269_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.2e-25
WP_016211856.1|1426484_1426670_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|1426796_1427264_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|1427260_1428139_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|1428389_1429697_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007028.1|1429849_1430305_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1430264_1430603_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	1446218	1552484	3158635	tRNA,transposase	Staphylococcus_phage(14.81%)	102	NA	NA
WP_054300271.1|1446218_1447193_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047162.1|1447212_1447650_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|1447664_1448030_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210855.1|1448183_1449161_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210849.1|1449278_1450727_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210847.1|1450755_1451760_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210851.1|1451782_1452454_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_155049813.1|1452438_1452999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049814.1|1453007_1453691_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1453939_1454494_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210848.1|1455077_1456262_+	MFS transporter	NA	NA	NA	NA	NA
WP_051307341.1|1456428_1458027_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_155047161.1|1458720_1459692_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300343.1|1459727_1459955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1459958_1460845_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007031.1|1460932_1461205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209794.1|1461939_1462563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776664.1|1462608_1464552_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	23.9	1.1e-05
WP_016209788.1|1464673_1465426_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016209790.1|1465477_1465936_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_129556639.1|1466231_1466642_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209775.1|1466658_1467114_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_016209797.1|1467110_1467602_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_080664822.1|1467598_1468348_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_016209776.1|1468377_1468647_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_036776670.1|1468662_1469448_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_016209786.1|1469461_1470595_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_016209770.1|1470629_1472723_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_016209767.1|1472753_1474214_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_129556524.1|1474194_1475082_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_016209784.1|1475078_1475801_+	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_017377132.1|1475887_1476271_+	response regulator	NA	NA	NA	NA	NA
WP_036776675.1|1476312_1477056_+	chemotaxis protein CheZ	NA	NA	NA	NA	NA
WP_036776682.1|1477068_1479093_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_051307317.1|1479154_1479448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209791.1|1479584_1480307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209771.1|1480471_1481194_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126436.1|1481900_1482356_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209793.1|1482371_1483820_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_016209795.1|1483860_1484616_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_080664823.1|1484596_1485997_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209796.1|1486020_1487238_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_016209778.1|1487268_1487643_+	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209772.1|1487661_1488213_+	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_054300271.1|1489494_1490469_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1490566_1491628_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1492182_1493157_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212424.1|1493500_1493779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|1493771_1494044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1494161_1495244_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300346.1|1495390_1496266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126678.1|1496276_1497287_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_016211554.1|1497613_1498240_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_016211557.1|1498285_1499515_+	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_032126677.1|1499709_1500273_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211555.1|1500347_1501706_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_016211664.1|1502242_1502971_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211666.1|1503343_1506163_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211669.1|1506317_1506668_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1507492_1508467_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556522.1|1509777_1511010_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211405.1|1511216_1512989_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_016211403.1|1513124_1514168_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_036777261.1|1514181_1514925_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_155047160.1|1515059_1515359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1515963_1516662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047159.1|1517083_1518475_+	protein kinase	NA	NA	NA	NA	NA
WP_016211733.1|1518530_1519355_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_054300173.1|1519969_1521031_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046730.1|1521249_1521390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1521657_1522305_-	LysE family translocator	NA	NA	NA	NA	NA
WP_016212267.1|1522585_1522945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|1523111_1523567_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1523526_1523865_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047158.1|1524000_1526274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126823.1|1526262_1526985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104609.1|1527095_1527728_+	MarC family protein	NA	NA	NA	NA	NA
WP_098082850.1|1527763_1527940_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_016211481.1|1528014_1529157_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_155049129.1|1529235_1529373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126825.1|1529389_1530703_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_054300349.1|1531254_1532979_+	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_155046942.1|1534039_1534925_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046942.1|1535089_1535975_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556521.1|1536509_1536698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1536648_1537802_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047157.1|1537866_1538271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047156.1|1538442_1539066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211631.1|1539324_1540131_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_054300351.1|1540386_1541208_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211632.1|1541243_1542098_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_081007023.1|1542793_1543450_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1543533_1543899_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300181.1|1543955_1544237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|1544240_1544420_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016210103.1|1544772_1546131_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_016210117.1|1546412_1546772_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210111.1|1547192_1548827_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_017377579.1|1548833_1549670_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210099.1|1549691_1550969_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_016210105.1|1551052_1551373_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210106.1|1551392_1552484_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	1570882	1614836	3158635	protease,integrase,transposase	Staphylococcus_phage(45.45%)	48	1570787:1570846	1597599:1597687
1570787:1570846	attL	GGTAACCCTCCCTTAAAATAGTACAAGTGATAAGTGGAATCTTCTGTTAAATTAACTTAG	NA	NA	NA	NA
WP_054300353.1|1570882_1571110_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300354.1|1571256_1571775_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	42.9	1.3e-30
WP_155047155.1|1571720_1571870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1571913_1572888_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047154.1|1572960_1573341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1573301_1573667_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1573612_1574188_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300355.1|1574177_1574363_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211563.1|1574573_1574735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211564.1|1574767_1575643_-	ParA family protein	NA	NA	NA	NA	NA
WP_052104693.1|1575808_1579675_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_080728343.1|1579756_1579897_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_081007034.1|1579878_1580163_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_155047153.1|1580427_1581846_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_016211991.1|1582754_1583660_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126537.1|1583900_1584086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211994.1|1584122_1584659_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_155047152.1|1584861_1585584_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1585623_1586598_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047151.1|1586594_1587134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047150.1|1587183_1588410_+	DUF4131 domain-containing protein	NA	NA	NA	NA	NA
WP_155047149.1|1588404_1588620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|1588643_1589618_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016212012.1|1589661_1590339_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016212013.1|1590354_1590738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212011.1|1590959_1592081_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_054300357.1|1592314_1593190_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211974.1|1593472_1594594_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075273551.1|1594693_1594996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556638.1|1594995_1595676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377865.1|1597020_1597305_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664876.1|1597663_1599526_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
1597599:1597687	attR	CTAAGTTAATTTAACAGAAGATTCCACTTATCACTTGTACTATTTTAAGGGAGGGTTACCGATGGTTATTTCACTAGATGAATTTTATT	NA	NA	NA	NA
WP_054300359.1|1599750_1600323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047148.1|1600681_1601719_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047147.1|1602248_1603223_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_054300361.1|1603376_1603673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377353.1|1603650_1604316_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1604355_1605330_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211144.1|1605886_1606516_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_036779218.1|1606499_1606922_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|1606928_1608668_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|1608668_1609733_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1609736_1610090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1610202_1611159_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|1611168_1611480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1611495_1612065_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|1612328_1613657_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1613861_1614836_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 16
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	1623724	1671128	3158635	tRNA,transposase,integrase	Staphylococcus_phage(25.0%)	43	1613771:1613830	1656596:1657697
1613771:1613830	attL	GCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTC	NA	NA	NA	NA
WP_129556637.1|1623724_1624504_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|1624978_1625416_-	MFS transporter	NA	NA	NA	NA	NA
WP_155047262.1|1625804_1625921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047146.1|1625863_1626073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300363.1|1626312_1626660_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047145.1|1626605_1627181_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273553.1|1627170_1628097_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300364.1|1628270_1629149_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126267.1|1629568_1629811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211330.1|1630158_1631259_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_098082827.1|1631433_1632735_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_052104656.1|1632811_1633315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126265.1|1633638_1634556_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016211336.1|1634621_1635236_-	chorismate mutase	NA	NA	NA	NA	NA
WP_016211334.1|1635284_1635473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210322.1|1636090_1636987_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016210320.1|1637123_1638197_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_054300366.1|1638346_1638760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300568.1|1638780_1639491_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.3	4.1e-38
WP_129556511.1|1639673_1641110_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210321.1|1641306_1642275_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_016210325.1|1644945_1646322_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210326.1|1646475_1647774_-	ankyrin repeats family protein	NA	NA	NA	NA	NA
WP_036778577.1|1648113_1649397_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_016210333.1|1649470_1650100_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_016210330.1|1650303_1650687_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210332.1|1650784_1651528_+	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_075273555.1|1651658_1652192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1652469_1653153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|1653906_1654881_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_155047144.1|1654916_1656242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1656686_1657661_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211804.1|1658043_1659429_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
1656596:1657697	attR	GCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_081007037.1|1659435_1660974_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211806.1|1661016_1661742_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032126804.1|1661906_1662782_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1662941_1663847_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_032126803.1|1664080_1665313_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_016211764.1|1665513_1666335_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211767.1|1667173_1667983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211289.1|1669599_1669872_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211286.1|1669983_1670331_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_036777656.1|1670348_1671128_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 17
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	1697189	1741247	3158635	protease,tRNA,transposase	Staphylococcus_phage(22.22%)	39	NA	NA
WP_054300173.1|1697189_1698251_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046721.1|1698431_1698599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1698770_1699745_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300373.1|1699741_1700599_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209842.1|1701326_1701716_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209834.1|1701892_1702651_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209829.1|1702647_1705047_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209839.1|1706426_1707725_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209838.1|1707922_1708816_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|1708815_1710030_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|1710049_1711336_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|1711351_1711606_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_036777393.1|1711841_1713209_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|1713539_1714562_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|1715084_1716560_+	APC family permease	NA	NA	NA	NA	NA
WP_054300271.1|1716799_1717774_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556633.1|1717882_1718779_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209827.1|1719097_1720657_+	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_075273569.1|1720732_1720939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209831.1|1721146_1721845_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|1722123_1722387_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_036777412.1|1722693_1725288_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209835.1|1725284_1725767_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209844.1|1725744_1726785_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209840.1|1726957_1727443_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_032126641.1|1727550_1730121_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_032126642.1|1730156_1730618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047141.1|1730687_1730894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|1732097_1732637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|1733584_1735069_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|1735193_1736729_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|1736962_1737328_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047140.1|1737273_1737858_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047139.1|1737881_1738286_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047138.1|1738261_1738744_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728346.1|1738761_1739094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046723.1|1740001_1740157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|1740315_1740621_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_075273327.1|1740671_1741247_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	1762667	1818193	3158635	tRNA,transposase	Staphylococcus_phage(15.38%)	55	NA	NA
WP_075273298.1|1762667_1763243_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046962.1|1763246_1763693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1764344_1764845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|1765260_1765614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211831.1|1765914_1767642_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_081007040.1|1767779_1768436_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210510.1|1768466_1769195_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_016210506.1|1769187_1770426_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210512.1|1770561_1771599_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210515.1|1771652_1772555_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210514.1|1772663_1773917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1773974_1777472_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075273576.1|1777531_1778260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778516.1|1778387_1778936_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016210508.1|1779256_1780954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1780962_1782116_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_036781272.1|1782711_1782930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047136.1|1783022_1783454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1783621_1783987_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047135.1|1783932_1784508_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211467.1|1784582_1785149_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_032126344.1|1785151_1786240_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032126343.1|1786360_1787173_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|1787303_1789289_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211470.1|1789348_1790002_-	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_155047134.1|1790768_1791791_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047133.1|1792062_1793037_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.6e-27
WP_016212421.1|1793787_1793970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|1794321_1794546_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155047132.1|1794690_1795353_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.6	5.3e-32
WP_032126637.1|1795469_1795763_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556508.1|1795824_1796268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047131.1|1796538_1797195_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047130.1|1797382_1798141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1798203_1799265_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211841.1|1800124_1800577_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211839.1|1800694_1802167_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|1802325_1802790_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|1803260_1803434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1804143_1804509_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1804454_1805030_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300250.1|1805019_1805679_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_032126143.1|1805778_1807050_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_016211422.1|1807138_1807609_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_051307357.1|1807631_1808225_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211417.1|1808361_1809411_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_016211415.1|1809434_1810358_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1810374_1810836_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211414.1|1810943_1811762_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_129556449.1|1811977_1812484_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1812498_1812864_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047129.1|1813067_1813724_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300382.1|1813994_1814417_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300383.1|1814687_1817168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126139.1|1817263_1818193_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 19
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	1892930	1998707	3158635	tRNA,transposase	uncultured_Mediterranean_phage(21.05%)	96	NA	NA
WP_054300173.1|1892930_1893992_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780082.1|1894535_1895441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|1895571_1896300_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|1896419_1896698_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_129556478.1|1896701_1897588_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047008.1|1897645_1897960_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016210889.1|1897977_1900824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210887.1|1901333_1902284_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210886.1|1902366_1903146_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_052104770.1|1903214_1903922_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210888.1|1903882_1904134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1904156_1904453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1904986_1905760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1905792_1906389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300398.1|1906446_1907328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1907669_1907936_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300400.1|1908080_1908323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1908379_1908907_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|1909572_1909767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1909980_1910334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1910665_1911286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211823.1|1911326_1911515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047122.1|1911549_1915641_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211770.1|1915840_1916974_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|1916987_1917176_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_054300276.1|1917468_1918443_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_075273594.1|1918482_1919853_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300404.1|1919925_1920819_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|1920927_1921845_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_036777569.1|1921896_1922652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|1922719_1923994_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_036777566.1|1924128_1924806_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209944.1|1925006_1926434_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|1926408_1927047_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|1927256_1927535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|1927768_1928713_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_036777561.1|1928734_1930603_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|1930623_1930977_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777579.1|1931015_1932131_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209932.1|1932313_1933354_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|1933356_1934391_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|1934387_1935449_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|1935560_1937033_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_052104625.1|1937185_1937629_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209940.1|1937704_1940476_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_036777555.1|1940632_1941862_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1941888_1942551_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|1943072_1943573_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047121.1|1943674_1944778_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	9.5e-10
WP_075274669.1|1944982_1945285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300286.1|1945669_1946134_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962623.1|1946297_1947450_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047120.1|1947459_1947804_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047119.1|1948088_1949411_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_081007042.1|1949819_1950635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300406.1|1953188_1955924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1956224_1957286_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126856.1|1957346_1957688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1957992_1959146_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_155049815.1|1959328_1959481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1959780_1960146_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1960091_1960667_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212005.1|1961005_1962766_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_016210592.1|1963155_1963812_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016210586.1|1963824_1965330_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210593.1|1965351_1965882_-	colicin V production protein	NA	NA	NA	NA	NA
WP_016210590.1|1965961_1967224_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210587.1|1967398_1968259_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_032126176.1|1968360_1969143_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210588.1|1969233_1970559_-	fimV domain protein	NA	NA	NA	NA	NA
WP_016210595.1|1970926_1972105_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210594.1|1972281_1972935_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_036778626.1|1973070_1975011_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_129556498.1|1975007_1975616_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054300271.1|1975795_1976770_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080728317.1|1976960_1980326_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211391.1|1980392_1980968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779996.1|1980979_1982536_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_036779999.1|1982555_1982987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780001.1|1982973_1983237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|1983593_1983965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|1984169_1984895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212252.1|1985209_1985368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047118.1|1985405_1986848_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_075273327.1|1986837_1987413_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1987358_1987724_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274672.1|1987761_1988355_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211114.1|1988720_1991651_-	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_016211115.1|1991783_1993736_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211112.1|1993928_1994576_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211113.1|1994631_1995957_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_032126179.1|1995986_1996238_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_080664854.1|1996195_1996777_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300408.1|1997113_1997770_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_032126362.1|1997820_1998186_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1998131_1998707_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	2028441	2137820	3158635	tRNA,transposase	Acinetobacter_phage(18.18%)	111	NA	NA
WP_129556499.1|2028441_2029595_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211588.1|2029762_2030464_-	cyclase family protein	NA	NA	NA	NA	NA
WP_032126329.1|2030539_2031169_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_129556496.1|2031354_2032593_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_036778365.1|2032867_2033530_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_016211589.1|2033519_2034752_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_129556495.1|2034874_2035132_+	VOC family protein	NA	NA	NA	NA	NA
WP_032126637.1|2036112_2036406_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126540.1|2036636_2037500_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155049816.1|2037633_2038518_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126332.1|2039165_2040365_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_016211366.1|2040617_2040905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779263.1|2040960_2042970_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_032126330.1|2043312_2044272_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_016211367.1|2044419_2045202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273303.1|2045357_2046074_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016210281.1|2046087_2047479_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210270.1|2047520_2050508_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210277.1|2050577_2051411_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210279.1|2051464_2052631_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210272.1|2052618_2053329_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210283.1|2053368_2054154_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_129556492.1|2054181_2054925_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|2055022_2057218_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_016210271.1|2057294_2057978_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_032126334.1|2057988_2058420_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_036778186.1|2058459_2058858_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_016210273.1|2059230_2059938_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210275.1|2060002_2060305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210276.1|2060360_2060837_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210284.1|2060891_2061413_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210280.1|2061494_2062589_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_075273327.1|2063000_2063576_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2063521_2063887_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047116.1|2063847_2064099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300415.1|2064688_2065390_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_032126500.1|2065523_2066240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|2066376_2067624_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126499.1|2068002_2068614_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211122.1|2068710_2069577_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2069580_2070342_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_036779309.1|2070505_2071411_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211125.1|2071633_2072464_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|2072633_2073023_+	lipoprotein	NA	NA	NA	NA	NA
WP_032126498.1|2073155_2073716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|2073777_2074143_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2074157_2074664_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047115.1|2074660_2075065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212585.1|2075359_2075680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2075791_2076766_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|2077135_2077711_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2077656_2078022_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274673.1|2077982_2078981_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780900.1|2079151_2079805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047081.1|2079855_2080293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212519.1|2080563_2080944_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300173.1|2081018_2082080_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212611.1|2082127_2082448_-	histidine kinase	NA	NA	NA	NA	NA
WP_081377357.1|2082931_2083333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046957.1|2083388_2084240_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_155047114.1|2084741_2084996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211088.1|2085115_2086078_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211087.1|2086285_2087281_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211081.1|2087308_2088244_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|2088284_2088746_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|2088724_2089768_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_155047113.1|2089780_2091367_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_081007043.1|2091326_2093069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|2093792_2095829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046717.1|2098085_2098235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274676.1|2098393_2098591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777508.1|2098665_2098938_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_155047112.1|2099014_2099554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|2099833_2100719_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047111.1|2100723_2102052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047110.1|2102168_2103230_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126869.1|2103207_2103447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2103967_2104543_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2104488_2104854_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047109.1|2104915_2105329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556488.1|2106509_2107360_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275079.1|2107508_2108570_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126801.1|2108617_2109127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274679.1|2109795_2110857_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212218.1|2112306_2112657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285943.1|2112801_2113638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|2113691_2114984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104686.1|2115219_2117976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046955.1|2119131_2119311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|2119552_2120254_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|2120514_2120721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|2120950_2121256_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|2121434_2123432_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2123415_2124462_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|2125182_2126034_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|2126034_2126955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|2127365_2127650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2127641_2128097_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2128056_2128395_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2128607_2129537_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2129693_2130122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047107.1|2130202_2130655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2130680_2131586_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2131782_2132391_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155047106.1|2132431_2133318_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556499.1|2133514_2134667_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211971.1|2134873_2135485_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2135505_2136702_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2136798_2136939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2136951_2137356_-	SufE family protein	NA	NA	NA	NA	NA
WP_075273313.1|2137481_2137820_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	2141836	2189498	3158635	protease,tRNA,transposase	Salinibacter_virus(16.67%)	46	NA	NA
WP_081007045.1|2141836_2142466_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036777096.1|2143568_2144909_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|2144971_2145685_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016209894.1|2145853_2146345_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209887.1|2146488_2146980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209877.1|2147182_2148073_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_080664826.1|2148272_2148872_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_052104598.1|2148952_2149891_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_036777110.1|2149942_2151037_-	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_052104599.1|2151161_2152478_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.1	3.2e-65
WP_016209893.1|2152820_2157710_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_016209881.1|2157802_2158105_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209876.1|2158215_2160138_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209888.1|2160159_2161455_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209898.1|2161451_2163062_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052104600.1|2163168_2164062_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209884.1|2164171_2164795_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2164871_2165072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2165213_2165912_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2166058_2166628_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2166942_2167566_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2167774_2168377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2168448_2169334_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046753.1|2169557_2170443_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273603.1|2170522_2170699_+	phosphatase	NA	NA	NA	NA	NA
WP_016212526.1|2170822_2171356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047105.1|2171526_2172408_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	3.4e-50
WP_016212445.1|2172650_2172917_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|2172975_2173560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274681.1|2174110_2174986_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063519.1|2175034_2175451_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210465.1|2175737_2176580_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2176630_2176978_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2177168_2178056_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2178170_2178773_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2178769_2179489_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_052104601.1|2179557_2181270_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_036777098.1|2181417_2183355_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2183463_2184516_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2184515_2184791_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2184871_2185420_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_051307322.1|2185693_2185873_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_155047104.1|2185876_2186158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2186214_2186580_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047103.1|2186695_2187817_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_155049817.1|2188611_2189498_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	2213680	2257138	3158635	transposase	Staphylococcus_phage(41.67%)	45	NA	NA
WP_075273327.1|2213680_2214256_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2214201_2214567_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036780787.1|2214765_2215725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2216093_2217176_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_155047098.1|2217191_2218484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047097.1|2218559_2219243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211538.1|2219937_2220861_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_054300443.1|2221099_2221378_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|2221430_2221679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|2221636_2222698_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212179.1|2223118_2223271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|2223693_2223867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2223943_2224201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781320.1|2226419_2226647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2226633_2226960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2226961_2227393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2227921_2228983_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300445.1|2229077_2229629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2229898_2230918_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2230904_2231327_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2231328_2231802_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|2231917_2232541_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|2232570_2233245_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2233250_2234399_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2234395_2234857_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2234932_2236183_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2236309_2237989_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2238098_2238965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2239867_2240842_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_036781250.1|2240937_2241723_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2241866_2242553_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2242586_2242985_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2243148_2243454_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|2243531_2243786_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2243939_2245601_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2245660_2246344_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2246343_2247432_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2247480_2250117_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300173.1|2250529_2251591_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300448.1|2251780_2254150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2254193_2255168_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300449.1|2255187_2255967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2256096_2256435_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049818.1|2256394_2256712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049819.1|2256856_2257138_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	2260883	2296356	3158635	tRNA,transposase	Halovirus(20.0%)	36	NA	NA
WP_075273327.1|2260883_2261459_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047096.1|2261490_2261763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047095.1|2261819_2261960_+	phosphatase	NA	NA	NA	NA	NA
WP_155047094.1|2262104_2262572_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211503.1|2262722_2263178_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|2263232_2263577_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2263606_2264650_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|2265352_2265562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2265551_2266438_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210192.1|2266750_2267269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|2267640_2267802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210194.1|2267858_2268206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036778869.1|2268240_2268903_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_036778872.1|2268946_2269552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210201.1|2269781_2270837_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_016210187.1|2270840_2274026_+	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210205.1|2274106_2275063_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210206.1|2275111_2275648_+	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210199.1|2275644_2276406_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_036778866.1|2276511_2279100_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.9	3.3e-122
WP_032126472.1|2279562_2280213_-	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_016210190.1|2280432_2281308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|2281498_2281900_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210198.1|2281916_2282468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|2282779_2283466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779341.1|2283466_2285677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210196.1|2286030_2286384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300452.1|2286341_2287403_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075285950.1|2287467_2288076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556449.1|2288065_2288572_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300455.1|2288586_2288952_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273329.1|2288912_2290214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2290261_2291323_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556651.1|2291510_2292719_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300173.1|2292960_2294022_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211428.1|2294292_2296356_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
>prophage 24
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	2336626	2398969	3158635	tRNA,transposase	Acinetobacter_phage(10.0%)	55	NA	NA
WP_129556571.1|2336626_2337337_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2337365_2337770_+	RidA family protein	NA	NA	NA	NA	NA
WP_036777168.1|2337794_2338754_-	response regulator	NA	NA	NA	NA	NA
WP_016209567.1|2338885_2339503_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126712.1|2339937_2340396_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2341140_2342151_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2342635_2343547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2343872_2347367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2347404_2348244_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_036777155.1|2348430_2348646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2348694_2349270_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2349266_2349605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209572.1|2350764_2351727_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_054300271.1|2352682_2353657_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2353794_2354028_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2354121_2354487_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2354501_2355008_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212572.1|2355065_2355458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2355587_2355953_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2356009_2356318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2356409_2356985_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2356930_2357296_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|2357448_2357721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126774.1|2358329_2358665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2358824_2360357_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2360389_2361229_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2361225_2361723_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_036779082.1|2361726_2362719_-	AAA family ATPase	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_155047091.1|2362833_2364180_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2364403_2365465_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2365543_2366689_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|2372496_2373354_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2373340_2374264_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_036778204.1|2374460_2375852_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2375898_2376942_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2376984_2377428_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2377560_2378751_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2378805_2378952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|2379502_2380420_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2380687_2380981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2381057_2381252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300462.1|2382270_2383188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2383653_2384496_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2384563_2385214_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|2385228_2386269_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|2386391_2387477_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2387503_2388613_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2388629_2388947_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2388943_2389303_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_080664847.1|2392634_2393588_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300173.1|2393660_2394722_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212048.1|2395485_2396043_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_032126664.1|2396236_2396920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126663.1|2397638_2397881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|2397907_2398969_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	2488862	2571573	3158635	tRNA,transposase	Escherichia_phage(37.93%)	82	NA	NA
WP_054300202.1|2488862_2489591_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|2489680_2490292_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_036779399.1|2490648_2490903_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2491001_2492786_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779389.1|2492874_2493594_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|2493776_2493983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779393.1|2493982_2494219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2494231_2494609_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2495115_2495934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779396.1|2496027_2496225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|2496319_2497705_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|2497831_2498422_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_155047083.1|2500613_2501342_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	4.3e-43
WP_016211816.1|2502410_2502764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2502805_2504419_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2504640_2504862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2505170_2505899_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2506515_2507613_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2507646_2508897_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_054300202.1|2509036_2509765_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212193.1|2509887_2510226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2510293_2510680_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2510676_2510922_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300475.1|2511330_2512059_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211625.1|2512542_2513412_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_036779883.1|2513408_2514758_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211623.1|2514870_2516511_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_054300202.1|2517325_2518054_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300478.1|2518333_2520070_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_155047082.1|2520231_2520411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300477.1|2520573_2521302_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016212214.1|2521460_2521961_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016212213.1|2521935_2522445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2523198_2523927_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300479.1|2524077_2525118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211653.1|2525315_2526341_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_016211652.1|2526448_2527654_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211655.1|2527913_2528327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2528455_2529025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2529028_2529361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300480.1|2529353_2530193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047081.1|2530280_2531828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2532277_2532781_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2532743_2533451_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2533519_2534380_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_036777969.1|2534360_2535134_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2535164_2536418_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2536417_2537380_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2537423_2538176_+	ComF family protein	NA	NA	NA	NA	NA
WP_036777977.1|2538229_2540110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|2540257_2540728_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2540773_2541013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777984.1|2541031_2541481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2541701_2543126_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|2543190_2544240_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2544506_2545286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2545337_2546240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047080.1|2546298_2547045_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	4.4e-19
WP_016210616.1|2547293_2550104_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_081007053.1|2550338_2551199_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_155047079.1|2552041_2552284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2552438_2553591_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047078.1|2553777_2554113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2554205_2554505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2554494_2554659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047077.1|2554890_2556043_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	4.4e-58
WP_155047076.1|2556052_2556328_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212641.1|2556523_2556970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049820.1|2556934_2557390_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273369.1|2557498_2558314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047075.1|2558387_2559308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2559319_2560048_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2560137_2560344_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007054.1|2560506_2561739_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_054300482.1|2562254_2563544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049821.1|2564702_2564891_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047219.1|2564937_2565666_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032127022.1|2566342_2568529_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2568590_2569744_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2570029_2570554_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|2570744_2570912_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|2570856_2571573_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
>prophage 26
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	2587203	2615390	3158635	protease,integrase,tRNA,transposase	Acinetobacter_phage(12.5%)	27	2584592:2584651	2602432:2602720
2584592:2584651	attL	ACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTT	NA	NA	NA	NA
WP_155047267.1|2587203_2587413_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007057.1|2588740_2589157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|2589214_2590367_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016212230.1|2590423_2591872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2593405_2593594_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046946.1|2594995_2595271_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2595273_2595876_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_016212522.1|2595972_2596227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|2596771_2597851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780431.1|2598169_2599888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2599931_2600837_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155049822.1|2601307_2601463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047221.1|2601854_2602334_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	42.0	1.7e-11
WP_155047222.1|2602442_2603117_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.8	2.2e-09
2602432:2602720	attR	AAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTT	NA	NA	NA	NA
WP_155047223.1|2603160_2603406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2604036_2604612_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_036778086.1|2604687_2605563_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_052104629.1|2605963_2606989_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047224.1|2607132_2607609_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778088.1|2607593_2608676_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.0e-20
WP_036777829.1|2608916_2609321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047225.1|2609655_2609853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2610033_2610765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2611021_2612323_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2612464_2613133_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2613576_2614173_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2614193_2615390_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
>prophage 27
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	2644606	2697347	3158635	tRNA,transposase	Microbacterium_phage(12.5%)	57	NA	NA
WP_054300282.1|2644606_2645071_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047228.1|2645127_2645610_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2646464_2646860_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|2646856_2647651_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_036778479.1|2647829_2648555_-	D-Ala-D-Ala dipeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2648800_2649988_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016210935.1|2650564_2651107_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2651103_2651790_-	acireductone synthase	NA	NA	NA	NA	NA
WP_036778484.1|2651793_2652405_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2652451_2653471_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2653572_2654367_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2654404_2655211_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2655289_2656339_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2656536_2657796_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2657842_2658520_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2658605_2658887_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|2658978_2660166_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_016210820.1|2660402_2661344_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2661847_2662072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2662363_2663068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|2663531_2664170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2664504_2665035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779158.1|2665031_2666564_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2666560_2667511_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2667931_2668564_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2668806_2669004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2669378_2669744_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2669800_2669965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2669954_2670254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2670301_2670730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300194.1|2670807_2671506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2671483_2672545_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2672769_2673066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|2673170_2673827_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2674050_2674548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047229.1|2675757_2676219_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2676178_2676517_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036778253.1|2676574_2678113_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_098082804.1|2678224_2679323_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2679560_2680760_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2680789_2681428_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|2681443_2683627_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|2683864_2684209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|2685254_2685461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|2685625_2686084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|2686671_2687799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2687922_2688585_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2688676_2688922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049823.1|2689354_2689735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2690283_2690943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2691044_2691695_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_054300271.1|2692186_2693161_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2693411_2693633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047230.1|2693921_2694344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047231.1|2694344_2694878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300190.1|2695372_2696335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046995.1|2696461_2697347_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	2758226	2816258	3158635	protease,tRNA,transposase	Staphylococcus_phage(37.5%)	56	NA	NA
WP_054300271.1|2758226_2759201_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047235.1|2759220_2760207_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2760297_2761044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275004.1|2761168_2762032_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2762275_2762638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273422.1|2762824_2763352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2763496_2763913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2766009_2766921_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2766972_2767821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2768265_2768976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2769067_2770036_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2770023_2770671_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036779767.1|2770699_2771551_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2771565_2772843_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2772883_2773399_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_054300183.1|2773477_2774539_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2774560_2775649_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_036777788.1|2775693_2777529_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2777571_2778042_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2778078_2778414_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2778426_2779143_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2779079_2780096_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2780092_2780572_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2780655_2783136_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2783198_2783564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2783902_2784241_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2784200_2784656_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2784670_2784961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777784.1|2785026_2786625_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2786755_2787091_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777781.1|2787118_2788783_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210581.1|2788779_2789424_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2789423_2790167_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2790225_2790465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2790615_2791983_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2791993_2792545_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2792625_2793609_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2793730_2795488_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2795710_2796301_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2796389_2796809_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_075273416.1|2796949_2797564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2797624_2798410_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075273313.1|2798663_2799002_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007003.1|2798961_2799423_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2799795_2800770_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212084.1|2801051_2802068_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2802067_2802583_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2802624_2803098_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_155047236.1|2803153_2803696_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2803719_2804175_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_155046996.1|2805948_2808462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046997.1|2809396_2811919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2812493_2813555_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046731.1|2813581_2814467_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046755.1|2814538_2814715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2815105_2816258_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 29
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	2941126	3005258	3158635	transposase	Staphylococcus_phage(16.67%)	53	NA	NA
WP_054300271.1|2941126_2942101_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211161.1|2942683_2943793_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2943804_2944449_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2944467_2945454_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2945533_2946610_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2946812_2947637_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_155049826.1|2947953_2948958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2949166_2950132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047242.1|2950270_2951146_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2951442_2952495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2952762_2953191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2953404_2953896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2953951_2955202_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2955304_2955523_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_036777591.1|2955980_2956835_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016210728.1|2956889_2957360_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2957747_2959127_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2959154_2959613_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2959590_2960808_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2960999_2961236_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2961249_2961405_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2961485_2962448_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2962607_2963924_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2963933_2964602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2964964_2966779_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_054300166.1|2966896_2967685_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211543.1|2968265_2970017_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|2970027_2970828_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|2970930_2971419_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_032126435.1|2971592_2971907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375799.1|2972927_2973272_+	DMT family protein	NA	NA	NA	NA	NA
WP_016210038.1|2978965_2979928_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|2980114_2981374_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|2981597_2981924_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|2982118_2983069_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|2983126_2985193_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|2985198_2986194_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|2986779_2988360_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|2988516_2989926_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|2989985_2991119_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|2991258_2992083_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|2992310_2992940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|2993276_2993648_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|2993951_2994239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|2994390_2995239_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|2995366_2996407_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_155047244.1|2996479_2998417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|2998700_2999360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2999514_3000489_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|3000564_3001584_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556602.1|3001982_3002192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|3003066_3004149_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_054300161.1|3004196_3005258_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP038952	Piscirickettsia salmonis strain Psal-040 chromosome, complete genome	3158635	3013143	3127063	3158635	tRNA,transposase	Staphylococcus_phage(33.33%)	113	NA	NA
WP_155047053.1|3013143_3014029_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212222.1|3014505_3014979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|3014975_3015371_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3016300_3016876_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3016821_3017187_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036778680.1|3017451_3019782_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_129556603.1|3019902_3021918_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300160.1|3022101_3025494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3025558_3025864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|3026054_3026234_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_155047245.1|3026237_3026426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|3026449_3027424_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	1.8e-28
WP_032126362.1|3027681_3028047_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047247.1|3028110_3028479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|3028482_3029369_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047248.1|3029432_3030119_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047249.1|3030371_3031472_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|3031866_3032976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|3034018_3034384_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047002.1|3034398_3035004_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036776867.1|3035374_3036772_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_051307313.1|3036891_3037839_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3037835_3038351_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3038337_3039537_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3039533_3039857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3039858_3041088_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3041087_3042131_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3042130_3042814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3042810_3045300_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3045316_3045571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3045571_3045928_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3046707_3047871_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3047890_3050998_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3050999_3052505_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3052532_3052814_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3052962_3053304_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3053423_3055304_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3055388_3056987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3057004_3058120_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3058247_3059246_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_052104582.1|3059249_3060008_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3060009_3061209_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3061192_3061864_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3061885_3062662_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3062665_3063664_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3063665_3064244_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3064240_3065710_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3065753_3066041_-	trp operon repressor	NA	NA	NA	NA	NA
WP_155047250.1|3066241_3066838_+	EamA family transporter	NA	NA	NA	NA	NA
WP_054300152.1|3066864_3067230_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3067286_3067442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273401.1|3067586_3068039_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047251.1|3068076_3068301_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155047003.1|3069896_3070782_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3070968_3071190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047252.1|3071305_3071884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047253.1|3072028_3072223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3072281_3073256_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|3073309_3074371_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776841.1|3075098_3075638_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3075722_3076259_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3076910_3077213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3077662_3077971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|3078579_3079029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3079311_3080022_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3080248_3080647_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_036778156.1|3081514_3082465_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3082464_3084543_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3084690_3085206_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3085214_3085778_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3085758_3086505_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3086644_3087097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3087520_3088357_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3088353_3089250_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3089282_3090350_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3090368_3090737_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3090762_3092211_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3092220_3093600_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3093640_3094972_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3094943_3095903_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3095995_3096499_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3096633_3097785_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3097781_3098261_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3098407_3100729_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3100673_3101300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3101304_3102204_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3102276_3102855_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3103155_3103413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556718.1|3103421_3104608_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_155046758.1|3105422_3105554_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3105698_3105854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777721.1|3106181_3106955_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155047254.1|3107891_3108029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3108072_3109047_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3110141_3110480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007065.1|3110496_3111336_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_081007013.1|3111548_3111848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3111837_3112002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3112058_3112424_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3113728_3114424_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3114420_3115848_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3115873_3116137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3116209_3117184_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047005.1|3117242_3118093_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3118130_3118475_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3118471_3119308_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3119308_3119650_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3119651_3120257_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3120253_3122248_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3122267_3123209_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052104719.1|3123436_3124861_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3125373_3126348_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3126406_3127063_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038953	Piscirickettsia salmonis strain Psal-040 plasmid unnamed1, complete sequence	194899	1943	172788	194899	head,protease,tail,integrase,transposase,capsid	Streptococcus_phage(17.91%)	175	93818:93877	121915:123090
WP_054300202.1|1943_2672_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|2875_5452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|5568_6546_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_016211953.1|9596_10076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211956.1|10133_10862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211955.1|11318_12299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275154.1|12435_13092_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.7	7.6e-31
WP_036771347.1|13454_14432_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_027242575.1|15061_15547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242576.1|15580_17443_-	AAA family ATPase	NA	A0A088C4M0	Shewanella_sp._phage	30.9	1.0e-56
WP_036771347.1|17635_18613_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047288.1|18627_18753_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047289.1|18685_18862_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049827.1|19111_21127_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155047291.1|22788_24819_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|25068_26046_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_075273760.1|26538_28941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047021.1|29043_29199_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300202.1|29222_29951_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075275153.1|30195_30993_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155049828.1|31969_33043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049829.1|33366_34101_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155049830.1|34156_34738_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.6	4.2e-33
WP_032126239.1|34812_35085_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049831.1|35666_36206_+	helix-turn-helix domain-containing protein	NA	W5R8L2	Staphylococcus_phage	34.9	1.0e-04
WP_017375910.1|36235_36964_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377658.1|37211_37898_+	Fic family protein	NA	NA	NA	NA	NA
WP_155047286.1|37901_38468_+	helix-turn-helix domain-containing protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	35.0	1.4e-20
WP_155047299.1|38557_39916_+	DEAD/DEAH box helicase	NA	D2J050	Enterococcus_phage	50.5	2.6e-126
WP_017375910.1|40099_40828_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_080963647.1|42498_42669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774631.1|43007_43472_-	hypothetical protein	NA	H6WFS7	Cyanophage	38.2	2.9e-21
WP_155047285.1|44605_44863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|44881_45859_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155049834.1|45871_46867_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047292.1|47344_48262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|48339_49317_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_105962623.1|49774_50928_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273751.1|51277_53008_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155047019.1|53020_53173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047293.1|53662_54388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|54540_55269_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126843.1|55645_55825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126844.1|56043_56340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212118.1|56434_56896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780014.1|57249_58692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780017.1|58852_59227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047014.1|59297_59639_-	hypothetical protein	NA	A0A1B1IQX9	uncultured_Mediterranean_phage	60.3	1.7e-21
WP_054300202.1|59857_60586_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155047294.1|60792_61455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047295.1|61700_62762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|62791_63874_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_155047300.1|63993_64266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047296.1|64374_65010_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	42.5	1.4e-34
WP_155046765.1|65896_66091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047015.1|66471_66795_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212122.1|67671_68373_+	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_016212121.1|68326_69250_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_105962625.1|69683_70569_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.7	4.5e-10
WP_016212151.1|71171_72134_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|72157_72472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|72535_73510_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_033923686.1|73634_74684_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|74792_75833_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|75846_76476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|76566_76866_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_081377909.1|76862_77327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104769.1|78288_79212_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_105962623.1|80356_81509_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274741.1|81578_81836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273822.1|81937_82438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|82882_83965_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212255.1|84151_84322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|84318_84522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|84858_85083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212260.1|85102_85375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|85532_86507_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_129556717.1|87161_88388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|88713_89550_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_016212398.1|89812_90274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047268.1|90440_90821_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|91909_92275_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|92220_92796_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_105962623.1|93779_94933_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
93818:93877	attL	ATAAATAATCATTAGCTGAGTGAATGCGTTTTCTGTTATAAAAAACTTCGATATACTCAA	NA	NA	NA	NA
WP_075273810.1|94953_95661_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	34.2	1.4e-11
WP_081007042.1|97820_98636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728342.1|98950_99454_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_105962174.1|99597_99762_+	phosphatase	NA	NA	NA	NA	NA
WP_155047269.1|99910_100306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273806.1|100567_101131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|101236_101692_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_075273804.1|101651_101990_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|102074_102803_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_016212413.1|103136_103565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|103612_104353_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_075273798.1|104753_104978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|105086_105611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047270.1|105731_105878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047297.1|106022_106169_-	phosphatase	NA	NA	NA	NA	NA
WP_032126138.1|107377_107641_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211871.1|108206_108542_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_129556699.1|108535_108736_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300590.1|109043_109268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|109884_110910_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273790.1|111454_111757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|111746_112373_-	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_016212412.1|112673_112838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|112830_113280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|113527_113701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212499.1|113905_114280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|115278_116431_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_075273786.1|116440_116839_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211913.1|117271_118393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|118718_118991_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|118994_119255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211912.1|119527_120118_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_129556698.1|120207_120909_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_054300249.1|121022_121388_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|121402_121909_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	1.0e-06
WP_155047271.1|121912_123030_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	3.6e-57
WP_051307374.1|123144_123621_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
121915:123090	attR	ATAAATAATCATTAGCTGAGTGAATGCGTTTTCTGTTATAAAAAACTTCGATATACTCAAAGATCGCTGATTTAGCCTCCTGTCGATTTTTAAAATTCATGTGATGAACTAACTCCGTTTTTAAGGTATGAAAGAAACTCTCTGAAACAGCGTTATCCCAGCAGTCTCCCTTACGACTCATACTTTGCTTAATTTGATGATCTTTAAGAATCTCACGATGACTTTCTGAAGCATATTGGCTTCCGCGATCTGAATGCCAAATTAACCCAGCTTTAGGCTTTCGTTTCCATAAGGCCATCAACAGAGCATCATTGACGAGTGATGCTTCCATATGATCCTCCATGGCCCAGCCAACAACTTTTCGTGAGAATAAGTCAATCACAACAGCCAAGTACAACCAGCCTTGTTGGGTCCGTATGTAGGTAATATCACCAACATATTTTTGGTTAGGGCCTGTTGCTGAAAAATTCCGGTCCAACACGTTTTTCGCAATTGGCAATCGATGTTTAGAATCCGTAGTTACTTTGAATTTACGCTTTATCTTGCAGCAAAGCTGGTTCTGCTTCATTAAACGGCCAACTCGCTTACGGCTTACAGAAATTTCCTGTGTTGCCAACTGTTTTCTAATTCTTCGAGTACCATAGGTTGCACGGCTTTCGATGAATATTTCCTTGATTCGCCTAGCTAATTTTTGGTTCTCTATCATTCGCTTGGAAGGCTGTACCTTTAACCAACTGTAATAACCTGATCGGCTAACACCTAAGATTGAGCACACCCTATCTACTGGAAAAACACATTTATTTTCTTTGATCCAGGCATACTTTACTGTGTTTCGCTTGCAAAGTACGCCGCCGCTTTTTTTAGTATTTCACGTTCCTGTGTCACTCTAGCCAACTCTTTTTTTAACTGTTTTATTTCAGCAGCCATATCACTAACTTCATCTTTAACAGTATTTGGACTGTTTGGATGATATTTATTGACCCAACCATGCAGTGTACTTGAGTGAATACCCAATTCCTGTGCTGTATGACTGATTGCTTGATTTGAATCGACTGCAAGCTTGGCAGATGATTTTTTAAATTCTTCGGTGTACTTGGTGACGTGACGCTTTCCCATTGTGATTCCTCCGGCTCGGATTATTGTAATTTATTTGTCCGGAATAGGGTAGCCTGATCA	NA	NA	NA	NA
WP_016212298.1|123861_124188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|124854_125880_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047272.1|126089_126818_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_054300594.1|127180_128206_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047273.1|128336_128474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046942.1|128612_129499_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.8	2.6e-10
WP_155047274.1|129583_129790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|130129_130945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211897.1|131338_131743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|131743_132490_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211895.1|132998_134057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126360.1|134179_134914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211773.1|135500_136175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|136276_136645_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211776.1|136812_138150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556697.1|138632_139025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|139409_140315_-|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_016210664.1|140612_141035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210651.1|141034_141385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210658.1|141381_141777_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210667.1|141769_142093_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210663.1|142089_142401_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210655.1|142719_143316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556716.1|143329_143620_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_052047108.1|143753_144152_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047275.1|144207_144705_-	DNA polymerase	NA	NA	NA	NA	NA
WP_155047276.1|144701_145481_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	31.7	1.8e-18
WP_129556718.1|145509_146695_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_081377350.1|147228_148044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047277.1|148108_148717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211936.1|149451_150474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047278.1|150963_151365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|151482_152508_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|153082_153244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|153243_153744_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273747.1|154005_154596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|154658_154952_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155049832.1|155034_155910_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	3.7e-57
WP_052104629.1|156027_157053_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047281.1|157279_157609_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.8	5.5e-06
WP_155047018.1|157676_158480_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.9e-55
WP_075274752.1|158515_158815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|158811_159387_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|159332_159698_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|160602_162645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|163414_163615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|163755_164730_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.0	1.9e-25
WP_016212579.1|166226_166424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|167023_167998_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212456.1|168041_168329_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_036779532.1|168325_168727_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_075273881.1|168736_170923_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.2	9.2e-73
WP_016212404.1|171043_171277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273857.1|172053_172788_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	8.4e-39
>prophage 1
NZ_CP038954	Piscirickettsia salmonis strain Psal-040 plasmid unnamed2, complete sequence	57412	2671	46650	57412	head,portal,protease,transposase,capsid,integrase,tail	Streptococcus_phage(14.29%)	57	NA	NA
WP_052104629.1|2671_3697_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047304.1|3967_4099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047313.1|4825_5179_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_016211142.1|6767_7034_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075274761.1|7090_7414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047305.1|7415_7838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274762.1|7837_8188_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_075274763.1|8184_8580_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	39.1	6.0e-07
WP_075274764.1|8572_8896_-|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	41.7	5.4e-14
WP_075274765.1|8892_9204_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.7	2.5e-08
WP_036778347.1|9523_10105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047306.1|10140_11307_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	38.7	1.2e-66
WP_081007077.1|11362_12034_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	45.8	5.5e-45
WP_054300593.1|11981_13223_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	43.6	2.7e-85
WP_155047307.1|13219_13816_-	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.3	2.0e-38
WP_155047308.1|13859_14834_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	8.3e-26
WP_155047309.1|14853_15783_-	hypothetical protein	NA	A0A1W6JP18	Morganella_phage	52.0	1.5e-85
WP_155047310.1|16011_16494_-	hypothetical protein	NA	Q9B019	Phage_GMSE-1	33.3	1.1e-13
WP_032126915.1|16580_16964_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	4.7e-25
WP_052047121.1|17142_17544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126916.1|17688_18159_-	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	48.8	1.5e-33
WP_155047311.1|18146_18449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923627.1|18445_18733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210963.1|18828_19068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047315.1|19064_19412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047314.1|19404_19767_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.9e-24
WP_036780304.1|19735_20272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211080.1|20312_21299_-	helix-turn-helix domain-containing protein	NA	A0A0S2MVA0	Bacillus_phage	45.4	4.3e-14
WP_036780299.1|21337_21640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211079.1|21794_22100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211067.1|22309_23053_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211077.1|23185_23971_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300594.1|24403_25429_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036780005.1|25576_26224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211069.1|26207_26639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047030.1|26663_26807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211075.1|27021_28263_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211068.1|28266_29079_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080664851.1|29075_29885_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|30087_31062_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047312.1|31097_31439_-	toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.7	2.0e-11
WP_027242955.1|31431_31692_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211925.1|32182_32968_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	28.7	9.7e-17
WP_016211928.1|32960_33401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|33951_34215_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_032126137.1|34989_36039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212188.1|36102_36843_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155047301.1|37020_37293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|37913_38489_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	6.0e-08
WP_032126136.1|38554_39100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|40133_41159_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047302.1|41812_42892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212274.1|43422_43887_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032126154.1|43897_44092_-	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_032126152.1|44307_44898_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
WP_081007075.1|44961_45303_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155047303.1|45648_46650_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.3e-29
>prophage 1
NZ_CP038955	Piscirickettsia salmonis strain Psal-040 plasmid unnamed3, complete sequence	39811	6501	21081	39811	head,terminase,portal,capsid,transposase,protease,tail	unidentified_phage(23.08%)	17	NA	NA
WP_054300271.1|6501_7476_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047029.1|7499_7715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|7880_8855_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047317.1|8989_9826_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_016211139.1|9905_10301_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211132.1|10293_10617_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211137.1|10613_10925_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_155047318.1|11115_12450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211140.1|12570_13764_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_080664855.1|13821_14493_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_155047319.1|14440_15061_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	50.9	5.5e-39
WP_052104629.1|15263_16289_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047320.1|16419_17142_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	40.8	2.6e-40
WP_155047321.1|17138_18821_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	45.7	6.9e-137
WP_016212234.1|18823_19303_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_155047322.1|19379_19772_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	4.4e-26
WP_054300271.1|20106_21081_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
>prophage 1
NZ_CP038956	Piscirickettsia salmonis strain Psal-040 plasmid unnamed4, complete sequence	33277	10315	26969	33277	transposase,tail	Indivirus(18.18%)	19	NA	NA
WP_036781073.1|10315_10576_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	A0A1S5NR91	Burkholderia_phage	48.8	2.1e-13
WP_081007079.1|10646_10919_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_129556478.1|11130_12017_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	5.8e-10
WP_016212315.1|13555_13990_+	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	39.7	9.1e-25
WP_155047334.1|14398_14839_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	37.6	1.1e-06
WP_054300249.1|14799_15165_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047335.1|15179_15623_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	5.1e-07
WP_054300271.1|16632_17607_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047336.1|17603_17888_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047337.1|17906_18269_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|18268_18691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275196.1|18692_19016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|19072_19339_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075275195.1|19342_21421_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.4	2.5e-56
WP_036776958.1|21413_21755_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|21751_22423_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|22391_23138_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_054300696.1|23127_23685_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_075275194.1|23681_26969_+	host specificity protein J	NA	A0A0R6PIC0	Moraxella_phage	33.2	5.2e-112
