The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	45566	89679	3160466	transposase	Moraxella_phage(16.67%)	46	NA	NA
WP_129556427.1|45566_46142_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46087_46453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46651_47413_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_016211195.1|47714_49241_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49612_50452_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50491_51799_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51773_52943_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|52997_53723_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54001_54391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54550_55456_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55531_55675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274979.1|55722_56562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|56554_56890_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_155046698.1|57068_57230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|57346_57640_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_016210704.1|58534_60481_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61135_64198_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64194_65259_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65614_66568_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66599_67763_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67768_68368_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68555_69056_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69073_70162_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70588_71833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71829_72672_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016211096.1|72651_73461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73639_73867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73867_74818_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74873_75425_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75551_75974_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75966_76713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76755_77454_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77464_78289_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78618_78987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274980.1|78981_80043_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|80092_80323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80452_81667_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81967_83029_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_016211249.1|83042_84770_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_016211245.1|84803_85535_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85534_86323_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86427_87051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87370_87583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273383.1|87738_88311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046699.1|88515_89088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274981.1|89082_89679_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	136473	178470	3160466	transposase	Staphylococcus_phage(50.0%)	46	NA	NA
WP_054300271.1|136473_137448_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|137949_139362_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|139854_140862_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|140881_142402_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_129556430.1|142458_142665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211018.1|143640_144957_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145060_145444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145578_148644_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|148712_149816_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|149839_150394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150508_151078_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151197_151953_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_054300545.1|152119_153181_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|153575_153971_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|153992_154358_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154414_154579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|154568_154868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|155120_155486_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|155431_156007_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212607.1|156007_156364_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|156452_157028_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|156973_157339_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|157818_158385_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|158396_159182_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|159813_160737_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|160788_161784_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|161815_162310_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|162401_162659_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|162748_163171_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|163489_164206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|164249_164501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556431.1|164514_165942_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|165969_167412_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|167499_167838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|167922_168453_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|168513_170706_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|170748_171234_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|171503_171935_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_016210245.1|171952_172783_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|172797_172941_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|172971_173856_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|173827_174049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|174222_174501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|175471_176377_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016212383.1|176779_177898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|177894_178470_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	182276	239530	3160466	protease,transposase,tRNA,tail	Escherichia_phage(12.5%)	56	NA	NA
WP_075273327.1|182276_182852_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|182797_183163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|183226_183499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212441.1|183766_183991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372761.1|185006_185456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|185519_186248_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210779.1|186290_187220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|187512_188106_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|188074_188728_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|188905_189877_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|189899_190796_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|190954_191401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210787.1|191397_192039_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|192148_192727_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|193202_193640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|193964_195305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|195568_196963_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075274986.1|198411_199479_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|199531_199954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|200194_200638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|200692_200950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|200927_201554_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|201631_203614_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|203823_205167_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|205433_208103_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|208126_210046_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|210215_211637_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|211782_212757_+	phospholipase A	NA	NA	NA	NA	NA
WP_016209855.1|212788_213184_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209859.1|213186_213408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|213571_215233_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|215305_215596_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_016209861.1|215821_216277_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|216341_216806_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216898_218245_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|218244_219150_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|219211_220198_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|220190_220433_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|220554_222099_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|222145_223432_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|223474_224869_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224892_225072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|225068_225644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|225589_225955_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274988.1|226016_228251_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016210079.1|228672_229170_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|229340_230036_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|230138_231701_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|232016_233810_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233895_234168_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|234173_234800_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234786_236217_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236549_237605_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237573_238251_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|238240_239077_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|239236_239530_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	256927	301882	3160466	transposase,tRNA	Acinetobacter_phage(40.0%)	48	NA	NA
WP_075274991.1|256927_257503_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377888.1|257506_258067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556436.1|258122_259009_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046701.1|259035_259185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|259329_259530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|259577_260039_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|260462_261944_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|262006_263116_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|263213_265175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|265704_266109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|266161_267223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046702.1|267348_267504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270449_271602_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556437.1|271644_272067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556438.1|272336_273803_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_032126861.1|274006_274321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|274655_275542_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212538.1|275713_276154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210630.1|276683_277799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664846.1|277737_278424_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032126366.1|278417_279395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210638.1|279433_280597_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210640.1|281061_281286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|281671_281959_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210633.1|282133_282889_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|282894_283350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210637.1|283325_283802_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210636.1|283808_285386_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_032126367.1|285389_286154_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210629.1|286207_286744_+	tim44-like domain protein	NA	NA	NA	NA	NA
WP_016210634.1|286740_287472_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_032126368.1|287580_288735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275120.1|288879_289191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664872.1|289514_290495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211898.1|290736_291360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211899.1|291687_291981_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_105962625.1|292077_292964_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046704.1|293575_293728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212296.1|293743_294472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126374.1|294580_295552_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664866.1|295583_296000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211609.1|296614_296923_+	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_032126373.1|296955_299142_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	2.7e-141
WP_016211605.1|299245_299479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|299695_300226_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211607.1|300254_300479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|300661_301477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300526.1|301585_301882_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	329457	375012	3160466	transposase	Hokovirus(33.33%)	46	NA	NA
WP_075273298.1|329457_330033_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210127.1|330085_331111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|331204_331468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|331834_332653_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|332725_335098_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_016210125.1|335810_337238_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|337272_338295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|338311_338689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126491.1|339046_339364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210122.1|339530_340223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|340849_341824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|341813_343586_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|343586_343934_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_032126493.1|344183_345410_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|345499_346798_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664834.1|346831_347191_-	VUT family protein	NA	NA	NA	NA	NA
WP_080664833.1|347236_347581_-	VUT family protein	NA	NA	NA	NA	NA
WP_016210137.1|347561_348113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664832.1|348339_349638_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|349754_350045_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_016212281.1|350356_351811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|352010_352586_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|352531_352897_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212359.1|353632_353851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|354218_355193_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212044.1|355731_355986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|356708_357695_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|357832_358027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664870.1|358709_359357_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_129556444.1|359349_359772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211797.1|359933_361337_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|361387_361963_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|361908_362223_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556445.1|362263_363150_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126227.1|363788_364079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212008.1|364116_364815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212010.1|364831_365128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212007.1|365251_366397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273619.1|366669_367245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211273.1|367302_368136_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.0	3.5e-17
WP_016211268.1|368251_369436_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211271.1|369454_370399_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016211269.1|370703_371489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211272.1|371606_371975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211270.1|372202_373780_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_054300173.1|373950_375012_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	447625	555266	3160466	transposase,integrase,tRNA	Escherichia_phage(45.95%)	103	512779:512838	545902:546282
WP_075275004.1|447625_448489_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|448705_450265_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|450286_451321_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|451369_451939_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|452074_453046_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|453057_454635_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|454700_455687_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016210646.1|456018_457128_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|457233_458418_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|458495_460484_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|460692_460848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|461105_461405_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_075275005.1|461563_461899_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|462815_464222_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|464239_465226_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|465228_466383_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|466379_467075_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|467209_468700_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|468720_469770_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|469836_471231_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|472109_474041_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|474045_474576_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|474610_474805_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|474847_475207_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|475626_476622_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_032126132.1|476634_479016_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|479021_479309_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|479580_480057_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|480201_480399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|480523_481498_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|482398_482497_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210477.1|482981_484271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126626.1|484507_485200_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|485241_486015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|486016_486958_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|487090_488668_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|488877_490635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|491183_491942_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|492149_492722_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|492825_493374_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|493675_493921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|493949_494246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|494513_495437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556451.1|495915_496173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275008.1|496236_496965_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	3.3e-43
WP_098082828.1|497279_497537_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275009.1|497668_498376_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.8	1.3e-44
WP_075275011.1|498419_499148_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.2e-42
WP_032126799.1|499339_500152_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_129556452.1|501272_501620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|501622_503362_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300501.1|503866_504595_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_016212066.1|504955_505732_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016212069.1|505943_506111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212070.1|506085_506685_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_054300500.1|507094_507823_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_054300501.1|508171_508900_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|508911_509304_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|509300_509546_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300307.1|510649_511378_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300307.1|511984_512713_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
512779:512838	attL	GATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCG	NA	NA	NA	NA
WP_016212268.1|513357_513942_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|513945_514629_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|514911_515640_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_052104629.1|515976_517002_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212159.1|517145_517343_-	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_016212158.1|517610_518525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275019.1|518634_519339_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	9.2e-43
WP_105962625.1|519302_520189_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211714.1|520563_523908_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_144019196.1|523940_524597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|524652_525381_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_075275021.1|525448_526390_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556625.1|526604_527162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126478.1|527154_527493_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.7e-24
WP_032126479.1|527479_527833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212114.1|527829_528060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212110.1|528063_528534_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	62.5	7.6e-33
WP_054300201.1|529180_529909_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_016212024.1|530304_530553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212021.1|530549_531149_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|531148_531367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|531853_532846_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|532842_533577_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_129556453.1|533996_534428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047116.1|534572_534752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|535453_536182_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_051307368.1|536839_538120_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|538119_539088_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_032126737.1|541599_542328_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_032126738.1|542528_542801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|542793_543072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212425.1|543275_543866_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.4	1.1e-20
WP_032126150.1|544014_544248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|544346_545321_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_075275025.1|546836_548852_-	DUF1561 family protein	NA	NA	NA	NA	NA
545902:546282	attR	GATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTTTTTCAAAAAGGCAATCGCCCAACCTTATGTGAAATCACCGCGTGTTGTGAATGTCGACAAGCACGCTTCATTTCCACCCGCTCACCAAAAAGCCAAAGATGAAGGTCTCTTTTCTAGTCAGTGTAAACTCAGGCGAGTGAAGTATTTAAACAACTGCATTGAAAATGATCACAAAGCGGTAAAGCGCAAATCCCGTTTCCGCCAATGGTACCAATCACTTTCTACAGCACGGCCTACCATTGACATAATGGAAGCGATGCGCATGGTTCAAAAAGGTCAATTACGTTATATTAAAAAACAGAATATCTGTGCC	NA	NA	NA	NA
WP_016211807.1|549101_549323_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728351.1|549210_549369_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556454.1|549632_551645_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_075275029.1|551813_552542_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	9.6e-43
WP_075275032.1|553285_554095_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	1.1e-15
WP_032126239.1|554145_554418_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|554429_555266_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
>prophage 7
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	560194	604161	3160466	transposase,tRNA	Escherichia_phage(22.22%)	47	NA	NA
WP_054300202.1|560194_560923_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211235.1|561417_561855_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|562284_563673_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211238.1|564115_565609_+	amino acid permease	NA	NA	NA	NA	NA
WP_129556456.1|565810_566560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556457.1|566603_567542_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016211244.1|567525_568221_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_036776715.1|568622_569351_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|569444_570110_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|570174_571131_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|571389_572088_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|572130_573243_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|573847_574423_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|574368_574734_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|574821_575172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|575907_576969_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212545.1|577344_577575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210908.1|578469_579285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|579375_580359_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|580529_581051_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_016210914.1|581084_581336_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210909.1|581341_582619_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|583311_583839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|583958_586271_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|586399_587215_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|587412_587877_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275036.1|588006_589068_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|589328_589625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|589907_591371_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|591373_592426_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211494.1|592415_592871_+	arginine repressor	NA	NA	NA	NA	NA
WP_016211487.1|592895_593219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|593566_593878_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_032126201.1|594007_594754_+	lipoprotein	NA	NA	NA	NA	NA
WP_054300148.1|594775_595837_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|595947_596922_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126197.1|597062_598016_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|598129_598327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047032.1|598539_598773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212072.1|598802_599000_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212074.1|599086_599308_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|599334_599700_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275038.1|599645_600236_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046713.1|600373_600538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|600832_602269_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|602310_603762_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|603873_604161_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	640122	740751	3160466	protease,plate,transposase,tRNA	Prochlorococcus_phage(17.65%)	104	NA	NA
WP_016209523.1|640122_641472_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|641522_641960_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|642221_643733_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_032126188.1|643738_644965_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|644958_645987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|645964_646657_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_016209516.1|646661_648131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556464.1|648120_648612_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|648617_650090_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|650089_650488_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|650484_652173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|652154_653111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|653153_653669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|653773_654706_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|654925_655312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|655328_655973_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|656153_656993_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|657068_657671_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|657671_658526_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|658882_659194_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|659218_660610_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|660765_661497_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_129556465.1|661493_662066_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|662052_662610_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|662615_663596_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|663735_664536_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_129556466.1|664539_665307_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|665303_665768_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|665790_666444_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|666447_666795_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|666828_667080_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|667154_668423_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|668425_669184_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|669245_670136_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|670186_670870_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|670955_671213_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_075275046.1|671485_673699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|673690_674563_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|674730_676560_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|676723_677365_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|677606_678137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|678154_678328_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|678386_679436_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|679442_680393_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|680446_681391_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|681418_682156_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|682244_682487_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|682561_683785_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|683816_684665_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|684661_685714_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|685834_686455_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_016210407.1|686470_687457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080743011.1|687567_688023_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556469.1|687982_688291_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|689084_689990_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275050.1|690065_690761_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275052.1|690905_691415_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|691464_691674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|692908_693355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|693358_693934_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275054.1|693879_694245_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|694365_694551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|694654_695689_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|695685_696396_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|696870_697389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|697506_697839_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209920.1|697868_700823_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209912.1|700868_701366_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|701425_701842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|701933_702794_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|702876_703443_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|703475_704330_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_016209914.1|704371_707278_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|707338_707536_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|707542_708553_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|708549_709608_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|709601_710402_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|710404_711223_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|711234_712182_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|712189_713491_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|713669_714773_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|714769_715162_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|715173_716550_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|716543_718013_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209916.1|718204_719176_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	3.7e-34
WP_129556470.1|719412_720299_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|720598_720844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|721392_722127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|722251_723313_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|723635_724340_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|724433_725147_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|725229_726321_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|726392_726974_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|726979_727606_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|727702_728638_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|728997_729669_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210598.1|729810_730470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|730638_731898_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|731894_732980_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|732972_733854_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|733842_735093_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_075275125.1|736684_737728_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|739864_740230_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|740175_740751_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	776181	822867	3160466	transposase,tRNA	Staphylococcus_phage(28.57%)	39	NA	NA
WP_016209374.1|776181_777633_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|777668_779198_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_016209380.1|779773_780196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556473.1|780328_781417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126585.1|781958_782879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|783229_784045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|784336_787027_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_080664814.1|787275_788496_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|788663_790370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|790968_792195_+	MFS transporter	NA	NA	NA	NA	NA
WP_075274832.1|792777_793752_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_075273456.1|793874_794174_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|794133_794589_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212416.1|794590_795121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212417.1|795244_795490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|795540_795906_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|795851_796427_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052047106.1|796500_796977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|797692_798058_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|798003_798579_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300173.1|798605_799667_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556627.1|799719_800325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211819.1|800543_800774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|801070_801571_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|801773_803030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211822.1|803386_803800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|804109_805171_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275065.1|805470_806145_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.9e-10
WP_016212172.1|807035_808508_+	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|808527_809502_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|809652_809928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|810093_810714_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_016210737.1|811032_813009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|813164_814622_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|814690_816271_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210744.1|816311_816797_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|816893_820790_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|820796_821120_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300173.1|821805_822867_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	839554	894007	3160466	protease,transposase	Staphylococcus_phage(15.38%)	45	NA	NA
WP_033923708.1|839554_840430_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|840685_841330_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|841360_843166_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|843189_843765_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556476.1|844309_845320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|845415_846390_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016209640.1|846808_847828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|848286_849252_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|849296_849872_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|849902_851177_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|851803_852517_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|852596_853334_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|853454_854810_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|854986_855658_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|855773_856649_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|857252_858557_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|858669_859275_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|859356_860658_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|860725_863158_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|863261_863534_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_032126162.1|863637_865515_+	SurA domain-containing protein	NA	NA	NA	NA	NA
WP_016209643.1|865546_866431_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|866439_866835_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|867262_869410_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|869381_870731_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|870727_872848_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|872844_874548_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209654.1|874666_875809_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|875873_876902_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_129556477.1|877061_878543_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|878632_879118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275067.1|879450_880518_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273512.1|881273_881618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|881754_882729_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126362.1|882900_883266_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051307360.1|884105_885035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211512.1|886126_886933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|887275_889168_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|889454_889859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923634.1|890063_890612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|890601_891488_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|891826_892237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556479.1|892450_892633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274918.1|893120_893486_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|893431_894007_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	900257	963094	3160466	transposase,integrase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(14.29%)	58	892617:892676	909901:910340
892617:892676	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_032126152.1|900257_900848_-|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016212424.1|901050_901329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|901321_901594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|901738_902821_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211300.1|902871_903912_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_129556480.1|904423_909913_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|909936_910911_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
909901:910340	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTA	NA	NA	NA	NA
WP_016212302.1|911224_911524_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_129556481.1|911708_912140_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_054300162.1|912397_913480_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211579.1|913703_914189_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|914256_915165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211581.1|915441_916212_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.9	8.9e-31
WP_016211585.1|916330_916888_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016211582.1|916949_917729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|917826_918180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|918246_918441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|918456_918801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|919158_919734_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|919679_920045_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275068.1|920129_920720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047108.1|920821_921220_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212107.1|922031_923168_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046716.1|923572_923719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|924416_924971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|925407_925590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210541.1|925654_925882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|926112_926859_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|927085_927379_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|927450_928056_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|928204_929182_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_032126547.1|929278_930721_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|930747_931401_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_016210552.1|931525_932092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|932446_934225_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_016210542.1|934296_936003_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.9	2.5e-25
WP_054300262.1|935994_936285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|936747_937113_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|937058_937634_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|937637_938012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275071.1|938387_939362_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_054300264.1|939464_939803_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300265.1|939947_940208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556469.1|940167_940476_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556484.1|940977_942438_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_016211426.1|942781_944224_+	MFS transporter	NA	NA	NA	NA	NA
WP_075273490.1|945206_946499_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_054300148.1|946739_947801_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556485.1|947953_950512_+	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.6	6.3e-73
WP_032126554.1|950531_951617_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_016210417.1|952058_952496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210423.1|952492_953377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210416.1|953466_953997_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_016210420.1|954067_955246_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.1	2.0e-50
WP_016210425.1|955394_959243_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_016210422.1|959229_960732_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_016210418.1|961282_961918_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_081377899.1|962230_963094_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	967166	1070347	3160466	transposase,tRNA	uncultured_Mediterranean_phage(11.11%)	110	NA	NA
WP_075275075.1|967166_968228_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|968222_968393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|968382_968547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|968603_968969_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|968990_969359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210898.1|970270_970621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|970709_971000_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|971474_971777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210897.1|972117_973098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|973176_974514_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|974632_975004_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|975224_975875_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|975917_977000_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|977053_978937_+	APC family permease	NA	NA	NA	NA	NA
WP_032126790.1|979436_980342_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275077.1|980426_981263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212218.1|981407_981758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|983208_984270_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|984395_985478_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_032126801.1|986148_986658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275079.1|986705_987767_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556488.1|987915_988765_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126540.1|989914_990778_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|991658_992024_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|991969_992545_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|992775_993141_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|993086_993662_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126869.1|994182_994422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|994399_995461_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212290.1|995577_996903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|996906_997793_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212326.1|998018_998216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122941816.1|998302_998611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212323.1|998687_998960_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_075274676.1|999034_999232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046717.1|999390_999540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|1001796_1003833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664853.1|1004556_1006299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211090.1|1006258_1007893_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|1007905_1008949_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|1008927_1009389_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_016211081.1|1009429_1010365_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211087.1|1010392_1011388_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211088.1|1011607_1012570_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126778.1|1012748_1012943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075285940.1|1013157_1013979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377357.1|1014063_1014465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212611.1|1014948_1015269_+	histidine kinase	NA	NA	NA	NA	NA
WP_075275084.1|1015316_1016378_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212519.1|1016452_1016833_+	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_052047081.1|1017103_1017541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212356.1|1017591_1018437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275086.1|1018414_1019413_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1019373_1019739_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1019684_1020260_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1020629_1021604_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016212585.1|1021715_1022036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212621.1|1022330_1022735_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_075273327.1|1022731_1023307_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1023252_1023618_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126498.1|1023679_1024240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211126.1|1024372_1024762_-	lipoprotein	NA	NA	NA	NA	NA
WP_016211125.1|1024931_1025762_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211128.1|1025984_1026890_-	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211119.1|1027053_1027815_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211122.1|1027818_1028685_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126499.1|1028781_1029393_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211118.1|1029771_1031019_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126500.1|1031155_1031872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275089.1|1032005_1032338_-	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	37.3	8.0e-05
WP_129556631.1|1032482_1032650_-	phosphatase	NA	NA	NA	NA	NA
WP_075275091.1|1033658_1034144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|1034414_1034825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300412.1|1034969_1035284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210280.1|1035520_1036615_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_016210284.1|1036696_1037218_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210276.1|1037272_1037749_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210275.1|1037804_1038107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210273.1|1038171_1038879_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210274.1|1039251_1039650_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_032126334.1|1039689_1040121_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210271.1|1040131_1040815_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1040899_1043095_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_129556492.1|1043192_1043936_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210283.1|1043963_1044749_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_016210272.1|1044788_1045499_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210279.1|1045486_1046653_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210277.1|1046706_1047540_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210270.1|1047609_1050597_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210281.1|1050638_1052030_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210269.1|1052043_1052394_-	L,D-transpeptidase catalytic domain protein	NA	NA	NA	NA	NA
WP_032126362.1|1052431_1052797_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1052742_1053318_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664860.1|1053281_1053719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211367.1|1053874_1054657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126330.1|1054804_1055764_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_032126331.1|1055818_1057828_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_016211366.1|1057883_1058171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126332.1|1058423_1059623_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_075273327.1|1060269_1060845_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1060790_1061156_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|1061289_1062153_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1062383_1062677_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556495.1|1063657_1063915_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211589.1|1064037_1065270_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_016211592.1|1065259_1065922_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_129556496.1|1066196_1067435_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_032126329.1|1067620_1068250_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211588.1|1068325_1069027_+	cyclase family protein	NA	NA	NA	NA	NA
WP_105962623.1|1069194_1070347_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 13
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	1099804	1142864	3160466	transposase,tRNA	Tupanvirus(28.57%)	40	NA	NA
WP_075275097.1|1099804_1100380_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1100325_1100691_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300408.1|1100741_1101398_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_080664854.1|1101734_1102316_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_032126179.1|1102273_1102525_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_016211113.1|1102554_1103880_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_016211112.1|1103935_1104583_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211115.1|1104775_1106728_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211114.1|1106860_1109791_+	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_075274672.1|1110156_1110750_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1110921_1111287_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1111232_1111808_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1111821_1112112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1112057_1112633_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212254.1|1112622_1114065_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016212252.1|1114102_1114261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|1114575_1115301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|1115505_1115877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211395.1|1116233_1116569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779999.1|1116484_1116916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211393.1|1116935_1118492_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_016211391.1|1118503_1119079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728317.1|1119145_1122511_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275098.1|1122701_1123631_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-24
WP_129556498.1|1124143_1124752_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210596.1|1124748_1126689_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.1e-72
WP_016210594.1|1126824_1127478_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210595.1|1127654_1128833_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210588.1|1129200_1130526_+	fimV domain protein	NA	NA	NA	NA	NA
WP_032126176.1|1130616_1131399_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210587.1|1131500_1132361_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_016210590.1|1132535_1133798_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210593.1|1133877_1134408_+	colicin V production protein	NA	NA	NA	NA	NA
WP_016210586.1|1134429_1135935_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210592.1|1135947_1136604_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016212005.1|1136993_1138754_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_129556499.1|1139654_1140807_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_032126856.1|1141112_1141454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377901.1|1141514_1142225_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275102.1|1142405_1142864_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	1196849	1249530	3160466	protease,transposase,tRNA	Klosneuvirus(28.57%)	48	NA	NA
WP_016209838.1|1196849_1197743_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|1197742_1198957_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|1198976_1200263_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|1200278_1200533_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016209830.1|1200768_1202136_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|1202466_1203489_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_032126640.1|1204011_1205487_+	APC family permease	NA	NA	NA	NA	NA
WP_129556633.1|1205703_1206600_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209827.1|1206918_1208478_+	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_016209841.1|1208553_1208748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209831.1|1208967_1209666_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|1209944_1210208_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209848.1|1210514_1213109_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209835.1|1213105_1213588_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209844.1|1213565_1214606_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209840.1|1214778_1215264_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_032126641.1|1215371_1217942_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_032126642.1|1217977_1218439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|1218508_1218715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|1219918_1220458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|1221117_1222602_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|1222726_1224262_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|1224495_1224861_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556501.1|1224806_1225382_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_059372539.1|1225414_1226278_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080728346.1|1226295_1226628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046723.1|1227535_1227691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|1227849_1228155_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_016210929.1|1228189_1228546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046724.1|1228542_1228710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210921.1|1228934_1229519_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_016210925.1|1229610_1230297_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.5	9.7e-29
WP_032126561.1|1230420_1231605_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210917.1|1231818_1233261_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	5.4e-21
WP_016210927.1|1233385_1234336_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210930.1|1234396_1235170_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210918.1|1235173_1235923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210926.1|1236007_1237477_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_129556502.1|1237736_1238300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273571.1|1238408_1239086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211012.1|1239235_1239808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211008.1|1239916_1241419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211010.1|1241511_1243941_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_016211011.1|1244219_1245416_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_016211013.1|1245476_1247843_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_032126565.1|1248160_1248433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1248643_1249009_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1248954_1249530_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	1254066	1431301	3160466	transposase,tRNA	Bacillus_phage(11.76%)	169	NA	NA
WP_081007040.1|1254066_1254723_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210510.1|1254753_1255482_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_016210506.1|1255474_1256713_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210512.1|1256848_1257886_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210515.1|1257939_1258842_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210514.1|1258950_1260204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1260261_1263759_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075273576.1|1263818_1264547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|1264674_1265223_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016210508.1|1265543_1267241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556503.1|1267249_1268116_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	5.6e-58
WP_032126637.1|1269177_1269471_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032127044.1|1270372_1270573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1270776_1271838_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047029.1|1271910_1272252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1272419_1272785_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|1272730_1273306_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211467.1|1273380_1273947_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_032126344.1|1273949_1275038_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032126343.1|1275158_1275971_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_016211471.1|1276101_1278087_+	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
WP_016211470.1|1278146_1278800_-	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_129556505.1|1279566_1280532_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1280572_1281547_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212421.1|1282297_1282480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1282971_1283337_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1283282_1283858_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556507.1|1283847_1284534_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.3	5.5e-48
WP_032126637.1|1284650_1284944_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556508.1|1285005_1285449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300380.1|1285719_1286376_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1286477_1286843_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1286788_1287364_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212483.1|1287360_1288158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1288168_1289251_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300173.1|1289553_1290615_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211841.1|1291474_1291927_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211839.1|1292044_1293517_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|1293675_1294140_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|1294610_1294784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274832.1|1295095_1296070_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_032126143.1|1296169_1297441_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_016211422.1|1297529_1298000_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_051307357.1|1298022_1298616_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211417.1|1298752_1299802_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_016211415.1|1299825_1300749_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1300765_1301227_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211414.1|1301334_1302153_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_129556449.1|1302368_1302875_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1302889_1303255_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377858.1|1303458_1304169_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300382.1|1304387_1304810_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046725.1|1305026_1305167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1305210_1306185_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075274829.1|1306208_1306481_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1306492_1307329_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126139.1|1309997_1310927_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_016210804.1|1310933_1312853_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126141.1|1312917_1314192_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210805.1|1314601_1315273_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_016210808.1|1315281_1316133_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210803.1|1316310_1317609_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_054300162.1|1317683_1318766_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212040.1|1318969_1320319_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_016212039.1|1320495_1321053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133287.1|1321241_1321640_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075274828.1|1321741_1323064_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.2e-11
WP_054300384.1|1323472_1324288_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212251.1|1324449_1324986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212250.1|1325147_1325798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126600.1|1325920_1326442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|1326713_1326896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1327245_1328523_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_080664858.1|1328519_1328657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211223.1|1329168_1330770_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211221.1|1330786_1331929_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211218.1|1332181_1332919_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|1332943_1334215_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_075274826.1|1334471_1335377_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211680.1|1335607_1338007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211682.1|1338054_1339737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209976.1|1340606_1340840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126209.1|1341040_1341661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209969.1|1341627_1342593_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016209951.1|1342583_1342994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209957.1|1343000_1343336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556634.1|1343336_1343879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209950.1|1344183_1344975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209973.1|1345011_1348116_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_016209965.1|1348145_1348943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209956.1|1348947_1351938_-	ATPase AAA	NA	NA	NA	NA	NA
WP_016209975.1|1351943_1352375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209972.1|1352425_1352992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126210.1|1352991_1354035_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_016209954.1|1354040_1354565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209953.1|1354586_1356893_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_016209962.1|1356944_1357184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209958.1|1357185_1358313_-	type II/IV secretion system family protein	NA	NA	NA	NA	NA
WP_016209964.1|1358312_1359065_-	dotC-like type IV secretion system protein	NA	NA	NA	NA	NA
WP_051307320.1|1359057_1359564_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_016209959.1|1359588_1359996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556635.1|1360023_1361031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209971.1|1361089_1361995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209955.1|1362001_1363195_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_032126212.1|1363191_1364100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211310.1|1365346_1366060_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SEW9	Cyanophage	39.1	2.2e-39
WP_016211308.1|1366135_1366414_-	lipoprotein	NA	NA	NA	NA	NA
WP_032126213.1|1366443_1367334_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_016211307.1|1367418_1367892_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_016211313.1|1368027_1368549_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016211309.1|1368589_1369384_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016211305.1|1369386_1369668_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211306.1|1369664_1370618_-	pentapeptide repeats family protein	NA	NA	NA	NA	NA
WP_016211312.1|1371323_1372070_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075274825.1|1372191_1373253_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1373530_1373803_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1373814_1374651_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_016211999.1|1375030_1375384_+	ras family protein	NA	NA	NA	NA	NA
WP_016211998.1|1375373_1375937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|1376067_1376796_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|1376915_1377194_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_129556636.1|1378147_1378456_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016210889.1|1378473_1381320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210887.1|1381829_1382780_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210886.1|1382862_1383642_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210883.1|1383710_1384418_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210888.1|1384378_1384630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1384652_1384949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1385482_1386256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1386288_1386885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210885.1|1386942_1387824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1388165_1388432_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300400.1|1388576_1388819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1388875_1389403_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|1390068_1390263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1390476_1390830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1391161_1391782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211823.1|1391822_1392011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274823.1|1392045_1396056_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211770.1|1396255_1397389_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|1397402_1397591_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_075274822.1|1397883_1398858_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016209929.1|1400316_1401210_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|1401318_1402236_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209943.1|1402287_1403043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|1403110_1404385_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209927.1|1404519_1405197_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209944.1|1405397_1406825_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|1406799_1407438_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|1407647_1407926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|1408159_1409104_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_032126634.1|1409125_1410994_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|1411014_1411368_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_016209936.1|1411406_1412522_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.6	1.4e-93
WP_016209932.1|1412704_1413745_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|1413747_1414782_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|1414778_1415840_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|1415951_1417424_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209937.1|1417576_1418020_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209940.1|1418095_1420867_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_016209946.1|1421023_1422253_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1422279_1422942_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|1423463_1423964_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556510.1|1424065_1425169_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	7.3e-10
WP_033923779.1|1425692_1426529_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1426540_1426813_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211806.1|1427602_1428328_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_016211805.1|1428370_1429909_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211804.1|1429915_1431301_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
>prophage 16
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	1458151	1494671	3160466	protease,transposase,integrase	Leptospira_phage(33.33%)	41	1450689:1450748	1504999:1505256
1450689:1450748	attL	TCGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGC	NA	NA	NA	NA
WP_098082828.1|1458151_1458409_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774189.1|1458408_1459416_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_051307372.1|1459463_1459853_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016212275.1|1459968_1460952_+	MFS transporter	NA	NA	NA	NA	NA
WP_129556512.1|1460941_1461517_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300363.1|1461462_1461810_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212589.1|1462233_1462671_+	MFS transporter	NA	NA	NA	NA	NA
WP_129556637.1|1463145_1463925_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016210843.1|1464539_1464770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210844.1|1464856_1465984_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_122941824.1|1466168_1467905_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_032126340.1|1467985_1468747_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556514.1|1469026_1471483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1471634_1472408_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016210841.1|1472466_1472838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1473051_1474026_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126239.1|1474110_1474383_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1474394_1475231_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_081377864.1|1475244_1475484_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211148.1|1475565_1476894_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1477157_1477727_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211151.1|1477742_1478054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1478063_1479020_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1479132_1479486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211153.1|1479489_1480554_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211145.1|1480554_1482294_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211152.1|1482300_1482723_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211144.1|1482706_1483336_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075273474.1|1483892_1484867_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_075274844.1|1485047_1485299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1485307_1486144_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1486155_1486428_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556515.1|1486446_1486806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046727.1|1487631_1487976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1488219_1489194_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075275108.1|1489170_1489776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556516.1|1490134_1490638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1490732_1491005_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1491016_1491853_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_080664876.1|1492165_1494028_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_081377865.1|1494386_1494671_+|transposase	transposase	transposase	NA	NA	NA	NA
1504999:1505256	attR	TCGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTACGTGCCTTGAATCGGCACACTCCACTACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGCCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCA	NA	NA	NA	NA
>prophage 17
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	1498501	1558047	3160466	transposase,tRNA	Staphylococcus_phage(18.75%)	52	NA	NA
WP_075274847.1|1498501_1499377_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212011.1|1499610_1500732_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_016212013.1|1500953_1501337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|1501352_1502030_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300271.1|1502266_1503241_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300271.1|1503888_1504863_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556517.1|1505260_1505548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1505566_1506403_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1506414_1506687_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274849.1|1506812_1507556_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212348.1|1507550_1508780_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_016211994.1|1510198_1510735_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_032126537.1|1510771_1510957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211991.1|1511197_1512103_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126538.1|1513011_1514430_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_081007034.1|1514694_1514979_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_080728343.1|1514960_1515101_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_016211561.1|1515182_1519049_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_016211564.1|1519214_1520090_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211563.1|1520122_1520284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274852.1|1520494_1520938_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1521066_1522041_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_052047138.1|1522303_1522537_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126690.1|1528584_1529067_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_016210112.1|1529760_1531188_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_122943012.1|1531304_1531760_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210108.1|1531945_1533211_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_016210114.1|1533303_1534563_+	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210107.1|1534634_1534907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210101.1|1535196_1536693_-	flagellin domain protein	NA	NA	NA	NA	NA
WP_016210113.1|1537115_1538165_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210110.1|1538352_1539108_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_016210102.1|1539168_1540758_-	APC family permease	NA	NA	NA	NA	NA
WP_016210106.1|1540940_1542032_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210105.1|1542051_1542372_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210099.1|1542455_1543733_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_017377579.1|1543754_1544591_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210111.1|1544597_1546232_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_016210117.1|1546652_1547012_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210103.1|1547293_1548652_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_081377868.1|1548727_1549384_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211627.1|1549689_1549854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211632.1|1550079_1550934_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211634.1|1550969_1551791_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211631.1|1552046_1552853_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_155046729.1|1553111_1554158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|1554375_1554669_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_075273327.1|1554744_1555320_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1555265_1555631_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556520.1|1555591_1556488_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.8e-54
WP_129556521.1|1556438_1556627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1557160_1558047_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	1568312	1624449	3160466	transposase,tRNA	Staphylococcus_phage(13.33%)	48	NA	NA
WP_075273804.1|1568312_1568651_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1568610_1569066_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212267.1|1569232_1569592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1569872_1570520_+	LysE family translocator	NA	NA	NA	NA	NA
WP_155046730.1|1570787_1570928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274856.1|1571146_1572172_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211733.1|1573927_1574752_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_016211731.1|1574807_1575914_-	protein kinase	NA	NA	NA	NA	NA
WP_016211734.1|1575929_1576199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1576620_1577319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211398.1|1577923_1578211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211399.1|1578357_1579101_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211403.1|1579114_1580158_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211405.1|1580293_1582066_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_129556522.1|1582272_1583505_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211669.1|1586613_1586964_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211666.1|1587118_1589938_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211664.1|1590310_1591039_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211555.1|1591575_1592934_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_032126677.1|1593008_1593572_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211557.1|1593766_1594996_-	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_016211554.1|1595041_1595668_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_032126678.1|1595994_1597005_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_075274857.1|1597015_1597891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274858.1|1599470_1600556_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1600692_1601058_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1601003_1601579_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1602269_1603244_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1603798_1604860_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1604957_1605932_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_129556523.1|1606267_1607153_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209772.1|1608172_1608724_-	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_016209778.1|1608742_1609117_-	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209796.1|1609147_1610365_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_080664823.1|1610388_1611789_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209795.1|1611769_1612525_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_016209793.1|1612565_1614014_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_032126436.1|1614029_1614485_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209771.1|1615191_1615914_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016209791.1|1616078_1616801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307317.1|1616937_1617231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209798.1|1617292_1619317_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_016209769.1|1619329_1620073_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_017377132.1|1620114_1620498_-	response regulator	NA	NA	NA	NA	NA
WP_016209784.1|1620584_1621307_-	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_129556524.1|1621303_1622191_-	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_032126239.1|1623328_1623601_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1623612_1624449_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
>prophage 19
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	1636414	1692207	3160466	transposase	Staphylococcus_phage(42.86%)	56	NA	NA
WP_081377870.1|1636414_1636933_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	31.0	1.6e-07
WP_081007030.1|1636968_1637940_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307341.1|1638633_1640232_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_016210848.1|1640398_1641583_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1641878_1642433_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210850.1|1642681_1643935_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210851.1|1643919_1644591_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210847.1|1644613_1645618_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210849.1|1645646_1647095_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210855.1|1647212_1648190_+	DMT family transporter	NA	NA	NA	NA	NA
WP_129556525.1|1648343_1649163_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1649239_1650214_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212475.1|1650411_1650618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211182.1|1651602_1651932_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_032126448.1|1651963_1652344_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211178.1|1652434_1653463_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016211180.1|1653525_1653990_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_032126449.1|1654010_1654934_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016211185.1|1655000_1655609_+	smr domain protein	NA	NA	NA	NA	NA
WP_032126450.1|1655721_1657716_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211177.1|1658083_1659304_+	amino acid permease	NA	NA	NA	NA	NA
WP_016212445.1|1659518_1659785_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_129556526.1|1659781_1660567_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	1.3e-45
WP_075274822.1|1660625_1661600_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016211736.1|1661623_1661824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211739.1|1661940_1662447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126783.1|1662557_1663799_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211741.1|1663944_1664721_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211738.1|1665197_1665842_-	membrane protein	NA	NA	NA	NA	NA
WP_032126790.1|1665912_1666818_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1667779_1668118_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1668077_1668533_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126602.1|1668685_1669993_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211857.1|1670243_1671122_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016211855.1|1671118_1671586_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|1671712_1671898_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_054300271.1|1672113_1673088_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556640.1|1673354_1674581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211351.1|1674656_1674995_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_032127067.1|1674991_1675594_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211349.1|1675590_1677585_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211350.1|1677648_1678587_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211352.1|1679265_1679706_+	universal stress protein	NA	NA	NA	NA	NA
WP_155046737.1|1679879_1680632_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210793.1|1680633_1681314_+	OmpW family protein	NA	NA	NA	NA	NA
WP_016210801.1|1681636_1682608_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210795.1|1682589_1683561_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_051307339.1|1683666_1684473_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210791.1|1684847_1685048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210799.1|1685474_1686428_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_129556527.1|1686889_1687150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273540.1|1687334_1687946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210800.1|1688312_1689140_+	DsbA family protein	NA	NA	NA	NA	NA
WP_080750117.1|1689275_1690916_+	APC family permease	NA	NA	NA	NA	NA
WP_052047040.1|1690941_1691880_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1691949_1692207_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	1698375	1753633	3160466	transposase,tRNA	Pseudomonas_phage(25.0%)	45	NA	NA
WP_075273327.1|1698375_1698951_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212185.1|1699044_1700034_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1700367_1700553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1701232_1703188_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016210749.1|1703486_1703948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210752.1|1704117_1704915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556641.1|1707291_1708554_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_032126362.1|1712428_1712794_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1712739_1713315_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211454.1|1713455_1713926_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_016211452.1|1714676_1716164_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211455.1|1716225_1717683_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_122942091.1|1717788_1718184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1718211_1718790_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_054300325.1|1719411_1719684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046732.1|1719877_1720048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274862.1|1720162_1720759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1720930_1721524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211728.1|1721911_1723846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1723884_1724799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1726369_1726636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1726712_1727369_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1727543_1727999_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1727958_1728297_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556531.1|1728259_1728457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211752.1|1728661_1729807_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211748.1|1729822_1731427_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211749.1|1731506_1732700_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_032126540.1|1732908_1733772_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075274864.1|1736992_1738018_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047087.1|1738189_1738408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211462.1|1738568_1739549_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211465.1|1740176_1741160_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211464.1|1741310_1741658_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_032126752.1|1741654_1742257_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211466.1|1742344_1743865_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126753.1|1743934_1744399_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_032126362.1|1744491_1744857_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1744802_1745378_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212485.1|1746130_1746664_+	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_129556532.1|1746960_1747143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664820.1|1747451_1747622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209620.1|1747604_1750661_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209619.1|1750747_1752196_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209621.1|1752628_1753633_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	1783255	1827386	3160466	transposase,integrase	Acinetobacter_phage(16.67%)	46	1782199:1782258	1811971:1812261
1782199:1782258	attL	AAACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGA	NA	NA	NA	NA
WP_081377829.1|1783255_1783990_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_129556535.1|1784434_1785320_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1785510_1785768_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377871.1|1785972_1786665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556536.1|1786667_1787821_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274872.1|1787780_1788320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274873.1|1788794_1789292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1789313_1789679_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1789624_1790200_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274874.1|1790200_1790569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126786.1|1790867_1793948_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016211319.1|1793965_1795018_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211316.1|1795550_1796201_+	porin family protein	NA	NA	NA	NA	NA
WP_016211315.1|1796535_1797180_+	porin family protein	NA	NA	NA	NA	NA
WP_054300314.1|1797367_1797703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273532.1|1797663_1798251_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126997.1|1798468_1798708_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_032126998.1|1799029_1799377_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_036774554.1|1799475_1799754_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1799806_1800094_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1800097_1800984_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211346.1|1802133_1802775_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_016211340.1|1802802_1803024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211347.1|1803016_1804000_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211344.1|1804213_1805032_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211342.1|1805192_1806875_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.1e-32
WP_016211343.1|1806882_1807905_-	YHYH protein	NA	NA	NA	NA	NA
WP_016211341.1|1808103_1808274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1808418_1809393_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211940.1|1809506_1809839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1809959_1811219_-	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211214.1|1812981_1813545_+	hypothetical protein	NA	NA	NA	NA	NA
1811971:1812261	attR	AAACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_016211210.1|1813647_1815129_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211213.1|1815135_1815342_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211211.1|1815390_1816470_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211215.1|1816661_1818632_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211212.1|1818992_1820552_+	APC family permease	NA	NA	NA	NA	NA
WP_075274875.1|1820834_1821137_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300307.1|1821183_1821912_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_129556539.1|1821980_1822325_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211983.1|1822572_1823232_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556643.1|1823327_1824692_+	histidine kinase	NA	NA	NA	NA	NA
WP_016212551.1|1825149_1825644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|1825985_1826561_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1826506_1826797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1826810_1827386_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	1831827	1951365	3160466	transposase,integrase	Leptospira_phage(20.0%)	119	1880823:1880882	1949222:1950381
WP_075274878.1|1831827_1832703_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212202.1|1833114_1834362_+	glutaminase	NA	NA	NA	NA	NA
WP_016209473.1|1835323_1835707_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_016209489.1|1835703_1836435_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_016209497.1|1836437_1837181_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_016209492.1|1837194_1838094_-	GTPase Era	NA	NA	NA	NA	NA
WP_016209466.1|1838099_1838774_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	34.5	8.9e-27
WP_129556644.1|1839179_1840067_-	signal peptidase I	NA	NA	NA	NA	NA
WP_016209482.1|1840117_1841920_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	39.2	5.1e-21
WP_016209457.1|1842219_1842801_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_016209458.1|1842944_1844519_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_129556541.1|1844526_1844841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209486.1|1844965_1845217_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_080664819.1|1845258_1846296_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_016209471.1|1846442_1846769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209462.1|1846778_1846922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209474.1|1846931_1847342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664818.1|1847483_1847819_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016209494.1|1848500_1850525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209467.1|1850594_1851620_-	FUSC family protein	NA	NA	NA	NA	NA
WP_016209455.1|1851612_1852659_-	membrane protein	NA	NA	NA	NA	NA
WP_075273528.1|1852839_1853805_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_016209459.1|1854064_1855231_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016209478.1|1855394_1856348_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_129556645.1|1856439_1858389_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_016209490.1|1858479_1858803_-	YqcC family protein	NA	NA	NA	NA	NA
WP_016209463.1|1859229_1859613_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032126730.1|1859967_1860456_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_016209472.1|1860558_1861929_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_016209456.1|1862042_1862774_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	M1IDP9	Pelagibacter_phage	35.8	5.3e-09
WP_016209491.1|1862798_1863896_-	alanine racemase	NA	NA	NA	NA	NA
WP_016209475.1|1863928_1865350_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	1.7e-152
WP_016209484.1|1865559_1866012_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|1866023_1866251_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_016209481.1|1866300_1866627_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_052047096.1|1866829_1867519_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016209488.1|1867668_1868157_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_016209465.1|1868197_1869298_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_016209460.1|1869344_1870427_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.1	1.0e-72
WP_052133284.1|1870416_1870983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126728.1|1870973_1872278_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209485.1|1872330_1873353_-	chorismate mutase	NA	NA	NA	NA	NA
WP_080664817.1|1873377_1874151_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209496.1|1874180_1874393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209453.1|1874560_1874710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556543.1|1874819_1875302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1875393_1875666_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377873.1|1875677_1876514_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.6e-41
WP_016212058.1|1877156_1878707_-	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_075274880.1|1878862_1879828_-|transposase	transposase	transposase	NA	NA	NA	NA
1880823:1880882	attL	TATGAAAAAGAGCAAATTAAGTGAATCAAAAATCGTAGAGTTGCTTAAGCGTGTTGAGGC	NA	NA	NA	NA
WP_032126239.1|1880823_1881096_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1881107_1881944_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_098082828.1|1882441_1882699_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1882698_1883706_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212247.1|1884072_1884828_+	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1885455_1886430_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300162.1|1886769_1887852_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212246.1|1887955_1888612_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_075274882.1|1889547_1890144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556544.1|1890258_1890615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1890677_1891760_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210771.1|1891851_1895253_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_016210773.1|1895249_1897943_-	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210769.1|1898246_1899749_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_033923762.1|1900049_1900283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1900410_1901220_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_016210772.1|1901303_1902857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1902989_1903289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|1903278_1903443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|1903499_1903865_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210397.1|1904054_1906229_+	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210388.1|1906225_1906900_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210399.1|1906925_1908917_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210390.1|1908931_1909273_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_032126670.1|1909277_1909715_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210394.1|1909740_1911126_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_122940572.1|1911236_1911662_-	flaG family protein	NA	NA	NA	NA	NA
WP_032126669.1|1911780_1913358_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210398.1|1913582_1915175_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210393.1|1915375_1917577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210391.1|1917670_1918621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210396.1|1918688_1918877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211164.1|1919014_1919392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1919434_1919950_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211169.1|1919949_1920897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211168.1|1920880_1921540_-	wbqC-like family protein	NA	NA	NA	NA	NA
WP_016211165.1|1921536_1922265_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307350.1|1922254_1923001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664856.1|1922984_1924049_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_016211172.1|1924237_1925434_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211167.1|1925483_1926605_-	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	1.5e-10
WP_016211170.1|1927236_1927407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126750.1|1927565_1928363_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_129556646.1|1929678_1931064_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_016211278.1|1931115_1932375_-	threonine synthase	NA	NA	NA	NA	NA
WP_016211277.1|1932361_1933330_-	homoserine kinase	NA	NA	NA	NA	NA
WP_016211279.1|1933343_1935812_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_075274886.1|1936555_1937617_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274888.1|1937888_1938224_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081007004.1|1938228_1938684_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1938643_1938982_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|1939139_1939304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1939293_1939593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212209.1|1940048_1941050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556545.1|1941304_1941646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274890.1|1941850_1942531_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_098082828.1|1942600_1942858_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377874.1|1943026_1943494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556546.1|1943954_1945140_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	5.9e-58
WP_155046738.1|1945149_1945290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556547.1|1945566_1946127_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_054300287.1|1946535_1946865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1946886_1947252_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1947197_1947773_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274733.1|1947791_1948109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1948159_1948996_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1949007_1949280_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211421.1|1950138_1950363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1950459_1951365_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
1949222:1950381	attR	GCCTCAACACGCTTAAGCAACTCTACGATTTTTGATTCACTTAATTTGCTCTTTTTCATATGCTCTCCTGTTTGAAAATGTTAACAGAAGATTCCAGTTATGAGTTGTCTCATTTTAAGGGAGGGTTACCACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGGTTGAGGCGTTTATTGAGCGATTGACACAACATATACCAGAAAAGTTTTTCAAAATGATACGGTATTACGGCTTTTTAGCGAATCGAGTCAGAAAAACCTTGTTACCAAAAGTCTATGATTTATTAGATCAGACCATTGAAGCTGCTCAGTCTGTTACCTATTCCAGCCTGATGAAAGCCAATTATGCAGTAGATCCTCTCATTTGCATACTTTGTGGCAGTGAAATGAGACTCTCTGGATTCACAAACTCAACCCCTTTATGGCAGTTGCGTCAACATCATGAAAAGCTTGCGAAGATGAAGGAGGTCCGGCTTTAATTCAGCCTGCATAGGATTAATCCGTCCAAAAACGATAAAACGCACCATATGTGATACTTTTTGCCGATAATTAAGAATAGTTTCTGTTCTTCAGGTCAAATCTCTCAAATTTTGCTTCACTAAAAAATGATCCATTAACCCGGCTGAAACTTTCAAATTCTTCAATATTAAATTTTCAACAGAAAAACACTGTTTCTTTATTTAAAATAATAAACAAAACCATAGTGATTTTATGCAGATTAACTAATGACATTTTTTTGATTAAAAGTTTAGCTGATGTAAACTTATTAAAGACTGTTATAGCACTCAACGAATAGTTTCTGACATTGACTTCATTACTTGACTAAGCGCTGTCTCTAAATTTATTTCATCTTGATCAAGCTTCATGCGAACCCTATTTTTAAGCGGTGACCATACATGCTCTATCGGGTTTAAATCAGGAGAATAAGGGGGTAAAAATAATAAGTGACAACCCGCATCTTCAATCGCTTCCTTAACCCCTTTTGATTTGTGAAAAGAGGCATTATCCATGATTACAGTCTCTCCAGG	NA	NA	NA	NA
>prophage 23
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	2031087	2082965	3160466	protease,transposase,tRNA	Orpheovirus(20.0%)	51	NA	NA
WP_016209424.1|2031087_2032365_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209433.1|2032464_2032839_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209412.1|2032923_2033811_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209436.1|2033868_2034597_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_129556555.1|2034593_2035724_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209444.1|2035854_2036283_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_032126508.1|2036377_2036737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209447.1|2036726_2037938_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016209421.1|2037934_2038723_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209411.1|2038885_2039680_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_054300271.1|2039885_2040860_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126933.1|2041028_2042330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2042333_2042633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2042622_2042787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2042843_2043209_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211553.1|2043548_2044289_-	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_016211549.1|2044292_2046797_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211548.1|2047059_2048016_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211550.1|2047999_2048761_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_075274903.1|2048838_2049714_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2049838_2050084_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016211262.1|2050143_2052417_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_075273504.1|2052471_2052825_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|2053014_2053308_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_032126515.1|2053480_2053660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307354.1|2053735_2054311_-	DedA family protein	NA	NA	NA	NA	NA
WP_032126514.1|2054593_2055910_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2055920_2056289_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016211265.1|2056319_2056982_-	adenylate kinase	NA	NA	NA	NA	NA
WP_032126362.1|2057156_2057522_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556556.1|2057467_2058043_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126519.1|2058210_2058930_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_016211478.1|2058909_2059725_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126518.1|2059741_2061943_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211474.1|2062025_2063375_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_016211473.1|2063449_2064049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211476.1|2064032_2064242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211931.1|2064559_2065747_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211932.1|2065942_2067232_+	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_054300152.1|2067642_2068008_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210558.1|2069644_2070400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210562.1|2070473_2072126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210560.1|2073693_2075394_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_016210557.1|2075482_2076235_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016210564.1|2076237_2076699_-	amidohydrolase	NA	NA	NA	NA	NA
WP_016210559.1|2076695_2077658_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_016210566.1|2078018_2078441_-	universal stress protein	NA	NA	NA	NA	NA
WP_016210568.1|2078746_2079388_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210561.1|2079515_2080850_+	dihydroorotase	NA	NA	NA	NA	NA
WP_032126397.1|2080964_2081555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2081903_2082965_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	2090809	2135515	3160466	transposase,tRNA	Staphylococcus_phage(22.22%)	47	NA	NA
WP_129556558.1|2090809_2091703_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126170.1|2091866_2092139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211040.1|2092366_2093578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211037.1|2093928_2094558_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211042.1|2094606_2095623_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211035.1|2095869_2096085_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211043.1|2096137_2096587_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211039.1|2096666_2098412_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211036.1|2098503_2100375_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_054300271.1|2100722_2101697_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211094.1|2101716_2102040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|2103104_2105585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211092.1|2105628_2106921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307348.1|2107156_2109913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211519.1|2111068_2111488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|2111488_2112190_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|2112450_2112657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|2112886_2113192_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|2113370_2115368_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2115351_2116398_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|2117105_2117957_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|2117957_2118878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|2119288_2119573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377876.1|2119564_2120020_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2119979_2120318_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2120530_2121460_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2121616_2122045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556560.1|2122125_2122662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2122631_2123537_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2123727_2124336_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_081007013.1|2124376_2124676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2124665_2124830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274909.1|2125213_2125540_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2125638_2126214_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2126159_2126525_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556561.1|2126695_2127848_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	2.6e-58
WP_016211971.1|2128054_2128666_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2128686_2129883_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2129979_2130120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2130132_2130537_-	SufE family protein	NA	NA	NA	NA	NA
WP_075273313.1|2130662_2131001_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556562.1|2130960_2131263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|2131407_2131593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|2132162_2132744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556649.1|2132771_2133629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|2134168_2134696_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_075273327.1|2134939_2135515_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	2156714	2206462	3160466	protease,transposase,tRNA	Staphylococcus_phage(33.33%)	48	NA	NA
WP_016209884.1|2156714_2157338_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2157414_2157615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2157756_2158455_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2158601_2159171_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2159485_2160109_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2160317_2160920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|2160991_2161357_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046744.1|2161413_2161587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556564.1|2162756_2163086_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273603.1|2164242_2164419_+	phosphatase	NA	NA	NA	NA	NA
WP_129556565.1|2164542_2164938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126686.1|2166407_2166992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274914.1|2167542_2168418_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_059372565.1|2168466_2168838_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556566.1|2168746_2168950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210465.1|2169457_2170300_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2170350_2170698_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2170888_2171776_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2171890_2172493_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2172489_2173209_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_075275113.1|2173277_2174987_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_016210464.1|2175137_2177075_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2177183_2178236_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2178235_2178511_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2178591_2179140_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_155049143.1|2179456_2182051_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_016210459.1|2182215_2182734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212492.1|2182938_2183793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2183842_2184817_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_033923740.1|2184875_2185163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211720.1|2185410_2186334_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211716.1|2186347_2187271_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126595.1|2187218_2187875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|2188177_2189005_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_052133280.1|2189445_2189817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126590.1|2190009_2191542_+	nuclease	NA	NA	NA	NA	NA
WP_032126591.1|2191604_2192942_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_016210313.1|2193084_2194551_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210314.1|2194547_2195597_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_016210306.1|2195720_2197829_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|2197993_2198398_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2198458_2199184_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210307.1|2199269_2200160_+	YicC family protein	NA	NA	NA	NA	NA
WP_032126592.1|2200200_2200821_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.3	2.5e-20
WP_016210310.1|2200881_2201088_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_016210316.1|2201109_2203263_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.1e-12
WP_016210317.1|2203269_2205252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2205487_2206462_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 26
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	2212654	2258155	3160466	transposase	Staphylococcus_phage(50.0%)	52	NA	NA
WP_054300443.1|2212654_2212933_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|2212985_2213234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|2213191_2214253_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212177.1|2215248_2215422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2215498_2215756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2216830_2217406_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274918.1|2217351_2217717_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212205.1|2218400_2218580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|2218719_2220165_+	MFS transporter	NA	NA	NA	NA	NA
WP_016212319.1|2220723_2220951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2220937_2221264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2221265_2221697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|2222225_2223287_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210831.1|2223381_2223927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2224196_2225216_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2225202_2225625_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2225626_2226100_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|2226215_2226839_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|2226868_2227543_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2227548_2228697_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2228693_2229155_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2229230_2230481_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2230607_2232287_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2232396_2233263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274920.1|2234693_2235428_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	4.8e-10
WP_016211000.1|2235523_2236309_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2236452_2237139_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2237172_2237571_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2237734_2238040_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|2238117_2238372_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2238525_2240187_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2240246_2240930_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2240929_2242018_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2242066_2244703_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300237.1|2245115_2246177_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556568.1|2246366_2247848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2247884_2248460_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|2248405_2248696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2248709_2249285_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2249230_2249596_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212450.1|2249751_2250654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2250697_2251672_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211507.1|2251985_2253305_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|2253308_2254025_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|2254021_2254663_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_075274921.1|2254655_2254754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274922.1|2254731_2255028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211503.1|2255038_2255494_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|2255548_2255893_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2255922_2256966_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|2257380_2257590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2257579_2258155_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	2327358	2386969	3160466	transposase,tRNA	Planktothrix_phage(16.67%)	56	NA	NA
WP_129556571.1|2327358_2328069_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2328097_2328502_+	RidA family protein	NA	NA	NA	NA	NA
WP_016209567.1|2329617_2330235_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126712.1|2330669_2331128_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2331872_2332883_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2333367_2334279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2334604_2338099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2338136_2338976_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_016209564.1|2339162_2339378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2339426_2340002_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2339998_2340337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2340505_2341495_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2341495_2342458_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_016209559.1|2342467_2343370_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300271.1|2343413_2344388_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2344525_2344759_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2344852_2345218_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2345274_2345439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2345428_2345728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212572.1|2345785_2346178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2346307_2346673_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2346729_2347038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2347129_2347705_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2347650_2348016_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|2348168_2348441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212514.1|2348851_2348989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2349007_2349844_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2349855_2350128_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126774.1|2350283_2350619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2350778_2352311_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2352343_2353183_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2353179_2353677_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211412.1|2353680_2354673_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211408.1|2354787_2356134_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2356357_2357419_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2357497_2358643_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|2364742_2365600_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2365586_2366510_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211368.1|2366706_2368098_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2368144_2369188_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2369230_2369674_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2369806_2370997_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2371051_2371198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|2371749_2372667_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2372934_2373228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2373304_2373499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212197.1|2374517_2375435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2375900_2376743_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2376810_2377461_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|2377475_2378516_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|2378638_2379724_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2379750_2380860_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2380876_2381194_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2381190_2381550_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_080664847.1|2384881_2385835_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_075274927.1|2385907_2386969_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	2424954	2598989	3160466	protease,transposase,integrase,tRNA	Escherichia_phage(32.65%)	163	2572613:2572672	2580854:2581141
WP_036771330.1|2424954_2425929_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_129556574.1|2426225_2426579_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211760.1|2426631_2428011_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211761.1|2428117_2430109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274928.1|2430524_2431499_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	5.2e-28
WP_016209674.1|2431728_2432562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126406.1|2432745_2434224_-	nuclease	NA	NA	NA	NA	NA
WP_155049159.1|2434664_2436461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209671.1|2436543_2436771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556575.1|2436838_2437807_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_032126407.1|2437782_2438193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209685.1|2438197_2438533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556656.1|2438534_2439062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556657.1|2439547_2439988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209678.1|2440089_2443308_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_129556576.1|2443347_2444202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209670.1|2444170_2447179_-	ATPase AAA	NA	NA	NA	NA	NA
WP_032126408.1|2447181_2447607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209688.1|2447638_2448220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209684.1|2448219_2449263_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_016209692.1|2449265_2449745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047060.1|2449753_2452057_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_016209677.1|2452345_2453452_-	type II/IV secretion system family protein	NA	NA	NA	NA	NA
WP_016209693.1|2453444_2454191_-	type IV secretion system protein DotC	NA	NA	NA	NA	NA
WP_016209695.1|2454183_2454687_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_032126411.1|2454750_2455185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209680.1|2455199_2456237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209681.1|2456252_2457233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556659.1|2457238_2458384_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209676.1|2458440_2459280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209672.1|2459793_2460219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209690.1|2460321_2463009_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_016211689.1|2463595_2464735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211690.1|2464810_2466967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556660.1|2467252_2468005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211688.1|2468190_2468409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211600.1|2468557_2469076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211601.1|2469411_2469834_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	37.3	1.1e-22
WP_016211597.1|2470139_2471510_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.8	2.6e-110
WP_016211595.1|2471867_2472335_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211599.1|2472347_2473358_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_080664865.1|2473553_2474030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2474026_2474863_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2474874_2475147_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211743.1|2475213_2475576_-	ABC transporter membrane domain protein	NA	NA	NA	NA	NA
WP_129556577.1|2475562_2476591_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	4.8e-16
WP_016211744.1|2476568_2476973_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_016211742.1|2477203_2479183_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054300202.1|2479462_2480191_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300202.1|2480666_2481395_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210955.1|2482118_2482373_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2482471_2484256_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_016210956.1|2484344_2485064_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|2485246_2485453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210948.1|2485452_2485689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2485701_2486079_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2486585_2487404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210947.1|2487497_2487695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|2487789_2489175_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|2489301_2489892_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_075274930.1|2490702_2491122_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274931.1|2491151_2491880_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_032126570.1|2492637_2492937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211816.1|2492949_2493303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2493344_2494958_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2495179_2495401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274933.1|2495709_2496438_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2497054_2498152_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2498185_2499436_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_075274934.1|2499923_2500592_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.0	2.8e-41
WP_016212193.1|2500714_2501053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2501120_2501507_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2501503_2501749_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300202.1|2502157_2502886_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211625.1|2503369_2504239_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_016211621.1|2504235_2505585_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	4.6e-75
WP_016211623.1|2505697_2507338_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_016211987.1|2509159_2510896_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_129556671.1|2511399_2512128_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_098082825.1|2512191_2512500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2512492_2512825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2512828_2513398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211655.1|2513526_2513940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211652.1|2514199_2515405_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211653.1|2515512_2516538_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_054300202.1|2516629_2517358_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212214.1|2517516_2518017_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036780855.1|2517991_2518489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|2519254_2519983_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211053.1|2520025_2520592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211047.1|2520679_2522314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2522675_2523179_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2523141_2523849_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2523917_2524778_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_016211045.1|2524758_2525532_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2525562_2526816_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2526815_2527778_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2527821_2528574_+	ComF family protein	NA	NA	NA	NA	NA
WP_016210615.1|2530949_2531420_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2531465_2531705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274938.1|2531723_2532230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2532393_2533818_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|2533882_2534932_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2535198_2535978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2536021_2536924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210625.1|2536982_2537729_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_016210616.1|2537977_2540788_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_129556661.1|2541088_2541652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2541640_2542369_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2542458_2542665_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212263.1|2542827_2543421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212264.1|2543466_2544060_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	5.4e-28
WP_016212238.1|2544575_2545865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274939.1|2545894_2546623_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.8e-42
WP_087910645.1|2546735_2547888_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274940.1|2547916_2548597_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	2.0e-42
WP_016211997.1|2548952_2550062_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.5	4.4e-07
WP_016211996.1|2550063_2551011_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_075274941.1|2551394_2552123_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.2e-42
WP_075275114.1|2552152_2552515_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212339.1|2552667_2553414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274942.1|2553432_2554161_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	2.7e-45
WP_032127022.1|2554837_2557024_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2557085_2558239_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2558524_2559049_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|2559239_2559407_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|2559351_2560068_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
WP_032126817.1|2560424_2561246_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211722.1|2561255_2564558_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_016211321.1|2564938_2566099_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211323.1|2566272_2567370_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211325.1|2567359_2568880_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211322.1|2568942_2569533_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211324.1|2570068_2570623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066186.1|2571380_2571860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274945.1|2572004_2572355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|2572579_2572729_+	hypothetical protein	NA	NA	NA	NA	NA
2572613:2572672	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_016212659.1|2572873_2573119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046748.1|2573206_2573512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212294.1|2573863_2574208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274946.1|2574221_2574665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|2574886_2575111_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_016212230.1|2575166_2576615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2578148_2578337_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556589.1|2579738_2580014_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2580016_2580619_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_155046749.1|2580682_2580970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|2581514_2582594_+	hypothetical protein	NA	NA	NA	NA	NA
2580854:2581141	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_016211874.1|2582912_2584631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2584674_2585580_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_081377873.1|2586742_2587579_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.6e-41
WP_032126239.1|2587590_2587863_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046750.1|2588059_2588197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2589383_2589959_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_016210050.1|2590034_2590910_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210054.1|2590974_2591496_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210069.1|2591480_2592563_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.6e-20
WP_016210051.1|2592803_2593208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2593632_2594364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2594620_2595922_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2596063_2596732_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2597175_2597772_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2597792_2598989_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
>prophage 29
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	2627629	2662069	3160466	transposase,tRNA	Microbacterium_phage(20.0%)	38	NA	NA
WP_054300282.1|2627629_2628094_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377880.1|2628150_2628630_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2629487_2629883_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|2629879_2630674_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211756.1|2630852_2631578_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2631823_2633011_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_081377344.1|2633365_2634493_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210935.1|2634823_2635366_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2635362_2636049_-	acireductone synthase	NA	NA	NA	NA	NA
WP_016210942.1|2636052_2636664_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2636710_2637730_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2637831_2638626_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2638663_2639470_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2639548_2640598_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2640795_2642055_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2642101_2642779_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2642864_2643146_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|2643237_2644425_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_129556549.1|2644532_2645419_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210820.1|2645620_2646562_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2647065_2647290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2647581_2648286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|2648735_2649374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2649708_2650239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210821.1|2650235_2651768_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2651764_2652715_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2653134_2653767_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2654009_2654207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2654556_2654985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307340.1|2655062_2655761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274949.1|2655738_2656800_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2657024_2657321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|2657425_2658082_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2658305_2658803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377881.1|2659719_2659887_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377882.1|2659893_2660175_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2660134_2660473_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210986.1|2660530_2662069_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	1.3e-86
>prophage 30
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	2670155	2721301	3160466	transposase,tRNA	Staphylococcus_phage(37.5%)	51	NA	NA
WP_105962625.1|2670155_2671042_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212032.1|2671298_2672426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2672549_2673212_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2673303_2673549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211962.1|2673846_2674362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2674910_2675570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2675671_2676322_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|2676434_2676755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2676813_2677788_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2678038_2678260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212027.1|2678282_2679506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212028.1|2680000_2680249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2680336_2681222_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210162.1|2681907_2682945_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_032126295.1|2682975_2684430_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_016210181.1|2684439_2685624_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_016210176.1|2685697_2686705_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210183.1|2686773_2688777_-	transketolase	NA	NA	NA	NA	NA
WP_016210174.1|2689227_2690388_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	8.2e-121
WP_016210170.1|2690624_2691740_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210172.1|2691902_2692427_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.6	6.9e-51
WP_016210163.1|2692426_2692957_+	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_016210178.1|2693046_2693514_-	DoxX family protein	NA	NA	NA	NA	NA
WP_016210161.1|2694015_2694270_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210179.1|2694470_2694974_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_129556592.1|2695264_2695795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2695955_2696639_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|2696714_2697494_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_032126297.1|2697480_2698341_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210177.1|2698465_2698831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210175.1|2699216_2699546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210171.1|2699859_2701419_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	5.8e-37
WP_036771330.1|2701976_2702951_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_075274951.1|2702947_2703832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211784.1|2704385_2705108_+	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_016211783.1|2705099_2705465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|2705745_2707023_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211782.1|2707622_2707805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2707866_2708232_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2708177_2708753_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556593.1|2708749_2709391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210766.1|2709479_2709923_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_032126291.1|2709926_2710436_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210756.1|2710428_2713242_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
WP_051307336.1|2713380_2714307_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	9.4e-11
WP_016210758.1|2714464_2716003_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2716176_2716437_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_016210763.1|2716745_2717990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210755.1|2718093_2718822_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_016210761.1|2718925_2719663_+	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_075273298.1|2720725_2721301_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	2744267	2804044	3160466	protease,transposase,tRNA	unidentified_phage(33.33%)	57	NA	NA
WP_054300173.1|2744267_2745329_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2745419_2746166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274953.1|2746290_2747154_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2747397_2747760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377902.1|2747946_2748474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2748618_2749035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2750806_2751718_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2751769_2752618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2753062_2753773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2753864_2754833_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2754820_2755468_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_016210370.1|2755496_2756348_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2756362_2757640_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2757680_2758196_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210372.1|2758274_2759336_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2759357_2760446_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_016210378.1|2760490_2762326_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2762368_2762839_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2762875_2763211_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2763223_2763940_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2763876_2764893_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2764889_2765369_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2765452_2767933_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2767995_2768361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273456.1|2768738_2769038_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2768997_2769453_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2769467_2769758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210570.1|2769823_2771422_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2771552_2771888_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_016210578.1|2771915_2773580_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	7.1e-33
WP_016210581.1|2773576_2774221_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2774220_2774964_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2775022_2775262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2775412_2776780_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2776790_2777342_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2777422_2778406_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2778527_2780285_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2780507_2781098_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2781185_2781605_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_016210580.1|2781745_2782006_+	methyltransferase	NA	NA	NA	NA	NA
WP_075274955.1|2782081_2783056_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_075274956.1|2783098_2783467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2783527_2784313_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075274955.1|2785698_2786673_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212084.1|2786954_2787971_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2787970_2788486_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2788527_2789001_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_075274955.1|2789158_2790133_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212306.1|2790168_2790699_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2790728_2791184_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_129556598.1|2793733_2796247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211935.1|2797181_2799830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274958.1|2800278_2801340_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2801366_2801942_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2801887_2802253_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046755.1|2802324_2802501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556599.1|2802891_2804044_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 32
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	2917841	2961239	3160466	protease,transposase	Acanthamoeba_polyphaga_lentillevirus(14.29%)	41	NA	NA
WP_016209259.1|2917841_2918690_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_016209274.1|2918806_2919718_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_075274963.1|2920436_2921498_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212454.1|2921717_2922398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211192.1|2923186_2924545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211189.1|2924589_2925048_-	NfeD family protein	NA	NA	NA	NA	NA
WP_016211187.1|2925072_2925993_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_016211186.1|2926119_2926902_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.3	8.2e-32
WP_016211190.1|2926991_2928491_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_016211188.1|2928812_2930696_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_075273298.1|2930769_2931345_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2931290_2931656_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211157.1|2932220_2932877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211161.1|2932984_2934094_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2934105_2934750_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2934768_2935755_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2935834_2936911_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2937113_2937938_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2938254_2939259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2939467_2940433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274965.1|2940571_2941447_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2941743_2942796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2943063_2943492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2943705_2944197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2944252_2945503_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2945605_2945824_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_052104629.1|2946266_2947292_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080728341.1|2947741_2947912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212561.1|2947883_2948024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210728.1|2948938_2949409_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2949697_2951077_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2951104_2951563_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2951540_2952758_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2952949_2953186_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2953199_2953355_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2953435_2954398_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2954557_2955874_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2955883_2956552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2956914_2958729_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_129556601.1|2958846_2959623_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_052104629.1|2960213_2961239_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP038942	Piscirickettsia salmonis strain Psal-027 chromosome, complete genome	3160466	2992924	3109635	3160466	transposase,tRNA	Staphylococcus_phage(33.33%)	109	NA	NA
WP_054300271.1|2992924_2993899_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2993974_2994994_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556602.1|2995392_2995602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274966.1|2997593_2998655_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|2998735_2999044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|2999158_3000475_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664857.1|3000936_3002223_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|3002295_3003192_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|3003278_3004277_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|3004385_3004910_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|3005157_3006396_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|3006943_3007417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|3007413_3007809_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3008738_3009314_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3009259_3009625_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211610.1|3009889_3012220_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_129556603.1|3012340_3014356_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075274967.1|3014539_3017932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3017996_3018302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274968.1|3018471_3019572_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|3019966_3021076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209721.1|3022014_3023412_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.3e-77
WP_051307313.1|3023531_3024479_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3024475_3024991_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3024977_3026177_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3026173_3026497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3026498_3027728_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3027727_3028771_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3028770_3029454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3029450_3031940_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3031956_3032211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3032211_3032568_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3033347_3034511_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3034530_3037638_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3037639_3039145_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3039172_3039454_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3039602_3039944_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3040063_3041944_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3042028_3043627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3043644_3044760_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3044887_3045886_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|3045889_3046648_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3046649_3047849_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3047832_3048504_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3048525_3049302_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3049305_3050304_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3050305_3050884_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3050880_3052350_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3052393_3052681_-	trp operon repressor	NA	NA	NA	NA	NA
WP_016209699.1|3052881_3053478_+	DMT family transporter	NA	NA	NA	NA	NA
WP_075274970.1|3053687_3054158_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3054214_3054370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274971.1|3054514_3054967_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3055152_3055374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|3055489_3056122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274972.1|3056099_3057161_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211865.1|3057600_3058140_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3058224_3058761_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3059412_3059715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3060164_3060473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274973.1|3061063_3061531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3061813_3062524_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3062750_3063149_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|3064016_3064967_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3064966_3067045_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3067192_3067708_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3067716_3068280_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3068260_3069007_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3069146_3069599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3070022_3070859_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3070855_3071752_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3071784_3072852_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3072870_3073239_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3073264_3074713_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3074722_3076102_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3076142_3077474_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3077445_3078405_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3078497_3079001_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3079135_3080287_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3080283_3080763_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3080909_3083231_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3083175_3083802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3083806_3084706_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3084778_3085357_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3085657_3085915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556611.1|3085923_3087077_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046758.1|3088213_3088345_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3088489_3088645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212051.1|3088972_3089746_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126148.1|3090287_3090470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3091073_3092048_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3093142_3093481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212337.1|3093497_3094208_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_051307375.1|3094195_3094387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|3094548_3094848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3094837_3095002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3095058_3095424_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3096728_3097424_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3097420_3098848_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3098873_3099137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3099497_3100472_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556612.1|3100530_3101381_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3101418_3101763_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3102595_3102937_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3102938_3103544_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3103540_3105535_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3105554_3106496_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211292.1|3106723_3108148_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3108660_3109635_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 1
NZ_CP038943	Piscirickettsia salmonis strain Psal-027 plasmid unnamed1, complete sequence	153781	2323	101076	153781	tail,transposase,protease,capsid,integrase,head	Streptococcus_phage(21.28%)	116	91315:91374	104649:105511
WP_129556705.1|2323_2824_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	28.0	9.9e-07
WP_036771330.1|2882_3857_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_054300162.1|4369_5452_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212151.1|5816_6779_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|6802_7117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923686.1|7173_8223_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|8331_9372_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|9385_10015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|10105_10405_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211886.1|10401_10830_-	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_054300202.1|11618_12347_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126832.1|12591_13500_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_054300202.1|13610_14339_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155062492.1|14406_14565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|15478_16207_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|16410_18987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046766.1|19211_19349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|19392_20367_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075274931.1|20567_21296_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.4e-38
WP_016212137.1|21739_22801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212139.1|22876_23122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307371.1|23093_23708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|24525_25500_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556707.1|25859_26879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|27507_28661_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126239.1|28805_29078_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|29089_29926_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075275144.1|29958_30690_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|30787_31201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212017.1|31495_31894_+	hypothetical protein	NA	W8VUR5	Pseudomonas_phage	38.8	2.3e-06
WP_047927838.1|31923_32169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|32165_32465_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016212019.1|32621_33317_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_081377351.1|34130_34910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|34993_35146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|35098_35431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|35595_35973_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|36279_36663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|37132_37861_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_129556708.1|37976_38312_-	mRNA-degrading endonuclease	NA	A9D9Y1	Lactobacillus_prophage	35.6	2.6e-11
WP_016212365.1|38304_38547_-	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_054300271.1|38755_39730_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075275142.1|40365_41094_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_075275141.1|41376_43062_+	protein kinase	NA	NA	NA	NA	NA
WP_129556709.1|43273_43363_+	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_129556710.1|43443_43914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275140.1|44067_44802_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.1e-38
WP_075275139.1|45428_45659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212404.1|46273_46507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126756.1|46627_47071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275138.1|47215_47524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047124.1|47728_49390_+	AAA family ATPase	NA	A0A0K2FLP8	Brevibacillus_phage	31.5	9.1e-65
WP_016212457.1|49399_49801_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_016212456.1|49797_50085_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_075275137.1|50128_50542_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126239.1|50597_50870_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|50881_51718_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_016212579.1|52648_52846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|54351_54552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|54562_55138_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|55083_55449_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|56280_58323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|59227_59593_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|59538_60114_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075274752.1|60110_60410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|60445_61599_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_052047048.1|61779_62280_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|62279_62441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211937.1|62710_63100_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211936.1|63589_64612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211938.1|65106_65667_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275133.1|66238_66547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|67079_68233_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273327.1|68481_69057_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075275128.1|69002_69368_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556696.1|69467_70484_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.0	3.0e-18
WP_052133287.1|70585_70984_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556716.1|71117_71408_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_016210655.1|71421_72018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210663.1|72336_72648_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210667.1|72644_72968_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210658.1|72960_73356_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210651.1|73352_73703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210664.1|73702_74125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210669.1|74126_74450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|74506_74773_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075273774.1|76974_78132_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275128.1|78273_78639_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|78584_79160_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126790.1|79630_80536_+|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_129556697.1|80920_81313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211776.1|81795_83133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|83300_83669_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211773.1|83770_84445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|84897_85263_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|85208_85784_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126360.1|85990_86725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|86847_87906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|88414_89161_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|89161_89566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|89959_90775_-	hypothetical protein	NA	NA	NA	NA	NA
91315:91374	attL	GGCACTGTTGCGAAAAATTATAGTGAACTTCAGAAAGGTTATTTTCTTGTGCTCTCTGCT	NA	NA	NA	NA
WP_054300202.1|91379_92108_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212298.1|92549_92876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|93116_93593_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_075275158.1|93707_94001_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377916.1|94117_94642_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.4	2.5e-29
WP_098082791.1|94846_95149_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.6	8.6e-14
WP_129556698.1|95157_95859_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_016211912.1|95948_96539_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_032126795.1|96811_97072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|97075_97348_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_016211913.1|97673_98795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273786.1|99227_99626_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377915.1|99634_100192_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	2.9e-47
WP_081377914.1|100336_100666_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|100782_101076_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
104649:105511	attR	GGCACTGTTGCGAAAAATTATAGTGAACTTCAGAAAGGTTATTTTCTTGTGCTCTCTGCTTAGAATTAAGCAGCTAATCCAAATAATTTATCAATGAGCTGATTTTGGGCACAGATATTCTGTTTTTTAATATAACGTAATTGACCTTTTTGAACCATGCGCATCGCTTCCATTATGTCAATGGTAGGCCGTGCTGTAGAAAGTGATTGGTACCATTGGCGGAAACGGGATTTGCGCTTTACCGCTTTGTGATCATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACACTGACTAGAAAAGACACCTTCATCTTTGGCTTTTTGGTGAGCGGGTGGAAATGAAGCGTGCTTGTCGACATTCACAACACGCGGTGATTTCACATAAGGTTGGGCGATTGCCTTTTTGAAAAAGCGCATCGCCGCTTTGGCATTTTGCTGTCGGCTGAGCATCCAGTCCAAAGTATGGCCATATTTATCAATGGCTCGATAAAGGTAATACCAACGACCTTTGATTTTCACCAACGTTTCATCTAACCGCCAAGAGGCACACGTTTGACGAAAGTGGGGCCTCAGCCGTTTGGCGATCTGCGAGCCATACTCGTGCACCCAGCGACAAATGGTTGAACGCTCAATCTCAAGACCTCTTTCAGCTGCTATTTCTTTGAGATCACGGTAAGATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATGATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTCTACCCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCCG	NA	NA	NA	NA
>prophage 1
NZ_CP038944	Piscirickettsia salmonis strain Psal-027 plasmid unnamed2, complete sequence	79943	4824	28863	79943	transposase	Streptococcus_phage(16.67%)	33	NA	NA
WP_075273327.1|4824_5400_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|5345_5711_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212400.1|5761_6361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212399.1|6360_6621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|6750_7903_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212392.1|7931_8939_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	26.4	1.2e-06
WP_075273802.1|9002_9731_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_016212131.1|9914_10262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212135.1|10700_11885_+	3-methylitaconate isomerase	NA	NA	NA	NA	NA
WP_075275202.1|12128_12830_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	6.0e-10
WP_075275201.1|12832_13561_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_016212164.1|13689_14718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211443.1|15741_16428_+	Fic family protein	NA	NA	NA	NA	NA
WP_016211439.1|16431_16986_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	40.6	1.0e-20
WP_016211436.1|17030_17969_+	fic/DOC family protein	NA	S4TP71	Salmonella_phage	37.2	5.2e-25
WP_016211434.1|17941_18133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211445.1|18310_18661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211437.1|18677_19304_-	zinc-ribbon domain-containing protein	NA	A0A1S5XYQ1	Kurlavirus	28.2	4.4e-12
WP_032126541.1|19310_19703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211440.1|19713_20628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211444.1|20897_21404_+	antirestriction protein ArdA	NA	A0A222YZE5	Mycobacterium_phage	33.7	2.8e-17
WP_051307358.1|21552_21936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556729.1|22219_22450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212541.1|22436_22661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212539.1|22720_22870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|22866_23841_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212090.1|23884_24064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212087.1|24063_24492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126714.1|24659_25199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212089.1|25435_25666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126713.1|25764_26802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|27271_28297_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275198.1|28323_28863_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	40.2	8.4e-12
>prophage 2
NZ_CP038944	Piscirickettsia salmonis strain Psal-027 plasmid unnamed2, complete sequence	79943	37206	57887	79943	head,portal,tail,capsid,terminase,protease	Pseudomonas_phage(11.76%)	29	NA	NA
WP_129556725.1|37206_37887_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	39.3	3.3e-37
WP_016210977.1|38065_38359_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_129556724.1|38576_38759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046773.1|38903_39083_-	phosphatase	NA	NA	NA	NA	NA
WP_129556723.1|39177_39495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126134.1|39795_40179_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	5.6e-26
WP_016212234.1|40266_40746_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_016212231.1|40749_40959_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	43.1	1.3e-08
WP_080743047.1|40974_41331_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	61.3	5.4e-23
WP_081377926.1|41349_42432_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	1.2e-89
WP_016211136.1|42428_43670_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	46.0	3.1e-86
WP_080664855.1|43617_44289_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_016211140.1|44346_45540_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_016211133.1|45660_46995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|47185_47497_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211132.1|47493_47817_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211139.1|47809_48205_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211129.1|48201_48552_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|48551_48974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126913.1|48975_49299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|49355_49622_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_032126912.1|49625_51704_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.0	2.5e-56
WP_016210657.1|51696_52038_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|52034_52706_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|52674_53421_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_016210665.1|53410_53968_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_016210662.1|53974_54262_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	2.5e-15
WP_016210670.1|54251_54506_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_016210653.1|54599_57887_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	33.5	5.2e-112
>prophage 1
NZ_CP038945	Piscirickettsia salmonis strain Psal-027 plasmid unnamed3, complete sequence	32424	11559	19100	32424	integrase,transposase	unidentified_phage(33.33%)	10	5164:5223	18422:18613
5164:5223	attL	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTA	NA	NA	NA	NA
WP_129556741.1|11559_12231_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.4	3.4e-10
WP_052133268.1|12252_12534_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	38.7	8.3e-11
WP_016212274.1|12606_13071_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032126154.1|13081_13276_-	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_032126152.1|13491_14082_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
WP_129556740.1|14145_14514_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155046774.1|14725_14902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300579.1|15120_16122_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	1.3e-26
WP_016211990.1|16269_18342_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_129556739.1|18371_19100_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
18422:18613	attR	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTACCGTGATCTCAAAGAAATAGCAGCTGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGTTGGGTGCACGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTC	NA	NA	NA	NA
