The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	45566	89679	3141916	transposase	Moraxella_phage(16.67%)	46	NA	NA
WP_129556427.1|45566_46142_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46087_46453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46651_47413_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_016211195.1|47714_49241_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49612_50452_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50491_51799_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51773_52943_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|52997_53723_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54001_54391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54550_55456_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55531_55675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274979.1|55722_56562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|56554_56890_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_155046698.1|57068_57230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|57346_57640_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_016210704.1|58534_60481_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61135_64198_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64194_65259_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65614_66568_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66599_67763_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67768_68368_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68555_69056_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69073_70162_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70588_71833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71829_72672_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016211096.1|72651_73461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73639_73867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73867_74818_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74873_75425_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75551_75974_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75966_76713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76755_77454_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77464_78289_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78618_78987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274980.1|78981_80043_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|80092_80323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80452_81667_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81967_83029_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_016211249.1|83042_84770_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_016211245.1|84803_85535_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85534_86323_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86427_87051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87370_87583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273383.1|87738_88311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046699.1|88515_89088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274981.1|89082_89679_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	136473	178470	3141916	transposase	Staphylococcus_phage(50.0%)	46	NA	NA
WP_054300271.1|136473_137448_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|137949_139362_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|139854_140862_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|140881_142402_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_129556430.1|142458_142665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211018.1|143640_144957_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145060_145444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145578_148644_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|148712_149816_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|149839_150394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150508_151078_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151197_151953_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_054300545.1|152119_153181_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|153575_153971_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|153992_154358_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154414_154579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|154568_154868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|155120_155486_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|155431_156007_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212607.1|156007_156364_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|156452_157028_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|156973_157339_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|157818_158385_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|158396_159182_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|159813_160737_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|160788_161784_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|161815_162310_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|162401_162659_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|162748_163171_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|163489_164206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|164249_164501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556431.1|164514_165942_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|165969_167412_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|167499_167838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|167922_168453_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|168513_170706_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|170748_171234_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|171503_171935_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_016210245.1|171952_172783_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|172797_172941_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|172971_173856_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|173827_174049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|174222_174501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|175471_176377_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556686.1|176779_177661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|177894_178470_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	182276	239530	3141916	tRNA,tail,transposase,protease	Escherichia_phage(12.5%)	56	NA	NA
WP_075273327.1|182276_182852_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|182797_183163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|183226_183499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212441.1|183766_183991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372761.1|185006_185456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|185519_186248_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210779.1|186290_187220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|187512_188106_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|188074_188728_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|188905_189877_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|189899_190796_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|190954_191401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210787.1|191397_192039_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|192148_192727_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|193202_193640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|193964_195305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|195568_196963_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075274986.1|198411_199479_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|199531_199954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|200194_200638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|200692_200950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|200927_201554_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|201631_203614_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|203823_205167_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|205433_208103_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|208126_210046_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|210215_211637_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|211782_212757_+	phospholipase A	NA	NA	NA	NA	NA
WP_016209855.1|212788_213184_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209859.1|213186_213408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|213571_215233_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|215305_215596_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_016209861.1|215821_216277_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|216341_216806_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216898_218245_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|218244_219150_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|219211_220198_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|220190_220433_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|220554_222099_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|222145_223432_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|223474_224869_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224892_225072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|225068_225644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|225589_225955_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274988.1|226016_228251_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016210079.1|228672_229170_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|229340_230036_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|230138_231701_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|232016_233810_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233895_234168_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|234173_234800_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234786_236217_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236549_237605_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237573_238251_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|238240_239077_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|239236_239530_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	256927	301858	3141916	transposase,tRNA	Acinetobacter_phage(40.0%)	49	NA	NA
WP_075274991.1|256927_257503_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377888.1|257506_258067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556436.1|258122_259009_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046701.1|259035_259185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|259329_259530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|259577_260039_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|260462_261944_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|262006_263116_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|263213_265175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|265704_266109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|266161_267223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046702.1|267348_267504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270449_271602_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556437.1|271644_272067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049804.1|272336_273779_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_032126861.1|273982_274297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046703.1|274490_274628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|274631_275518_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212538.1|275689_276130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210630.1|276659_277775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664846.1|277713_278400_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032126366.1|278393_279371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210638.1|279409_280573_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210640.1|281037_281262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|281647_281935_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210633.1|282109_282865_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|282870_283326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210637.1|283301_283778_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210636.1|283784_285362_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_032126367.1|285365_286130_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210629.1|286183_286720_+	tim44-like domain protein	NA	NA	NA	NA	NA
WP_016210634.1|286716_287448_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_032126368.1|287556_288711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275120.1|288855_289167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664872.1|289490_290471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211898.1|290712_291336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211899.1|291663_291957_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_105962625.1|292053_292940_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046704.1|293551_293704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212296.1|293719_294448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126374.1|294556_295528_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664866.1|295559_295976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211609.1|296590_296899_+	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_032126373.1|296931_299118_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	2.7e-141
WP_016211605.1|299221_299455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|299671_300202_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211607.1|300230_300455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|300637_301453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300526.1|301561_301858_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	329433	374988	3141916	transposase	Hokovirus(33.33%)	46	NA	NA
WP_075273298.1|329433_330009_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210127.1|330061_331087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|331180_331444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|331810_332629_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|332701_335074_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_016210125.1|335786_337214_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|337248_338271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|338287_338665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126491.1|339022_339340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210122.1|339506_340199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|340825_341800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|341789_343562_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|343562_343910_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_032126493.1|344159_345386_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|345475_346774_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664834.1|346807_347167_-	VUT family protein	NA	NA	NA	NA	NA
WP_080664833.1|347212_347557_-	VUT family protein	NA	NA	NA	NA	NA
WP_016210137.1|347537_348089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664832.1|348315_349614_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|349730_350021_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_016212281.1|350332_351787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|351986_352562_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|352507_352873_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212359.1|353608_353827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|354194_355169_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212044.1|355707_355962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|356684_357671_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|357808_358003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664870.1|358685_359333_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_129556444.1|359325_359748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211797.1|359909_361313_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|361363_361939_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|361884_362199_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556445.1|362239_363126_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126227.1|363764_364055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212008.1|364092_364791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212010.1|364807_365104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212007.1|365227_366373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273619.1|366645_367221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211273.1|367278_368112_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.0	3.5e-17
WP_016211268.1|368227_369412_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211271.1|369430_370375_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016211269.1|370679_371465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211272.1|371582_371951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211270.1|372178_373756_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_054300173.1|373926_374988_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	447599	550111	3141916	protease,transposase,tRNA	Escherichia_phage(36.67%)	97	NA	NA
WP_075275004.1|447599_448463_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|448679_450239_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|450260_451295_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|451343_451913_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|452048_453020_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|453031_454609_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|454674_455661_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016210646.1|455992_457102_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|457207_458392_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|458469_460458_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|460666_460822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|461079_461379_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_075275005.1|461537_461873_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|462789_464196_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|464213_465200_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|465202_466357_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|466353_467049_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|467183_468674_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|468694_469744_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|469810_471205_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|472083_474015_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|474019_474550_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|474584_474779_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|474821_475181_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|475600_476596_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_032126132.1|476608_478990_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|478995_479283_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|479554_480031_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|480175_480373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|480497_481472_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|483580_483679_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210477.1|484163_485453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126626.1|485689_486382_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|486423_487197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|487198_488140_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|488272_489850_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|490059_491817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|492365_493124_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|493331_493904_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|494007_494556_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|494857_495103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|495131_495428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|495695_496619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556451.1|497097_497355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275008.1|497418_498147_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	3.3e-43
WP_098082828.1|498461_498719_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275009.1|498850_499558_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.8	1.3e-44
WP_075275011.1|499601_500330_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.2e-42
WP_032126799.1|500521_501334_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_129556452.1|502454_502802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|502804_504544_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300501.1|505048_505777_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_016212066.1|506137_506914_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016212069.1|507125_507293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212070.1|507267_507867_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_054300500.1|508276_509005_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_075275013.1|509047_509269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300501.1|509353_510082_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|510093_510486_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|510482_510728_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300307.1|511831_512560_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300307.1|513166_513895_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_016212268.1|514539_515124_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|515127_515811_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|516093_516822_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_052104629.1|517158_518184_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212159.1|518327_518525_-	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_016212158.1|518792_519707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275019.1|519816_520521_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	9.2e-43
WP_105962625.1|520484_521371_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211714.1|521745_525090_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_144019196.1|525122_525779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|525834_526563_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126534.1|527077_527593_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212084.1|527592_528609_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_075274955.1|528890_529865_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212327.1|531250_532036_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075274956.1|532096_532465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|532507_533482_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016210580.1|533557_533818_-	methyltransferase	NA	NA	NA	NA	NA
WP_016210574.1|533958_534378_+	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_032126277.1|534465_535056_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210572.1|535278_537036_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126278.1|537157_538141_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_032126275.1|538221_538773_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126276.1|538783_540151_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126279.1|540301_540541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210582.1|540599_541343_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_016210581.1|541342_541987_+	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210578.1|541983_543648_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	7.1e-33
WP_016210576.1|543675_544011_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_016210570.1|544141_545740_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210577.1|545805_546096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|546110_546566_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273456.1|546525_546825_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556663.1|547202_547568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210376.1|547630_550111_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
>prophage 7
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	594262	645407	3141916	transposase,tRNA	Staphylococcus_phage(37.5%)	52	NA	NA
WP_075273298.1|594262_594838_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377880.1|594783_595263_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210761.1|595900_596638_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_016210755.1|596741_597470_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_016210763.1|597573_598818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|599126_599387_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_016210758.1|599560_601099_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_051307336.1|601256_602183_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	9.4e-11
WP_016210756.1|602321_605135_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
WP_032126291.1|605127_605637_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210766.1|605640_606084_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_129556593.1|606172_606814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|606810_607386_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|607331_607697_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211782.1|607758_607941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|608540_609818_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211783.1|610098_610464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211784.1|610455_611178_-	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_075274951.1|611731_612616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|612612_613587_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016210171.1|614144_615704_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	5.8e-37
WP_016210175.1|616017_616347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210177.1|616732_617098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126297.1|617222_618083_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|618069_618849_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_016210168.1|618924_619608_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556592.1|619768_620299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210179.1|620589_621093_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_016210161.1|621293_621548_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210178.1|622049_622517_+	DoxX family protein	NA	NA	NA	NA	NA
WP_016210163.1|622606_623137_-	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_016210172.1|623136_623661_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.6	6.9e-51
WP_016210170.1|623823_624939_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210174.1|625175_626336_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	8.2e-121
WP_016210183.1|626786_628790_+	transketolase	NA	NA	NA	NA	NA
WP_016210176.1|628858_629866_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210181.1|629939_631124_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_032126295.1|631133_632588_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_016210162.1|632618_633656_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_105962625.1|634340_635227_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212028.1|635314_635563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212027.1|636057_637281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126299.1|637303_637525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|637775_638750_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211964.1|638808_639129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|639241_639892_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211963.1|639993_640653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211962.1|641201_641717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212030.1|642014_642260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|642351_643014_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212032.1|643137_644265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|644521_645407_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	653494	687934	3141916	transposase,tRNA	Catovirus(20.0%)	37	NA	NA
WP_016210986.1|653494_655033_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	1.3e-86
WP_075273313.1|655090_655429_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377882.1|655388_655670_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377881.1|655676_655844_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377817.1|656760_657258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|657481_658138_+	porin family protein	NA	NA	NA	NA	NA
WP_032126306.1|658242_658539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274949.1|658763_659825_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046752.1|659802_660540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|660578_661007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210814.1|661356_661554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210817.1|661796_662429_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210815.1|662848_663799_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210821.1|663795_665328_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_017377821.1|665324_665855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|666189_666828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|667277_667982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210818.1|668273_668498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210820.1|669001_669943_-	DMT family transporter	NA	NA	NA	NA	NA
WP_129556549.1|670144_671030_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210940.1|671138_672326_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_016210937.1|672417_672699_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126309.1|672784_673462_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_032126310.1|673508_674768_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_016210941.1|674965_676015_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_016210931.1|676093_676900_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210936.1|676937_677732_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210944.1|677833_678853_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210942.1|678899_679511_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210943.1|679514_680201_+	acireductone synthase	NA	NA	NA	NA	NA
WP_016210935.1|680197_680740_+	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016211759.1|682552_683740_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016211756.1|683985_684711_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_032126312.1|684889_685684_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_129556590.1|685680_686076_-	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_051307363.1|686352_686535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300282.1|687469_687934_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	716574	824046	3141916	integrase,protease,transposase,tRNA	Escherichia_phage(35.0%)	101	733188:733247	739416:739703
WP_016210052.1|716574_717771_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
WP_032126425.1|717791_718388_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210066.1|718831_719500_-|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_016210076.1|719641_720943_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210073.1|721199_721931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210051.1|722355_722760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210069.1|723000_724083_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.6e-20
WP_016210054.1|724067_724589_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210050.1|724653_725529_+	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210068.1|725604_726180_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_155046750.1|727366_727504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|728748_729654_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211874.1|729697_731416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|731734_732814_-	hypothetical protein	NA	NA	NA	NA	NA
733188:733247	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_016212522.1|733358_733613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300489.1|733709_734312_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_129556589.1|734314_734590_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032126389.1|735991_736180_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212230.1|737713_739162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|739217_739442_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_075274946.1|739663_740107_+	hypothetical protein	NA	NA	NA	NA	NA
739416:739703	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACG	NA	NA	NA	NA
WP_016212294.1|740120_740465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046748.1|740816_741122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212659.1|741209_741455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|741599_741749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274945.1|741973_742324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211326.1|742468_743209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211324.1|743705_744260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211322.1|744795_745386_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211325.1|745448_746969_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211323.1|746958_748056_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211321.1|748229_749390_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211722.1|749770_753073_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_032126817.1|753082_753904_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_075274944.1|754260_754977_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
WP_129556588.1|754921_755089_+	phosphatase	NA	NA	NA	NA	NA
WP_075274943.1|755279_755804_-	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_087910645.1|756089_757242_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_032127022.1|757304_759491_-	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_075274942.1|760167_760896_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	2.7e-45
WP_016212339.1|760914_761661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275114.1|761813_762176_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274941.1|762205_762934_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.2e-42
WP_016211996.1|763317_764265_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211997.1|764266_765376_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.5	4.4e-07
WP_075274940.1|765731_766412_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	2.0e-42
WP_087910645.1|766439_767593_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274939.1|767705_768434_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.8e-42
WP_016212238.1|768463_769753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212264.1|770268_770862_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	5.4e-28
WP_016212263.1|770907_771501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664881.1|771663_771870_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_129556661.1|772675_773239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210616.1|773539_776350_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_016210625.1|776598_777345_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_129556587.1|777403_778306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307334.1|778349_779129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210618.1|779395_780445_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_016210617.1|780509_781934_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_075274938.1|782097_782604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210624.1|782622_782862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|782907_783378_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016211056.1|785753_786506_-	ComF family protein	NA	NA	NA	NA	NA
WP_016211049.1|786549_787512_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211052.1|787511_788765_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211045.1|788795_789569_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211044.1|789549_790410_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_016211050.1|790478_791186_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211051.1|791148_791652_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211047.1|792013_793648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049878.1|793726_794302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|794344_795073_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_036780855.1|795838_796336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049879.1|796310_796712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|796680_797409_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211625.1|797892_798762_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_016211621.1|798758_800108_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	4.6e-75
WP_016211623.1|800220_801861_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_016211987.1|803682_805419_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_144019359.1|805580_805778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556671.1|805922_806651_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_098082825.1|806714_807023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|807015_807348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|807351_807921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211655.1|808049_808463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211652.1|808722_809928_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211653.1|810035_811061_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_054300202.1|811152_811881_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300202.1|812311_813040_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212196.1|813448_813694_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016212195.1|813690_814077_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212193.1|814144_814483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274934.1|814605_815274_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.0	2.8e-41
WP_016211949.1|815761_817012_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_016211951.1|817045_818143_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_075274933.1|818759_819488_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_075274932.1|819796_820018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|820239_821853_-	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_016211816.1|821894_822248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126570.1|822260_822560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|823317_824046_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
>prophage 10
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	913258	965317	3141916	transposase,tRNA	Agrobacterium_phage(12.5%)	45	NA	NA
WP_081007050.1|913258_913786_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|913842_914208_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211061.1|914269_914623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211058.1|914743_915277_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_032126660.1|915415_917053_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.2	5.8e-88
WP_016211065.1|917057_917279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211066.1|917376_918390_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_016211063.1|918552_920781_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
WP_032126658.1|920761_921466_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|921700_922030_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_054300173.1|923110_924172_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126663.1|924198_924441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126664.1|925159_925843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212048.1|926036_926594_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_075274927.1|927357_928419_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664847.1|928491_929445_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_016210878.1|929945_932675_+	kinase	NA	NA	NA	NA	NA
WP_016210879.1|932777_933137_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210871.1|933133_933451_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210872.1|933467_934577_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210882.1|934603_935689_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210874.1|935811_936852_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210873.1|936866_937517_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210876.1|937584_938427_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016212197.1|938892_939810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|940828_941023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036794860.1|941099_941393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|941660_942578_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_016211373.1|943129_943276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211374.1|943330_944521_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211370.1|944653_945097_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211369.1|945139_946183_-	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211368.1|946229_947621_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211371.1|947817_948741_+	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211372.1|948727_949585_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016212287.1|955681_956827_-|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_054300173.1|956905_957967_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211408.1|958190_959537_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_016211412.1|959651_960644_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211411.1|960647_961145_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211407.1|961141_961981_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_051307356.1|962013_963546_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_032126774.1|963705_964041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|964196_964469_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|964480_965317_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
>prophage 11
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	1027227	1108834	3141916	transposase,tRNA	Staphylococcus_phage(35.29%)	82	NA	NA
WP_016211428.1|1027227_1029291_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
WP_054300237.1|1029561_1030623_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556651.1|1030864_1032073_+	MFS transporter	NA	NA	NA	NA	NA
WP_075274925.1|1032260_1033322_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212285.1|1033369_1034848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1034897_1035959_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210196.1|1035916_1036270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210185.1|1036623_1038834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|1038834_1039521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210198.1|1039832_1040384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|1040400_1040802_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210190.1|1040992_1041868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126472.1|1042087_1042738_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_016210202.1|1043200_1045789_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.8	9.7e-122
WP_016210199.1|1045894_1046656_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_016210206.1|1046652_1047189_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210205.1|1047237_1048194_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210187.1|1048274_1051460_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210201.1|1051463_1052519_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_155063788.1|1052678_1053347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210186.1|1053390_1054053_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_016210194.1|1054087_1054435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|1054491_1054653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210192.1|1055024_1055543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1055855_1056221_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1056166_1056742_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556569.1|1056731_1056941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211502.1|1057355_1058399_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_016211508.1|1058428_1058773_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211503.1|1058827_1059283_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_075274922.1|1059293_1059590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274921.1|1059567_1059666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211506.1|1059658_1060300_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|1060296_1061013_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211507.1|1061016_1062336_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_054300271.1|1062649_1063624_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212450.1|1063667_1064570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1064725_1065091_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1065036_1065612_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1065625_1065916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1065861_1066437_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556568.1|1066473_1067955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|1068144_1069206_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211004.1|1069618_1072255_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_080664849.1|1072303_1073392_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016210997.1|1073391_1074075_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_016210998.1|1075949_1076204_+	LapA family protein	NA	NA	NA	NA	NA
WP_016211001.1|1076281_1076587_+	competence protein ComEA	NA	NA	NA	NA	NA
WP_016211002.1|1076750_1077149_+	VOC family protein	NA	NA	NA	NA	NA
WP_051307345.1|1077182_1077869_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211000.1|1078012_1078798_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_075274920.1|1078893_1079628_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	4.8e-10
WP_016210826.1|1081058_1081925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210824.1|1082034_1083714_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210830.1|1083840_1085091_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_032126465.1|1085166_1085628_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210835.1|1085624_1086773_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_016210836.1|1086778_1087453_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_052133275.1|1087482_1088106_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210828.1|1088221_1088695_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_016210832.1|1088696_1089119_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210829.1|1089105_1090125_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210831.1|1090394_1090940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|1091034_1092096_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212318.1|1092624_1093056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|1093057_1093384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212319.1|1093370_1093598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|1094156_1095602_-	MFS transporter	NA	NA	NA	NA	NA
WP_016212205.1|1095741_1095921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274918.1|1096604_1096970_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1096915_1097491_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212174.1|1098565_1098823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|1098899_1099073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|1100068_1101130_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|1101087_1101336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300443.1|1101388_1101667_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211538.1|1101905_1102829_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_016211536.1|1103523_1103757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211535.1|1103832_1105620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923739.1|1105831_1107340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212614.1|1107484_1107691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1107859_1108834_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 12
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	1129504	1256853	3141916	protease,transposase,tRNA	Staphylococcus_phage(17.65%)	119	NA	NA
WP_054300271.1|1129504_1130479_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212492.1|1130528_1131383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210459.1|1131587_1132106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210458.1|1135180_1135729_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210461.1|1135809_1136085_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_032126596.1|1136084_1137137_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210464.1|1137245_1139183_-	AsmA family protein	NA	NA	NA	NA	NA
WP_075275113.1|1139333_1141043_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_016210468.1|1141111_1141831_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_016210467.1|1141827_1142430_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210471.1|1142544_1143432_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|1143622_1143970_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210465.1|1144020_1144863_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_129556566.1|1145370_1145574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372565.1|1145482_1145854_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274914.1|1145902_1146778_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|1147328_1147913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556565.1|1149382_1149778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273603.1|1149901_1150078_-	phosphatase	NA	NA	NA	NA	NA
WP_129556564.1|1151234_1151564_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046744.1|1152733_1152907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1152963_1153329_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126745.1|1153400_1154003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122940402.1|1154211_1154835_+	porin family protein	NA	NA	NA	NA	NA
WP_016209896.1|1155149_1155719_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016209891.1|1155865_1156564_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_036777115.1|1156705_1156906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209884.1|1156982_1157606_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_016209882.1|1157715_1158609_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209898.1|1158715_1160326_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_016209888.1|1160322_1161618_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209876.1|1161639_1163562_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209881.1|1163672_1163975_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209893.1|1164067_1168957_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_016209883.1|1169011_1170328_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	9.4e-65
WP_129556563.1|1170446_1171547_+	FUSC family protein	NA	NA	NA	NA	NA
WP_016209878.1|1171598_1172537_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_080664826.1|1172617_1173217_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209877.1|1173405_1174296_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_016209887.1|1174498_1174990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209894.1|1175133_1175625_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1175793_1176507_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556650.1|1176935_1177910_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209897.1|1178230_1178473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1178494_1178860_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1178805_1179381_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211960.1|1179624_1180152_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_129556649.1|1180691_1181549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|1181576_1182158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|1182727_1182913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556562.1|1183057_1183360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1183319_1183658_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211968.1|1183783_1184188_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1184200_1184341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126649.1|1184437_1185634_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_016211971.1|1185654_1186266_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_129556561.1|1186471_1187625_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	2.6e-58
WP_032126362.1|1187795_1188161_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1188106_1188682_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274909.1|1188780_1189107_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1189490_1189655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1189644_1189944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728345.1|1189984_1190593_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032126790.1|1190783_1191689_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556560.1|1191658_1192195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556559.1|1192275_1192704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212093.1|1192860_1193790_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_075273313.1|1194002_1194341_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377876.1|1194300_1194756_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212654.1|1194747_1195032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212100.1|1195442_1196363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212098.1|1196363_1197215_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1197922_1198969_+	glutathione synthase	NA	NA	NA	NA	NA
WP_032126840.1|1198952_1200950_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_122941967.1|1201128_1201434_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|1201663_1201870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|1202130_1202832_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211519.1|1202832_1203252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307348.1|1204407_1207164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211092.1|1207399_1208692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|1208735_1211216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211094.1|1212280_1212604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1212623_1213598_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211036.1|1213945_1215817_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_016211039.1|1215908_1217654_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211043.1|1217733_1218183_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211035.1|1218235_1218451_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211042.1|1218697_1219714_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211037.1|1219762_1220392_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211040.1|1220742_1221954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126170.1|1222181_1222454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556558.1|1222617_1223511_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556557.1|1223655_1223967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212394.1|1224014_1224719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211450.1|1225740_1226763_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211448.1|1226861_1228070_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211446.1|1228059_1229787_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_129556648.1|1229970_1230942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1231355_1232417_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126397.1|1232765_1233356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210561.1|1233470_1234805_-	dihydroorotase	NA	NA	NA	NA	NA
WP_016210568.1|1234932_1235574_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210566.1|1235879_1236302_+	universal stress protein	NA	NA	NA	NA	NA
WP_016210559.1|1236662_1237625_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_016210564.1|1237621_1238083_+	amidohydrolase	NA	NA	NA	NA	NA
WP_016210557.1|1238085_1238838_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016210560.1|1238926_1240627_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_016210562.1|1242194_1243847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|1243920_1244676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1246312_1246678_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211932.1|1247088_1248378_-	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_016211931.1|1248573_1249761_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211476.1|1250078_1250288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211473.1|1250271_1250871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211474.1|1250945_1252295_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_032126518.1|1252377_1254579_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211478.1|1254595_1255411_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126519.1|1255390_1256110_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_129556556.1|1256277_1256853_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	1299573	1531352	3141916	integrase,protease,transposase,tRNA	Staphylococcus_phage(10.34%)	224	1365258:1365317	1532119:1532409
WP_016209434.1|1299573_1300995_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209437.1|1301025_1301547_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_016209438.1|1301543_1302143_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_016209440.1|1302220_1303231_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	1.5e-06
WP_016209415.1|1303343_1304048_+	protein TolQ	NA	NA	NA	NA	NA
WP_016209407.1|1304084_1304516_+	protein TolR	NA	NA	NA	NA	NA
WP_016209428.1|1304518_1305613_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_129556552.1|1305648_1307016_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_016209425.1|1307051_1307693_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126507.1|1307735_1308665_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_016209451.1|1308667_1309315_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	37.9	1.2e-36
WP_032126506.1|1309365_1310169_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	8.9e-42
WP_016209417.1|1310350_1310563_+	SlyX family protein	NA	NA	NA	NA	NA
WP_016209423.1|1310566_1310800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209422.1|1310861_1312442_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_016209426.1|1312643_1313573_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.3	1.6e-13
WP_016209420.1|1313574_1314342_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_032126509.1|1314746_1315463_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_016209442.1|1315500_1315863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209432.1|1316034_1317744_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209448.1|1318001_1319333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209449.1|1319774_1321247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1321420_1322395_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300152.1|1323068_1323434_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274897.1|1323674_1324541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|1325053_1325398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210519.1|1325387_1326155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210521.1|1326390_1328328_-	his Kinase A domain protein	NA	NA	NA	NA	NA
WP_016210517.1|1329341_1330061_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|1330174_1333714_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|1333780_1334599_+	ZipA protein	NA	NA	NA	NA	NA
WP_016210518.1|1334585_1336625_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210522.1|1336640_1337693_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210524.1|1337703_1338234_+	exsB family protein	NA	NA	NA	NA	NA
WP_129556549.1|1338772_1339658_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046739.1|1340543_1340684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210010.1|1342328_1342505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210017.1|1342680_1343064_+	hpt domain protein	NA	NA	NA	NA	NA
WP_075273518.1|1343139_1343433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210016.1|1343599_1344559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|1345159_1345315_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|1345579_1346950_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210009.1|1346942_1347149_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016210012.1|1347224_1347896_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210005.1|1347876_1350681_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	2.4e-57
WP_016210027.1|1350760_1351357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1351746_1352502_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210004.1|1352701_1353343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|1353603_1354929_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210023.1|1354925_1356983_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210007.1|1356960_1357533_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|1357588_1357948_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|1358012_1359047_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|1359304_1360156_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|1360250_1361234_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|1361390_1363058_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_032126790.1|1363243_1364149_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211421.1|1364245_1364470_+	hypothetical protein	NA	NA	NA	NA	NA
1365258:1365317	attL	GGTAACCCTCCCTTAAAATGAGACAACTCATAACTGGAATCTTCTGTTAACATTTTCAAA	NA	NA	NA	NA
WP_032126239.1|1365328_1365601_+|transposase	transposase	transposase	NA	NA	NA	NA
1365258:1365317	attL	GGTAACCCTCCCTTAAAATGAGACAACTCATAACTGGAATCTTCTGTTAACATTTTCAAA	NA	NA	NA	NA
WP_033923779.1|1365612_1366449_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274733.1|1366499_1366817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1366835_1367411_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1367356_1367722_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|1367743_1368073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556547.1|1368481_1369042_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_081377874.1|1371113_1371581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1371749_1372007_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274890.1|1372076_1372757_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_129556545.1|1372961_1373303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212209.1|1373557_1374559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1375014_1375314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|1375303_1375468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1375625_1375964_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1375923_1376379_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075274888.1|1376383_1376719_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274886.1|1376990_1378052_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211279.1|1378795_1381264_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_016211277.1|1381277_1382246_+	homoserine kinase	NA	NA	NA	NA	NA
WP_016211278.1|1382232_1383492_+	threonine synthase	NA	NA	NA	NA	NA
WP_129556646.1|1383543_1384929_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300295.1|1385739_1385964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126750.1|1386244_1387042_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211170.1|1387200_1387371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211167.1|1388002_1389124_+	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	1.5e-10
WP_016211172.1|1389173_1390370_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_080664856.1|1390558_1391623_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_051307350.1|1391606_1392353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211165.1|1392342_1393071_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211168.1|1393067_1393727_+	wbqC-like family protein	NA	NA	NA	NA	NA
WP_016211169.1|1393710_1394658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1394657_1395173_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211164.1|1395215_1395593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210396.1|1395730_1395919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210391.1|1395986_1396937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210393.1|1397030_1399232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210398.1|1399432_1401025_+	B-type flagellin	NA	NA	NA	NA	NA
WP_032126669.1|1401249_1402827_+	B-type flagellin	NA	NA	NA	NA	NA
WP_122940572.1|1402945_1403371_+	flaG family protein	NA	NA	NA	NA	NA
WP_016210394.1|1403481_1404867_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032126670.1|1404892_1405330_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210390.1|1405334_1405676_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_016210399.1|1405690_1407682_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210388.1|1407707_1408382_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210397.1|1408378_1410553_-	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_054300550.1|1410742_1411108_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1411164_1411329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1411318_1411618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210772.1|1411750_1413304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1413387_1414197_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_033923762.1|1414324_1414558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210769.1|1414858_1416361_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_016210773.1|1416664_1419358_+	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210771.1|1419354_1422756_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_054300162.1|1422847_1423930_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556544.1|1423992_1424349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274882.1|1424463_1425060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212246.1|1425995_1426652_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|1426755_1427838_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300271.1|1428177_1429152_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212247.1|1429779_1430535_-	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_036779544.1|1430901_1431909_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1431908_1432166_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1432663_1433500_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1433511_1433784_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274880.1|1434779_1435745_+|transposase	transposase	transposase	NA	NA	NA	NA
1433796:1435025	attR	TTTGAAAATGTTAACAGAAGATTCCAGTTATGAGTTGTCTCATTTTAAGGGAGGGTTACCTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGAAGTATCAGCCATGATAAAGTCACACGCTTTTTAAATAAAAACCACTTTGGATCAAAAGAGCTCTGGAGCTATGTTAAAAAGCATGTTCGTCAGTATGAAGAAGAAGTTGGAGGCGTTTTAAGTCTGGATGATACCGTGGAAGAAAAGCCTTATACAGATGAGAATGATGTGGTTTGTTGGCATTATTCACACAGCAAAAGCGCTCATGTAAAGGGAATTAATATTTTGACAAGTATGGTGACTTACAAG	NA	NA	NA	NA
WP_016212058.1|1435900_1437451_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
1433796:1435025	attR	TTTGAAAATGTTAACAGAAGATTCCAGTTATGAGTTGTCTCATTTTAAGGGAGGGTTACCTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGAAGTATCAGCCATGATAAAGTCACACGCTTTTTAAATAAAAACCACTTTGGATCAAAAGAGCTCTGGAGCTATGTTAAAAAGCATGTTCGTCAGTATGAAGAAGAAGTTGGAGGCGTTTTAAGTCTGGATGATACCGTGGAAGAAAAGCCTTATACAGATGAGAATGATGTGGTTTGTTGGCATTATTCACACAGCAAAAGCGCTCATGTAAAGGGAATTAATATTTTGACAAGTATGGTGACTTACAAG	NA	NA	NA	NA
WP_081377873.1|1438093_1438930_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.6e-41
WP_032126239.1|1438941_1439214_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556543.1|1439305_1439788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209453.1|1439897_1440047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209496.1|1440214_1440427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664817.1|1440456_1441230_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209485.1|1441254_1442277_+	chorismate mutase	NA	NA	NA	NA	NA
WP_032126728.1|1442329_1443634_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_052133284.1|1443624_1444191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209460.1|1444180_1445263_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.1	1.0e-72
WP_016209465.1|1445309_1446410_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_016209488.1|1446450_1446939_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_052047096.1|1447088_1447778_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016209481.1|1447980_1448307_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_016209480.1|1448356_1448584_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_016209484.1|1448595_1449048_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209475.1|1449257_1450679_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	1.7e-152
WP_016209491.1|1450711_1451809_+	alanine racemase	NA	NA	NA	NA	NA
WP_016209456.1|1451833_1452565_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	M1IDP9	Pelagibacter_phage	35.8	5.3e-09
WP_016209472.1|1452678_1454049_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_032126730.1|1454151_1454640_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_016209463.1|1454994_1455378_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_016209490.1|1455804_1456128_+	YqcC family protein	NA	NA	NA	NA	NA
WP_129556645.1|1456218_1458168_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_016209478.1|1458259_1459213_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209459.1|1459376_1460543_-	rasGEF domain protein	NA	NA	NA	NA	NA
WP_075273528.1|1460802_1461768_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_016209455.1|1461948_1462995_+	membrane protein	NA	NA	NA	NA	NA
WP_016209467.1|1462987_1464013_+	FUSC family protein	NA	NA	NA	NA	NA
WP_016209494.1|1464082_1466107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664818.1|1466788_1467124_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016209474.1|1467265_1467676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209462.1|1467685_1467829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209471.1|1467838_1468165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664819.1|1468311_1469349_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_016209486.1|1469390_1469642_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_129556541.1|1469766_1470081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209458.1|1470088_1471663_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_016209457.1|1471806_1472388_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_016209482.1|1472687_1474490_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	39.2	5.1e-21
WP_129556644.1|1474540_1475428_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209466.1|1475833_1476508_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	34.5	8.9e-27
WP_016209492.1|1476513_1477413_+	GTPase Era	NA	NA	NA	NA	NA
WP_016209497.1|1477426_1478170_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_016209489.1|1478172_1478904_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_016209473.1|1478900_1479284_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_016212202.1|1480245_1481493_-	glutaminase	NA	NA	NA	NA	NA
WP_075274878.1|1481904_1482780_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211947.1|1483182_1484328_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_129556540.1|1484320_1484716_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211946.1|1484934_1485690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1486910_1487276_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1487221_1487797_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1487810_1488101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|1488046_1488622_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212551.1|1488963_1489458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556643.1|1489915_1491280_-	histidine kinase	NA	NA	NA	NA	NA
WP_016211983.1|1491375_1492035_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556539.1|1492282_1492627_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300307.1|1492695_1493424_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_075274875.1|1493470_1493773_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211212.1|1494055_1495615_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|1495975_1497946_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|1498137_1499217_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211213.1|1499265_1499472_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211210.1|1499478_1500960_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211214.1|1501062_1501626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1503388_1504648_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211940.1|1504768_1505101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1505214_1506189_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211341.1|1506333_1506504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211343.1|1506702_1507725_+	YHYH protein	NA	NA	NA	NA	NA
WP_016211342.1|1507732_1509415_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.1e-32
WP_016211344.1|1509575_1510394_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|1510607_1511591_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|1511583_1511805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|1511832_1512474_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_105962625.1|1513623_1514509_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1514513_1514801_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|1514853_1515132_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|1515230_1515578_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|1515899_1516139_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|1516356_1516944_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|1516904_1517240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|1517427_1518072_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|1518406_1519057_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|1519589_1520642_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032126786.1|1520659_1523740_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_075274874.1|1524038_1524407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1524407_1524983_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1524928_1525294_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274873.1|1525315_1525813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274872.1|1526287_1526827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556536.1|1526786_1527939_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_081377871.1|1527942_1528635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1528839_1529097_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556535.1|1529286_1530173_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377829.1|1530617_1531352_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1532119:1532409	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTTT	NA	NA	NA	NA
>prophage 14
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	1560974	1623666	3141916	transposase,tRNA	Bacillus_thuringiensis_phage(14.29%)	55	NA	NA
WP_016209621.1|1560974_1561979_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|1562411_1563860_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209620.1|1563946_1567003_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_080664820.1|1566985_1567156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556532.1|1567464_1567647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212485.1|1567943_1568477_-	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_075273327.1|1569229_1569805_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1569750_1570116_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126753.1|1570208_1570673_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|1570742_1572263_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126752.1|1572350_1572953_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|1572949_1573297_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|1573447_1574431_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211462.1|1575058_1576039_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052047087.1|1576199_1576418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274864.1|1576589_1577615_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212346.1|1580455_1580602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1580835_1581699_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211749.1|1581907_1583101_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211748.1|1583180_1584785_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211752.1|1584800_1585946_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_129556531.1|1586150_1586348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1586310_1586649_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1586608_1587064_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_081007023.1|1587238_1587895_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212534.1|1587971_1588238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1589808_1590723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211728.1|1590761_1592696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1593083_1593677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274862.1|1593848_1594445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046732.1|1594559_1594730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1594923_1595196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1595817_1596396_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_122942091.1|1596423_1596819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211455.1|1596924_1598382_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_016211452.1|1598443_1599931_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211454.1|1600681_1601152_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1601292_1601868_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1601813_1602179_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556641.1|1606053_1607316_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016210751.1|1607403_1609209_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_016210752.1|1609692_1610490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210749.1|1610659_1611121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1611419_1613375_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1614054_1614240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|1614573_1615563_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_075273327.1|1615656_1616232_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1616177_1616543_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080664871.1|1616974_1618597_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.9	1.9e-27
WP_016211834.1|1618687_1619002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307365.1|1619258_1619519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1619538_1620027_+	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_129556528.1|1621550_1621979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1622400_1622658_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047040.1|1622727_1623666_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	1633974	1678193	3141916	transposase	Staphylococcus_phage(42.86%)	45	NA	NA
WP_081007004.1|1633974_1634430_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1634389_1634728_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|1634901_1635342_-	universal stress protein	NA	NA	NA	NA	NA
WP_016211350.1|1636020_1636959_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211349.1|1637022_1639017_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|1639013_1639616_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211351.1|1639612_1639951_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|1640026_1641253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1641519_1642494_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211856.1|1642709_1642895_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|1643021_1643489_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|1643485_1644364_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|1644614_1645922_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007004.1|1646074_1646530_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1646489_1646828_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1647789_1648695_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211738.1|1648765_1649410_+	membrane protein	NA	NA	NA	NA	NA
WP_016211741.1|1649886_1650663_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126783.1|1650808_1652050_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211739.1|1652160_1652667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211736.1|1652783_1652984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|1653007_1653982_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_129556526.1|1654040_1654826_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	1.3e-45
WP_016212445.1|1654822_1655089_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016211177.1|1655303_1656524_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126450.1|1656891_1658886_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211185.1|1658998_1659607_-	smr domain protein	NA	NA	NA	NA	NA
WP_032126449.1|1659673_1660597_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016211180.1|1660617_1661082_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_016211178.1|1661144_1662173_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032126448.1|1662263_1662644_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211182.1|1662675_1663005_+	DUF4404 family protein	NA	NA	NA	NA	NA
WP_016212475.1|1663989_1664196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1664393_1665368_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556525.1|1665443_1666264_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210855.1|1666417_1667395_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210849.1|1667512_1668961_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210847.1|1668989_1669994_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210851.1|1670016_1670688_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210850.1|1670672_1671926_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1672174_1672729_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210848.1|1673024_1674209_+	MFS transporter	NA	NA	NA	NA	NA
WP_051307341.1|1674375_1675974_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_081007030.1|1676667_1677639_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377870.1|1677674_1678193_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	31.0	1.6e-07
>prophage 16
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	1706219	1745061	3141916	transposase,tRNA	Staphylococcus_phage(20.0%)	31	NA	NA
WP_129556523.1|1706219_1707106_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1707441_1708416_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_054300148.1|1708513_1709575_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1710129_1711104_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|1711794_1712370_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1712315_1712681_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274858.1|1712817_1713903_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274857.1|1715482_1716358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126678.1|1716368_1717379_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_016211554.1|1717705_1718332_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_016211557.1|1718377_1719607_+	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_032126677.1|1719801_1720365_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211555.1|1720439_1721798_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_016211664.1|1722334_1723063_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211666.1|1723435_1726255_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211669.1|1726409_1726760_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556522.1|1729868_1731101_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211405.1|1731307_1733080_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_016211403.1|1733215_1734259_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211399.1|1734272_1735016_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211398.1|1735162_1735450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1736054_1736753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211734.1|1737174_1737444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211731.1|1737459_1738566_+	protein kinase	NA	NA	NA	NA	NA
WP_016211733.1|1738621_1739446_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_075274856.1|1741201_1742227_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046730.1|1742445_1742586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1742853_1743501_-	LysE family translocator	NA	NA	NA	NA	NA
WP_016212267.1|1743781_1744141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|1744307_1744763_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273804.1|1744722_1745061_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	1755326	1855222	3141916	integrase,protease,transposase,tRNA	Staphylococcus_phage(20.0%)	96	1825738:1825797	1860222:1860302
WP_105962625.1|1755326_1756212_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556521.1|1756746_1756935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556520.1|1756885_1757782_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.8e-54
WP_032126362.1|1757742_1758108_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1758053_1758629_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1758704_1758998_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155046729.1|1759215_1760262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211631.1|1760520_1761327_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_016211634.1|1761582_1762404_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211632.1|1762439_1763294_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211627.1|1763519_1763684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377868.1|1763989_1764646_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210103.1|1764721_1766080_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_016210117.1|1766361_1766721_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210111.1|1767141_1768776_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_017377579.1|1768782_1769619_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210099.1|1769640_1770918_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_016210105.1|1771001_1771322_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210106.1|1771341_1772433_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210102.1|1772615_1774205_+	APC family permease	NA	NA	NA	NA	NA
WP_016210110.1|1774265_1775021_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_016210113.1|1775208_1776258_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210101.1|1776680_1778177_+	flagellin domain protein	NA	NA	NA	NA	NA
WP_016210107.1|1778466_1778739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210114.1|1778810_1780070_-	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210108.1|1780162_1781428_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_122943012.1|1781613_1782069_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210112.1|1782185_1783613_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_032126690.1|1784306_1784789_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_052047138.1|1790836_1791070_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046728.1|1791332_1792307_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	6.8e-28
WP_155049900.1|1792435_1792741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211563.1|1793089_1793251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211564.1|1793283_1794159_-	ParA family protein	NA	NA	NA	NA	NA
WP_016211561.1|1794324_1798191_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_080728343.1|1798272_1798413_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_081007034.1|1798394_1798679_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_032126538.1|1798943_1800362_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_016211991.1|1801270_1802176_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126537.1|1802416_1802602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211994.1|1802638_1803175_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_016212348.1|1804593_1805823_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_075274849.1|1805817_1806561_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1806686_1806959_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1806970_1807807_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_129556517.1|1807825_1808113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1808510_1809485_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300271.1|1810132_1811107_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212012.1|1811343_1812021_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016212013.1|1812036_1812420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212011.1|1812641_1813763_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_075274847.1|1813996_1814872_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211974.1|1815154_1816276_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075273551.1|1816375_1816678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556638.1|1816677_1817358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377865.1|1818702_1818987_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664876.1|1819345_1821208_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_033923779.1|1821520_1822357_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1822368_1822641_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212529.1|1822681_1823239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275108.1|1823597_1824203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1824179_1825154_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046727.1|1825397_1825742_+	hypothetical protein	NA	NA	NA	NA	NA
1825738:1825797	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_129556515.1|1826567_1826927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1826945_1827218_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1827229_1828066_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274844.1|1828074_1828326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|1828506_1829481_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016211144.1|1830037_1830667_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_016211152.1|1830650_1831073_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|1831079_1832819_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|1832819_1833884_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1833887_1834241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1834353_1835310_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|1835319_1835631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1835646_1836216_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|1836479_1837808_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_081377864.1|1837889_1838129_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1838142_1838979_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1838990_1839263_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1839347_1840322_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210841.1|1840535_1840907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1840965_1841739_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_129556514.1|1841890_1844347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126340.1|1844626_1845388_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_122941824.1|1845468_1847205_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016210844.1|1847389_1848517_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_016210843.1|1848603_1848834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556637.1|1849448_1850228_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|1850702_1851140_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300363.1|1851563_1851911_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556512.1|1851856_1852432_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212275.1|1852421_1853405_-	MFS transporter	NA	NA	NA	NA	NA
WP_051307372.1|1853520_1853910_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036774189.1|1853957_1854965_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1854964_1855222_-|transposase	transposase	transposase	NA	NA	NA	NA
1860222:1860302	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCC	NA	NA	NA	NA
>prophage 18
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	1882072	1941182	3141916	transposase,tRNA	uncultured_Mediterranean_phage(30.77%)	55	NA	NA
WP_016211804.1|1882072_1883458_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_016211805.1|1883464_1885003_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211806.1|1885045_1885771_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032126239.1|1886560_1886833_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1886844_1887681_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_129556510.1|1888204_1889308_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	7.3e-10
WP_054300405.1|1889409_1889910_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209947.1|1890431_1891094_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016209946.1|1891120_1892350_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209940.1|1892506_1895278_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_016209937.1|1895353_1895797_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209931.1|1895949_1897422_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209926.1|1897533_1898595_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209945.1|1898591_1899626_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209932.1|1899628_1900669_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209936.1|1900851_1901967_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.6	1.4e-93
WP_016209930.1|1902005_1902359_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_032126634.1|1902379_1904248_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209935.1|1904269_1905214_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_016209925.1|1905447_1905726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1905935_1906574_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209944.1|1906548_1907976_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209927.1|1908176_1908854_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209939.1|1908988_1910263_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209943.1|1910330_1911086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209948.1|1911137_1912055_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209929.1|1912163_1913057_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075274822.1|1914515_1915490_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016211771.1|1915782_1915971_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_016211770.1|1915984_1917118_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_075274823.1|1917317_1921328_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211823.1|1921362_1921551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1921591_1922212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1922543_1922897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1923110_1923305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1923970_1924498_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300400.1|1924554_1924797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1924941_1925208_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210885.1|1925549_1926431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1926488_1927085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1927117_1927891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1928424_1928721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210888.1|1928743_1928995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155053505.1|1928940_1929663_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210886.1|1929731_1930511_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210887.1|1930593_1931544_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210889.1|1932053_1934900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556636.1|1934917_1935226_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016212002.1|1936179_1936458_-	DNA-J related family protein	NA	NA	NA	NA	NA
WP_016212000.1|1936577_1937306_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016211998.1|1937436_1938000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211999.1|1937989_1938343_-	ras family protein	NA	NA	NA	NA	NA
WP_033923779.1|1938722_1939559_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1939570_1939843_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274825.1|1940120_1941182_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	1977996	2064419	3141916	transposase,tRNA	Bacillus_phage(15.0%)	84	NA	NA
WP_075274826.1|1977996_1978902_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1979158_1980430_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_016211218.1|1980454_1981192_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1981444_1982587_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1982603_1984205_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1984716_1984854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1984850_1986128_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1986477_1986660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126600.1|1986931_1987453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212250.1|1987575_1988226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212251.1|1988387_1988924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300384.1|1989085_1989901_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075274828.1|1990309_1991632_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.2e-11
WP_052133287.1|1991733_1992132_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212039.1|1992320_1992878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212040.1|1993054_1994404_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_054300162.1|1994607_1995690_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210803.1|1995764_1997063_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_016210808.1|1997240_1998092_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210805.1|1998100_1998772_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_032126141.1|1999181_2000456_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210804.1|2000520_2002440_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126139.1|2002446_2003376_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_033923779.1|2006044_2006881_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274829.1|2006892_2007165_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2007188_2008163_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046725.1|2008206_2008347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300382.1|2008563_2008986_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377858.1|2009204_2009915_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2010118_2010484_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2010498_2011005_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211414.1|2011220_2012039_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|2012146_2012608_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211415.1|2012624_2013548_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211417.1|2013571_2014621_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_051307357.1|2014757_2015351_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211422.1|2015373_2015844_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032126143.1|2015932_2017204_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_075274832.1|2017303_2018278_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_016211838.1|2018589_2018763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211840.1|2019233_2019698_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211839.1|2019856_2021329_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211841.1|2021446_2021899_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|2022758_2023820_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|2024122_2025205_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212483.1|2025215_2026013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2026009_2026585_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2026530_2026896_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300380.1|2026997_2027654_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556508.1|2027924_2028368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|2028429_2028723_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556507.1|2028839_2029526_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.3	5.5e-48
WP_075273327.1|2029515_2030091_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2030036_2030402_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212421.1|2030893_2031076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2031826_2032801_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556505.1|2032841_2033807_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211470.1|2034573_2035227_+	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_016211471.1|2035286_2037272_-	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
WP_032126343.1|2037402_2038215_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_032126344.1|2038335_2039424_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_016211467.1|2039426_2039993_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_075273298.1|2040067_2040643_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|2040588_2040954_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047029.1|2041121_2041463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2041535_2042597_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032127044.1|2042800_2043001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|2043902_2044196_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556503.1|2045257_2046124_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	5.6e-58
WP_016210508.1|2046132_2047830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|2048150_2048699_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_075273576.1|2048826_2049555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|2049614_2053112_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_016210514.1|2053169_2054423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210515.1|2054531_2055434_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210512.1|2055487_2056525_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210506.1|2056660_2057899_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210510.1|2057891_2058620_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_081007040.1|2058650_2059307_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211831.1|2059444_2061172_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|2061472_2061826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|2062241_2062742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047133.1|2063393_2063840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2063843_2064419_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	2100264	2213569	3141916	protease,transposase,tRNA	Vibrio_phage(13.33%)	94	NA	NA
WP_016209848.1|2100264_2102859_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209832.1|2103165_2103429_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209831.1|2103707_2104406_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|2104625_2104820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209827.1|2104895_2106455_-	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_129556633.1|2106773_2107670_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|2107886_2109362_-	APC family permease	NA	NA	NA	NA	NA
WP_016209826.1|2109884_2110907_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209830.1|2111237_2112605_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209846.1|2112840_2113095_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126639.1|2113110_2114397_+	GTPase HflX	NA	NA	NA	NA	NA
WP_016209836.1|2114416_2115631_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_016209838.1|2115630_2116524_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209839.1|2116721_2118020_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209829.1|2119399_2121799_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209834.1|2121795_2122554_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209842.1|2122730_2123120_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016212367.1|2123847_2124705_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_155046721.1|2125846_2126014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274836.1|2126194_2127085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046720.1|2127222_2127396_-	phosphatase	NA	NA	NA	NA	NA
WP_129556500.1|2127850_2128237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210154.1|2128358_2129051_+	haloacid dehalogenase	NA	NA	NA	NA	NA
WP_016210155.1|2129089_2129899_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.9	3.8e-16
WP_016210149.1|2129904_2131149_-	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210156.1|2131182_2133051_-	ferric iron reductase FhuF-like transporter family protein	NA	NA	NA	NA	NA
WP_080664835.1|2133043_2134270_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664836.1|2134257_2136108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210150.1|2136092_2137298_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_016210144.1|2137309_2139499_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_016210157.1|2140041_2140671_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075273564.1|2140693_2141113_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016210153.1|2141105_2141510_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_032126761.1|2141563_2142385_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_016210142.1|2142444_2143425_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210160.1|2143405_2145403_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_016210147.1|2145415_2146588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210148.1|2147448_2147667_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_032126762.1|2148502_2150530_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_016211282.1|2150611_2151862_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211281.1|2152156_2152492_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_016211283.1|2152803_2153052_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_016211280.1|2153087_2153597_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211285.1|2153596_2154376_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211286.1|2154393_2154741_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211289.1|2154852_2155125_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211767.1|2156453_2157263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211764.1|2157813_2158635_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126803.1|2158835_2160068_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_081377862.1|2160554_2161391_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2161402_2161675_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046719.1|2161693_2161852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|2164070_2164886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211525.1|2167185_2169921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275102.1|2170509_2170968_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377901.1|2171148_2171859_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126856.1|2171919_2172261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|2172565_2173719_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016212005.1|2174619_2176380_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_016210592.1|2176769_2177426_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016210586.1|2177438_2178944_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210593.1|2178965_2179496_-	colicin V production protein	NA	NA	NA	NA	NA
WP_016210590.1|2179575_2180838_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210587.1|2181012_2181873_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_032126176.1|2181974_2182757_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210588.1|2182847_2184173_-	fimV domain protein	NA	NA	NA	NA	NA
WP_016210595.1|2184540_2185719_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210594.1|2185895_2186549_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210596.1|2186684_2188625_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.1e-72
WP_129556498.1|2188621_2189230_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075275098.1|2189742_2190672_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-24
WP_080728317.1|2190862_2194228_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211391.1|2194294_2194870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211393.1|2194881_2196438_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_016211396.1|2196457_2196808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211395.1|2196804_2197140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|2197496_2197868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|2198072_2198798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212252.1|2199112_2199271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212254.1|2199308_2200751_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_075273327.1|2200740_2201316_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|2201261_2201552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2201565_2202141_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2202086_2202452_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274672.1|2202623_2203217_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211114.1|2203582_2206513_-	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_016211115.1|2206645_2208598_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211112.1|2208790_2209438_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211113.1|2209493_2210819_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_032126179.1|2210848_2211100_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_080664854.1|2211057_2211639_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300408.1|2211975_2212632_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_032126362.1|2212682_2213048_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275097.1|2212993_2213569_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	2243025	2351142	3141916	transposase,tRNA	Acinetobacter_phage(11.11%)	115	NA	NA
WP_105962623.1|2243025_2244179_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016211588.1|2244346_2245048_-	cyclase family protein	NA	NA	NA	NA	NA
WP_032126329.1|2245123_2245753_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_129556496.1|2245938_2247177_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_016211592.1|2247451_2248114_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_016211589.1|2248103_2249336_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_129556495.1|2249458_2249716_+	VOC family protein	NA	NA	NA	NA	NA
WP_032126637.1|2250696_2250990_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126540.1|2251220_2252084_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2252217_2252583_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2252528_2253104_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126332.1|2253750_2254950_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_016211366.1|2255202_2255490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126331.1|2255545_2257555_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_032126330.1|2257609_2258569_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_016211367.1|2258716_2259499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664860.1|2259654_2260092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2260055_2260631_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2260576_2260942_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210269.1|2260979_2261330_+	L,D-transpeptidase catalytic domain protein	NA	NA	NA	NA	NA
WP_016210281.1|2261343_2262735_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210270.1|2262776_2265764_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210277.1|2265833_2266667_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210279.1|2266720_2267887_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210272.1|2267874_2268585_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210283.1|2268624_2269410_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_129556492.1|2269437_2270181_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|2270278_2272474_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_016210271.1|2272558_2273242_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_032126334.1|2273252_2273684_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210274.1|2273723_2274122_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_016210273.1|2274494_2275202_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210275.1|2275266_2275569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210276.1|2275624_2276101_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210284.1|2276155_2276677_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210280.1|2276758_2277853_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_054300412.1|2278089_2278404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|2278548_2278959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275091.1|2279229_2279715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556631.1|2280723_2280891_+	phosphatase	NA	NA	NA	NA	NA
WP_075275089.1|2281035_2281368_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	37.3	8.0e-05
WP_032126500.1|2281501_2282218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|2282354_2283602_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126499.1|2283980_2284592_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211122.1|2284688_2285555_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2285558_2286320_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211128.1|2286483_2287389_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211125.1|2287611_2288442_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|2288611_2289001_+	lipoprotein	NA	NA	NA	NA	NA
WP_032126498.1|2289133_2289694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2289755_2290121_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2290066_2290642_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212621.1|2290638_2291043_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_016212585.1|2291337_2291658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|2291769_2292744_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_075273327.1|2293113_2293689_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2293634_2294000_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275086.1|2293960_2294959_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212356.1|2294936_2295782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047081.1|2295832_2296270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212519.1|2296540_2296921_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_075275084.1|2296995_2298057_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212611.1|2298104_2298425_-	histidine kinase	NA	NA	NA	NA	NA
WP_081377357.1|2298908_2299310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285940.1|2299394_2300216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126778.1|2300430_2300625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211088.1|2300803_2301766_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211087.1|2301985_2302981_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211081.1|2303008_2303944_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|2303984_2304446_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|2304424_2305468_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211090.1|2305480_2307115_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080664853.1|2307074_2308817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|2309540_2311577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211709.1|2313836_2313983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274676.1|2314141_2314339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212323.1|2314413_2314686_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_122941816.1|2314762_2315071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212326.1|2315157_2315355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155063791.1|2315580_2316465_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212290.1|2316469_2317795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2317911_2318973_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126869.1|2318950_2319190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2319710_2320286_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2320231_2320597_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2320827_2321403_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2321348_2321714_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|2322594_2323458_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556488.1|2324606_2325457_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275079.1|2325605_2326667_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126801.1|2326714_2327224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2327894_2328977_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300173.1|2329102_2330164_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212218.1|2331614_2331965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275077.1|2332109_2332946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2333030_2333936_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016210899.1|2334435_2336319_-	APC family permease	NA	NA	NA	NA	NA
WP_016210896.1|2336372_2337455_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210904.1|2337497_2338148_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210903.1|2338368_2338740_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_129556487.1|2338858_2340196_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210897.1|2340274_2341255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210894.1|2341595_2341898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|2342372_2342663_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210898.1|2342751_2343102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300269.1|2344013_2344382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2344403_2344769_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2344825_2344990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007012.1|2344979_2345150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275075.1|2345144_2346206_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273492.1|2346314_2346434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556486.1|2346524_2346872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556630.1|2346957_2348307_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211781.1|2348616_2349864_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_081377899.1|2350278_2351142_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	2365571	2484250	3141916	integrase,transposase,protease	Bacillus_phage(13.33%)	107	2393262:2393321	2430040:2430550
WP_054300148.1|2365571_2366633_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273490.1|2366873_2368166_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_016211426.1|2369148_2370591_-	MFS transporter	NA	NA	NA	NA	NA
WP_129556484.1|2370934_2372395_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_129556469.1|2372896_2373205_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|2373164_2373425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300264.1|2373569_2373908_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_075275071.1|2374010_2374985_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212461.1|2375360_2375735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|2375738_2376314_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2376259_2376625_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300262.1|2377087_2377378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210542.1|2377369_2379076_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.9	2.5e-25
WP_051307331.1|2379147_2380926_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_016210552.1|2381280_2381847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210553.1|2381971_2382625_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_032126547.1|2382651_2384094_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210545.1|2384190_2385168_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_129556482.1|2385316_2385922_+	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_026063577.1|2385993_2386287_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556629.1|2386513_2387260_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_016210541.1|2387490_2387718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|2387782_2387965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|2388401_2388956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046716.1|2389653_2389800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212107.1|2390204_2391341_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_052047108.1|2392152_2392551_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275068.1|2392652_2393243_-	hypothetical protein	NA	NA	NA	NA	NA
2393262:2393321	attL	TATAGCGCTGGATTAACAGTTTCTGACATAATATCAGTAGGTTAAAAAATACAATAAGGA	NA	NA	NA	NA
WP_032126362.1|2393327_2393693_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2393638_2394214_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211578.1|2394571_2394916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|2394931_2395126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|2395192_2395546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211582.1|2395643_2396423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211585.1|2396484_2397042_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016211581.1|2397160_2397931_-	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.9	8.9e-31
WP_016211583.1|2398207_2399116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211579.1|2399183_2399669_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054300162.1|2399892_2400975_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556481.1|2401232_2401664_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_016212302.1|2401848_2402148_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_054300271.1|2402461_2403436_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556480.1|2403459_2408949_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_016211300.1|2409460_2410501_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_054300162.1|2410551_2411634_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212424.1|2412042_2412321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126152.1|2412523_2413114_+|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016211531.1|2413177_2413858_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016211530.1|2414211_2415108_+	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211534.1|2415113_2415623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211532.1|2415609_2416560_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	35.8	1.8e-09
WP_016211528.1|2417206_2417512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664862.1|2417492_2418191_-	P-loop NTPase	NA	NA	NA	NA	NA
WP_075273327.1|2419364_2419940_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274918.1|2419885_2420251_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556479.1|2420738_2420921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212436.1|2421134_2421545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|2421883_2422769_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923634.1|2422759_2423308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126157.1|2423512_2423917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|2424203_2426096_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_016211512.1|2426438_2427245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307360.1|2428336_2429266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2430105_2430471_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|2430642_2431617_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
2430040:2430550	attR	TATAGCGCTGGATTAACAGTTTCTGACATAATATCAGTAGGTTAAAAAATACAATAAGGAAAAACGATGCCTTCTCCTTACAGTTATGACTTAAGAATTCGAGCACTAAAAATGATTGATGAAGGGATACCTATTACACAAATTTCCAAGCTCTTAAAAATCAGTCGAGACACTCTGCATCGTTGGAAAAATAGGCGTGATCATACAGGAGACGTCAAAGCAAGGTTTGGCTACCAAACGGGCTATAACCATAAAATCAGTGATATGAAAGAATTTCAAAAATTTATTGATCAGAATCCGGGTAAAACTCATCAACAACTCGCTGATCTTTACCCTGTAGAAATGAGTGCAAAAACCATGGGAGTGTGGATTAAAAAATTAGGCTATACCAGAAAAAAAAGAGCTTCAGATACCAAGAACGTGATGCATTAAAGCGGAAAGCTTTCCTGGAAAAAGTCGAGAAAATCGATAACGACAAAATTGTTTATATGGACGAAGCGGGTATGGATGA	NA	NA	NA	NA
WP_075273512.1|2431753_2432098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275067.1|2432853_2433921_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_059372266.1|2434253_2434739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556477.1|2434828_2436310_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209659.1|2436469_2437498_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_016209654.1|2437562_2438705_+	galactokinase	NA	NA	NA	NA	NA
WP_016209656.1|2438823_2440527_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209642.1|2440523_2442644_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209652.1|2442640_2443990_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209662.1|2443961_2446109_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209657.1|2446536_2446932_+	CrcB family protein	NA	NA	NA	NA	NA
WP_016209643.1|2446940_2447825_-	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_032126162.1|2447856_2449734_-	SurA domain-containing protein	NA	NA	NA	NA	NA
WP_016209655.1|2449837_2450110_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_032126161.1|2450213_2452646_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209663.1|2452713_2454015_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_016209647.1|2454096_2454702_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209645.1|2454814_2456119_-	trigger factor	NA	NA	NA	NA	NA
WP_016209661.1|2456722_2457598_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_075273478.1|2457713_2458385_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209658.1|2458561_2459917_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_016209641.1|2460037_2460775_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032126159.1|2460854_2461568_-	aldolase	NA	NA	NA	NA	NA
WP_016209651.1|2462194_2463469_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2463499_2464075_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209649.1|2464119_2465085_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209640.1|2465543_2466563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|2466981_2467956_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_129556476.1|2468051_2469062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211684.1|2469606_2470182_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016211685.1|2470205_2472011_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211687.1|2472041_2472686_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_033923708.1|2472941_2473817_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556628.1|2474021_2474837_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.5e-32
WP_016210297.1|2474922_2476302_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_032126463.1|2476358_2477615_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_032126458.1|2477695_2479222_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_129556475.1|2479227_2480250_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_016210290.1|2480472_2481267_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210287.1|2481355_2482219_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_033923779.1|2483129_2483966_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2483977_2484250_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	2492111	2539640	3141916	transposase,tRNA	Staphylococcus_phage(25.0%)	41	NA	NA
WP_032126239.1|2492111_2492384_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|2492395_2493232_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_155063795.1|2493290_2494034_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210741.1|2494719_2495043_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_016210746.1|2495049_2498946_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210744.1|2499042_2499528_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210743.1|2499568_2501149_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210739.1|2501217_2502675_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210737.1|2502830_2504807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|2505125_2505746_-	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_016210742.1|2505911_2506187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2506337_2507312_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212172.1|2507331_2508804_-	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_075275065.1|2509694_2510369_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.9e-10
WP_054300173.1|2510668_2511730_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211822.1|2512039_2512453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211818.1|2512809_2514066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|2514268_2514769_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211819.1|2515065_2515296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556627.1|2515514_2516120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2516172_2517234_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2517260_2517836_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2517781_2518147_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047106.1|2518862_2519339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2519412_2519988_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2519933_2520299_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212417.1|2520349_2520595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212416.1|2520718_2521249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2521250_2521706_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273456.1|2521665_2521965_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274832.1|2522087_2523062_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_016209398.1|2523626_2524853_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|2525451_2527158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664814.1|2527325_2528546_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209395.1|2528794_2531485_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_016209384.1|2531776_2532592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126585.1|2532942_2533863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556473.1|2534404_2535493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209380.1|2535625_2536048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209368.1|2536623_2538153_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_016209374.1|2538188_2539640_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 24
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	2575070	2628254	3141916	protease,transposase,tRNA	Prochlorococcus_phage(33.33%)	52	NA	NA
WP_075273327.1|2575070_2575646_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2575591_2575957_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275125.1|2578093_2579137_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210612.1|2580728_2581979_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016210605.1|2581967_2582849_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210611.1|2582841_2583927_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210607.1|2583923_2585183_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210598.1|2585351_2586011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556471.1|2586152_2586824_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210609.1|2587183_2588119_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_016210606.1|2588215_2588842_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210603.1|2588847_2589429_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210601.1|2589500_2590592_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210599.1|2590674_2591388_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_122940948.1|2591481_2592186_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300148.1|2592508_2593570_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126800.1|2593694_2594429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046715.1|2594977_2595223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556470.1|2595522_2596408_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209916.1|2596645_2597617_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	3.7e-34
WP_016209900.1|2597808_2599278_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209924.1|2599271_2600648_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209906.1|2600659_2601052_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209919.1|2601048_2602152_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_032126654.1|2602330_2603632_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209907.1|2603639_2604587_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_016209913.1|2604598_2605417_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_032126655.1|2605419_2606220_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209910.1|2606213_2607272_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_016209903.1|2607268_2608279_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|2608285_2608483_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209914.1|2608543_2611450_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209918.1|2611491_2612346_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_032126652.1|2612378_2612945_-	chorismate lyase	NA	NA	NA	NA	NA
WP_016209915.1|2613027_2613888_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016209922.1|2613979_2614396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209912.1|2614455_2614953_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209920.1|2614998_2617953_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209901.1|2617982_2618315_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209923.1|2618432_2618951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209908.1|2619425_2620136_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209899.1|2620132_2621167_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_032126651.1|2621270_2621456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275054.1|2621576_2621942_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2621887_2622463_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212369.1|2622466_2622913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212599.1|2624147_2624357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275052.1|2624406_2624916_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275050.1|2625060_2625756_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2625831_2626737_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556469.1|2627530_2627839_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080743011.1|2627798_2628254_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	2665333	2804317	3141916	integrase,transposase,plate,tRNA	Escherichia_phage(32.14%)	139	2770273:2770332	2784058:2784249
WP_032126187.1|2665333_2665732_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_051307310.1|2665731_2667204_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_129556464.1|2667209_2667701_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016209516.1|2667690_2669160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|2669164_2669857_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|2669834_2670863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126188.1|2670856_2672083_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209501.1|2672088_2673600_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_016209510.1|2673861_2674299_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209523.1|2674349_2675699_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209529.1|2675703_2676414_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_016209536.1|2676426_2679597_+	intracellular multiplication and macrophage-killing family protein	NA	NA	NA	NA	NA
WP_016209533.1|2681458_2681779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126191.1|2681923_2682445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376335.1|2682577_2683378_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_016210437.1|2683476_2684052_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.5	3.7e-58
WP_016210432.1|2684110_2684782_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_016210442.1|2684827_2685727_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_016210438.1|2685761_2686145_-	response regulator	NA	NA	NA	NA	NA
WP_016210440.1|2686272_2686749_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_033923648.1|2686748_2687030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210439.1|2687026_2687737_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_016210436.1|2687733_2688759_-	phosphotransferase	NA	NA	NA	NA	NA
WP_080664841.1|2688888_2691393_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_016210428.1|2691399_2692671_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_016210429.1|2692672_2693656_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_016210434.1|2693668_2694487_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_016210431.1|2694531_2694924_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_016210435.1|2694983_2695790_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_129556462.1|2696020_2696866_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.8	1.4e-24
WP_105962625.1|2696862_2697749_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007066.1|2698128_2698467_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275039.1|2698461_2698956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|2699759_2700050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007010.1|2700099_2700720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210530.1|2701560_2702241_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_016210535.1|2702237_2703050_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210534.1|2703123_2706804_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_016210531.1|2706813_2708301_-	ribonuclease G	NA	NA	NA	NA	NA
WP_016210527.1|2708310_2708928_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016210528.1|2708997_2709516_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210536.1|2709512_2710412_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2710427_2711471_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210537.1|2711660_2711948_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210532.1|2712059_2713511_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_032126195.1|2713552_2714989_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_155046713.1|2715283_2715448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275038.1|2715585_2716176_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2716121_2716487_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212074.1|2716513_2716735_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212072.1|2716821_2717019_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047032.1|2717048_2717282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212075.1|2717494_2717692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126197.1|2717805_2718759_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300271.1|2718899_2719874_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|2719984_2721046_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126201.1|2721067_2721814_-	lipoprotein	NA	NA	NA	NA	NA
WP_032126199.1|2721943_2722255_+	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_016211487.1|2722602_2722926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211494.1|2722950_2723406_-	arginine repressor	NA	NA	NA	NA	NA
WP_016211489.1|2723395_2724448_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211493.1|2724450_2725914_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211491.1|2726196_2726493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275036.1|2726753_2727815_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210915.1|2727944_2728409_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_032126715.1|2728606_2729422_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210906.1|2729550_2731863_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_051307343.1|2731982_2732510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210909.1|2733202_2734480_+	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_016210914.1|2734485_2734737_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210913.1|2734770_2735292_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_032126716.1|2735462_2736446_-	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210908.1|2736536_2737352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556458.1|2738243_2738477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2738852_2739914_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212580.1|2740649_2741000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2741087_2741453_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2741398_2741974_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211662.1|2742578_2743691_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_032126810.1|2743733_2744432_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211661.1|2744690_2745647_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_016211663.1|2745711_2746377_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_036776715.1|2746470_2747199_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211244.1|2747600_2748296_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_016211242.1|2748249_2749218_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_129556456.1|2749261_2750011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211238.1|2750212_2751706_-	amino acid permease	NA	NA	NA	NA	NA
WP_129556626.1|2752148_2753537_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211235.1|2753966_2754404_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300202.1|2754898_2755627_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211644.1|2755768_2756035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211639.1|2756149_2756452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211640.1|2756831_2757434_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211645.1|2757465_2758215_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	28.2	2.4e-09
WP_016211641.1|2758237_2758693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|2758697_2759300_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211642.1|2759600_2759954_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_016211646.1|2759946_2760186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2760555_2761392_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2761403_2761676_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275032.1|2761726_2762536_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	1.1e-15
WP_075275029.1|2763279_2764008_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	9.6e-43
WP_129556454.1|2764176_2766189_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_080728351.1|2766452_2766611_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211807.1|2766498_2766720_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275025.1|2766969_2768985_+	DUF1561 family protein	NA	NA	NA	NA	NA
2770273:2770332	attL	GAGGCACACGTTTGACGAAAGTGGGGCCTCAGCCGTTTGGCGATCTGCGAGCCATACTCG	NA	NA	NA	NA
WP_036771330.1|2770500_2771475_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_032126150.1|2771573_2771807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212425.1|2771955_2772546_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.4	1.1e-20
WP_016212424.1|2772749_2773028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126738.1|2773020_2773293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|2773419_2774148_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211918.1|2774696_2775665_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_051307368.1|2775664_2776945_-	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_054300202.1|2777602_2778331_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_052047116.1|2779032_2779212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556453.1|2779356_2779788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273432.1|2780207_2780942_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_016212023.1|2780938_2781931_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_016212022.1|2782417_2782636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212021.1|2782635_2783235_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212024.1|2783231_2783480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|2783875_2784604_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
2784058:2784249	attR	CGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTCTTGGCGGTTAGATGAAACGTTGGTGAAAATTAAAGGTCGTTGGTATTACCTTTATCGAGCCATTGATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTT	NA	NA	NA	NA
WP_016212110.1|2785250_2785721_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	62.5	7.6e-33
WP_016212114.1|2785724_2785955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126479.1|2785951_2786305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126478.1|2786291_2786630_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.7e-24
WP_129556625.1|2786622_2787180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275021.1|2787394_2788336_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300201.1|2788403_2789132_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_075274955.1|2789431_2790406_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212306.1|2790441_2790972_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2791001_2791457_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_129556598.1|2794006_2796520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211935.1|2797454_2800103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274958.1|2800551_2801613_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2801639_2802215_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2802160_2802526_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556599.1|2803164_2804317_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 26
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	2916879	2960277	3141916	transposase,protease	Acanthamoeba_polyphaga_lentillevirus(14.29%)	41	NA	NA
WP_016209259.1|2916879_2917728_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_016209274.1|2917844_2918756_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_075274963.1|2919474_2920536_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212454.1|2920755_2921436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211192.1|2922224_2923583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211189.1|2923627_2924086_-	NfeD family protein	NA	NA	NA	NA	NA
WP_016211187.1|2924110_2925031_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_016211186.1|2925157_2925940_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.3	8.2e-32
WP_016211190.1|2926029_2927529_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_016211188.1|2927850_2929734_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_075273298.1|2929807_2930383_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2930328_2930694_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211157.1|2931258_2931915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211161.1|2932022_2933132_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2933143_2933788_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2933806_2934793_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2934872_2935949_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2936151_2936976_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2937292_2938297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2938505_2939471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274965.1|2939609_2940485_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2940781_2941834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2942101_2942530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2942743_2943235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2943290_2944541_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2944643_2944862_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_052104629.1|2945304_2946330_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080728341.1|2946779_2946950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212561.1|2946921_2947062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210728.1|2947976_2948447_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2948735_2950115_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2950142_2950601_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2950578_2951796_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2951987_2952224_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2952237_2952393_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2952473_2953436_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2953595_2954912_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2954921_2955590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2955952_2957767_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_129556601.1|2957884_2958661_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_052104629.1|2959251_2960277_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP038937	Piscirickettsia salmonis strain Psal-026 chromosome, complete genome	3141916	2991962	3109388	3141916	transposase,tRNA	Staphylococcus_phage(33.33%)	111	NA	NA
WP_054300271.1|2991962_2992937_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2993012_2994032_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556602.1|2994430_2994640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274966.1|2996631_2997693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|2997773_2998082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|2998196_2999513_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664857.1|2999974_3001261_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|3001333_3002230_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|3002316_3003315_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|3003423_3003948_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|3004195_3005434_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|3005981_3006455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|3006451_3006847_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3007776_3008352_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3008297_3008663_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211610.1|3008927_3011258_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_129556603.1|3011378_3013394_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075274967.1|3013577_3016970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3017034_3017340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274968.1|3017509_3018610_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|3019004_3020114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209721.1|3021052_3022450_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.3e-77
WP_051307313.1|3022569_3023517_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3023513_3024029_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3024015_3025215_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3025211_3025535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3025536_3026766_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3026765_3027809_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3027808_3028492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3028488_3030978_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3030994_3031249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3031249_3031606_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3032385_3033549_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3033568_3036676_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3036677_3038183_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3038210_3038492_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3038640_3038982_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3039101_3040982_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3041066_3042665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3042682_3043798_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3043925_3044924_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|3044927_3045686_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3045687_3046887_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3046870_3047542_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3047563_3048340_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3048343_3049342_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3049343_3049922_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3049918_3051388_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3051431_3051719_-	trp operon repressor	NA	NA	NA	NA	NA
WP_016209699.1|3051919_3052516_+	DMT family transporter	NA	NA	NA	NA	NA
WP_155063798.1|3052725_3053187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046757.1|3053251_3053407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274971.1|3053551_3054004_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3054189_3054411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|3054526_3055159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274972.1|3055136_3056198_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211865.1|3056637_3057177_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3057261_3057798_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3058449_3058752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3059201_3059510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274973.1|3060100_3060568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3060850_3061561_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3061787_3062186_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|3063053_3064004_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3064003_3066082_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3066229_3066745_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3066753_3067317_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3067297_3068044_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3068183_3068636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3069059_3069896_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3069892_3070789_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3070821_3071889_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3071907_3072276_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3072301_3073750_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3073759_3075139_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3075179_3076511_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3076482_3077442_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3077534_3078038_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3078172_3079324_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3079320_3079800_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3079946_3082268_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3082212_3082839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3082843_3083743_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3083815_3084394_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3084694_3084952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556611.1|3084960_3086114_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046758.1|3087250_3087382_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3087526_3087682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212051.1|3088009_3088783_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126148.1|3089324_3089507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3090110_3091085_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3092179_3092518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212337.1|3092534_3093245_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_051307375.1|3093232_3093424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|3093585_3093885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3093874_3094039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3094095_3094461_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3095765_3096461_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3096457_3097885_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3097910_3098174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3098534_3099509_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556612.1|3099567_3100418_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3100455_3100800_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3100796_3101633_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3101633_3101975_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3101976_3102582_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3102578_3104573_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3104592_3105534_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211292.1|3105761_3107186_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3107698_3108673_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3108731_3109388_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038938	Piscirickettsia salmonis strain Psal-026 plasmid unnamed1, complete sequence	110308	2892	103671	110308	protease,integrase,transposase	Streptococcus_phage(25.58%)	116	68078:68137	91849:92820
WP_054300202.1|2892_3621_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212168.1|3589_5278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155063809.1|5621_6596_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.9e-25
WP_016211953.1|6830_7310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144019150.1|7539_8520_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080664873.1|8429_8744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155063811.1|9356_9557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211955.1|10013_10994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126843.1|12170_12350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126844.1|12568_12865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212118.1|12959_13421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|14339_15314_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_075274955.1|16689_17664_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556704.1|18157_18487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212122.1|19363_20065_+	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_016212121.1|20018_20942_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_032126205.1|21375_21741_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556705.1|21686_22187_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	28.0	9.9e-07
WP_036771330.1|22245_23220_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_054300162.1|23732_24815_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212151.1|25179_26142_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|26165_26480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923686.1|26536_27586_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|27694_28735_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|28748_29378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|29468_29768_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211886.1|29764_30193_-	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_054300202.1|30981_31710_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126832.1|31954_32863_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_054300202.1|32973_33702_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046765.1|33813_34008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|34894_35623_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|35826_38403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|38808_39783_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075274931.1|39983_40712_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.4e-38
WP_016212137.1|41155_42217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212139.1|42292_42538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307371.1|42509_43124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|43941_44916_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556707.1|45275_46295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|46923_48077_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126239.1|48221_48494_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|48505_49342_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075275144.1|49374_50106_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|50203_50617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212017.1|50911_51310_+	hypothetical protein	NA	W8VUR5	Pseudomonas_phage	38.8	2.3e-06
WP_047927838.1|51339_51585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|51581_51881_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016212019.1|52037_52733_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_081377351.1|53546_54326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|54409_54562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|54514_54847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|55011_55389_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|55695_56079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|56548_57277_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_098082839.1|57362_57563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|57730_58099_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211773.1|58200_58875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|59327_59693_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|59638_60214_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126360.1|60420_61155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|61277_62336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|62844_63591_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|63591_63996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|64389_65205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|65809_66538_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212298.1|66979_67306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|67546_68023_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
68078:68137	attL	TGATCAGGCTACCCTATTCCGGACAAATAAATTACAATAATCCGAGCCGGAGGAATCACA	NA	NA	NA	NA
WP_075275158.1|68137_68431_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377916.1|68547_69072_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.4	2.5e-29
WP_098082791.1|69276_69579_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.6	8.6e-14
WP_129556698.1|69587_70289_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_016211912.1|70378_70969_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_032126795.1|71241_71502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|71505_71778_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_016211913.1|72103_73225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273786.1|73657_74056_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377915.1|74064_74622_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	2.9e-47
WP_081377914.1|74766_75096_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|75212_75506_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_016212499.1|76504_76879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|77083_77257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|77504_77954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212412.1|77946_78111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|78411_79038_+	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_054300202.1|79143_79872_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_054300590.1|79901_80126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556699.1|80433_80634_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211871.1|80627_80963_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_032126138.1|81528_81792_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211872.1|82346_83150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|83270_83795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273798.1|83903_84128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126346.1|84219_84462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|84528_85269_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_016212413.1|85316_85745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|86078_86807_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_129556700.1|86983_87229_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|87188_87644_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_054300148.1|87749_88811_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728342.1|88850_89354_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032126739.1|89668_90001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556701.1|90247_90772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275159.1|91180_91888_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	32.0	3.8e-12
WP_129556702.1|91908_93061_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
91849:92820	attR	TGATCAGGCTACCCTATTCCGGACAAATAAATTACAATAATCCGAGCCGGAGGAATCACAATGGGAAAGCGTCACGTCACCAAGTACACCGAAGAATTTAAAAAATCATCTGCCAAGCTTGCAGTCGATTCAAATCAAGCAATCAGTCATACAGCACAGGAATTGGGTATTCACTCAAGTACACTGCATGGTTGGGTCAATAAATATCATCCAAACAGTCCAAATACTGTTAAAGATGAAGTTAGTGATATGGCTGCTGAAATAAAACAGTTAAAAAAAGAGTTGGCTAGAGTGACACAGGAACGTGAAATGCTAAAAAAAGCGTCGGCGTACTTTGCAAGCGAAACACAGTAAAGTATGCCTGGATCAAAGAAAATAAATGTGTTTTTCCAGTAGATAGGGTGTGCTCAATCTTAGGTGTTAGCCGATCAGGTTATTACAGTTGGTTAAAGGTACAGCCTTCCAAGCGAATGATAGAGAACCAAAAATTAGCTAGGCGAATCAAGGAAATATTCATCGAAAGCCGTGCAACCTATGGTACTCGAAGAATTAGAAAACAGTTGGCAACACAGGAAATTTCTGTAAGCCGTAAGCGAGTTGGCCGTTTAATGAAGCAGAACCAGCTTTGCTGCAAGATAAAGCGTAAATTCAAAGTAACTACGGATTCTAAACATCGATTGCCAATTGCGAAAAACGTGTTGGACCGGAATTTTTCAGCAACAGGCCCTAACCAAAAATATGTTGGTGATATTACCTACATACGGACCCAACAAGGCTGGTTGTACTTGGCTGTTGTGATTGACTTATTCTCACGAAAAGTTGTTGGCTGGGCCATGGAGGATCATATGGAAGCATCACTCGTCAATGATGCTCTGTTGATGGCCTTATGGAAACGAAAGCCTAAAGCTGGGTTAATTTGGCATTCAGATCGCGGAAGCCAATATGCTTCAGAAAGTCATCGTGAGATTCTTA	NA	NA	NA	NA
WP_075273327.1|94045_94621_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|94566_94932_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212398.1|96279_96741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|97003_97840_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_129556717.1|98165_99392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|100046_101021_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_016212260.1|101178_101451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|101470_101695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|102031_102235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212255.1|102231_102402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|102588_103671_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
>prophage 1
NZ_CP038939	Piscirickettsia salmonis strain Psal-026 plasmid unnamed2, complete sequence	79943	4824	28863	79943	transposase	Streptococcus_phage(16.67%)	33	NA	NA
WP_075273327.1|4824_5400_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|5345_5711_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212400.1|5761_6361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212399.1|6360_6621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|6750_7903_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212392.1|7931_8939_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	26.4	1.2e-06
WP_075273802.1|9002_9731_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_016212131.1|9914_10262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212135.1|10700_11885_+	3-methylitaconate isomerase	NA	NA	NA	NA	NA
WP_075275202.1|12128_12830_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	6.0e-10
WP_075275201.1|12832_13561_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_016212164.1|13689_14718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211443.1|15741_16428_+	Fic family protein	NA	NA	NA	NA	NA
WP_016211439.1|16431_16986_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	40.6	1.0e-20
WP_016211436.1|17030_17969_+	fic/DOC family protein	NA	S4TP71	Salmonella_phage	37.2	5.2e-25
WP_016211434.1|17941_18133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211445.1|18310_18661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211437.1|18677_19304_-	zinc-ribbon domain-containing protein	NA	A0A1S5XYQ1	Kurlavirus	28.2	4.4e-12
WP_032126541.1|19310_19703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211440.1|19713_20628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211444.1|20897_21404_+	antirestriction protein ArdA	NA	A0A222YZE5	Mycobacterium_phage	33.7	2.8e-17
WP_051307358.1|21552_21936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556729.1|22219_22450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212541.1|22436_22661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212539.1|22720_22870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|22866_23841_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212090.1|23884_24064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212087.1|24063_24492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126714.1|24659_25199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212089.1|25435_25666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126713.1|25764_26802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|27271_28297_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275198.1|28323_28863_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	40.2	8.4e-12
>prophage 2
NZ_CP038939	Piscirickettsia salmonis strain Psal-026 plasmid unnamed2, complete sequence	79943	37206	57887	79943	terminase,head,portal,capsid,tail,protease	Pseudomonas_phage(11.76%)	29	NA	NA
WP_129556725.1|37206_37887_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	39.3	3.3e-37
WP_016210977.1|38065_38359_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_129556724.1|38576_38759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046773.1|38903_39083_-	phosphatase	NA	NA	NA	NA	NA
WP_129556723.1|39177_39495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126134.1|39795_40179_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	5.6e-26
WP_016212234.1|40266_40746_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_016212231.1|40749_40959_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	43.1	1.3e-08
WP_080743047.1|40974_41331_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	61.3	5.4e-23
WP_081377926.1|41349_42432_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	1.2e-89
WP_016211136.1|42428_43670_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	46.0	3.1e-86
WP_080664855.1|43617_44289_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_016211140.1|44346_45540_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_016211133.1|45660_46995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|47185_47497_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211132.1|47493_47817_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211139.1|47809_48205_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211129.1|48201_48552_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|48551_48974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126913.1|48975_49299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|49355_49622_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_032126912.1|49625_51704_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.0	2.5e-56
WP_016210657.1|51696_52038_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|52034_52706_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|52674_53421_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_016210665.1|53410_53968_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_016210662.1|53974_54262_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	2.5e-15
WP_016210670.1|54251_54506_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_016210653.1|54599_57887_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	33.5	5.2e-112
>prophage 1
NZ_CP038940	Piscirickettsia salmonis strain Psal-026 plasmid unnamed3, complete sequence	36705	14424	22147	36705	transposase,integrase	unidentified_phage(33.33%)	10	8029:8088	21469:21660
8029:8088	attL	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTA	NA	NA	NA	NA
WP_129556741.1|14424_15096_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.4	3.4e-10
WP_052133268.1|15117_15399_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	38.7	8.3e-11
WP_016212274.1|15471_15936_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032126154.1|15946_16141_-	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_032126152.1|16356_16947_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
WP_129556740.1|17010_17379_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155046774.1|17590_17767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300579.1|17985_18987_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	1.3e-26
WP_016211990.1|19316_21389_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_129556739.1|21418_22147_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
21469:21660	attR	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTACCGTGATCTCAAAGAAATAGCAGCTGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGTTGGGTGCACGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTC	NA	NA	NA	NA
