The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	31805	91882	3195621	tRNA,transposase	Staphylococcus_phage(28.57%)	53	NA	NA
WP_036772169.1|31805_32681_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33039_34395_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34486_34993_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34989_35358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36760_38545_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39025_40153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40225_40981_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|41017_43711_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43742_44294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44401_45415_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45535_45760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46115_46877_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47307_48102_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|48246_48999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49310_50837_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50975_52049_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|52088_53396_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53370_54540_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54594_55320_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55785_57891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|58105_58570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58589_59099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59483_60425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60706_62158_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155051387.1|62271_62427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773655.1|62624_63029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63589_64564_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|65298_65676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|66265_67240_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773242.1|67279_67834_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|68014_68914_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|68918_69545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|69489_71811_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|71957_72437_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|72433_73585_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|73719_74223_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|74316_75291_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|75280_76594_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|76634_78014_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|78020_79472_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|79497_79866_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378407.1|79884_80952_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|80984_81881_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|81877_82714_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|82849_83302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|83440_84187_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|84167_84731_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|84739_85255_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|85396_87475_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|87474_88425_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|89292_89691_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|89916_90246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|90862_91882_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	123280	241348	3195621	protease,tRNA,transposase	Staphylococcus_phage(12.5%)	105	NA	NA
WP_075278722.1|123280_124156_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|124596_124890_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|124890_125145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|125161_127654_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|127646_128330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|128329_129373_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|129372_130602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|130603_130933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|130929_132129_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|132241_132631_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|132630_133575_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|133694_135092_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|135417_135939_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|136062_136371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|136385_141608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|141998_144005_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|144135_146466_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|146641_147472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|147588_147984_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|147980_148514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|148510_148912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|149306_149627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|149636_150593_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|151102_151627_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|151727_152726_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|152814_153711_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|153784_155071_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|155530_156847_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|156960_157131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|157150_158125_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|158251_158512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|158779_159070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|161608_162649_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|162751_163723_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|163845_164694_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|164845_165133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|165443_165815_+	isochorismatase	NA	NA	NA	NA	NA
WP_017377540.1|166866_167100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|167237_167375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|167388_167601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|168124_168949_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|169087_170221_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|170280_171690_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|171837_173418_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|174175_175171_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|175176_177243_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|177300_178251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|178445_178772_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|178994_180254_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|180513_181389_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|181427_182390_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|188084_188429_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|188525_189449_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|189948_190437_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|190539_191340_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|191350_193102_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|193991_194234_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|194237_194636_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|194867_195743_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|196461_196920_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|197101_197287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|198002_199817_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|200227_200896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|200905_202222_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|202381_203344_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|203424_203580_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|203593_203830_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|204022_205240_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|205217_205676_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|205703_207083_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|207119_207338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|207657_208953_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|209157_209349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|209547_210423_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|210610_211876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|211909_212785_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|212906_213365_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|213388_214309_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|214436_215219_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|215309_216809_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|217122_219006_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|219265_219928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|219994_221104_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|221115_221760_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|221778_222765_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|222849_223926_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|224127_224952_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|225254_226220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|226538_227591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|227649_228624_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|228959_229388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|229624_230107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|230162_231413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|231515_231734_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|232205_233060_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|233114_233585_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|233881_234118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|234264_234645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|234703_235579_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|236345_237257_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|237373_238222_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|238288_239299_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|239322_239646_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375571.1|239656_240058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|240328_241348_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	315151	357798	3195621	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|315151_316027_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|316107_316740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|316693_318139_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|318173_318593_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|319366_319735_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|319744_320284_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|320444_320876_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|320879_321578_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|321825_322332_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|322374_322743_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|323013_327090_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|327153_331362_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|331523_331898_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|332002_332476_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|332491_334603_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|334630_335821_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|335827_336139_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|336261_336900_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|336915_337533_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|337529_337826_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|337840_338665_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|338681_338957_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|338962_339295_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|339307_340042_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|340055_340469_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|340468_340669_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|340668_340926_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|341047_341416_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|341433_341745_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|341760_342303_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|342315_342621_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|342649_343042_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|343054_343588_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|343597_343951_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|343961_344462_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|344467_344650_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|344652_345087_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|345087_346410_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|346466_346580_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|346723_347080_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|347105_347495_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|347504_348125_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|348146_349124_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|349172_349571_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|349683_350931_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|350917_351574_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|351658_351937_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|352179_352407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|352539_353334_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|353642_354857_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|355254_355434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066878.1|355804_356344_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|356719_356968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|357057_357798_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	375816	425499	3195621	tRNA,transposase	Staphylococcus_phage(25.0%)	55	NA	NA
WP_017376964.1|375816_378297_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|378383_378863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|378835_379876_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|379812_380529_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|380541_380877_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|380913_381384_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|381426_383262_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|383306_384395_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|384416_385478_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|385555_386071_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|386111_387389_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|387403_388255_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|388283_388931_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|388927_389887_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_036774534.1|389978_390404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875861.1|390408_391278_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|391422_391677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|391821_392388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|392493_392934_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_027242664.1|393445_394648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|394931_395906_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046562.1|396087_396231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046563.1|396375_396513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|396529_396745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|396949_397561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|397557_397815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|398065_398458_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|398587_399136_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|399135_399963_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|400012_401698_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|401775_402237_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|402273_402837_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|403063_403393_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|403373_403598_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|403742_404333_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|404357_405629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|405646_406900_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|406896_407541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|407613_408663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|408764_410402_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|410436_410766_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|410922_411210_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376927.1|411636_411774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046565.1|411736_412030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|412279_413500_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|413558_416357_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|416662_417829_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|417927_418464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|418525_418858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|419115_420018_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|420087_420585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|420730_422134_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|422334_423063_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963630.1|423232_424090_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_048875864.1|424473_425499_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	451571	499710	3195621	transposase	Staphylococcus_phage(100.0%)	42	NA	NA
WP_036774259.1|451571_452546_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377364.1|452695_453532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|453651_455055_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242658.1|456397_457861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856768.1|457936_458731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242656.1|459022_459841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|459858_460452_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376894.1|460668_460902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242655.1|461125_462022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155050372.1|462317_463097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376891.1|463266_464169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|464165_465389_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_027242653.1|465406_466333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|466348_467389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242651.1|467503_467914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376888.1|467966_468470_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_017376887.1|468462_469209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376886.1|469211_470342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|470346_470586_+	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_027242650.1|473075_473564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|473566_474643_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_017376878.1|474635_475289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875870.1|475295_475721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|475757_478757_+	ATPase AAA	NA	NA	NA	NA	NA
WP_027242646.1|478818_480321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|480772_482392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|482433_484737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376870.1|485013_485910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|485912_489239_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_144420818.1|489440_489629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|489640_490117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|490159_490387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|490568_491102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|491132_491474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772347.1|491476_491893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876253.1|492054_492711_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036771639.1|492707_493682_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|494123_494387_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|494814_495789_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_087910671.1|496176_496641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910670.1|496734_496920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|498735_499710_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 6
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	504514	559197	3195621	transposase	Streptococcus_phage(22.22%)	52	NA	NA
WP_048875872.1|504514_505798_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|505970_506108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|506104_507508_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|507621_508059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|508179_508608_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|508855_509293_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|509724_511113_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|511559_513053_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|513247_514003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|514502_514733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|515837_516848_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|516844_517066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|517784_518726_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|519253_519652_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|519591_520446_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|520537_520819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|520904_521582_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|521627_522908_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|523083_524133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|524211_525012_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|525025_525820_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|525922_526942_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|526988_527600_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|527603_528290_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|528286_528829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|529121_530309_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|530553_531279_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|531464_532253_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|532249_532645_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|533037_534078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|534074_535478_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|537893_538151_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|538190_539576_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242633.1|539905_541003_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_017377120.1|541036_542287_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|542287_542920_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|543209_543662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|543707_544550_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|544584_545076_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|545271_547239_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|547466_547871_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|547848_548877_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|548863_549652_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|550078_551482_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377110.1|551683_552694_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_075275363.1|552706_553174_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377107.1|553503_554874_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_017377106.1|555176_555647_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377105.1|555924_556200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|556210_557614_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069971661.1|557788_558226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|558222_559197_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 7
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	590988	724382	3195621	plate,tRNA,transposase	Staphylococcus_phage(13.64%)	111	NA	NA
WP_036772726.1|590988_591537_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|592289_593669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|594028_595492_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|595675_596488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|596952_598947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|599341_600721_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|600758_601196_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|601238_601955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|603501_604032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|604098_605919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|606483_606990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|607074_608478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|608592_608847_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|608999_609272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|609847_610030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|610146_610722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046568.1|610730_610889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|611789_612032_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|612334_613426_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|613406_614360_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|614583_616068_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|616107_616611_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|616870_618046_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|618193_618598_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|618754_619630_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|619664_620018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|623347_623773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|624003_625140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|625126_626449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|626441_627560_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|627680_628214_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|628352_629990_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|629994_630216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|630324_631338_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|631609_633838_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_026063593.1|633818_634523_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|634757_635087_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|636487_636706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|636764_637640_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|637632_638499_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|638566_639886_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|640355_640916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|641234_642161_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|643056_643965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|647661_648501_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|648687_648903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|648951_649527_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|649523_649862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|650030_651020_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|652009_652912_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875883.1|653171_653708_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|653852_654770_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|655204_656215_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|657022_657559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|658771_659119_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|659263_660223_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|660324_661107_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|661239_662199_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|662223_662628_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|662656_663331_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|663430_665146_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|665142_665505_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|665519_666674_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|666677_667685_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|667687_668704_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|668919_670005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|670111_670504_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|670636_671920_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|671935_673237_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|673254_675057_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|675061_676054_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|676134_677211_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|677308_678283_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|678350_679322_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|679505_679775_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|680376_681663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|681727_682408_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376024.1|688063_688312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816881.1|688389_688608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275355.1|688631_689606_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_027242570.1|689819_690959_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|691167_692538_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|692916_693909_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|693912_694428_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|694424_695264_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|695296_696847_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|696954_697326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|698546_698708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|699288_700692_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|700726_701164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|701187_702162_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|702220_702649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|702836_703643_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|703717_704110_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|704154_704976_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|704988_705972_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|705973_707242_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|707248_709753_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|709883_710909_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|710905_711616_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|711540_712371_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|712520_712904_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|712938_713838_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|713883_714555_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|714637_715213_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|715311_716112_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|716253_717111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|717973_719110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|719176_722347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|722359_723070_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|723074_724382_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	733024	779340	3195621	transposase,plate	Staphylococcus_phage(21.43%)	52	NA	NA
WP_017376356.1|733024_733423_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|733419_735108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|735089_736046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|736088_736604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|736708_737641_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|737860_738247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|738264_738909_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|739059_739899_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|739974_740577_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|740577_741432_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|741789_742101_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|742125_743514_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|743669_744401_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|744397_744925_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|744956_745514_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|745519_746500_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|746639_747440_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|747443_748211_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|748207_748672_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|748694_749348_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|749351_749699_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|749732_749984_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|750061_751330_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|751332_752091_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|752152_753043_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|753093_753777_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|753786_754134_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155066880.1|754406_756137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556468.1|756223_756526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|756517_757390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|757557_759387_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|759554_760196_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|760520_760967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|760984_761158_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|761216_762266_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|762272_763223_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|763277_764222_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|764249_764987_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|765075_765318_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|765392_766616_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|766647_767496_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|767492_768545_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|768681_769302_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|769527_770680_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|771700_772675_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|772671_772842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|773810_774407_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|774375_775536_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_146619455.1|776130_776388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|776491_777526_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|777522_778233_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|778365_779340_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 9
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	787500	841811	3195621	protease,tRNA,transposase	Prochlorococcus_phage(33.33%)	49	NA	NA
WP_017377942.1|787500_788007_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_155046572.1|788088_788511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|788596_789457_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|789554_790100_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|790182_791034_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|791075_793982_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|794042_794240_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|794246_795257_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|795253_796312_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|796326_797106_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|797108_797921_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|797932_798880_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|798890_800183_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|800361_801465_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|801461_801854_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|801866_803243_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|803236_804706_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|804899_805334_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|805629_805806_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|806840_807866_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_155046573.1|808328_808760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|810152_810803_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|811501_812296_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|812475_813120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|813294_814269_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|814669_814927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|816604_817282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|817515_818340_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|818433_819147_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|819236_820328_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|820399_820981_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|820986_821613_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|821709_822657_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|823003_823666_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|823836_824496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|824664_825924_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|825920_827006_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|826998_827880_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|827868_829119_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|830504_830825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|831083_831350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|831840_832059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|833044_833266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|833262_834345_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|834355_834727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|834723_834903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|837606_837882_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|838717_840175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|840602_841811_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	885491	948278	3195621	tRNA,transposase	Staphylococcus_phage(28.57%)	53	NA	NA
WP_048875904.1|885491_886367_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|886623_887061_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|887121_887754_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|887769_888417_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|888419_890483_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|890809_892102_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|892490_894701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|894717_895374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|897759_898635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|898893_899505_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|899932_902521_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|902623_903385_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|903381_903918_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|903966_904923_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|905000_908186_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|908189_909245_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|909474_910077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|910120_910783_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|910817_911165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375702.1|911633_912665_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|913127_914531_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|915649_915994_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|916085_916541_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|916789_916924_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|916916_917558_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|917554_918271_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|918274_919594_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155046577.1|920275_920437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773644.1|921398_924035_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_036773645.1|924076_925162_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|925161_925845_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_065653732.1|927453_927855_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377747.1|928007_928262_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|928340_928658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|928810_929209_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|929290_929929_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|930085_931060_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|931432_931708_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|932257_932542_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|934358_934952_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|936018_936900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|937011_938691_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|938817_940068_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|940143_940605_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|940601_941750_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|941755_942430_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|942426_943083_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|943208_943682_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|943683_944106_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|944092_945112_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|945271_945451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|945669_945951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|947402_948278_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	952180	1019143	3195621	protease,tRNA,transposase	Bacillus_phage(20.0%)	57	NA	NA
WP_048876012.1|952180_953584_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|953942_954710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|954823_956227_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|956223_956385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|956700_957675_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|957915_959199_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|959265_960189_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|962384_964529_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|964550_964757_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|964817_965438_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|965478_966372_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|966457_967183_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|967244_967649_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|967811_969920_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|970043_971093_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|971089_972556_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|972698_974036_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|974103_975594_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|975822_976194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|976344_977172_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|977474_978131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|978078_979002_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|979015_979939_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420713.1|980168_980870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|982569_982797_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_016210338.1|982864_983002_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376989.1|983121_983670_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|983750_984026_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|984025_985075_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|985187_987125_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|987272_988985_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|989053_989773_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|989769_990372_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|990486_991374_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|991564_991912_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|991962_992802_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|992897_993644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|993840_994467_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|994782_995352_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|995495_996194_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|996900_997524_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|997633_998527_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|998633_1000244_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|1000240_1001536_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|1001557_1003480_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|1003590_1003893_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|1003987_1008874_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1008921_1010244_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1010368_1011463_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1011514_1012453_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1012533_1013118_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1013502_1014393_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1014595_1015087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1015226_1015718_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1015886_1016600_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065653747.1|1016662_1018003_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1018267_1019143_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	1024756	1087283	3195621	transposase	Staphylococcus_phage(33.33%)	57	NA	NA
WP_017377787.1|1024756_1024984_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1025010_1026051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1026117_1026687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1026917_1027322_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1027334_1027475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1027569_1028769_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1028789_1029401_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1029602_1030364_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1030659_1031586_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1031746_1032703_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1032847_1033117_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1033383_1034358_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1034511_1034739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1034855_1035281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1035437_1036367_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1036813_1037344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|1037665_1037971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1038448_1038760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1039099_1040266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1042453_1043425_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1044027_1044201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1044596_1045514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1045514_1046366_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1046806_1047853_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1047842_1049834_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1049943_1050318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1050571_1050754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1051015_1051717_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420709.1|1051717_1052137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619460.1|1053790_1056574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1056809_1058102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1058588_1059494_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376296.1|1060271_1060988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1061273_1062035_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1062067_1063471_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1063467_1063632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1063691_1063979_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1064723_1065452_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1065420_1066167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046685.1|1066217_1066637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1066633_1067608_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1067764_1068082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772457.1|1070557_1070866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1070941_1071214_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1073747_1074185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1074786_1075974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1076244_1077879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1077929_1078658_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1080085_1081048_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1081271_1082267_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1082294_1083230_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1083273_1083735_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1083713_1084331_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1084360_1085335_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1085389_1085857_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1085869_1086514_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1086554_1087283_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 13
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	1095983	1145552	3195621	transposase	Acinetobacter_phage(25.0%)	39	NA	NA
WP_082300708.1|1095983_1096544_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1097868_1098264_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1098272_1098629_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1098621_1099497_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1099582_1100161_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1100118_1100412_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1101372_1102884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1103131_1104535_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1104740_1105175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1105257_1105962_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1106220_1106709_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1106737_1107412_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1107652_1108528_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275340.1|1109058_1109667_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1109937_1110396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1110674_1111064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1111249_1112065_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1112287_1113193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1113356_1114118_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1114121_1114988_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1115073_1115685_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1116063_1117311_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1117462_1118164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1118461_1118635_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1119124_1119625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066883.1|1120716_1120932_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036774233.1|1120984_1121218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1121246_1121927_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1121949_1124124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1124369_1125440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1125436_1126840_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378190.1|1126982_1127474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1127545_1128367_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1129033_1130533_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1130836_1133530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1133526_1136928_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_048875961.1|1138515_1139919_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1140997_1141669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1144577_1145552_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 14
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	1170275	1226669	3195621	tRNA,transposase	Staphylococcus_phage(37.5%)	52	NA	NA
WP_053093677.1|1170275_1170995_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1171222_1171399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1171647_1171971_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1172059_1174078_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1174100_1175054_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1175219_1176407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1177120_1177759_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1178056_1179052_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_027242772.1|1179192_1180239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1180231_1181257_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1181323_1183354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1184660_1184888_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1186231_1186375_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1186371_1187064_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242771.1|1187330_1187648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|1187790_1188201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1188357_1188684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1188830_1189868_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1189909_1190155_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_129556541.1|1190279_1190594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1190601_1192176_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1192330_1192900_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1193209_1195012_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1195008_1195950_+	signal peptidase I	NA	NA	NA	NA	NA
WP_036771308.1|1195977_1196199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242761.1|1196361_1197036_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1197041_1197941_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1197954_1198698_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1198700_1199432_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1199428_1199812_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1199949_1201197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1201607_1202753_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1202745_1203099_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1203379_1203922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1204566_1204755_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1204774_1205749_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1205792_1206668_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1207021_1207849_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1207948_1208110_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1208760_1210101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1211152_1211380_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|1211521_1212883_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1212978_1213638_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144420701.1|1214478_1214835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1215431_1216991_-	APC family permease	NA	NA	NA	NA	NA
WP_027243001.1|1217351_1219322_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375893.1|1219519_1220590_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1220647_1220854_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1220860_1222336_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1222471_1223035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1223204_1224608_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1225574_1226669_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	1242911	1290636	3195621	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_036772169.1|1242911_1243787_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1243856_1244960_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1245027_1245351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1245507_1246290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1246425_1247403_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1247476_1249468_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1249523_1249805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1250058_1251258_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_051929862.1|1253689_1254202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1254388_1255264_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1255300_1255465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1256673_1257087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1257097_1257433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1257577_1258696_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1258925_1259192_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1260474_1260702_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1260712_1261219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1261296_1261914_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1262045_1263278_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1263267_1263930_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1264204_1265461_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1265598_1266258_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1266332_1267034_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1267781_1268756_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1269964_1270318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1270531_1270726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1270793_1271306_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1271443_1272298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1272346_1272991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1273024_1273669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243125.1|1274191_1274485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1274583_1275366_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1275448_1276399_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1278441_1281282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1281304_1281886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1282005_1282734_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1282879_1283854_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1283969_1284875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1285473_1286220_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1286472_1286865_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1286902_1287550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1289265_1290636_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	1314455	1355665	3195621	transposase	Enterobacteria_phage(16.67%)	37	NA	NA
WP_048876023.1|1314455_1315559_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1315649_1316802_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1317215_1318067_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|1318204_1318354_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1318978_1321345_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1321392_1322589_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1323157_1325590_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1325911_1327411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1327519_1328092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1328406_1329876_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1329948_1330698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1330701_1331475_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1331573_1332524_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1332663_1334106_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1334321_1335506_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1335629_1336316_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1336451_1337036_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1337125_1337455_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1337790_1338030_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_017377970.1|1338078_1338270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1339044_1339338_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1339486_1339648_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1340162_1340702_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1341040_1341685_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1342018_1342669_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1343192_1344245_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1344262_1347343_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1347508_1347757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1347822_1348698_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1349620_1350127_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1350144_1350342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1350360_1350504_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1350571_1350745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1350949_1352263_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1352272_1352536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1352594_1353569_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1355437_1355665_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 17
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	1386882	1435781	3195621	tRNA,transposase	Bacillus_thuringiensis_phage(25.0%)	40	NA	NA
WP_036772026.1|1386882_1387758_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1387862_1391165_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1391161_1392985_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1393024_1393423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1393531_1394548_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1394982_1396437_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1396518_1399575_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_144420694.1|1399868_1400105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081329473.1|1400965_1401385_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376676.1|1401757_1402222_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1402294_1403296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1406188_1406521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1406882_1407026_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1407013_1407958_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080963606.1|1407961_1408348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1408169_1408508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1408882_1409482_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1409481_1409829_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1409979_1410963_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1411872_1412187_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1412335_1412494_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1412465_1413395_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1414309_1414726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1415854_1416571_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1417319_1417478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1417526_1418102_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1418246_1418525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1418589_1419465_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1419630_1423497_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1423652_1424462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1424511_1425333_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1425532_1426765_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1426935_1427661_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1427703_1429242_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1429248_1430634_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1430947_1431997_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1432556_1432934_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|1433125_1434001_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1434982_1435210_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1435262_1435781_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	1440079	1508970	3195621	transposase	Staphylococcus_phage(20.0%)	60	NA	NA
WP_048875984.1|1440079_1440616_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876016.1|1440760_1441171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375877.1|1441441_1441690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|1442050_1442386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375878.1|1442723_1442996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243180.1|1443067_1444327_-	phosphoesterase	NA	NA	NA	NA	NA
WP_017375881.1|1444411_1445677_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_026063485.1|1445835_1446318_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_036772592.1|1446395_1447856_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_155046587.1|1447978_1448119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|1448532_1449033_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_017375698.1|1455147_1456341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243221.1|1456684_1458313_+	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_027243222.1|1458328_1459477_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_051929845.1|1459551_1460376_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1460779_1461754_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1461939_1462533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1462713_1463178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1463572_1463854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1463850_1465254_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1465905_1466286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1466525_1467182_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1467326_1467623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1467682_1467970_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_027243051.1|1468253_1468463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772296.1|1469159_1469537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1469736_1470786_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1470762_1472580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1472850_1473429_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1473456_1473921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1473957_1475415_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1475476_1476964_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1477733_1478336_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1478897_1479368_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1481015_1481759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1481910_1482342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1484979_1486326_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1486413_1488219_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1488684_1489482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1489866_1490328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1490550_1491525_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1491567_1491690_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1491761_1493717_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1494106_1494292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1494613_1495603_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1496015_1497641_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1497749_1498064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1498359_1499745_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1499909_1500137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1500277_1500736_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1500936_1501122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1501190_1502018_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1502472_1502997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420684.1|1503179_1503428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1503597_1504551_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1504745_1505720_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1505847_1506873_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1507525_1507813_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1507872_1508205_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1508409_1508970_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
>prophage 19
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	1517691	1625645	3195621	protease,integrase,tRNA,transposase	Staphylococcus_phage(21.74%)	104	1506542:1506601	1576967:1577577
1506542:1506601	attL	CCACCACGTGTCACTGATAAGTGGACGTGCGTATTCCAATTTAAACTCTGGCCGAAAGTA	NA	NA	NA	NA
WP_017376809.1|1517691_1519461_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_017376808.1|1519599_1520643_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376807.1|1520656_1521400_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_027243093.1|1521512_1521830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1521891_1522071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243094.1|1522133_1522841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420791.1|1523624_1524836_+	protein kinase	NA	NA	NA	NA	NA
WP_017376801.1|1524891_1525716_-	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_017376798.1|1526903_1527539_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017376797.1|1527820_1528180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1528453_1530739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420683.1|1530727_1531384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|1531560_1532193_+	MarC family protein	NA	NA	NA	NA	NA
WP_027243097.1|1532228_1532414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243098.1|1532479_1533625_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243099.1|1533860_1535174_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_155046588.1|1536289_1536499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420682.1|1537033_1537195_-	phosphatase	NA	NA	NA	NA	NA
WP_017376785.1|1538601_1539507_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376784.1|1539747_1539933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242578.1|1539969_1540506_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_027242577.1|1540523_1541825_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_048876008.1|1541821_1542796_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_144420681.1|1542839_1543025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1543204_1543369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1543370_1544246_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1544561_1545482_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1545497_1545881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1546207_1547164_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_144420678.1|1547431_1547710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243017.1|1548208_1549552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|1549725_1549869_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1549948_1550923_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1551070_1552942_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1552974_1553073_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1553308_1553938_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1553921_1554344_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1554350_1556090_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1556090_1557155_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1557158_1557512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1557624_1558593_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1558602_1558914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1558929_1559499_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1559762_1561091_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1561131_1562106_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1562692_1563094_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146619459.1|1563613_1566070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1566272_1567124_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1567169_1568876_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1570347_1571322_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1571684_1571930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1572293_1573322_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1573452_1573656_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420676.1|1573940_1574897_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_047927838.1|1575189_1575435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1575431_1575731_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1575953_1576424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1577034_1577262_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036772851.1|1578484_1578802_+	hypothetical protein	NA	NA	NA	NA	NA
1576967:1577577	attR	TACTTTCGGCCAGAGTTTAAATTGGAATACGCACGTCCACTTATCAGTGACACGTGGTGGTGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGATAGGTTAGCATTGGCTGTATGCAACCGATCATGATTGTAATATCGAATATAGGCCTCAACATCCTCCTTCATAGTATCACGGGTTAAGTGAATCACATTCAACAGCCATTCGTGCTTTAGGCTGCCAAAAAAACGCTCGACAACCGCATTGTCAACGCAAGCACCGACACTGCTCATAGAAGCGGTGATTTTATGCTTCTTCAACAGTTTTCGATATTTTTTACTGGTATACTGCGAACCACGATCACTGTGAAATAACAAGTGTTCTGTCGGCTGCCGCAAGTGAATCGCCATATCCATTGCACGACAAACTAGATTTTCGCTCATTCTCTTATTCATCGCCCAGCCAATCACTTTTCGAGAGTATAAATCAATAACGACCGCAAGATACAACCAGCCTTCAGCAGTTCTAAGGTAGGTAATGTCACCTGCCCATGAGTGATTTGCAATGACTGGATTAAACTGCTGATTCAATACGTTATCTGCAACAGC	NA	NA	NA	NA
WP_027243023.1|1578795_1579038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243024.1|1579388_1580489_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_017377328.1|1580657_1581959_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_047927520.1|1582035_1582539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|1582714_1584118_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1584305_1585163_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1585287_1585923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1585971_1586223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1586478_1587378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1587514_1588588_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1588688_1589102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1589122_1589836_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1590023_1591436_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1591645_1592614_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1593347_1593716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1593719_1594037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1594112_1595087_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1595606_1596107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1596177_1597506_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1597641_1599030_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1599177_1600488_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1600828_1602112_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1602185_1602806_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1603004_1603265_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1603467_1603614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1603589_1604183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1606046_1606265_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1607517_1608288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1608374_1608590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1608686_1609808_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1610074_1611049_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1611311_1612433_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1612725_1613013_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1612985_1613489_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1613569_1614229_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1614570_1615488_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1615617_1615791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1616456_1617815_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_144420789.1|1618006_1618453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376485.1|1618647_1619877_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1619922_1620549_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1620698_1621886_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1621894_1622587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1622708_1623861_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1624661_1625645_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 20
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	1683980	1774295	3195621	protease,tRNA,transposase	Burkholderia_phage(14.29%)	82	NA	NA
WP_036774017.1|1683980_1684856_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1685245_1685584_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1685580_1686177_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1686179_1688174_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1688237_1689176_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1689524_1690499_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1690702_1690900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1691061_1691466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1693049_1693490_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1693816_1694692_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1694704_1694947_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1695353_1695608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1696819_1697785_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1697877_1698189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1698389_1699166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1699995_1700187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1700915_1701965_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1702135_1702909_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1702969_1704559_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1704749_1705841_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1705863_1706181_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1706267_1707545_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1707566_1708403_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1708409_1710044_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1710475_1710835_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1711116_1712475_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1712500_1712743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1713236_1713416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1713671_1714928_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1715041_1715299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1715443_1716454_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1716830_1717685_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1717714_1718548_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036773204.1|1719124_1719898_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1719979_1720300_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1720518_1721424_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1721509_1721908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1722052_1722550_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047927093.1|1724210_1725314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1725412_1725790_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1725869_1726844_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1728388_1729108_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1729191_1729479_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1729763_1730636_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1730592_1731369_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1731573_1731909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1732307_1732664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1732825_1733101_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1733210_1733558_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1733575_1734355_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1734354_1734864_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1734899_1735148_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1735459_1735795_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1736094_1737345_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1737426_1739454_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1739999_1740218_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1740389_1740752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1740900_1742304_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1742585_1743761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1743778_1745776_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1745756_1746737_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1746792_1747635_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_036772544.1|1747634_1748051_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1748031_1748451_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1748473_1749103_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1749671_1751861_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1751872_1753078_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1753062_1754910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1754894_1756133_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1756119_1757988_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1758021_1759275_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1759280_1760138_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1760156_1760885_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1762023_1762815_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1763180_1763468_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|1765590_1765980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1766156_1766915_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1766911_1769311_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1769324_1770602_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1770691_1771990_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1772187_1773081_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1773080_1774295_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 21
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	1784994	1835479	3195621	tRNA,transposase	Vibrio_phage(14.29%)	46	NA	NA
WP_069971651.1|1784994_1785870_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1786242_1786506_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1786812_1789407_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1789403_1789886_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1789863_1790904_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1791078_1791564_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1791671_1794242_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1794275_1794737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1795073_1795949_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1796226_1797987_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1798080_1798746_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1798758_1800264_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1800285_1800816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1800889_1802152_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1802338_1803211_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1803312_1804101_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1804193_1805519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1805872_1807048_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1807216_1807870_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1808025_1809966_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1809962_1810586_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1810750_1811725_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1811996_1812617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1812613_1814017_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1814084_1814501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1814908_1815406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1815402_1816377_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|1816456_1817026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1817170_1817707_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1817711_1818008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1818016_1818622_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1818807_1819206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1819396_1819600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1819744_1819900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1820024_1820477_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1820593_1822066_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1822504_1822969_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1823657_1824908_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1825017_1825488_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1825510_1826104_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1826241_1827291_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1827314_1828238_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1828254_1828716_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1828823_1829642_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1830251_1830395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1834558_1835479_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 22
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	1897772	1913088	3195621	transposase	Staphylococcus_phage(50.0%)	15	NA	NA
WP_017378288.1|1897772_1897994_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1898052_1899027_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1899225_1899390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1899386_1900022_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046602.1|1900298_1901078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1901110_1901872_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1901848_1902838_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1902973_1903849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1903867_1904527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1904768_1905215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1905211_1906615_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1906728_1907574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1907718_1909368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1909458_1910244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|1911684_1913088_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	1941761	1990633	3195621	tRNA,transposase	uncultured_Mediterranean_phage(33.33%)	43	NA	NA
WP_144420657.1|1941761_1942823_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1943534_1943696_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1944612_1945152_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1945534_1945951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1946046_1946862_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1946994_1948488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1948673_1949099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1949095_1951156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1951439_1952255_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1952355_1953174_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1953170_1953539_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1953720_1954548_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1954611_1955340_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1955742_1956471_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1956860_1957586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1957620_1961493_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1961693_1962827_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1962840_1963029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1963252_1964611_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_036773947.1|1966217_1967093_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1967604_1968240_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999981.1|1968252_1968726_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_155046603.1|1968653_1968806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929627.1|1968999_1969350_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1969409_1969697_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1969749_1970529_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376415.1|1970953_1971871_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1971922_1972678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1972745_1974020_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376412.1|1974140_1974818_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376411.1|1975018_1976443_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_016209938.1|1976417_1977056_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376410.1|1977418_1977697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376409.1|1977930_1978875_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376408.1|1978896_1980765_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376407.1|1980785_1981139_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_026063528.1|1981177_1982293_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1982477_1983518_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_027242800.1|1983520_1984555_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376402.1|1984551_1985613_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_017376401.1|1985724_1987197_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376400.1|1987349_1987793_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376399.1|1987861_1990633_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
>prophage 24
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	1995064	2043931	3195621	transposase	Staphylococcus_phage(25.0%)	45	NA	NA
WP_036773116.1|1995064_1996039_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|1996562_1999289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|2000176_2001151_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|2001401_2002106_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|2003345_2003864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|2004831_2006316_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2006440_2007976_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2007998_2008328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2008224_2008440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2010423_2011623_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2011832_2012693_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2012808_2013387_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2013543_2014185_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2014223_2014445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2014437_2015421_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2015814_2016312_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2016456_2016732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2016883_2018566_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2018573_2019596_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2019764_2020766_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2020879_2021218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2021693_2022953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2023161_2023389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2023417_2023636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2023773_2024139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2024206_2024449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2024463_2024799_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2024803_2025241_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_036772812.1|2025266_2026652_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2026762_2027194_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2027299_2028811_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2029101_2030694_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2030894_2033090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772819.1|2033183_2034617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2034659_2035175_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2035174_2036122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2036105_2036771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2036767_2037496_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2037485_2038232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2038215_2039280_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2039484_2040672_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2040728_2041847_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2042294_2042552_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2042831_2043509_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2043727_2043931_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	2063631	2113166	3195621	protease,tRNA,transposase	Burkholderia_virus(20.0%)	41	NA	NA
WP_017377787.1|2063631_2063859_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2063948_2064704_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2065117_2065714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2065793_2068598_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2068578_2069532_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2069524_2070895_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2071065_2072469_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2073240_2073567_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420651.1|2073771_2074425_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_017376600.1|2074744_2074924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2075179_2076436_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2076674_2076821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2076903_2077260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2077755_2078115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2078124_2078508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2079396_2079537_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2079681_2080602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2082759_2083290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2083300_2084356_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2084371_2086411_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2086397_2087228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2087294_2090834_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2090947_2091667_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2091905_2092535_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2092654_2094058_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2094203_2096147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2096664_2097525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2097960_2099706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|2100108_2101581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2101763_2102363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2102500_2102698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2102898_2103039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2103106_2103886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2104450_2104852_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2104996_2105374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2105833_2107141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2107889_2108147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2108198_2109602_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2109842_2111552_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2111721_2112084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|2112191_2113166_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 26
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	2127735	2187288	3195621	protease,tRNA,transposase	unidentified_phage(14.29%)	60	NA	NA
WP_017377892.1|2127735_2129157_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_026063687.1|2129246_2130845_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377894.1|2131001_2131628_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027242839.1|2131708_2134381_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377896.1|2134863_2135820_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_017377897.1|2135872_2136292_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_048875958.1|2136318_2137182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377899.1|2137171_2137963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2138267_2139239_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2139587_2139896_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2139892_2140549_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2140682_2141168_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2141245_2141767_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2141812_2142706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2142702_2143524_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2143718_2143868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2144095_2144926_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046606.1|2146331_2146502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2146654_2148058_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_048875956.1|2148167_2149409_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2149395_2150127_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2150138_2151416_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2151515_2151890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2151974_2152862_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2152919_2153648_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2153644_2154754_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2154905_2155334_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2155428_2155785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2155777_2156989_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2156985_2157774_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2157936_2158731_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2159180_2159921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2159924_2162423_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2162685_2163642_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2163625_2164387_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2164594_2165569_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2165677_2166433_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2166557_2166803_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2166862_2169136_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2169190_2169493_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2169733_2170027_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2170197_2170377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2170452_2171064_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2171310_2172627_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2172637_2173006_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2173036_2173699_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2174121_2174700_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2174679_2175087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2175210_2175507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2175553_2176429_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876123.1|2176498_2178679_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_017376060.1|2178782_2180132_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_036772012.1|2180205_2180895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2181027_2182215_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376055.1|2182733_2183378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2183374_2184688_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2184892_2185066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2185335_2185809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2185953_2186148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2186412_2187288_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	2206350	2254573	3195621	tRNA,transposase	Staphylococcus_phage(16.67%)	41	NA	NA
WP_036771639.1|2206350_2207325_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875951.1|2207368_2208205_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2208350_2208770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2209046_2209727_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2209692_2210043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2210075_2211287_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2211627_2212257_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2212305_2213322_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2213568_2213784_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2213836_2214286_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2214365_2216111_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2216202_2218074_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2218518_2219235_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2220672_2221542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2221498_2221726_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2222694_2223609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2223654_2224677_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2224745_2225795_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046689.1|2226417_2226594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243219.1|2226878_2227187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2227353_2228757_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046608.1|2228849_2229014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2229335_2229560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2229570_2230782_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036774710.1|2231176_2232076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|2232249_2232651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2232897_2233941_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2234060_2234297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2235085_2236639_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2238819_2239047_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2239917_2240892_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017375736.1|2241618_2242701_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_017375735.1|2242743_2243394_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375734.1|2243616_2243988_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_027243178.1|2244098_2245460_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155046609.1|2247180_2247387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2247697_2248780_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2248776_2249088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2250133_2251108_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2252114_2252894_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2253355_2254573_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	2267422	2328390	3195621	integrase,transposase	Staphylococcus_phage(30.0%)	47	2275275:2275334	2325696:2326456
WP_144420638.1|2267422_2268505_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2268501_2268813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2270310_2271246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2271838_2272984_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2275226_2276390_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2275275:2275334	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|2276418_2276643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2277990_2279166_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2279511_2282022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2282080_2282893_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377669.1|2283333_2284038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2284087_2285062_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2285166_2286498_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2286696_2286765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2286896_2288339_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2288730_2290143_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2290832_2291279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2291873_2292722_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2292975_2294034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2294025_2295732_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2295803_2297537_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2297833_2298400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2298524_2299178_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2299204_2300665_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2300761_2301739_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2302208_2303612_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2304137_2304431_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2304657_2305422_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2305629_2305857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2305920_2306103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2306665_2306845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376902.1|2306908_2307220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2308074_2308779_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2308976_2309117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2309521_2310046_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|2310192_2311449_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2311516_2311996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2312436_2313840_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243186.1|2314254_2316636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2317142_2319035_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2319206_2320181_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2320484_2321291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2321359_2321971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2323452_2323749_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2323745_2324588_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2324978_2325764_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2325768_2327172_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2325696:2326456	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2327445_2328390_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	2349232	2376885	3195621	protease,transposase	Staphylococcus_phage(25.0%)	28	NA	NA
WP_017377305.1|2349232_2350534_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2350615_2351221_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2351333_2352638_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2353238_2354114_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2354229_2354901_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2355080_2356436_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2356556_2357294_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2357372_2358089_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2358737_2360012_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2360042_2360618_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2360662_2361628_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2362091_2363000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046610.1|2363312_2363639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2363783_2364212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2364197_2365142_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2365346_2365499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2365527_2366262_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2366356_2366617_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2366835_2367801_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|2367777_2368074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2368264_2368714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2368973_2369402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2369497_2369998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2369934_2370096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2370976_2371198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2372696_2373374_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2374688_2375027_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2375910_2376885_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 30
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	2416129	2488069	3195621	tRNA,transposase	Staphylococcus_phage(37.5%)	53	NA	NA
WP_080999971.1|2416129_2417533_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2417646_2418222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2419467_2419695_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2419984_2420524_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2420833_2422321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2422372_2422798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2423016_2424420_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2424416_2424794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2424753_2425299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2425694_2426921_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2427521_2429174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2429110_2429305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963645.1|2429637_2430828_-	MFS transporter	NA	NA	NA	NA	NA
WP_027243147.1|2431076_2433749_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2434037_2434874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2435534_2436425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2436893_2437868_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876012.1|2438352_2439756_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2439901_2441305_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|2441389_2443204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2445115_2446519_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2446552_2448082_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2448117_2449578_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_027242908.1|2449552_2450512_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376200.1|2450589_2454096_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_017376201.1|2454119_2454689_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_027242907.1|2454902_2456057_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376204.1|2456075_2456849_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|2456848_2457295_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376206.1|2457312_2458362_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_017376207.1|2458472_2459006_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_036771893.1|2459086_2461504_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_027242906.1|2461788_2462856_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_017376209.1|2465058_2466123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376210.1|2466112_2467141_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376211.1|2467137_2467677_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376212.1|2468213_2470124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420622.1|2470568_2472146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|2472242_2473118_-	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_080963646.1|2473206_2474106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063514.1|2474020_2474767_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_017376216.1|2474774_2475332_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_017376217.1|2475335_2476073_-	UMP kinase	NA	NA	NA	NA	NA
WP_017376218.1|2476076_2476955_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376219.1|2477119_2477887_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376220.1|2478293_2479103_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376221.1|2479180_2481838_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|2481841_2482879_+	asparaginase	NA	NA	NA	NA	NA
WP_017376223.1|2482880_2483702_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376224.1|2483832_2484717_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_036773116.1|2485029_2486004_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2486056_2487052_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2487094_2488069_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 31
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	2498801	2543593	3195621	tRNA,transposase	Burkholderia_virus(33.33%)	44	NA	NA
WP_017376309.1|2498801_2499089_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2499209_2500670_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2500749_2502186_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2502310_2503285_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2505475_2506237_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2507394_2507622_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2508575_2508788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2508805_2509123_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2509149_2509839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2510179_2510383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2510514_2511450_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2511462_2512245_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2512374_2512686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2513029_2513356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2513380_2513836_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2513825_2514878_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2514880_2516344_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2516478_2516706_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2518122_2518587_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2518843_2519659_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2519787_2522100_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2522216_2522744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2523435_2524713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2524723_2524975_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2525008_2525530_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2525699_2526686_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2526776_2527592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2528020_2528416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2528388_2528616_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_047927746.1|2529584_2530172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2530774_2531446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875918.1|2531590_2532172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420767.1|2532214_2532892_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243185.1|2533170_2534127_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_017377736.1|2534186_2534852_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017377737.1|2534885_2535431_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_155046615.1|2535710_2535872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774946.1|2536568_2537183_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_144420620.1|2537109_2538312_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875923.1|2538297_2539293_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2539296_2539701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2540668_2540896_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2541864_2542461_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046616.1|2542429_2543593_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
>prophage 32
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	2553314	2604728	3195621	tRNA,transposase	Bacillus_phage(20.0%)	55	NA	NA
WP_048876031.1|2553314_2554718_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|2554823_2555048_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2555230_2556052_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|2556197_2556452_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377841.1|2556840_2558625_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|2558713_2559433_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2559594_2559801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2559800_2560037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2560049_2560403_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2560940_2561774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2561866_2562064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2562161_2563547_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2563673_2564264_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2565295_2565583_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2565642_2565807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2565803_2567174_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2567540_2568953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2569022_2569793_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2570285_2570573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2572049_2572343_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2572300_2573122_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2573266_2573491_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155046618.1|2573745_2574273_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|2574449_2574710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2574628_2574784_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2574882_2575857_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2577185_2577335_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2577451_2577745_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2578553_2579129_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2579206_2580082_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2580146_2580767_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2580751_2581834_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2582067_2582472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2583962_2585264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2585410_2586079_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2587011_2587575_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2587631_2588828_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_017376587.1|2588952_2590317_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376586.1|2590313_2591405_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376585.1|2591659_2592310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2592502_2592697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2592804_2592957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376583.1|2593223_2594351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063543.1|2594440_2595274_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376581.1|2595277_2595928_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_017376580.1|2595917_2596757_-	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_016210074.1|2596762_2597389_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376579.1|2597549_2598092_+	septation protein A	NA	NA	NA	NA	NA
WP_017376578.1|2598175_2598478_+	YciI family protein	NA	NA	NA	NA	NA
WP_144420763.1|2598495_2598738_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376576.1|2598836_2599109_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376575.1|2599147_2599786_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376574.1|2599818_2600910_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376573.1|2601081_2602824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2603753_2604728_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 33
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	2614022	2732483	3195621	tRNA,transposase	Staphylococcus_phage(29.63%)	108	NA	NA
WP_080999966.1|2614022_2615372_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2615669_2616227_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2616320_2616827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2617331_2618027_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|2618157_2618946_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2618979_2620383_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2620806_2621781_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2622037_2622265_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2623352_2623883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2623879_2625412_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2625408_2626359_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2626779_2627412_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2627654_2627852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2628201_2628630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2628707_2629703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2629847_2630099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2630203_2630848_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2631083_2631581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2632092_2633067_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2633437_2633731_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2634543_2634879_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2635199_2636738_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2636890_2637989_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2638227_2639427_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2639457_2640084_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2640112_2640997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2641130_2641361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2641498_2642740_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_144420613.1|2643019_2643391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2645522_2645684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2646059_2647187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2647303_2647966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2648051_2648312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2648730_2649492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2651553_2652213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2652313_2652964_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2653111_2653801_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377795.1|2653823_2654987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2655191_2655443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619442.1|2655966_2656629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2656762_2657737_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376009.1|2659091_2659382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376008.1|2659704_2660742_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376007.1|2660772_2662227_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376006.1|2662236_2663421_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376005.1|2663494_2664502_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376004.1|2664570_2666574_-	transketolase	NA	NA	NA	NA	NA
WP_017376003.1|2667025_2668186_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376001.1|2668422_2669538_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376000.1|2669700_2670225_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017375999.1|2670224_2670755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2672414_2673290_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2673410_2673911_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2673907_2674174_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2674339_2675314_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2675493_2676114_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2676420_2677824_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771922.1|2678658_2679849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|2680415_2680883_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|2681384_2681639_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|2681840_2682344_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|2682560_2683166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2683326_2684010_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2684085_2684865_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|2684851_2685712_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|2685835_2686201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377271.1|2686586_2686916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2687326_2688301_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377273.1|2688835_2689075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377274.1|2689068_2690421_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	3.2e-36
WP_017377275.1|2691482_2692205_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2692196_2692565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2692827_2694129_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2694224_2694668_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2694671_2695181_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2695173_2697987_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2698483_2699416_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2699520_2700447_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2700625_2702164_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2702337_2702598_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2703872_2704481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2704527_2705256_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2705502_2705640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619438.1|2706790_2707342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2707576_2708488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2708747_2709044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2709388_2710542_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2711138_2711687_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2711790_2712354_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2712571_2713330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2714605_2714833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2715055_2715235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2715490_2716747_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2716814_2717459_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_017378393.1|2718263_2718470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378392.1|2718740_2718893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816949.1|2719470_2719869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378390.1|2720062_2721640_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378389.1|2721773_2722715_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378388.1|2722716_2723490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963621.1|2725098_2725305_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2725571_2725859_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378384.1|2725864_2728246_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|2728258_2729254_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_016210495.1|2729385_2729745_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378382.1|2729787_2729982_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|2730016_2730547_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378381.1|2730551_2732483_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
>prophage 34
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	2770261	2823290	3195621	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2770261_2771236_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2771392_2772967_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2773191_2773470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2773539_2774415_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2774424_2775585_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2775699_2776848_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2776858_2779660_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2779766_2780465_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2780477_2782241_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2782244_2782592_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2782585_2782960_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2783907_2785191_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2785600_2786896_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2787251_2787797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242732.1|2788384_2788906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2788917_2790297_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2790532_2790967_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2790963_2792316_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2792315_2793431_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2793431_2794448_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2794437_2796108_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2796127_2796463_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2796490_2797930_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2797926_2798973_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2799115_2800612_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2800907_2801909_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2802014_2802626_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2802746_2803124_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2803174_2804581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2804574_2805642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2805748_2807350_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2807598_2808516_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2808584_2810279_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2810513_2811443_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2811473_2812877_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2813107_2813812_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2813878_2814535_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2814545_2815427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2815597_2818267_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2818627_2819602_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2819681_2820653_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2820706_2821681_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2821800_2822022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2822085_2822394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2822318_2823290_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	2837856	2875043	3195621	transposase	Staphylococcus_phage(50.0%)	36	NA	NA
WP_026063658.1|2837856_2838585_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2838894_2839149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2839862_2842517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2842555_2842846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2842962_2844261_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2844831_2845320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2845300_2845603_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2845849_2846338_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2846371_2847010_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2847131_2847671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2847760_2848987_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2849599_2849857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2849943_2850843_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2850987_2851254_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2851245_2851395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2851622_2852498_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2852627_2852855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2852921_2853116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2853174_2854149_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2854186_2854375_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2854375_2856148_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2856137_2857130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2857737_2858430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2858916_2859486_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2859482_2860457_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2860496_2861000_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2861090_2862494_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2863192_2863378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2863483_2864887_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420599.1|2864891_2865464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2865497_2866925_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|2868210_2870580_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2870655_2871474_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2871825_2872371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2872853_2874092_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2874068_2875043_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 36
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	2890796	2949331	3195621	tRNA,transposase	Lake_Baikal_phage(12.5%)	52	NA	NA
WP_155066888.1|2890796_2892116_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376537.1|2892839_2894465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376536.1|2894634_2894994_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376535.1|2895206_2895638_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017376534.1|2895649_2895829_-	rubredoxin	NA	NA	NA	NA	NA
WP_144420597.1|2895945_2896932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243034.1|2897112_2898402_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_017376531.1|2898513_2899311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|2899702_2901070_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2901562_2902042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2902221_2904285_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2904293_2905019_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2905646_2906360_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2906364_2906895_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2907129_2907363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2907475_2907724_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2908531_2910724_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2910741_2911050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2911703_2913413_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2913606_2913762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2915164_2916040_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2916365_2917127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2917351_2918083_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2918079_2918616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2918669_2919434_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2919436_2921014_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2921020_2921497_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2921472_2921904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2921936_2922692_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2922866_2923154_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2923536_2923761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2924100_2925264_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2925298_2926276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2926269_2926956_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2926894_2928010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2928289_2928895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2929132_2929612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2931434_2932088_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2932200_2932752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2932851_2933826_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2934111_2934636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2935333_2936158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2936413_2936770_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2936766_2938170_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2938289_2938850_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2939007_2939574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066890.1|2939776_2942059_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_027243087.1|2942322_2943018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2943058_2943271_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2944843_2945953_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2946008_2947490_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2947927_2949331_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP038918	Piscirickettsia salmonis strain Psal-010b chromosome, complete genome	3195621	3077013	3142262	3195621	protease,transposase	Hokovirus(14.29%)	56	NA	NA
WP_017376170.1|3077013_3078114_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3078471_3079446_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3079582_3080461_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3080468_3080699_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3080752_3081757_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3081975_3082803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3082884_3084273_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3084560_3085961_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3086055_3086982_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3086978_3088115_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3088111_3089119_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3089115_3090279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3090288_3091140_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3091171_3092344_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3092340_3093729_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3093757_3094165_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3094184_3095192_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3095188_3096061_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3096057_3096918_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3096919_3099190_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3099191_3100337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3100383_3100869_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3100908_3101532_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3107211_3107964_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155046626.1|3108566_3108734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243062.1|3109295_3109919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3110023_3110812_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3110811_3111543_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3111576_3113304_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3113317_3114379_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3114693_3115908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3116040_3116565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3117182_3118031_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3118017_3118716_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3118770_3119532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3119524_3119947_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3120076_3120628_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3120683_3121646_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3121646_3121862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3122048_3122858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3122837_3123680_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3123676_3124921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3125059_3126148_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3126165_3126666_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3126853_3127453_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3127458_3128622_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3128654_3129608_+	glutathione synthase	NA	NA	NA	NA	NA
WP_017376261.1|3129971_3131036_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3131032_3134095_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3134247_3134700_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3134731_3135088_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3135506_3136280_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376269.1|3138903_3139194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3139418_3140294_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3140290_3140848_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3140858_3142262_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038919	Piscirickettsia salmonis strain Psal-010b plasmid unnamed1, complete sequence	176541	0	118633	176541	transposase,integrase,terminase,portal	Streptococcus_phage(39.22%)	123	11253:11312	118999:120734
WP_017377655.1|1412_1658_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|1654_2041_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|2128_2857_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|2835_3456_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|3801_4488_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|5437_5800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|5802_7542_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|7943_8096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|8123_8807_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|8888_9866_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|9941_10112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|10152_10881_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
11253:11312	attL	GATGTATCTTAGCTAAATCTGTCAGCACCTTTTTAATTTTAGTATCAACAACCTGTTTTT	NA	NA	NA	NA
WP_036771293.1|11426_11693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772437.1|11988_13887_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|14308_15037_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_080999960.1|15104_15257_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|15673_15838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|15858_17145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|17327_18056_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|18183_19161_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046631.1|19235_19886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046632.1|21895_22045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126795.1|22517_22778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|22781_23054_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|23129_23858_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|24426_25398_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|26262_27090_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|27943_28414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|29307_29451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|30657_31257_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|31610_32387_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|32747_33476_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|33545_33746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|33664_34636_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027242938.1|35049_35418_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017375972.1|35419_35728_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017375841.1|36172_36382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|36688_36907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242936.1|36903_37356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242935.1|37498_37714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876207.1|38219_39695_-	response regulator	NA	NA	NA	NA	NA
WP_017375966.1|39695_40262_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_146619519.1|40406_40844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|40875_41301_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_036817204.1|41571_42567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817201.1|42870_43278_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017375960.1|43385_44429_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_017375959.1|44730_44964_+	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_146619517.1|45101_45254_-	phosphatase	NA	NA	NA	NA	NA
WP_081078123.1|45283_45646_+	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
WP_026063496.1|46524_46890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242932.1|47022_47250_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242931.1|47258_47666_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242930.1|47811_49194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375952.1|49383_49587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242929.1|49782_50166_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|50252_50735_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|50737_52069_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|52273_52708_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|52794_53181_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|53218_53953_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|53999_54713_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_144420848.1|56091_56277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243190.1|56280_59625_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017377509.1|59805_60534_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|60627_61602_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|61915_62278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|62317_62827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066902.1|63058_63295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|63313_64291_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155066904.1|64756_65626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|65627_66605_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|67085_68063_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|68077_68239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|68456_68711_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|68700_68988_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_036771347.1|69482_70460_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|71460_71673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|71830_72808_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_075317322.1|72794_74309_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_047927782.1|75104_75494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|75409_76387_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_048876196.1|76416_77565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243215.1|79378_80401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|80883_81612_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_048876194.1|82851_83385_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|83565_83907_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|84087_84354_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|84426_86292_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|86459_86744_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|87087_87816_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|87897_88389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|89121_89349_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|90900_91329_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|91264_91651_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|91680_92409_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|92420_92570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|92816_93545_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|94922_95885_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|95908_96238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|96304_97345_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|97358_97550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|97754_98324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|98366_98666_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155046638.1|98662_99127_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|99400_100129_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|100302_101076_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|101789_102725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|102999_103728_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046639.1|103893_104097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|104196_107538_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|107695_108424_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|108717_109113_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|109165_109894_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|110377_111106_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|111276_111846_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|111850_112534_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|112685_113414_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_080963627.1|113432_113651_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774644.1|114630_115692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|116200_116947_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|116947_117352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|117658_118633_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
118999:120734	attR	GATGTATCTTAGCTAAATCTGTCAGCACCTTTTTAATTTTAGTATCAACAACCTGTTTTTTAGGTTGATACCGATAAACTGATCGGCCAATACGGCACATCTTGCATGCTTTATTCCCGCTCAATGCATGAGCTTTGACAGCATAATCAACTAAGTCACGCCGACTCGCTGCGGTTATAGCTTTTTTTCAACAATATCCTTGAGCACTTTGTGCTCTAGGCTAATGTCTGCGTACATCTGTTTCAAACGACGGTTTTCGTCTTCAAACTCTTTTAAACGCTGTAGATCTGAAACGCCCATGCCTTGATATTTGGATCTGAGTTTGTAGTAGCTGCTTTTAGCAATACCATACTGGCGACAAATATCTTCAACTTTAACACCCGCTTGGCCTTCATTAAGCATGGCTACAATTTGTGATTCTGTTAGTTTTGATCGTTTCATCTTCTCTCTCCTGGCTAAGTTAATTTAACAGAAGATTCCACTTATCACTTGTACTATTTTAAGGGAGGGTTACCGAGTTATGTGAGAGCACAGTAGTGGAGTGTGCCGATTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTTGCGACAGAACCCTCCTTGGTTCGCAGCGCCAACATCATATCATTAAATCAAATTGCGACAGAACCATTATAGCTCATCATCTTCATATCTTGTATGTTTAGGATCATTACAAACATACCATCCACTAGAACTAGAATTTGTACATACCCCATACCTTTTAGATAAATCAAAGTACATAGTTGTGCTAGAAGGAGATTGTGATGATTTAGCATCAAAAAGTGAGCCAAAATGATTGTAAGTCGTGACATATAAATTACTTTTATCTGAATTTTTAATATATATTGCGCTGACAGGATCATTTACTCTACTTTCTAAAAACCATTTTAAATTATTAGGTACGTTATCCATAAATGGATCACACTGTTTGAAATAAACCCAATCCCAATCCGTCGTTTTTCCAGCAATATTAGAAGTTAAACAGCTTAAAAACCAACCATCAGATGAAAATGCACGGCCATATAGTGAAAGCATCAATATTCTAGAATTTTTCATATCATAGTATGTTCTATTCAAATAATTTGAATTATACGAACCTGAATACATAGGATAGTAATTATTATCAGATTTATCATAAAACCTCATACCAATTTCATACCAAAATGTATTTACTTTTGATGGTGTTTTAAAAAAGTATTTAGACATTTTATTTGCATCTAAAACAATATTAGTTCCACTTGATTTTGAAATAATTCCATAGTTGCCATACCATTGAATAGATAGATCTTTATTTAAACGAGGTTTTAATTTTCCATCTCTTACATCCCATTTTTGATAAGGGTTATAAATATCACAAGGCCAAAACTCTACATAATCCCATTTATCATCACCTTTGATGACATTTTCTGGTGCAGTCATACATAGAGGGATTCCAAATTGAGATTTAGAGAAAGCAACTCTGCCAAGAGTATCATAAATAGCTTTTTGACTTTCTACATTAGAACATGTTTGAGCGTATAAATAAGATCGAGACGTTTTCATAGAAGAGTCTCTTGATTGAGTTGGAGCTAAACAGTAACCTCCCTGAGTTGTAATTAACTGGCTTGGTATTGTAGGTAAATCTTTAAAT	NA	NA	NA	NA
>prophage 2
NZ_CP038919	Piscirickettsia salmonis strain Psal-010b plasmid unnamed1, complete sequence	176541	124580	126202	176541	transposase	Acinetobacter_phage(50.0%)	3	NA	NA
WP_017375632.1|124580_124916_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|125110_125314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|125407_126202_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
>prophage 3
NZ_CP038919	Piscirickettsia salmonis strain Psal-010b plasmid unnamed1, complete sequence	176541	132572	134990	176541	transposase,portal	unidentified_phage(50.0%)	2	NA	NA
WP_048875857.1|132572_133547_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|134534_134990_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
>prophage 4
NZ_CP038919	Piscirickettsia salmonis strain Psal-010b plasmid unnamed1, complete sequence	176541	139708	146676	176541	transposase	Streptococcus_phage(100.0%)	7	NA	NA
WP_017377509.1|139708_140437_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|140578_141511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|141540_142269_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|142271_142544_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|143394_144123_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|144178_144799_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|145947_146676_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 5
NZ_CP038919	Piscirickettsia salmonis strain Psal-010b plasmid unnamed1, complete sequence	176541	152711	153446	176541	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_027243210.1|152711_153446_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.9e-36
>prophage 6
NZ_CP038919	Piscirickettsia salmonis strain Psal-010b plasmid unnamed1, complete sequence	176541	156663	161656	176541	transposase	Streptococcus_phage(66.67%)	5	NA	NA
WP_075275471.1|156663_157638_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_155046640.1|158273_158441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876214.1|158409_159138_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_017377521.1|159646_160000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|160927_161656_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 7
NZ_CP038919	Piscirickettsia salmonis strain Psal-010b plasmid unnamed1, complete sequence	176541	168020	173923	176541	transposase	Staphylococcus_phage(28.57%)	9	NA	NA
WP_075275473.1|168020_168197_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|168313_169021_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|168974_169853_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243193.1|169883_170426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|170697_171402_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|171413_172142_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|172171_172561_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|172583_173312_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|173314_173923_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
>prophage 1
NZ_CP038921	Piscirickettsia salmonis strain Psal-010b plasmid unnamed3, complete sequence	49554	32440	46236	49554	tail,transposase,head,capsid	Moraxella_phage(18.18%)	18	NA	NA
WP_036771639.1|32440_33415_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|33464_34004_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|34017_34602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|34986_35298_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|35294_35720_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|35898_36294_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|36290_36641_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|36640_37063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|37064_37388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|37444_37711_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|37714_39793_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|39785_40127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|40123_40795_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|40724_41510_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|41499_42057_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|42053_44744_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|44802_45231_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|45258_46236_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 1
NZ_CP038922	Piscirickettsia salmonis strain Psal-010b plasmid unnamed4, complete sequence	33497	3344	19366	33497	integrase,capsid,tail,transposase,terminase,head	unidentified_phage(35.71%)	21	NA	NA
WP_036771330.1|3344_4319_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4854_5445_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5675_5936_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5928_6282_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6458_7433_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|7965_8331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|8475_8730_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8713_9070_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|9167_10142_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|10767_11634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|11846_12230_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|12316_12799_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|12801_12987_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|13006_13981_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|14077_14470_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|14505_15087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|15467_16442_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|16515_16731_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|17534_18050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|18395_18953_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|18949_19366_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
