The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	31805	68058	3201212	transposase	Staphylococcus_phage(60.0%)	29	NA	NA
WP_036772169.1|31805_32681_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33039_34395_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34486_34993_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34989_35358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36760_38545_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39025_40153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40225_40981_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|41017_43711_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43742_44294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44401_45415_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45535_45760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46115_46877_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47019_47814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|47958_48711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49022_50549_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50687_51761_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|51800_53108_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53082_54252_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54306_55032_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55497_57603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|57817_58282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58301_58811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59195_60137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60418_61870_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773655.1|62336_62741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63301_64276_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|65010_65388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|65631_66606_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_036771330.1|67083_68058_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 2
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	124806	244259	3201212	tRNA,protease,transposase	Staphylococcus_phage(11.76%)	106	NA	NA
WP_053093682.1|124806_125550_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|125990_126284_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|126284_126539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|126555_129048_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|129040_129724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|129723_130767_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|130766_131996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|131997_132327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|132323_133523_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|133635_134025_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|134024_134969_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|135088_136486_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|136811_137333_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|137456_137765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|137779_143002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|143392_145399_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|145529_147860_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|148035_148866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|148982_149378_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|149374_149908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|149904_150306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|150700_151021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|151030_151987_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|152496_153021_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|153121_154120_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|154208_155105_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|155178_156465_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|156924_158241_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|158354_158525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|158544_159519_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|159645_159906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|160173_160464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|163002_164043_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|164145_165117_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|165239_166088_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|166239_166527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|166837_167209_+	isochorismatase	NA	NA	NA	NA	NA
WP_017377540.1|168260_168494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|168631_168769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|168782_168995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|169518_170343_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|170481_171615_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|171674_173084_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|173231_174812_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|175565_176561_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|176566_178633_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|178690_179641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|179835_180162_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|180672_181932_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|182191_183067_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|183105_184068_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|189762_190107_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|190203_191127_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|191626_192115_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|192217_193018_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|193028_194780_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|195669_195912_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|195915_196314_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|197594_197822_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_081078121.1|197853_198654_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|199372_199831_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|200012_200198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|200913_202728_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|203138_203807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|203816_205133_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|205292_206255_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|206335_206491_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|206504_206741_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|206933_208151_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|208128_208587_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|208614_209994_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|210030_210249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|210568_211864_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|212068_212260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|212458_213334_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|213521_214787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|214820_215696_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|215817_216276_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|216299_217220_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|217347_218130_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|218220_219720_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|220033_221917_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|222176_222839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|222905_224015_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|224026_224671_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|224689_225676_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|225760_226837_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|227038_227863_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|228165_229131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|229449_230502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|230560_231535_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|231870_232299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|232535_233018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|233073_234324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|234426_234645_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|235116_235971_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|236025_236496_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|236792_237029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|237175_237556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|237614_238490_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|239256_240168_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|240284_241133_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|241199_242210_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|242233_242557_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375571.1|242567_242969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|243239_244259_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	318054	360413	3201212	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|318054_318930_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|319010_319643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|319596_321042_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|321076_321496_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|322269_322638_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|322647_323187_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|323347_323779_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|323782_324481_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|324728_325235_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|325277_325646_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|325916_329993_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|330056_334265_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|334426_334801_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|334905_335379_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|335394_337506_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|337533_338724_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|338730_339042_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|339164_339803_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|339818_340436_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|340432_340729_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|340743_341568_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|341584_341860_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|341865_342198_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|342210_342945_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|342958_343372_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|343371_343572_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|343571_343829_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|343950_344319_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|344336_344648_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|344663_345206_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|345218_345524_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|345552_345945_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|345957_346491_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|346500_346854_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|346864_347365_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|347370_347553_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|347555_347990_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|347990_349313_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|349369_349483_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|349626_349983_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|350008_350398_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|350407_351028_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|351049_352027_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|352075_352474_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|352586_353834_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|353820_354477_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|354561_354840_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|355082_355310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|355442_356237_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|356545_357760_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|358157_358337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|358305_358959_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|359334_359583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|359672_360413_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	378431	428114	3201212	tRNA,transposase	Staphylococcus_phage(25.0%)	55	NA	NA
WP_017376964.1|378431_380912_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|380998_381478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|381450_382491_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|382427_383144_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|383156_383492_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|383528_383999_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|384041_385877_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|385921_387010_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|387031_388093_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|388170_388686_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|388726_390004_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|390018_390870_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|390898_391546_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|391542_392502_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_036774534.1|392593_393019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875861.1|393023_393893_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|394037_394292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|394436_395003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|395108_395549_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_051929598.1|395506_395764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242664.1|396060_397263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|397546_398521_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046563.1|398990_399128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772941.1|399120_399360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|399564_400176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|400172_400430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|400680_401073_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|401202_401751_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|401750_402578_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|402627_404313_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|404390_404852_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|404888_405452_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|405678_406008_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|405988_406213_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|406357_406948_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|406972_408244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|408261_409515_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|409511_410156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|410228_411278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|411379_413017_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|413051_413381_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|413537_413825_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376927.1|414251_414389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376926.1|414378_414645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|414894_416115_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|416173_418972_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|419277_420444_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|420542_421079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|421140_421473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|421730_422633_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|422702_423200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|423345_424749_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|424949_425678_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963630.1|425847_426705_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_048875864.1|427088_428114_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	499040	546008	3201212	transposase	Streptococcus_phage(33.33%)	44	NA	NA
WP_048875872.1|499040_500324_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|500496_500634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|500630_502034_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|502147_502585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|502705_503134_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|503381_503819_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|504250_505639_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|506085_507579_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|507773_508529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|509028_509259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|510363_511374_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|511370_511592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|512310_513252_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|513779_514178_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|514117_514972_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|515063_515345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|515430_516108_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|516153_517434_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|517609_518659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|518737_519538_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|519551_520346_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|520448_521468_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|521514_522126_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|522129_522816_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|522812_523355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|523647_524835_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|525079_525805_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|525990_526779_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|526775_527171_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|527563_528604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|528600_530004_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|532419_532677_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|532716_534102_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242633.1|534431_535529_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_017377120.1|535562_536813_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|536813_537446_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|537735_538188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|538233_539076_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|539110_539602_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|539797_541765_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|541992_542397_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|542374_543403_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|543389_544178_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|544604_546008_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	585514	719474	3201212	tRNA,plate,transposase	Staphylococcus_phage(13.64%)	109	NA	NA
WP_036772726.1|585514_586063_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|586815_588195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|588554_590018_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|590201_591014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|591478_593473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|593867_595247_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|595284_595722_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|595764_596481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|598027_598558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|598624_600445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|601009_601516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|601600_603004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|603118_603373_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|603525_603798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|604672_605248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048025.1|605229_605415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|606315_606558_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|606860_607952_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|607932_608886_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|609109_610594_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|610633_611137_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|611396_612572_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|612719_613124_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|613280_614156_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|614190_614544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|617873_618299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|618529_619666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|619652_620975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|620967_622086_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|622206_622740_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|622878_624516_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|624520_624742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|624850_625864_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|626126_628355_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_017377041.1|629273_629603_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|631003_631222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|631280_632156_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|632148_633015_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|633082_634402_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|634871_635432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|635750_636677_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|637572_638481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|642177_643017_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|643203_643419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|643467_644043_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|644039_644378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|644546_645536_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|646525_647428_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875984.1|647687_648224_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|648368_649286_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|649720_650731_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|651538_652075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155048027.1|653133_653277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|653287_653635_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|653779_654739_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|654840_655623_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|655755_656715_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|656739_657144_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|657172_657847_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|657946_659662_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|659658_660021_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|660035_661190_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|661193_662201_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|662203_663220_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|663435_664521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|664627_665020_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|665152_666436_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|666451_667753_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|667770_669573_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|669577_670570_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|670650_671727_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|671824_672799_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|672866_673838_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|674021_674291_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|674892_676179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|676243_676924_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376024.1|682579_682828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816881.1|682905_683124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062365741.1|683807_684410_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.0e-10
WP_027242570.1|684623_685763_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|685971_687342_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|687720_688713_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|688716_689232_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|689228_690068_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|690100_691651_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|691758_692130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|693350_693512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|694092_695496_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|695530_695968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|695991_696966_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|697024_697453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376322.1|698809_699202_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|699246_700068_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|700080_701064_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|701065_702334_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|702340_704845_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|704975_706001_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|705997_706708_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|706632_707463_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|707612_707996_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|708030_708930_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|708975_709647_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|709729_710305_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|710403_711204_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|711345_712203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|713065_714202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|714268_717439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|717451_718162_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|718166_719474_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 7
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	728116	774430	3201212	plate,transposase	Staphylococcus_phage(21.43%)	52	NA	NA
WP_017376356.1|728116_728515_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|728511_730200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|730181_731138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|731180_731696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|731800_732733_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|732952_733339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|733356_734001_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|734151_734991_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|735066_735669_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|735669_736524_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|736881_737193_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|737217_738606_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|738761_739493_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|739489_740017_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|740048_740606_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|740611_741592_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|741731_742532_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|742535_743303_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|743299_743764_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|743786_744440_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|744443_744791_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|744824_745076_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|745152_746421_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|746423_747182_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|747243_748134_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|748184_748868_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|748877_749225_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155048029.1|749497_751018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556468.1|751313_751616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|751607_752480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|752647_754477_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|754644_755286_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|755610_756057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|756074_756248_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|756306_757356_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|757362_758313_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|758367_759312_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|759339_760077_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|760165_760408_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|760482_761706_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|761737_762586_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|762582_763635_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|763771_764392_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|764617_765770_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|766790_767765_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|767761_767932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|768900_769497_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|769465_770626_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|771136_771478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|771581_772616_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|772612_773323_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|773455_774430_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 8
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	782590	836901	3201212	protease,tRNA,transposase	Prochlorococcus_phage(33.33%)	49	NA	NA
WP_017377942.1|782590_783097_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_155048031.1|783178_783544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|783686_784547_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|784644_785190_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|785272_786124_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|786165_789072_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|789132_789330_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|789336_790347_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|790343_791402_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|791416_792196_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|792198_793011_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|793022_793970_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|793980_795273_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|795451_796555_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|796551_796944_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|796956_798333_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|798326_799796_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|799989_800424_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|800719_800896_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|801930_802956_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_017377925.1|803457_803850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|805242_805893_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|806591_807386_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|807565_808210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|808384_809359_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|809759_810017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|811694_812372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|812605_813430_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|813523_814237_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|814326_815418_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|815489_816071_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|816076_816703_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|816799_817747_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|818093_818756_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|818926_819586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|819754_821014_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|821010_822096_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|822088_822970_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|822958_824209_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|825594_825915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|826173_826440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|826930_827149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|828134_828356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|828352_829435_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|829445_829817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|829813_829993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|832696_832972_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|833807_835265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048033.1|835692_836901_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	880581	943840	3201212	tRNA,transposase	Staphylococcus_phage(28.57%)	53	NA	NA
WP_048875904.1|880581_881457_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|881713_882151_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|882211_882844_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|882859_883507_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|883509_885573_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|885899_887192_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|887580_889791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|889807_890464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|892849_893725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|893983_894595_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|895022_897611_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|897713_898475_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|898471_899008_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|899056_900013_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|900090_903276_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|903279_904335_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|904564_905167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|905210_905873_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|905907_906255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375702.1|906723_907755_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|908217_909621_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|910739_911084_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|911175_911631_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|911879_912014_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|912006_912648_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|912644_913361_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|913364_914684_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155046577.1|915365_915527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377751.1|916488_919125_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	6.9e-99
WP_036773645.1|919166_920252_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|920251_920935_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_155048036.1|922598_922964_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377747.1|923383_923638_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|923716_924034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|924186_924585_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|924666_925305_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|925461_926436_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|926808_927084_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|927633_927918_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|929734_930328_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|931580_932462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|932573_934253_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|934379_935630_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|935705_936167_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|936163_937312_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|937317_937992_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|937988_938645_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|938770_939244_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|939245_939668_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|939654_940674_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|940833_941013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|941231_941513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|942964_943840_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	947742	1016254	3201212	tRNA,protease,transposase	Bacillus_phage(20.0%)	58	NA	NA
WP_062365735.1|947742_949146_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|949504_950272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|950385_951789_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|951785_951947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|952262_953237_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|953477_954761_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|954827_955751_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|957946_960091_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|960112_960319_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|960379_961000_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|961040_961934_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|962019_962745_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|962806_963211_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|963373_965482_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|965605_966655_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|966651_968118_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|968260_969598_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|969665_971156_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|971384_971756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|971906_972734_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|973036_973693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|973640_974564_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|974577_975501_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376987.1|975748_976432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|978131_978359_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_016210338.1|978426_978564_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376989.1|978683_979232_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_048876012.1|979391_980795_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376990.1|980861_981137_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|981136_982186_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|982298_984236_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|984383_986096_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|986164_986884_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|986880_987483_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|987597_988485_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|988675_989023_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|989073_989913_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|990008_990755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|990951_991578_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|991893_992463_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|992606_993305_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|994011_994635_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|994744_995638_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|995744_997355_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|997351_998647_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|998668_1000591_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|1000701_1001004_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|1001098_1005985_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1006032_1007355_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1007479_1008574_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1008625_1009564_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1009644_1010229_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1010613_1011504_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1011706_1012198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1012337_1012829_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1012997_1013711_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027242874.1|1014139_1015114_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1015378_1016254_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	1021867	1084096	3201212	transposase	Staphylococcus_phage(33.33%)	57	NA	NA
WP_017377787.1|1021867_1022095_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1022121_1023162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1023228_1023798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1024028_1024433_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1024445_1024586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1024680_1025880_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1025900_1026512_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1026713_1027475_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1027770_1028697_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1028857_1029814_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1029958_1030228_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1030494_1031469_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1031622_1031850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1031966_1032392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1032548_1033478_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1033924_1034455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046580.1|1034839_1035082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1035559_1035871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1036210_1037377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1039564_1040536_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1041138_1041312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1041707_1042625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1042625_1043477_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1043917_1044964_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1044953_1046945_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1047054_1047429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1047682_1047865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1048126_1048828_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420709.1|1048828_1049248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376293.1|1050934_1053685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1053920_1055213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1055699_1056605_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046684.1|1057397_1058099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1058384_1059146_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1059178_1060582_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1060578_1060743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1060802_1061090_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1061834_1062563_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1062531_1063278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046685.1|1063328_1063748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1063744_1064719_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1064875_1065193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772457.1|1067668_1067977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1068052_1068325_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1070858_1071296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1071897_1073085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1073355_1074990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1075040_1075769_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1076908_1077871_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1078084_1079080_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1079107_1080043_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1080086_1080548_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1080526_1081144_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1081173_1082148_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1082202_1082670_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1082682_1083327_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1083367_1084096_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 12
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	1092796	1153603	3201212	transposase	Acinetobacter_phage(20.0%)	47	NA	NA
WP_082300708.1|1092796_1093357_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1094681_1095077_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1095085_1095442_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1095434_1096310_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1096395_1096974_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1096931_1097225_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1098185_1099697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875941.1|1099944_1100256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|1100252_1101335_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1101540_1101975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1102057_1102762_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1103020_1103509_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1103537_1104212_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1104452_1105328_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275340.1|1105858_1106467_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1106737_1107196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1107474_1107864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1108049_1108865_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1109087_1109993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1110156_1110918_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1110921_1111788_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1111873_1112485_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1112863_1114111_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1114262_1114964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1115261_1115435_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1115924_1116425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1117503_1117731_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774233.1|1117783_1118017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1118045_1118726_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1118748_1120923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1121168_1122239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1122235_1123639_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619408.1|1123787_1124273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1124344_1125166_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1125832_1127332_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1127635_1130329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1130325_1133727_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_048875961.1|1135314_1136718_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1137796_1138468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1141376_1142351_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378207.1|1143059_1143815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378208.1|1144109_1145660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929877.1|1146442_1147066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048040.1|1147408_1150585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242785.1|1151017_1152034_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_051929890.1|1152058_1152607_+	chorismate mutase	NA	NA	NA	NA	NA
WP_036771347.1|1152625_1153603_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 13
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	1168197	1288558	3201212	tRNA,transposase	Staphylococcus_phage(38.46%)	110	NA	NA
WP_053093677.1|1168197_1168917_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1169144_1169321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1169569_1169893_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1169981_1172000_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1172022_1172976_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1173141_1174329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1175042_1175681_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1175978_1176974_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_027242772.1|1177114_1178161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1178153_1179179_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1179245_1181276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1182582_1182810_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1184153_1184297_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1184293_1184986_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242771.1|1185252_1185570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|1185712_1186123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1186279_1186606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1186752_1187790_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1187831_1188077_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_129556541.1|1188201_1188516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1188523_1190098_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1190252_1190822_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1191131_1192934_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1192930_1193872_+	signal peptidase I	NA	NA	NA	NA	NA
WP_027242761.1|1194283_1194958_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1194963_1195863_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1195876_1196620_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1196622_1197354_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1197350_1197734_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1197871_1199119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1199529_1200675_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1200667_1201021_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1201301_1201844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1202488_1202677_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1202696_1203671_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1203714_1204590_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1204943_1205771_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1205870_1206032_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1206682_1208023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1209074_1209302_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|1209443_1210805_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1210900_1211560_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144420701.1|1212400_1212757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1213353_1214913_-	APC family permease	NA	NA	NA	NA	NA
WP_027243001.1|1215273_1217244_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375893.1|1217441_1218512_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1218569_1218776_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1218782_1220258_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1220393_1220957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1221126_1222530_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1223496_1224591_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_027242998.1|1224672_1225194_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_146619421.1|1225247_1225727_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_027242996.1|1225765_1226062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242995.1|1226126_1226834_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_027242994.1|1227210_1227609_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242993.1|1227654_1228086_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242992.1|1228096_1228780_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1228854_1231050_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242991.1|1231154_1231892_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_027242990.1|1231919_1232705_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_027242989.1|1232750_1233455_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_087910648.1|1233442_1234630_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_027242987.1|1234684_1235518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242986.1|1235587_1238575_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_027242985.1|1238616_1240008_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_080963581.1|1240021_1240483_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_047927184.1|1240492_1240837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1240833_1241709_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1241778_1242882_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1242949_1243273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1243429_1244212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1244347_1245325_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1245398_1247390_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1247445_1247727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1247980_1249180_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_155048042.1|1251575_1252124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1252310_1253186_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1253222_1253387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1254595_1255009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1255019_1255355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1255499_1256618_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1256847_1257114_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1258396_1258624_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1258634_1259141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1259218_1259836_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1259967_1261200_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1261189_1261852_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1262126_1263383_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1263520_1264180_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1264254_1264956_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1265703_1266678_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1267886_1268240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1268453_1268648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1268715_1269228_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1269365_1270220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1270268_1270913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1270946_1271591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243125.1|1272113_1272407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1272505_1273288_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1273370_1274321_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1276363_1279204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1279226_1279808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1279927_1280656_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1280801_1281776_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1281891_1282797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1283395_1284142_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1284394_1284787_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1284824_1285472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1287187_1288558_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	1296686	1353587	3201212	transposase	Staphylococcus_phage(22.22%)	49	NA	NA
WP_048875857.1|1296686_1297661_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017375871.1|1297885_1298434_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_144420795.1|1298561_1299239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242968.1|1299355_1302847_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_027242967.1|1302904_1304158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375866.1|1304267_1305170_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	3.2e-56
WP_017375865.1|1305224_1306262_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_017375864.1|1306399_1307638_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_047927270.1|1307630_1308356_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	6.4e-31
WP_017375862.1|1308459_1310187_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|1310487_1310841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375861.1|1311537_1312038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876023.1|1312377_1313481_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1313571_1314724_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1315137_1315989_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|1316126_1316276_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1316900_1319267_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1319314_1320511_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1321079_1323512_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1323833_1325333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1325441_1326014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1326328_1327798_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1327870_1328620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1328623_1329397_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1329495_1330446_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1330585_1332028_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1332243_1333428_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1333551_1334238_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1334373_1334958_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1335047_1335377_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1335712_1335952_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_155046686.1|1336045_1336192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1336966_1337260_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1337408_1337570_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1338084_1338624_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1338962_1339607_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1339940_1340591_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1341114_1342167_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1342184_1345265_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1345430_1345679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1345744_1346620_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1347542_1348049_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1348066_1348264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1348282_1348426_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1348493_1348667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1348871_1350185_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1350194_1350458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1350516_1351491_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1353359_1353587_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 15
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	1384804	1433415	3201212	tRNA,transposase	Bacillus_thuringiensis_phage(25.0%)	38	NA	NA
WP_036772026.1|1384804_1385680_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1385784_1389087_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1389083_1390907_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1390946_1391345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1391453_1392470_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1392904_1394359_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1394440_1397497_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_017376676.1|1399391_1399856_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1399928_1400930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1403822_1404155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1404516_1404660_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1404647_1405592_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420692.1|1405595_1405985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1405803_1406142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1406516_1407116_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1407115_1407463_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1407613_1408597_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1409506_1409821_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1409969_1410128_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1410099_1411029_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1411943_1412360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1413488_1414205_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1414953_1415112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1415160_1415736_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1415880_1416159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1416223_1417099_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1417264_1421131_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1421286_1422096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1422145_1422967_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1423166_1424399_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1424569_1425295_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1425337_1426876_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1426882_1428268_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1428581_1429631_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1430190_1430568_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|1430759_1431635_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1432616_1432844_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1432896_1433415_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	1437713	1506316	3201212	transposase	Staphylococcus_phage(20.0%)	58	NA	NA
WP_048875984.1|1437713_1438250_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155048044.1|1438394_1439165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|1439396_1439732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375878.1|1440069_1440342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243180.1|1440413_1441673_-	phosphoesterase	NA	NA	NA	NA	NA
WP_017375881.1|1441757_1443023_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_026063485.1|1443181_1443664_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_036772592.1|1443741_1445202_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_155046587.1|1445324_1445465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|1445878_1446379_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_017375698.1|1452493_1453687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243221.1|1454030_1455659_+	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_027243222.1|1455674_1456823_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_051929845.1|1456897_1457722_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1458125_1459100_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1459285_1459879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1460059_1460524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1460918_1461200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1461196_1462600_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1463251_1463632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1463871_1464528_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1464672_1464969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1465028_1465316_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036772296.1|1466505_1466883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1467082_1468132_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1468108_1469926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1470196_1470775_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1470802_1471267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1471303_1472761_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1472822_1474310_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1475079_1475682_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1476243_1476714_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1478361_1479105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1479256_1479688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1482325_1483672_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1483759_1485565_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1486030_1486828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1487212_1487674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1487896_1488871_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1488913_1489036_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1489107_1491063_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1491452_1491638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1491959_1492949_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1493361_1494987_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1495095_1495410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1495705_1497091_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1497255_1497483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1497623_1498082_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1498282_1498468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1498536_1499364_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1499818_1500343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420684.1|1500525_1500774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1500943_1501897_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1502091_1503066_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1503193_1504219_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1504871_1505159_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1505218_1505551_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1505755_1506316_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
>prophage 17
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	1515037	1575672	3201212	tRNA,protease,integrase,transposase	Staphylococcus_phage(25.0%)	58	1544856:1544915	1572321:1573315
WP_017376809.1|1515037_1516807_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_017376808.1|1516945_1517989_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376807.1|1518002_1518746_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_062312151.1|1518843_1519176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243094.1|1519479_1520187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420791.1|1520970_1522182_+	protein kinase	NA	NA	NA	NA	NA
WP_017376801.1|1522237_1523062_-	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_017376798.1|1524249_1524885_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017376797.1|1525166_1525526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1525799_1528085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420683.1|1528073_1528730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|1528906_1529539_+	MarC family protein	NA	NA	NA	NA	NA
WP_027243097.1|1529574_1529760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243098.1|1529825_1530971_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243099.1|1531206_1532520_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_155046588.1|1533635_1533845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420682.1|1534379_1534541_-	phosphatase	NA	NA	NA	NA	NA
WP_017376785.1|1535947_1536853_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376784.1|1537093_1537279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242578.1|1537315_1537852_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_027242577.1|1537869_1539171_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_048876008.1|1539167_1540142_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_144420681.1|1540185_1540371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1540550_1540715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1540716_1541592_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|1541882_1542047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1542048_1542924_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1543239_1544160_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1544175_1544559_-	hypothetical protein	NA	NA	NA	NA	NA
1544856:1544915	attL	TCTGACTCCTGATGAAAAGGCTGAGCTTCAATCCCTGCGAAAGAAAGTAAAGCAACTGCA	NA	NA	NA	NA
WP_144420679.1|1544885_1545842_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_027243017.1|1546598_1547942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|1548115_1548259_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1548338_1549313_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1549460_1551332_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1551364_1551463_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1551698_1552328_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1552311_1552734_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1552740_1554480_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1554480_1555545_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1555548_1555902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1556034_1557003_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1557012_1557324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1557339_1557909_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1558172_1559501_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1559541_1560516_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1561102_1561504_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146619459.1|1562023_1564480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1564682_1565534_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1565579_1567286_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1568757_1569732_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1570094_1570340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1570703_1571732_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1571862_1572066_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420679.1|1572350_1573307_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_047927838.1|1573599_1573845_+	hypothetical protein	NA	NA	NA	NA	NA
1572321:1573315	attR	TCTGACTCCTGATGAAAAGGCTGAGCTTCAATCCCTGCGAAAGAAAGTAAAGCAACTGCAGATGGAGAAAGAAATTTTAAAAAAGGCGAGTGCCTTCTTCGCGAAAGAAATGAAGTAAAATTTAATTTTATTCGGAAGAACAAAGTGTTATATCCTATTAATCTGACCTGTAAAGTGATGAAGGTAAGCCGTTCTGCCTTTTATGCTTGGGACAAGCGGCCTGCTAAAGTGATTTCAATTGAAGAGCTTCAGCTTTATCGGCGCTGTAAGGAGCTTTTTAAAGAAAGTCGCGGCAGCTTAGGATCACGAATGATGGCATATAAACTTCAAGAAGAAGGCTTTCAAGTAGGCCGTTATCGGGCGAGAAGCCTAATGCAAAAACTCGGTTTAAAGGTGCTGCAACGTAAAGCTTATAAAGTGACAACTAAGCGTAAGCACCATCACGCTGTTGCAGATAACGTATTGAATCAGCAGTTTAATCCAGTCATTGCAAATCACTCATGGGCAGGTGACATTACCTACCTTAGAACTGCTGAAGGCTGGTTGTATCTTGCGGTCGTTATTGATTTATACTCTCGAAAAGTGATTGGCTGGGCGATGAATAAGAGAATGAGCGAAAATCTAGTTTGTCGTGCAATGGATATGGCGATTCACTTGCGGCAGCCGACAGAACACTTGTTATTTCACAGTGATCGTGGTTCGCAGTATACCAGTAAAAAATATCGAAAACTGTTGAAGAAGCATAAAATCACCGCTTCTATGAGCAGTGTCGGTGCTTGCGTTGACAATGCGGTTGTCGAGCGTTTTTTTGGCAGCCTAAAGCACGAATGGCTGTTGAATGTGATTCACTTAACCCGTGATACTATGAAGGAGGATGTTGAGGCCTATATTCGATATTACAATCATGATCGGTTGCATACAGCCAATGGTAACCTATCGCCTATTAATTTTGAAAAGTCTCAATTAAAAGTGTCCAATATGACTTGACCAGAACA	NA	NA	NA	NA
WP_016212018.1|1573841_1574141_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1574363_1574834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1575444_1575672_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 18
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	1581124	1624055	3201212	transposase	Staphylococcus_phage(20.0%)	41	NA	NA
WP_048876031.1|1581124_1582528_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1582715_1583573_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1583697_1584333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1584381_1584633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1584888_1585788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1585924_1586998_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1587098_1587512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1587532_1588246_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1588433_1589846_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1590055_1591024_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1591757_1592126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1592129_1592447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1592522_1593497_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1594016_1594517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1594587_1595916_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243164.1|1596051_1597440_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1597587_1598898_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1599238_1600522_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1600595_1601216_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1601414_1601675_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1601877_1602024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1601999_1602593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1604456_1604675_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1605927_1606698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1606784_1607000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1607096_1608218_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1608484_1609459_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1609721_1610843_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1611135_1611423_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1611395_1611899_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_082300502.1|1611979_1612639_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1612980_1613898_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1614027_1614201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1614866_1616225_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_144420789.1|1616416_1616863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376485.1|1617057_1618287_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1618332_1618959_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1619108_1620296_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1620304_1620997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1621118_1622271_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1623071_1624055_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 19
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	1682390	1772705	3201212	tRNA,protease,transposase	Burkholderia_phage(14.29%)	82	NA	NA
WP_036774017.1|1682390_1683266_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1683655_1683994_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1683990_1684587_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1684589_1686584_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1686647_1687586_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1687934_1688909_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1689112_1689310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1689471_1689876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1691459_1691900_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1692226_1693102_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1693114_1693357_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1693763_1694018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1695229_1696195_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1696287_1696599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1696799_1697576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1698405_1698597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1699325_1700375_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1700545_1701319_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1701379_1702969_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1703159_1704251_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1704273_1704591_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1704677_1705955_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1705976_1706813_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1706819_1708454_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1708885_1709245_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1709526_1710885_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1710910_1711153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1711646_1711826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1712081_1713338_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1713451_1713709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1713853_1714864_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1715240_1716095_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1716124_1716958_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_047927608.1|1717585_1718308_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1718389_1718710_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1718928_1719834_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1719919_1720318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1720462_1720960_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047927093.1|1722620_1723724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1723822_1724200_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1724279_1725254_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1726798_1727518_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1727601_1727889_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1728173_1729046_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1729002_1729779_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1729983_1730319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1730717_1731074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1731235_1731511_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1731620_1731968_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1731985_1732765_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1732764_1733274_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1733309_1733558_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1733869_1734205_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1734504_1735755_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1735836_1737864_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1738409_1738628_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1738799_1739162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1739310_1740714_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1740995_1742171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1742188_1744186_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1744166_1745147_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1745202_1746045_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_036772544.1|1746044_1746461_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1746441_1746861_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1746883_1747513_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1748081_1750271_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1750282_1751488_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1751472_1753320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1753304_1754543_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1754529_1756398_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1756431_1757685_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1757690_1758548_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1758566_1759295_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1760433_1761225_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1761590_1761878_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|1764000_1764390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1764566_1765325_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1765321_1767721_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1767734_1769012_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1769101_1770400_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1770597_1771491_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1771490_1772705_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 20
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	1783404	1833889	3201212	tRNA,transposase	Vibrio_phage(14.29%)	47	NA	NA
WP_069971651.1|1783404_1784280_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1784652_1784916_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1785222_1787817_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1787813_1788296_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1788273_1789314_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1789488_1789974_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1790081_1792652_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1792685_1793147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1793483_1794359_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1794636_1796397_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1796490_1797156_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1797168_1798674_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1798695_1799226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1799299_1800562_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1800748_1801621_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1801722_1802511_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1802603_1803929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1804282_1805458_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1805626_1806280_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1806435_1808376_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1808372_1808996_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1809160_1810135_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1810406_1811027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1811023_1812427_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1812494_1812911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1813318_1813816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1813812_1814787_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|1814866_1815436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1815580_1816117_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1816121_1816418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1816426_1817032_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1817217_1817616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1817806_1818010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1818154_1818310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1818434_1818887_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1819003_1820476_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1820914_1821379_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1822067_1823318_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1823427_1823898_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1823920_1824514_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1824651_1825701_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1825724_1826648_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1826664_1827126_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1827233_1828052_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1828661_1828805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048048.1|1832383_1832917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1832968_1833889_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	1896085	1911401	3201212	transposase	Staphylococcus_phage(50.0%)	15	NA	NA
WP_017378288.1|1896085_1896307_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1896365_1897340_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1897538_1897703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1897699_1898335_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420659.1|1898611_1899391_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420658.1|1899423_1900185_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1900161_1901151_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1901286_1902162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1902180_1902840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1903081_1903528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1903524_1904928_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1905041_1905887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1906031_1907681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1907771_1908557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|1909997_1911401_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	1940074	1987039	3201212	tRNA,transposase	uncultured_Mediterranean_phage(36.36%)	40	NA	NA
WP_144420657.1|1940074_1941136_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1941847_1942009_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1942925_1943465_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1943847_1944264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1944359_1945175_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1945307_1946801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1946986_1947412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1947408_1949469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1949752_1950568_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1950668_1951487_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1951483_1951852_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1952033_1952861_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1952924_1953653_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1954055_1954784_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1955173_1955899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1955933_1959806_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1960006_1961140_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1961153_1961342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1961565_1962924_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_081078111.1|1964530_1965283_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929627.1|1965405_1965756_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1965815_1966103_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1966155_1966935_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376415.1|1967359_1968277_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1968328_1969084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1969151_1970426_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376412.1|1970546_1971224_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376411.1|1971424_1972849_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_016209938.1|1972823_1973462_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376410.1|1973824_1974103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376409.1|1974336_1975281_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376408.1|1975302_1977171_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376407.1|1977191_1977545_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_026063528.1|1977583_1978699_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1978883_1979924_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_027242800.1|1979926_1980961_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376402.1|1980957_1982019_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_017376401.1|1982130_1983603_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376400.1|1983755_1984199_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376399.1|1984267_1987039_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
>prophage 23
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	1991470	2040337	3201212	transposase	Staphylococcus_phage(25.0%)	45	NA	NA
WP_036773116.1|1991470_1992445_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|1992968_1995695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|1996582_1997557_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|1997807_1998512_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|1999751_2000270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|2001237_2002722_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2002846_2004382_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2004404_2004734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2004630_2004846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2006829_2008029_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2008238_2009099_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2009214_2009793_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2009949_2010591_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2010629_2010851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2010843_2011827_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2012220_2012718_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2012862_2013138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2013289_2014972_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2014979_2016002_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2016170_2017172_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2017285_2017624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2018099_2019359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2019567_2019795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2019823_2020042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2020179_2020545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2020612_2020855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2020869_2021205_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2021209_2021647_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_017377417.1|2021672_2023058_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2023168_2023600_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2023705_2025217_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2025507_2027100_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2027300_2029496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242889.1|2029589_2031023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2031065_2031581_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2031580_2032528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2032511_2033177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2033173_2033902_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2033891_2034638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2034621_2035686_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2035890_2037078_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2037134_2038253_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2038700_2038958_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2039237_2039915_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2040133_2040337_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	2060037	2110148	3201212	protease,tRNA,transposase	Burkholderia_virus(20.0%)	43	NA	NA
WP_017377787.1|2060037_2060265_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2060354_2061110_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2061523_2062120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2062199_2065004_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2064984_2065938_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2065930_2067301_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_155048054.1|2067471_2068077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048056.1|2068221_2069163_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2069934_2070261_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420651.1|2070465_2071119_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_017376600.1|2071438_2071618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2071873_2073130_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2073368_2073515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2073597_2073954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2074449_2074809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2074818_2075202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2076090_2076231_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2076375_2077296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2079453_2079984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2079994_2081050_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2081065_2083105_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2083091_2083922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2083988_2087528_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2087641_2088361_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2088599_2089229_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2089348_2090752_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2090897_2092841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2093358_2094219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2094654_2096400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|2096802_2098275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2098457_2099057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2099194_2099392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2099592_2099733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2099800_2100580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2101144_2101546_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2101690_2102068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2102527_2103835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155048058.1|2104383_2104566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2104871_2105129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2105180_2106584_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2106824_2108534_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2108703_2109066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2109173_2110148_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 25
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	2124717	2251555	3201212	tRNA,protease,transposase	Staphylococcus_phage(14.81%)	117	NA	NA
WP_017377892.1|2124717_2126139_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_026063687.1|2126228_2127827_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377894.1|2127983_2128610_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027242839.1|2128690_2131363_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377896.1|2131845_2132802_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_017377897.1|2132854_2133274_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_048875958.1|2133300_2134164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377899.1|2134153_2134945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2135249_2136221_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2136569_2136878_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2136874_2137531_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2137664_2138150_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2138227_2138749_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2138794_2139688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2139684_2140506_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2140700_2140850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2141077_2141908_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046606.1|2143313_2143484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2143636_2145040_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_144420645.1|2145149_2146406_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2146377_2147109_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2147120_2148398_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2148497_2148872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2148956_2149844_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2149901_2150630_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2150626_2151736_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2151887_2152316_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2152410_2152767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2152759_2153971_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2153967_2154756_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2154918_2155713_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2156162_2156903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2156906_2159405_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2159667_2160624_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2160607_2161369_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2161576_2162551_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2162659_2163415_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2163539_2163785_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2163844_2166118_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2166172_2166475_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2166715_2167009_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2167179_2167359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2167434_2168046_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2168292_2169609_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2169619_2169988_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2170018_2170681_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2171103_2171682_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2171661_2172069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2172192_2172489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2172535_2173411_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876123.1|2173480_2175661_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_017376060.1|2175764_2177114_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_036772012.1|2177187_2177877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2178009_2179197_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376055.1|2179715_2180360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2180356_2181670_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2181874_2182048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2182317_2182791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2182935_2183130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2183394_2184270_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210558.1|2184456_2185212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376051.1|2185285_2186938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376050.1|2186977_2188516_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_087910638.1|2188515_2190216_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_075275404.1|2190304_2191480_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_017376046.1|2191518_2192481_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_017376045.1|2192758_2193181_-	universal stress protein	NA	NA	NA	NA	NA
WP_017376044.1|2193486_2194128_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376043.1|2194256_2195591_+	dihydroorotase	NA	NA	NA	NA	NA
WP_048875952.1|2195705_2196341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771517.1|2197085_2198222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771498.1|2198405_2200136_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_017376037.1|2200125_2201334_+	MFS transporter	NA	NA	NA	NA	NA
WP_075275290.1|2201432_2202434_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420641.1|2202677_2203313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2203332_2204307_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155048060.1|2204386_2204644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619425.1|2204788_2205475_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2205620_2206040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2206316_2206997_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2206962_2207313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2207345_2208557_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2208897_2209527_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2209575_2210592_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2210838_2211054_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2211106_2211556_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2211635_2213381_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2213472_2215344_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2215788_2216505_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2217942_2218812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2218768_2218996_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2219964_2220879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2220924_2221947_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2222015_2223065_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046607.1|2223681_2223864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243219.1|2224148_2224457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2224623_2226027_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046608.1|2226119_2226284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2226605_2226830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2226840_2228052_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036774710.1|2228446_2229346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|2229519_2229921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2230167_2231211_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2231330_2231567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2232355_2233909_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2236089_2236317_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2237187_2238162_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017375736.1|2238888_2239971_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_017375735.1|2240013_2240664_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375734.1|2240886_2241258_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_027243178.1|2241368_2242730_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155046609.1|2244450_2244657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2244967_2246050_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2246046_2246358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2247403_2248378_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2249096_2249876_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2250337_2251555_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	2264425	2325393	3201212	integrase,transposase	Staphylococcus_phage(30.0%)	46	2272278:2272337	2322699:2323459
WP_144420638.1|2264425_2265508_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2265504_2265816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2267313_2268249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2268841_2269987_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2272229_2273393_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2272278:2272337	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_036815620.1|2274993_2276169_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2276514_2279025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2279083_2279896_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377669.1|2280336_2281041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2281090_2282065_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2282169_2283501_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2283699_2283768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2283899_2285342_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2285733_2287146_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2287835_2288282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2288876_2289725_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2289978_2291037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2291028_2292735_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2292806_2294540_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2294836_2295403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2295527_2296181_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2296207_2297668_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2297764_2298742_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2299211_2300615_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2301140_2301434_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2301660_2302425_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2302632_2302860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2302923_2303106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2303668_2303848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046690.1|2303890_2304223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2305077_2305782_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2305979_2306120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2306524_2307049_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|2307195_2308452_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2308519_2308999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2309439_2310843_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420632.1|2311257_2313573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2314145_2316038_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2316209_2317184_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2317487_2318294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2318362_2318974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2320455_2320752_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2320748_2321591_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2321981_2322767_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2322771_2324175_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2322699:2323459	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2324448_2325393_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	2346235	2373888	3201212	protease,transposase	Staphylococcus_phage(25.0%)	28	NA	NA
WP_017377305.1|2346235_2347537_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2347618_2348224_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2348336_2349641_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2350241_2351117_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2351232_2351904_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2352083_2353439_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2353559_2354297_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2354375_2355092_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2355740_2357015_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2357045_2357621_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2357665_2358631_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2359094_2360003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|2360390_2360642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2360786_2361215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2361200_2362145_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2362349_2362502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2362530_2363265_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2363359_2363620_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2363838_2364804_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|2364780_2365077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2365267_2365717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2365976_2366405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2366500_2367001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2366937_2367099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2367979_2368201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2369699_2370377_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2371691_2372030_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2372913_2373888_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 28
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	2412935	2534506	3201212	tRNA,transposase	Burkholderia_virus(27.78%)	103	NA	NA
WP_080999971.1|2412935_2414339_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2414452_2415028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2416273_2416501_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2416790_2417330_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2417639_2419127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2419178_2419604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2419822_2421226_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2421222_2421600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2421559_2422105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2422500_2423727_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2424327_2425980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2425916_2426111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963645.1|2426443_2427634_-	MFS transporter	NA	NA	NA	NA	NA
WP_027243147.1|2427882_2430555_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2430843_2431680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2432340_2433231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2433699_2434674_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876012.1|2435158_2436562_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2436707_2438111_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|2438195_2440010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2441921_2443325_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2443358_2444888_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2444923_2446384_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_027242908.1|2446358_2447318_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376200.1|2447395_2450902_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_017376201.1|2450925_2451495_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_027242907.1|2451708_2452863_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376204.1|2452881_2453655_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|2453654_2454101_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376206.1|2454118_2455168_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_017376207.1|2455278_2455812_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_036771893.1|2455892_2458310_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_027242906.1|2458594_2459662_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_017376209.1|2461864_2462929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376210.1|2462918_2463947_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376211.1|2463943_2464483_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376212.1|2465019_2466930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420623.1|2466977_2467175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420622.1|2467374_2468952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|2469048_2469924_-	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_080963646.1|2470012_2470912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063514.1|2470826_2471573_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_017376216.1|2471580_2472138_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_017376217.1|2472141_2472879_-	UMP kinase	NA	NA	NA	NA	NA
WP_017376218.1|2472882_2473761_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376219.1|2473925_2474693_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376220.1|2475099_2475909_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376221.1|2475986_2478644_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|2478647_2479685_+	asparaginase	NA	NA	NA	NA	NA
WP_017376223.1|2479686_2480508_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376224.1|2480638_2481523_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_036773116.1|2481835_2482810_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2482862_2483858_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2483900_2484875_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376319.1|2485499_2486180_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017376318.1|2486179_2486989_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027242903.1|2487062_2490743_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_026063524.1|2490752_2492240_-	ribonuclease G	NA	NA	NA	NA	NA
WP_017376313.1|2492249_2492867_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_017376312.1|2492936_2493455_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376311.1|2493451_2494351_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2494366_2495410_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376309.1|2495607_2495895_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2496015_2497476_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2497555_2498992_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2499116_2500091_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2502281_2503043_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2504200_2504428_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2505381_2505594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2505611_2505929_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2505955_2506645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2506985_2507189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2507320_2508256_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2508268_2509051_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2509180_2509492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2509835_2510162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2510186_2510642_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2510631_2511684_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2511686_2513150_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2513284_2513512_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2514465_2514678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2514695_2515013_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2515039_2515729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2516069_2516273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2516404_2517340_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2517352_2518135_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2518264_2518576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2518919_2519246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2519270_2519726_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2519715_2520768_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2520770_2522234_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2522368_2522596_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2524012_2524477_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2524733_2525549_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2525677_2527990_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2528106_2528634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2529325_2530603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2530613_2530865_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2530898_2531420_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2531589_2532576_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2532666_2533482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2533910_2534306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2534278_2534506_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 29
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	2544187	2594430	3201212	tRNA,transposase	Bacillus_phage(33.33%)	50	NA	NA
WP_155048063.1|2544187_2545183_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2545186_2545591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2546558_2546786_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2547754_2548351_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875914.1|2548319_2549480_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_017375625.1|2550184_2550412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875913.1|2550408_2551179_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017377194.1|2551175_2552489_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_027243130.1|2553413_2554283_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377197.1|2554279_2555629_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_017377198.1|2555741_2557382_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_027243131.1|2557767_2558034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377200.1|2558163_2558352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2558916_2560320_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|2560425_2560650_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2560832_2561654_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|2561799_2562054_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377841.1|2562442_2564227_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|2564315_2565035_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2565196_2565403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2565402_2565639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2565651_2566005_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2566542_2567376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2567468_2567666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2567763_2569149_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2569275_2569866_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2570897_2571185_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2571244_2571409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2571405_2572776_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2573142_2574555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2574624_2575395_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2575887_2576175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2577651_2577945_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2577902_2578724_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2578868_2579093_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155046618.1|2579347_2579875_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|2580051_2580312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2580230_2580386_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2580484_2581459_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2582787_2582937_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2583053_2583347_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2584155_2584731_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2584808_2585684_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2585748_2586369_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2586353_2587436_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2587669_2588074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2589564_2590866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2591012_2591681_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2592613_2593177_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2593233_2594430_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
>prophage 30
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	2609355	2663339	3201212	tRNA,transposase	Staphylococcus_phage(33.33%)	51	NA	NA
WP_036771330.1|2609355_2610330_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376571.1|2610496_2612821_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.7	7.6e-25
WP_017376570.1|2612995_2613712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063542.1|2613791_2614406_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_017376568.1|2614398_2615781_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_017376567.1|2615789_2616263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376566.1|2616395_2617655_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_144420761.1|2618178_2618358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|2618502_2619213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046619.1|2619280_2619538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999966.1|2619624_2620974_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2621271_2621829_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2621922_2622429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2622933_2623629_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|2623759_2624548_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2624581_2625985_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2626408_2627383_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2627639_2627867_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2628954_2629485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2629481_2631014_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2631010_2631961_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2632381_2633014_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2633256_2633454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2633803_2634232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2634309_2635305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2635449_2635701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2635805_2636450_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2636685_2637183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2637694_2638669_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2639039_2639333_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2640145_2640481_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2640801_2642340_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2642492_2643591_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2643829_2645029_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2645059_2645686_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2645714_2646599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2646732_2646963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2647100_2648342_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_144420613.1|2648621_2648993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2651124_2651286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2651661_2652789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2652905_2653568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2653653_2653914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2654332_2655094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2657155_2657815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2657915_2658566_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2658713_2659403_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377795.1|2659425_2660589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2660793_2661045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420612.1|2661568_2662177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2662364_2663339_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 31
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	2678016	2723061	3201212	tRNA,transposase	Staphylococcus_phage(40.0%)	43	NA	NA
WP_048875904.1|2678016_2678892_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2679012_2679513_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2679509_2679776_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2679941_2680916_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2681095_2681716_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2682022_2683426_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771922.1|2684260_2685451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|2686017_2686485_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|2686986_2687241_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|2687442_2687946_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|2688162_2688768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2688928_2689612_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2689687_2690467_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|2690453_2691314_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|2691437_2691803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377271.1|2692188_2692518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2692928_2693903_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377273.1|2694437_2694677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420610.1|2694670_2696050_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	3.3e-36
WP_017377275.1|2697084_2697807_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2697798_2698167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2698429_2699731_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2699826_2700270_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2700273_2700783_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2700775_2703589_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2704085_2705018_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2705122_2706049_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2706227_2707766_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2707939_2708200_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2709474_2710083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2710129_2710858_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2711104_2711242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377696.1|2712404_2712944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2713178_2714090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2714349_2714646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2714990_2716144_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2716740_2717289_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2717392_2717956_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2718173_2718932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2720207_2720435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2720657_2720837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2721092_2722349_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2722416_2723061_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
>prophage 32
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	2775863	2828904	3201212	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2775863_2776838_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2776994_2778569_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2778793_2779072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2779141_2780017_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2780026_2781187_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2781301_2782450_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2782460_2785262_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2785368_2786067_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2786079_2787843_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2787846_2788194_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2788187_2788562_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2789509_2790793_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2791202_2792498_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2792853_2793399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046622.1|2793992_2794508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2794519_2795899_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2796146_2796581_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2796577_2797930_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2797929_2799045_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2799045_2800062_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2800051_2801722_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2801741_2802077_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2802104_2803544_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2803540_2804587_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2804729_2806226_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2806521_2807523_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2807628_2808240_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2808360_2808738_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2808788_2810195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2810188_2811256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2811362_2812964_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2813212_2814130_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2814198_2815893_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2816127_2817057_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2817087_2818491_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2818721_2819426_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2819492_2820149_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2820159_2821041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2821211_2823881_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2824241_2825216_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2825295_2826267_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2826320_2827295_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2827414_2827636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2827699_2828008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2827932_2828904_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	2843470	2880657	3201212	transposase	Staphylococcus_phage(50.0%)	37	NA	NA
WP_026063658.1|2843470_2844199_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2844508_2844763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2845476_2848131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2848169_2848460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2848576_2849875_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2850445_2850934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2850914_2851217_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2851463_2851952_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2851985_2852624_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2852745_2853285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2853374_2854601_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2855213_2855471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2855557_2856457_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2856601_2856868_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2856859_2857009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2857236_2858112_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2858241_2858469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2858535_2858730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2858788_2859763_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2859800_2859989_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2859989_2861762_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2861751_2862744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2863351_2864044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2864530_2865100_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2865096_2866071_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2866110_2866614_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2866704_2868108_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2868806_2868992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2869097_2870501_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420599.1|2870505_2871078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2871111_2872539_-	amino acid permease	NA	NA	NA	NA	NA
WP_155048066.1|2873162_2873351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772717.1|2873824_2876194_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2876269_2877088_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2877439_2877985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2878467_2879706_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2879682_2880657_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 34
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	2896303	2955210	3201212	tRNA,transposase	Lake_Baikal_phage(12.5%)	52	NA	NA
WP_080999962.1|2896303_2897731_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376537.1|2898454_2900080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376536.1|2900249_2900609_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376535.1|2900821_2901253_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017376534.1|2901264_2901444_-	rubredoxin	NA	NA	NA	NA	NA
WP_144420597.1|2901560_2902547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243034.1|2902727_2904017_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_017376531.1|2904128_2904926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|2905317_2906685_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2907177_2907657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2907836_2909900_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2909908_2910634_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2911261_2911975_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2911979_2912510_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2912744_2912978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2913090_2913339_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2914146_2916339_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2916356_2916665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2917318_2919028_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2919221_2919377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2920779_2921655_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2921980_2922742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2922966_2923698_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2923694_2924231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2924284_2925049_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2925051_2926629_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2926635_2927112_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2927087_2927519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2927551_2928307_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2928481_2928769_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2929151_2929376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2929715_2930879_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2930913_2931891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2931884_2932571_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2932509_2933625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2933904_2934510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2934747_2935227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2937049_2937703_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2937815_2938367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2938466_2939441_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2939726_2940251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2940948_2941773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2942028_2942385_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2942381_2943785_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2943904_2944465_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2944622_2945189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155048067.1|2945391_2947938_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_027243087.1|2948201_2948897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2948937_2949150_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2950722_2951832_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2951887_2953369_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2953806_2955210_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP038904	Piscirickettsia salmonis strain Psal-008 chromosome, complete genome	3201212	3082604	3147853	3201212	protease,transposase	Hokovirus(14.29%)	57	NA	NA
WP_017376170.1|3082604_3083705_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3084062_3085037_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3085173_3086052_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3086059_3086290_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3086343_3087348_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3087566_3088394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3088475_3089864_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3090151_3091552_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3091646_3092573_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3092569_3093706_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3093702_3094710_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3094706_3095870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3095879_3096731_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3096762_3097935_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3097931_3099320_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3099348_3099756_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3099775_3100783_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3100779_3101652_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3101648_3102509_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3102510_3104781_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3104782_3105928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3105974_3106460_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3106499_3107123_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3112802_3113555_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155046626.1|3114157_3114325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243062.1|3114886_3115510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3115614_3116403_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3116402_3117134_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3117167_3118895_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3118908_3119970_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3120284_3121499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3121631_3122156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3122773_3123622_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3123608_3124307_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3124361_3125123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3125115_3125538_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3125667_3126219_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3126274_3127237_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3127237_3127453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3127639_3128449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3128428_3129271_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3129267_3130512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3130650_3131739_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3131756_3132257_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3132444_3133044_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3133049_3134213_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3134245_3135199_+	glutathione synthase	NA	NA	NA	NA	NA
WP_155048072.1|3135343_3135499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376261.1|3135562_3136627_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3136623_3139686_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3139838_3140291_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3140322_3140679_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3141097_3141871_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376269.1|3144494_3144785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3145009_3145885_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3145881_3146439_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3146449_3147853_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038905	Piscirickettsia salmonis strain Psal-008 plasmid unnamed1, complete sequence	165781	0	39588	165781	transposase,terminase,portal	Streptococcus_phage(35.0%)	41	NA	NA
WP_017377655.1|1412_1658_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|1654_2041_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|2128_2857_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|2835_3456_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|3801_4488_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|5437_5800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|5802_7542_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|7943_8096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|8123_8807_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|8888_9866_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771293.1|10934_11201_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420835.1|11496_13410_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|13816_14545_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420842.1|14606_14765_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|15181_15346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|15366_16653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|16835_17564_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|17691_18669_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_069971704.1|18750_19242_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|19349_20327_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155048088.1|20327_21158_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	35.8	4.9e-35
WP_027243212.1|21652_21940_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_027243211.1|21929_22184_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_155046636.1|22401_22563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|22577_23555_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_062365770.1|23573_23807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|23888_24866_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_144420849.1|25331_26312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|26543_27053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242596.1|27092_27455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275482.1|27768_28743_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_017377509.1|28836_29565_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_027243190.1|29745_33090_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_144420848.1|33093_33279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876202.1|34657_35371_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_036771649.1|35417_36152_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_087910668.1|36189_36576_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_047927581.1|36662_37097_-	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_048876205.1|37301_38633_-|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_075278733.1|38635_39118_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_027242929.1|39204_39588_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
>prophage 2
NZ_CP038905	Piscirickettsia salmonis strain Psal-008 plasmid unnamed1, complete sequence	165781	43724	48495	165781		Vibrio_phage(25.0%)	7	NA	NA
WP_081078123.1|43724_44087_-	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
WP_146619517.1|44116_44269_+	phosphatase	NA	NA	NA	NA	NA
WP_017375959.1|44406_44640_-	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_017375960.1|44941_45985_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_036817201.1|46092_46500_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_036817204.1|46803_47799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|48069_48495_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
>prophage 3
NZ_CP038905	Piscirickettsia salmonis strain Psal-008 plasmid unnamed1, complete sequence	165781	54734	112377	165781	transposase,portal,integrase	Streptococcus_phage(52.0%)	55	71046:71105	110688:111608
WP_048876229.1|54734_55706_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046634.1|55624_55825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771279.1|55894_56623_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375850.1|56983_57760_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_027242940.1|58113_58713_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_155046633.1|59919_60063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771289.1|60956_61427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876208.1|62280_63108_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_048876229.1|63972_64944_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|65513_66242_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036772441.1|66317_66590_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|66593_66854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929764.1|68212_68704_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.1	6.9e-21
WP_036772450.1|69375_70503_-	hypothetical protein	NA	NA	NA	NA	NA
71046:71105	attL	TTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTA	NA	NA	NA	NA
WP_027243215.1|72316_73339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|73821_74550_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_048876194.1|75789_76323_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|76503_76845_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|77025_77292_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|77364_79230_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|79397_79682_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|80025_80754_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|80835_81327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|82059_82287_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|83838_84267_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|84202_84589_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|84618_85347_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|85358_85508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|85754_86483_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|87860_88823_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|88846_89176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|89242_90283_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|90296_90488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|90692_91262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|91304_91604_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774376.1|91600_92029_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|92338_93067_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|93240_94014_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|94727_95663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|95937_96666_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243201.1|96831_97071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|97134_100476_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|100633_101362_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|101655_102051_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|102103_102832_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|103315_104044_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|104214_104784_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|104788_105472_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|105623_106352_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_080963627.1|106370_106589_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774644.1|107568_108630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|109138_109885_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|109885_110290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|110596_111571_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_036771293.1|112110_112377_-|transposase	transposase	transposase	NA	NA	NA	NA
110688:111608	attR	TTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGCGCACAAGAAAAACGAGCTAACGCTAAGCAAGGACAAGCTTTTCAACAAATTTCAGAAGAGGAAAAAATGTTGATTCATCAGCGGTTAAGCACTCATACATCCCCCGATGTTATCAGTCAAGAACTTATACGTGAGCATAATATTCAGGTGAGTGAGAGCACGATTTACCGTTATATTTATGATGATAGAGAGCGGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCAGGAAAACCTTATAAGAAGAAGGTGAGTCGTGGTGATCAAACAAAAATACCTAATCGCGTTGGTATTGAACAACGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGTGACCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACTTCTGACAACGGAACAGAGTTTGCCGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAACACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACGGATTTTAATGAAGTTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATCGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGT	NA	NA	NA	NA
>prophage 4
NZ_CP038905	Piscirickettsia salmonis strain Psal-008 plasmid unnamed1, complete sequence	165781	117521	119143	165781	transposase	Acinetobacter_phage(50.0%)	3	NA	NA
WP_017375632.1|117521_117857_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|118051_118255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|118348_119143_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
>prophage 5
NZ_CP038905	Piscirickettsia salmonis strain Psal-008 plasmid unnamed1, complete sequence	165781	125639	128057	165781	transposase,portal	unidentified_phage(50.0%)	2	NA	NA
WP_048875857.1|125639_126614_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|127601_128057_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
>prophage 6
NZ_CP038905	Piscirickettsia salmonis strain Psal-008 plasmid unnamed1, complete sequence	165781	132775	139743	165781	transposase	Streptococcus_phage(100.0%)	7	NA	NA
WP_017377509.1|132775_133504_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|133645_134578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|134607_135336_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|135338_135611_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|136461_137190_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036773689.1|137212_137866_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|139014_139743_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 7
NZ_CP038905	Piscirickettsia salmonis strain Psal-008 plasmid unnamed1, complete sequence	165781	145778	150896	165781	transposase	Streptococcus_phage(100.0%)	5	NA	NA
WP_027243210.1|145778_146513_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.9e-36
WP_155046640.1|147513_147681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876214.1|147649_148378_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_017377521.1|148886_149240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|150167_150896_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 8
NZ_CP038905	Piscirickettsia salmonis strain Psal-008 plasmid unnamed1, complete sequence	165781	157260	163163	165781	transposase	Staphylococcus_phage(28.57%)	9	NA	NA
WP_075275473.1|157260_157437_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|157553_158261_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|158214_159093_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243193.1|159123_159666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|159937_160642_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|160653_161382_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|161411_161801_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|161823_162552_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|162554_163163_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
>prophage 1
NZ_CP038906	Piscirickettsia salmonis strain Psal-008 plasmid unnamed2, complete sequence	53331	16061	29857	53331	capsid,head,tail,transposase	Moraxella_phage(18.18%)	18	NA	NA
WP_036771347.1|16061_17039_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375652.1|17066_17495_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242568.1|17553_20244_-	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375789.1|20240_20798_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_144420832.1|20787_21573_-	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375787.1|21502_22174_-|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_017375786.1|22170_22512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771950.1|22504_24583_-|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375784.1|24586_24853_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_017375783.1|24909_25233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375782.1|25234_25657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375781.1|25656_26007_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375780.1|26003_26399_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375779.1|26577_27003_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375778.1|26999_27311_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_027242598.1|27695_28280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275454.1|28293_28833_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_036771639.1|28882_29857_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
>prophage 1
NZ_CP038907	Piscirickettsia salmonis strain Psal-008 plasmid unnamed3, complete sequence	33555	3402	19424	33555	terminase,head,integrase,tail,transposase,capsid	unidentified_phage(35.71%)	21	NA	NA
WP_036771330.1|3402_4377_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4912_5503_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5733_5994_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5986_6340_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6516_7491_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|8023_8389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|8533_8788_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8771_9128_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|9225_10200_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|10825_11692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|11904_12288_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|12374_12857_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|12859_13045_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|13064_14039_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|14135_14528_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|14563_15145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|15525_16500_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|16573_16789_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|17592_18108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|18453_19011_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|19007_19424_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
