The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	45576	89168	3337236	transposase	Moraxella_phage(20.0%)	42	NA	NA
WP_075273371.1|45576_46152_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46097_46463_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036776493.1|46661_47423_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_036779326.1|47724_49251_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49622_50462_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50501_51809_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51783_52953_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|53007_53733_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54011_54401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54588_55494_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55541_55685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047031.1|55732_56329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|56563_57717_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016210704.1|58611_60558_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61212_64275_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64271_65336_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65691_66645_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66676_67840_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67845_68445_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68632_69133_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69150_70239_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70377_71622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71618_72461_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_032126369.1|73416_73644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73644_74595_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74650_75202_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75328_75751_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75743_76490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76532_77231_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77241_78066_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78395_78764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|78758_79820_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|79869_80100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80229_81444_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81744_82806_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_036777695.1|82819_84547_+	oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_016211245.1|84580_85312_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85311_86100_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86204_86828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87147_87360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047032.1|87515_88577_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047033.1|88571_89168_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	127258	181533	3337236	transposase	Staphylococcus_phage(42.86%)	58	NA	NA
WP_054300271.1|127258_128233_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209611.1|128481_128673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047035.1|128752_128932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209580.1|129023_129548_+	ankyrin repeat family protein	NA	NA	NA	NA	NA
WP_016209612.1|129931_130300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209595.1|130337_130610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300576.1|130700_131996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211692.1|132631_133534_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.4	1.6e-18
WP_051307362.1|133590_134442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211694.1|135021_137031_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	3.0e-110
WP_054300271.1|137068_138043_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|138544_139957_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|140449_141457_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|141476_142997_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_016211018.1|143947_145264_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145367_145751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145885_148951_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|149019_150123_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|150146_150701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150815_151385_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151504_152260_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_155047036.1|152426_153326_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047037.1|153470_153776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082829.1|154170_154566_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|154587_154953_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|155009_155174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|155163_155463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300544.1|155553_156000_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|156495_157062_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|157073_157859_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|158490_159414_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|159465_160461_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|160492_160987_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_036778333.1|161078_161336_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|161425_161848_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|162166_162883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|162926_163178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778330.1|163182_164619_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|164646_166089_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|166176_166515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|166599_167130_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|167190_169383_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|169425_169911_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|170180_170612_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036778324.1|170629_171460_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|171474_171618_-	lipoprotein	NA	NA	NA	NA	NA
WP_052104672.1|171648_172533_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|172504_172726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|172899_173178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|174148_175054_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_036780891.1|175110_176289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|176285_176861_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|176806_177172_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300541.1|177499_178279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126848.1|178812_179613_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_052104671.1|179831_180590_+	ion transporter	NA	NA	NA	NA	NA
WP_016211859.1|180666_180954_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_075273327.1|180957_181533_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	200549	271546	3337236	tail,transposase,protease,tRNA	Acinetobacter_phage(25.0%)	58	NA	NA
WP_016209871.1|200549_202532_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|202741_204085_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|204351_207021_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|207044_208964_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|209133_210555_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|210700_211675_+	phospholipase A	NA	NA	NA	NA	NA
WP_054300537.1|211706_212114_+	glyoxalase	NA	NA	NA	NA	NA
WP_016209859.1|212392_212614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|212777_214439_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|214511_214802_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_036776911.1|215027_215483_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|215547_216012_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216104_217451_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|217450_218356_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|218417_219404_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|219396_219639_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|219760_221305_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_036776914.1|221351_222638_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|222680_224075_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224098_224278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|224274_224454_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300181.1|224457_224739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|224795_225161_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210079.1|228166_228664_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|228834_229530_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|229632_231195_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|231510_233304_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233389_233662_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|233667_234294_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234280_235711_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236043_237099_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237067_237745_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|237734_238571_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|238730_239024_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|239130_239937_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|240241_241096_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_036776920.1|241250_242300_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_036776924.1|242350_243007_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|243024_244305_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|244578_245940_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_032126863.1|246339_246891_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016211802.1|252322_253594_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036778206.1|253650_254634_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|254630_255416_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_032126362.1|256112_256478_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|256423_256999_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300535.1|257002_257722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|257866_258067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|258114_258576_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|258999_260481_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|260543_261653_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|261750_263712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|264241_264646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047045.1|264698_265394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|265370_266345_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_098082809.1|266515_266866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|267808_268891_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556499.1|270393_271546_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 4
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	274887	327551	3337236	transposase,tRNA	Acinetobacter_phage(33.33%)	57	NA	NA
WP_105962625.1|274887_275774_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300529.1|275945_276347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210630.1|276627_277743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664846.1|277681_278368_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032126366.1|278361_279339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779423.1|279377_280541_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210640.1|281005_281230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|281615_281903_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210633.1|282077_282833_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|282838_283294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210637.1|283269_283746_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210636.1|283752_285330_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_032126367.1|285333_286098_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_036779427.1|286151_286688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210634.1|286684_287416_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_052104757.1|287524_288913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664872.1|289170_290151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211898.1|290392_291016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211899.1|291343_291637_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_129556490.1|291733_292620_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047046.1|293028_294588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211609.1|295202_295511_+	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_032126373.1|295543_297730_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	2.7e-141
WP_016211605.1|297843_298077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|298293_298824_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211607.1|298852_299077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047047.1|299259_299694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047048.1|299898_300363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300526.1|300471_300768_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962174.1|300916_301081_-	phosphatase	NA	NA	NA	NA	NA
WP_016211026.1|301179_301584_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075273367.1|301876_302653_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_155047049.1|302661_304743_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	4.0e-17
WP_016211031.1|304907_305387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211032.1|305696_306494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211033.1|306605_307898_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_032126377.1|308063_309065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211034.1|309181_309361_+	rubredoxin	NA	NA	NA	NA	NA
WP_016211023.1|309371_309806_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_016211029.1|310019_310382_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.6e-25
WP_016212102.1|310555_312196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|313706_314859_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_081377350.1|315392_316208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047277.1|316272_316881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211936.1|317615_318638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047278.1|319127_319529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|319646_320672_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|321246_321408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|321407_321908_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273747.1|322169_322760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|322822_323116_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155049832.1|323198_324074_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	3.7e-57
WP_052104629.1|324191_325217_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047281.1|325443_325773_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.8	5.5e-06
WP_155047018.1|325840_326644_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.9e-55
WP_075274752.1|326679_326979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|326975_327551_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	331919	385446	3337236	integrase,transposase	Escherichia_phage(37.04%)	56	345882:345941	364938:365801
WP_155047246.1|331919_332894_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	1.8e-28
WP_016212579.1|334390_334588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|335187_336162_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212456.1|336205_336493_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_036779532.1|336489_336891_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_075273881.1|336900_339087_-	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	30.1	5.1e-47
WP_016212404.1|339207_339441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273857.1|340217_340952_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	2.1e-45
WP_129556710.1|341105_341576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556709.1|341656_341746_-	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_052047129.1|341957_343541_-	protein kinase	NA	NA	NA	NA	NA
WP_075274745.1|343823_344552_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	2.3e-44
WP_016212365.1|345264_345507_+	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_036781349.1|345508_345835_+	potassium ABC transporter ATPase	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.1e-11
345882:345941	attL	TGGCACTGTTGCAAAAAATTTAGATTTGAGTAGGGTGTAGCAATCAACGGAAGTTAAGAG	NA	NA	NA	NA
WP_054300202.1|345950_346679_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212152.1|347148_347532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|347838_348216_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_155047283.1|348380_348713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|348665_348818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377351.1|348901_349681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047298.1|350210_350396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212019.1|350782_351478_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.2	7.5e-37
WP_105962690.1|351946_352222_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|352218_352464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047016.1|352493_352721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212014.1|353124_353538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|353635_354364_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_105962623.1|354430_355583_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047284.1|356212_357241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|357520_358674_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273826.1|358633_359761_-	hypothetical protein	NA	A0A0N7AE80	Bacillus_phage	22.8	6.1e-12
WP_155047013.1|359981_360128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|360457_361273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780064.1|361518_362109_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	38.3	2.0e-22
WP_016211879.1|363063_364083_+	ParA family protein	NA	NA	NA	NA	NA
WP_075274742.1|364095_364977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|365006_365735_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211890.1|365938_368515_+	hypothetical protein	NA	NA	NA	NA	NA
364938:365801	attR	TGGCACTGTTGCAAAAAATTTAGATTTGAGTAGGGTGTAGCAATCAACGGAAGTTAAGAGTGAATTGCTGTGGGTAGACGTAAACGATTTAAGAAGAATCAACCCTTTAAATGGAAGCATTATTCCGGTGAGATCATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTACCGTGATCTCAAAGAAATAGCAGCTGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGCTGGGTGCACGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTCTTGGCGGTTAGATGAAACGTTGGTGAAAATCAAAGGTCGTTGGTATTACCTTTATCGAGCCATTGATAAATATGGCCATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTTTTTCAAAAAGGCAATCGCCCAACCTTATGTGAAATCACCGCGTGTTGTGAATGTCGACAAGCACGCTTCATTTCCACCCGCTCACCAAAAAGCCAAAGATGAAGGTGTCTTTTCTAGTCAGTGTAAACTCAGGCGAGTGAAGTATTTAAACAACTGCATTGAAAATGATCACAAAGCGGTAAAGCGCAAATCCCGTTTCCGCCAATGGTACCAATCACTTTCTACAGCACGGCCTACCATTGACATAATGGAAGCGATGCGCATGGTTCAAAAAGGTCAATTACGTTATATTAAAAAACAGAATATCTGTGCCCAAAATCAGCTCATTGATAAATTATTTGGATTAGCTGCTTAATTCTAAGCAGAGAGCACAAGAAAATAACCTTTCTGAAGTTCACTATAATTTTTCGCAACAGTGCCC	NA	NA	NA	NA
WP_036771347.1|368631_369609_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047285.1|369627_369885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774631.1|371018_371483_+	hypothetical protein	NA	A0A067XRB3	Caulobacter_phage	38.2	1.4e-26
WP_080963647.1|371821_371992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|373662_374391_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047299.1|374574_375933_-	DEAD/DEAH box helicase	NA	D2J050	Enterococcus_phage	50.5	2.6e-126
WP_155047286.1|376022_376589_-	helix-turn-helix domain-containing protein	NA	A0A1B0VBM1	Salmonella_phage	32.8	2.0e-19
WP_017377658.1|376592_377279_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|377526_378255_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155049831.1|378284_378824_-	helix-turn-helix domain-containing protein	NA	W5R8L2	Staphylococcus_phage	34.9	1.0e-04
WP_032126239.1|379405_379678_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049830.1|379752_380334_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.6	4.2e-33
WP_155049829.1|380389_381124_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155049828.1|381447_382521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066232.1|382517_383387_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075275153.1|383496_384294_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300202.1|384538_385267_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_155047021.1|385290_385446_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	394072	551745	3337236	integrase,transposase,head,protease,tail,capsid	Escherichia_phage(24.32%)	166	409323:409382	481493:482668
WP_075275154.1|394072_394729_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.7	7.6e-31
WP_036771347.1|395091_396069_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_027242575.1|396698_397184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242576.1|397217_399080_-	AAA family ATPase	NA	A0A2I7R5Z1	Vibrio_phage	30.5	1.3e-56
WP_036771347.1|399272_400250_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047288.1|400264_400390_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047289.1|400322_400499_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275025.1|400748_402764_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155047291.1|404425_406456_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|406590_407568_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047292.1|407645_408563_-	hypothetical protein	NA	NA	NA	NA	NA
409323:409382	attL	TGATCTGGCAACCTTTTTCTAGACAAATTTTTAACTGATTTTTTGATTATGCTCGTATTC	NA	NA	NA	NA
WP_105962623.1|409352_410506_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
409323:409382	attL	TGATCTGGCAACCTTTTTCTAGACAAATTTTTAACTGATTTTTTGATTATGCTCGTATTC	NA	NA	NA	NA
WP_075273751.1|410855_412586_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155047019.1|412598_412751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047293.1|413240_413966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|414118_414847_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_032126843.1|415223_415403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126844.1|415621_415918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212118.1|416012_416474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780014.1|416827_418270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780017.1|418430_418805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047014.1|418875_419217_-	hypothetical protein	NA	A0A1B1IQX9	uncultured_Mediterranean_phage	60.3	1.7e-21
WP_054300202.1|419435_420164_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_155047294.1|420370_421033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047295.1|421278_422340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|422369_423452_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_155047300.1|423571_423844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047296.1|423952_424588_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.4	7.3e-39
WP_155046765.1|425474_425669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047015.1|426049_426373_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212122.1|427249_427951_+	ParA family protein	NA	A0A222YXS3	Escherichia_phage	34.3	1.0e-25
WP_016212121.1|427904_428828_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_105962625.1|429261_430147_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212151.1|430749_431712_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|431735_432050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|432113_433088_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_033923686.1|433212_434262_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|434370_435411_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|435424_436054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|436144_436444_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_081377909.1|436440_436905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104769.1|437866_438790_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	30.2	1.0e-28
WP_105962623.1|439934_441087_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274741.1|441156_441414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273822.1|441515_442016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|442460_443543_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212255.1|443729_443900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|443896_444100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|444436_444661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212260.1|444680_444953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|445110_446085_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556717.1|446739_447966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|448291_449128_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_016212398.1|449390_449852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047268.1|450018_450399_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|451487_451853_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|451798_452374_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962623.1|453357_454511_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273810.1|454531_455239_-	hypothetical protein	NA	A0A0N7AE80	Bacillus_phage	28.2	4.4e-08
453328:454571	attR	TGATCTGGCAACCTTTTTCTAGACAAATTTTTAACTGATTTTTTGATTATGCTCGTATTCCTCAGGTGATAAATAATCATTAGCTGAGTGAATGCGTTTTCTGTTATAAAAAACTTCGATATACTCAAAGATCGCTGATTTAGCCTCCTGTCGATTTTTAAAATTCATGTGATGAACTAACTCCGTTTTTAAGGTATGAAAGAAACTCTCTGAAACAGCGTTATCCCAGCAGTCTCCCTTACGACTCATACTTTGCTTAATTTGATGATCTTTAAGAATCTCACGATGACTTTCTGAAGCATATTGGCTTCCGCGATCTGAATGCCAAATTAACCCAGCTTTAGGCTTTCGTTTCCATAAGGCCATCAACAGAGCATCATTGACGAGTGATGCTTCCATATGATCCTCCATGGCCCAGCCAACAACTTTTCGTGAGAATAAGTCAATCACAACAGCCAAGTACAACCAGCCTTGTTGGGTCCGTATGTAGGTAATATCACCAACATATTTTTGGTTAGGGCCTGTTGCTGAAAAATTCCGGTCCAACACGTTTTTCGCAATTGGCAATCGATGTTTAGAATCCGTAGTTACTTTGAATTTACGCTTTATCTTGCAGCAAAGCTGGTTCTGCTTCATTAAACGGCCAACTCGCTTACGGCTTACAGAAATTTCCTGTGTTGCCAACTGTTTTCTAATTCTTCGAGTACCATAGGTTGCACGGCTTTCGATGAATATTTCCTTGATTCGCCTAGCTAATTTTTGGTTCTCTATCATTCGCTTGGAAGGCTGTACCTTTAACCAACTGTAATAACCTGATCGGCTAACACCTAAGATTGAGCACACCCTATCTACTGGAAAAACACATTTATTTTCTTTGATCCAGGCATACTTTACTGTGTTTCGCTTGCAAAGTACGCCGCCGCTTTTTTTAGTATTTCACGTTCCTGTGTCACTCTAGCCAACTCTTTTTTTAACTGTTTTATTTCAGCAGCCATATCACTAACTTCATCTTTAACAGTATTTGGACTGTTTGGATGATATTTATTGACCCAACCATGCAGTGTACTTGAGTGAATACCCAATTCCTGTGCTGTATGACTGATTGCTTGATTTGAATCGACTGCAAGCTTGGCAGATGATTTTTTAAATTCTTCGGTGTACTTGGTGACGTGACGCTTTCCCATTGTGATTCCTCCGGCTCGGATTATTGTAATTTATTTGTCCGGAATAGGGTAGCCTGATCA	NA	NA	NA	NA
WP_081007042.1|457398_458214_+	hypothetical protein	NA	NA	NA	NA	NA
453328:454571	attR	TGATCTGGCAACCTTTTTCTAGACAAATTTTTAACTGATTTTTTGATTATGCTCGTATTCCTCAGGTGATAAATAATCATTAGCTGAGTGAATGCGTTTTCTGTTATAAAAAACTTCGATATACTCAAAGATCGCTGATTTAGCCTCCTGTCGATTTTTAAAATTCATGTGATGAACTAACTCCGTTTTTAAGGTATGAAAGAAACTCTCTGAAACAGCGTTATCCCAGCAGTCTCCCTTACGACTCATACTTTGCTTAATTTGATGATCTTTAAGAATCTCACGATGACTTTCTGAAGCATATTGGCTTCCGCGATCTGAATGCCAAATTAACCCAGCTTTAGGCTTTCGTTTCCATAAGGCCATCAACAGAGCATCATTGACGAGTGATGCTTCCATATGATCCTCCATGGCCCAGCCAACAACTTTTCGTGAGAATAAGTCAATCACAACAGCCAAGTACAACCAGCCTTGTTGGGTCCGTATGTAGGTAATATCACCAACATATTTTTGGTTAGGGCCTGTTGCTGAAAAATTCCGGTCCAACACGTTTTTCGCAATTGGCAATCGATGTTTAGAATCCGTAGTTACTTTGAATTTACGCTTTATCTTGCAGCAAAGCTGGTTCTGCTTCATTAAACGGCCAACTCGCTTACGGCTTACAGAAATTTCCTGTGTTGCCAACTGTTTTCTAATTCTTCGAGTACCATAGGTTGCACGGCTTTCGATGAATATTTCCTTGATTCGCCTAGCTAATTTTTGGTTCTCTATCATTCGCTTGGAAGGCTGTACCTTTAACCAACTGTAATAACCTGATCGGCTAACACCTAAGATTGAGCACACCCTATCTACTGGAAAAACACATTTATTTTCTTTGATCCAGGCATACTTTACTGTGTTTCGCTTGCAAAGTACGCCGCCGCTTTTTTTAGTATTTCACGTTCCTGTGTCACTCTAGCCAACTCTTTTTTTAACTGTTTTATTTCAGCAGCCATATCACTAACTTCATCTTTAACAGTATTTGGACTGTTTGGATGATATTTATTGACCCAACCATGCAGTGTACTTGAGTGAATACCCAATTCCTGTGCTGTATGACTGATTGCTTGATTTGAATCGACTGCAAGCTTGGCAGATGATTTTTTAAATTCTTCGGTGTACTTGGTGACGTGACGCTTTCCCATTGTGATTCCTCCGGCTCGGATTATTGTAATTTATTTGTCCGGAATAGGGTAGCCTGATCA	NA	NA	NA	NA
WP_080728342.1|458528_459032_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_105962174.1|459175_459340_+	phosphatase	NA	NA	NA	NA	NA
WP_155047269.1|459488_459884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273806.1|460145_460709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|460814_461270_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273804.1|461229_461568_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|461652_462381_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_016212413.1|462714_463143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|463190_463931_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_075273798.1|464331_464556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|464664_465189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047270.1|465309_465456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047297.1|465600_465747_-	phosphatase	NA	NA	NA	NA	NA
WP_032126138.1|466955_467219_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211871.1|467784_468120_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_129556699.1|468113_468314_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300590.1|468621_468846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|469462_470488_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273790.1|471032_471335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|471324_471951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212412.1|472251_472416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|472408_472858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|473105_473279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212499.1|473483_473858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|474856_476009_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_075273786.1|476018_476417_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211913.1|476849_477971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|478296_478569_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|478572_478833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211912.1|479105_479696_+|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	4.0e-15
WP_129556698.1|479785_480487_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
WP_054300249.1|480600_480966_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|480980_481487_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047271.1|481490_482608_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	3.6e-57
WP_051307374.1|482722_483199_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_016212298.1|483439_483766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|484432_485458_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047272.1|485667_486396_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_054300594.1|486758_487784_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047273.1|487914_488052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046942.1|488190_489077_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047274.1|489161_489368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|489707_490523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211897.1|490916_491321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|491321_492068_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211895.1|492576_493635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126360.1|493757_494492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211773.1|495078_495753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|495854_496223_-	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	54.2	1.2e-22
WP_016211776.1|496390_497728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556697.1|498210_498603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|498987_499893_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016210664.1|500190_500613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210651.1|500612_500963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210658.1|500959_501355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210667.1|501347_501671_-|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	40.4	1.3e-12
WP_016210663.1|501667_501979_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	35.4	1.0e-06
WP_016210655.1|502297_502894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556716.1|502907_503198_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_052047108.1|503331_503730_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047275.1|503785_504283_-	DNA polymerase	NA	NA	NA	NA	NA
WP_155047276.1|504279_505059_-	hypothetical protein	NA	A0A0N7AE80	Bacillus_phage	26.4	7.9e-11
WP_129556718.1|505087_506273_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_129556441.1|509701_510928_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126490.1|511276_512242_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_016210868.1|512238_512538_+	pilZ domain protein	NA	NA	NA	NA	NA
WP_036778898.1|512569_513349_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_016210861.1|513374_513605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|513756_514002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210870.1|514153_514945_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016212128.1|515858_516605_+	solute symporter family protein	NA	NA	NA	NA	NA
WP_032126495.1|516695_517580_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_054300397.1|517985_518231_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046705.1|518471_518639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|518584_519160_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047050.1|519212_519950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777815.1|519953_520238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|520331_520595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|520961_521780_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|521852_524225_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_036777812.1|524937_526365_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|526399_527422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|527438_527816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|528778_529144_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|529089_529665_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210122.1|529904_530597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|531223_532198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|532187_533960_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|533960_534308_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036777821.1|534557_535784_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|535873_537172_-	MFS transporter	NA	NA	NA	NA	NA
WP_081007061.1|537205_537955_-	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	30.4	3.9e-15
WP_016210137.1|537935_538487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007060.1|538713_540012_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|540128_540419_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_155047051.1|540730_541600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047052.1|541744_542473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777801.1|543335_543554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212044.1|544327_544582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|545304_546291_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|546428_546623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007059.1|547305_548367_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_016211797.1|548528_549932_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|549982_550558_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|550503_550818_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047053.1|550858_551745_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	635977	736449	3337236	integrase,transposase,tRNA	Escherichia_phage(43.75%)	108	702764:702823	716975:717148
WP_054300513.1|635977_636841_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|637057_638617_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|638638_639673_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|639721_640291_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|640426_641398_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|641409_642987_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|643052_644039_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054300512.1|644370_645480_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|645585_646770_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|646847_648836_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|649044_649200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047055.1|649470_649758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|649795_650161_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|650106_650682_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047056.1|650671_651034_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|651950_653357_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|653374_654361_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|654363_655518_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|655514_656210_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|656344_657835_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_036777447.1|657855_658905_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|658971_660366_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_036777444.1|661244_663176_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	1.0e-120
WP_075273353.1|663180_663711_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|663745_663940_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|663982_664342_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|664761_665757_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_036777440.1|665769_668151_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|668156_668444_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|668715_669192_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|669336_669534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|669658_670633_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|671533_671632_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780545.1|672116_672827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047057.1|672990_673407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|673643_674336_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|674377_675151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|675152_676094_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|676226_677804_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|678013_679771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|680319_681078_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|681285_681858_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|681961_682510_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|682811_683057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779353.1|683649_684561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300506.1|685051_685459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|685530_686259_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126799.1|686339_687152_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_155047058.1|688213_688576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|688578_690318_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046941.1|690719_690983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300500.1|691654_692383_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_016212070.1|692792_693392_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_016212069.1|693366_693534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212066.1|693745_694522_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_054300501.1|694882_695611_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|695622_696015_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|696011_696257_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|696417_697146_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211714.1|697220_700565_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|701813_702389_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|702334_702700_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
702764:702823	attL	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCT	NA	NA	NA	NA
WP_155047059.1|702978_703893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212159.1|704160_704358_+	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_054300201.1|704717_705446_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_155047060.1|705475_706150_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	45.9	5.2e-27
WP_016212024.1|706294_706543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|706539_707139_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|707138_707357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|708131_709124_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|709120_709855_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_155047061.1|710115_710382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047062.1|710526_710685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047063.1|710707_710959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300477.1|711408_712137_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_051307368.1|712843_714124_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|714123_715092_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211646.1|715463_715703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|715695_716049_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|716351_717080_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047064.1|717549_717858_-	hypothetical protein	NA	NA	NA	NA	NA
716975:717148	attR	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTTTTACCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCC	NA	NA	NA	NA
WP_155047065.1|718019_718697_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.1	7.0e-40
WP_155047066.1|719190_719919_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.5e-43
WP_016212269.1|720087_720771_+	Fic family protein	NA	NA	NA	NA	NA
WP_016212268.1|720774_721359_+	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_017375910.1|721515_722244_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047064.1|722712_723021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|723271_723874_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300203.1|723878_724337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781052.1|725713_726316_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126808.1|726478_726688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211639.1|726695_726998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211644.1|727112_727379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104773.1|727486_727930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|727991_728877_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047067.1|728977_729871_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047259.1|730015_730231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104771.1|730680_731019_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	54.9	5.4e-25
WP_075274739.1|731011_731359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274717.1|731355_731586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274718.1|731589_732060_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	64.3	1.3e-32
WP_075274740.1|732204_732570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780395.1|732714_732969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377363.1|732952_733309_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_075274719.1|733614_734481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047068.1|734966_735167_+	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	64.3	3.5e-16
WP_155047069.1|735254_735608_+	hypothetical protein	NA	Q6DMU4	Streptococcus_phage	34.8	8.2e-08
WP_054300202.1|735720_736449_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 8
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	744148	792101	3337236	transposase,tRNA	Synechococcus_phage(33.33%)	51	NA	NA
WP_054300202.1|744148_744877_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|744970_745636_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|745700_746657_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|746915_747614_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|747656_748769_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|749373_749949_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|749894_750260_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|750347_750698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|751433_752495_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210908.1|753706_754522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|754612_755596_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|755766_756288_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_036779246.1|756321_756576_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.4e-20
WP_016210909.1|756578_757856_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|758548_759076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|759195_761508_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|761636_762452_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|762649_763114_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|763243_764305_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|764565_764862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|765144_766608_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|766610_767663_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_036779281.1|767652_768108_+	arginine repressor	NA	NA	NA	NA	NA
WP_155047071.1|768132_768456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|768803_769115_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_054300208.1|769244_770036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779278.1|771193_772147_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|772260_772458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|772703_772904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142396463.1|773014_773131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212074.1|773217_773439_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|773465_773831_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|773887_774052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047072.1|774041_774356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046713.1|774493_774658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|774952_776389_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|776430_777882_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|777993_778281_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|778470_779514_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210536.1|779529_780429_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210528.1|780425_780944_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210527.1|781013_781631_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_036776217.1|781640_783128_+	ribonuclease G	NA	NA	NA	NA	NA
WP_016210534.1|783137_786818_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_036776215.1|786891_787704_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210530.1|787700_788381_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_155047260.1|789221_789380_-	phosphatase	NA	NA	NA	NA	NA
WP_155047073.1|789572_790130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|790179_790470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300215.1|791273_791768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|791762_792101_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	813571	916167	3337236	transposase,plate,protease,tRNA	Prochlorococcus_phage(17.65%)	108	NA	NA
WP_016209523.1|813571_814921_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|814971_815409_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|815670_817182_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_036778935.1|817187_818414_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|818407_819436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|819413_820106_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_155049805.1|820107_821580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778941.1|821572_822061_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|822066_823539_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|823538_823937_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|823933_825622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|825603_826560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|826602_827118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|827222_828155_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|828374_828761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|828777_829422_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|829602_830442_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|830517_831120_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|831120_831975_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|832331_832643_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|832667_834059_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|834214_834946_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_129556465.1|834942_835515_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|835501_836059_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|836064_837045_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|837184_837985_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_036780687.1|837988_838756_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|838752_839217_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|839239_839893_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|839896_840244_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|840277_840529_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|840605_841874_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|841876_842635_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|842696_843587_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|843637_844321_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|844406_844664_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155047218.1|844936_847105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|847096_847969_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|848136_849966_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|850128_850770_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|851011_851542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|851559_851733_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|851791_852841_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|852847_853798_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|853851_854796_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|854823_855561_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|855649_855892_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|855966_857190_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|857221_858070_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|858066_859119_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|859239_859860_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_036780649.1|859875_860862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|860972_861428_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|861387_861726_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|862490_863396_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155047217.1|863470_864532_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|864581_864791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|866025_866472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|866475_867051_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|866996_867362_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|867482_867668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|867771_868806_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|868802_869513_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|869987_870506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|870623_870956_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_036777003.1|870985_873940_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_054300221.1|873985_874483_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|874542_874959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|875050_875911_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|875993_876560_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|876592_877447_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_155047216.1|877488_880395_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|880455_880653_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|880659_881670_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|881666_882725_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|882718_883519_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|883521_884340_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|884351_885299_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|885306_886608_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|886786_887890_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|887886_888279_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|888290_889667_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|889660_891130_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_032126362.1|891587_891953_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|891898_892474_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300223.1|892568_893540_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_129556478.1|893776_894663_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|894962_895208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|896170_896590_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046954.1|896696_896870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|897096_897831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|897955_899017_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|899339_900044_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|900137_900851_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|900933_902025_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|902096_902678_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|902683_903310_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|903406_904342_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|904701_905373_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_036778813.1|905514_906174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|906342_907602_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|907598_908684_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|908676_909558_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|909546_910797_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_054300237.1|912082_913144_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047215.1|913121_914375_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_032126362.1|915280_915646_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|915591_916167_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	951584	999509	3337236	transposase,tRNA	Staphylococcus_phage(42.86%)	37	NA	NA
WP_016209374.1|951584_953036_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|953071_954601_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_155047212.1|955176_956820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047211.1|957361_958303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|958653_959469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|959760_962451_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_081007011.1|962699_963920_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|964087_965794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|966392_967619_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|968171_969146_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273456.1|969268_969568_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047210.1|969527_969890_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|969951_970837_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047266.1|971945_972377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|973092_973458_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|973403_973979_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|974005_975067_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556478.1|975181_976068_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047209.1|976417_976972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211819.1|977190_977421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|977717_978218_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|978420_979677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777316.1|980033_980447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|980756_981641_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300240.1|981897_982101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|982400_983375_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047208.1|983677_985150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|985169_986144_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|986294_986570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|986735_987356_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_054300241.1|987674_989651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|989806_991264_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|991332_992913_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_054300242.1|992953_993490_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|993535_997432_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|997438_997762_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300237.1|998447_999509_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	1016190	1129604	3337236	integrase,transposase,protease	Staphylococcus_phage(30.3%)	107	1078655:1078714	1099849:1100951
WP_033923708.1|1016190_1017066_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|1017321_1017966_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|1017996_1019802_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|1019825_1020401_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_155047207.1|1020945_1022019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1022128_1023103_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046989.1|1023335_1024400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1024492_1025467_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046989.1|1025699_1026764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1027254_1027620_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047206.1|1027634_1028144_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1028179_1029154_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300250.1|1029236_1029896_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_016209640.1|1030314_1031334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|1031792_1032758_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|1032802_1033378_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|1033408_1034683_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|1035328_1036042_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|1036121_1036859_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|1036979_1038335_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|1038511_1039183_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|1039298_1040174_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|1040777_1042082_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|1042194_1042800_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|1042881_1044183_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|1044250_1046683_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|1046786_1047059_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075273480.1|1047141_1049040_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209643.1|1049071_1049956_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|1049964_1050360_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|1050787_1052935_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|1052906_1054256_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|1054252_1056373_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|1056369_1058073_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209654.1|1058191_1059334_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|1059398_1060427_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_036776625.1|1060553_1062068_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|1062157_1062643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275067.1|1062975_1064043_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1065105_1066011_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_051307360.1|1066127_1067057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780074.1|1068148_1068955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|1069297_1071190_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|1071476_1071881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923634.1|1072085_1072634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|1072623_1073510_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|1073848_1074259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047205.1|1074433_1074655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1075142_1075508_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1075453_1076029_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664862.1|1077202_1077901_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_016211528.1|1077881_1078187_+	hypothetical protein	NA	NA	NA	NA	NA
1078655:1078714	attL	CGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACT	NA	NA	NA	NA
WP_054300271.1|1078746_1079721_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300253.1|1079939_1080890_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	34.7	6.9e-09
WP_016211534.1|1080876_1081386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211530.1|1081391_1082288_-	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211531.1|1082641_1083322_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155047204.1|1083385_1083943_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0V4T7	Roseobacter_phage	33.3	8.4e-15
WP_054300271.1|1083966_1084941_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212424.1|1085284_1085563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|1085555_1085828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1085945_1087028_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036780532.1|1087105_1088146_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_081007067.1|1088657_1094132_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_016212302.1|1094352_1094652_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_155047203.1|1094952_1096014_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036781361.1|1096033_1096423_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_155047202.1|1096705_1097770_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.2	4.7e-139
WP_016211579.1|1098274_1098760_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|1098827_1099736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1099940_1100915_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300257.1|1101119_1101929_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.6	1.8e-29
1099849:1100951	attR	CGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_075273486.1|1101905_1102880_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.2e-29
WP_016211585.1|1103114_1103672_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_155047201.1|1103733_1104495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1104570_1105545_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211584.1|1105717_1106071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|1106137_1106332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|1106347_1106692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1106761_1107337_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1107282_1107648_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155049808.1|1107732_1108341_+	DNA polymerase	NA	NA	NA	NA	NA
WP_052047108.1|1108425_1108824_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046984.1|1109635_1110754_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046716.1|1111175_1111322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|1112019_1112574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|1113010_1113193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|1113257_1113485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|1113715_1114462_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|1114688_1114982_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|1115053_1115659_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|1115807_1116785_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_155047199.1|1116881_1118324_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|1118350_1119004_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_036779374.1|1119128_1119695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|1120049_1121828_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_052104721.1|1121899_1123606_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_054300262.1|1123597_1123888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1124350_1124716_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1124661_1125237_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|1125240_1125615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|1125990_1126965_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_054300263.1|1127036_1127477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047198.1|1127464_1127632_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|1127776_1128037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1127996_1128335_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1128718_1129604_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	1150146	1195269	3337236	transposase,tRNA	Escherichia_phage(16.67%)	44	NA	NA
WP_054300173.1|1150146_1151208_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211781.1|1151424_1152672_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036779112.1|1152894_1154331_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_129556486.1|1154416_1154764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273492.1|1154854_1154974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|1155082_1156144_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|1156138_1156309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|1156298_1156463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|1156519_1156885_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|1156906_1157275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047196.1|1157419_1158001_-	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_017375910.1|1158071_1158800_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016210898.1|1159056_1159407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|1159495_1159786_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|1160260_1160563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300270.1|1160903_1161881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|1161959_1163297_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|1163415_1163787_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|1164008_1164659_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|1164701_1165784_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|1165837_1167721_+	APC family permease	NA	NA	NA	NA	NA
WP_033923708.1|1168330_1169206_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155047195.1|1169218_1170121_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211091.1|1170195_1172676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273494.1|1173740_1174301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1174891_1175953_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275207.1|1176000_1176450_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211036.1|1176797_1178669_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_036779409.1|1178760_1180506_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211043.1|1180585_1181035_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211035.1|1181087_1181303_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211042.1|1181549_1182566_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211037.1|1182614_1183244_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211040.1|1183594_1184806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126170.1|1185033_1185306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047067.1|1185469_1186363_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556557.1|1186507_1186819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104774.1|1186866_1187499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047009.1|1187643_1187817_-	phosphatase	NA	NA	NA	NA	NA
WP_016211450.1|1188592_1189615_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211448.1|1189713_1190922_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211446.1|1190911_1192639_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036776407.1|1192822_1193959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|1194207_1195269_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	1207777	1245219	3337236	transposase,protease,tRNA	Orpheovirus(20.0%)	40	NA	NA
WP_129556478.1|1207777_1208664_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211932.1|1209074_1210364_-	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_036777061.1|1210559_1211747_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211476.1|1212064_1212274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211473.1|1212257_1212857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211474.1|1212931_1214281_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_032126518.1|1214363_1216565_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211478.1|1216581_1217397_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126519.1|1217376_1218096_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_075273327.1|1218263_1218839_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1218784_1219150_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211265.1|1219324_1219987_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1220017_1220386_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_032126514.1|1220396_1221713_-	MFS transporter	NA	NA	NA	NA	NA
WP_051307354.1|1221995_1222571_+	DedA family protein	NA	NA	NA	NA	NA
WP_032126515.1|1222646_1222826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|1222998_1223292_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_075273504.1|1223481_1223835_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211262.1|1223889_1226163_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_016211259.1|1226222_1226468_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_054300275.1|1226592_1227468_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211550.1|1227545_1228307_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_016211548.1|1228290_1229247_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211549.1|1229509_1232014_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211553.1|1232017_1232758_+	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_054300209.1|1233097_1233463_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1233519_1233684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1233673_1233973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049809.1|1233976_1235272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1235446_1236421_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209411.1|1236626_1237421_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_016209421.1|1237583_1238372_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_036776605.1|1238368_1239580_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_032126508.1|1239569_1239929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209444.1|1240023_1240452_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_129556555.1|1240582_1241713_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209436.1|1241709_1242438_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_016209412.1|1242495_1243383_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209433.1|1243467_1243842_+	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209424.1|1243941_1245219_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
>prophage 14
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	1277705	1406921	3337236	transposase,protease,tRNA	Staphylococcus_phage(21.43%)	104	NA	NA
WP_016209432.1|1277705_1279415_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209448.1|1279672_1281004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209449.1|1281445_1282918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1283633_1283999_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273508.1|1284239_1285106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|1285618_1285963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776562.1|1286115_1286307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1286550_1287126_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1287071_1287437_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300283.1|1287677_1288319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1288786_1289761_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047193.1|1290974_1292363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780476.1|1292598_1294536_-	histidine kinase	NA	NA	NA	NA	NA
WP_016210517.1|1295549_1296269_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|1296382_1299922_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|1299988_1300807_+	ZipA protein	NA	NA	NA	NA	NA
WP_016210518.1|1300793_1302833_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210522.1|1302848_1303901_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210524.1|1303911_1304442_+	exsB family protein	NA	NA	NA	NA	NA
WP_016210010.1|1306079_1306256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780418.1|1306431_1306815_+	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_075273518.1|1306890_1307184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210016.1|1307350_1308310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|1309040_1309196_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|1309460_1310831_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_052104723.1|1310823_1311777_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036779556.1|1311757_1314562_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.0	3.1e-57
WP_016210027.1|1314641_1315238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1315627_1316383_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155047191.1|1316780_1317512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|1317772_1319098_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210023.1|1319094_1321152_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210007.1|1321129_1321702_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|1321757_1322117_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|1322181_1323216_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|1323473_1324325_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|1324419_1325403_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|1325559_1327227_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_155047190.1|1328165_1328483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556556.1|1328501_1329077_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1329022_1329388_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|1329409_1329739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047175.1|1330147_1331470_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_032126362.1|1332000_1332366_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1332311_1332887_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047189.1|1332946_1333120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047265.1|1333409_1334003_+	reverse transcriptase	NA	A0A0N7AE80	Bacillus_phage	28.9	4.0e-07
WP_105962623.1|1334011_1335165_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300290.1|1335298_1335556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007015.1|1335657_1336083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1336294_1336552_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1336551_1337559_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300292.1|1337813_1338815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|1339270_1339423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|1339395_1339569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047188.1|1339558_1339723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300293.1|1339779_1340145_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300294.1|1340416_1341478_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211279.1|1342221_1344690_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_016211277.1|1344703_1345672_+	homoserine kinase	NA	NA	NA	NA	NA
WP_016211278.1|1345658_1346918_+	threonine synthase	NA	NA	NA	NA	NA
WP_129556646.1|1346969_1348355_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_036781047.1|1349672_1350530_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_036778145.1|1351142_1352264_+	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	8.7e-11
WP_016211172.1|1352313_1353510_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_080664856.1|1353698_1354763_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_051307350.1|1354746_1355493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778066.1|1355482_1356211_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211168.1|1356207_1356867_+	wbqC-like family protein	NA	NA	NA	NA	NA
WP_155046736.1|1356844_1357798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1357797_1358313_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778065.1|1358355_1359789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210393.1|1359882_1362084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210398.1|1362572_1364165_+	B-type flagellin	NA	NA	NA	NA	NA
WP_032126669.1|1364389_1365967_+	B-type flagellin	NA	NA	NA	NA	NA
WP_122940572.1|1366078_1366504_+	flaG family protein	NA	NA	NA	NA	NA
WP_016210394.1|1366614_1368000_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032126670.1|1368025_1368463_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210390.1|1368467_1368809_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_016210399.1|1368823_1370815_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210388.1|1370840_1371515_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210397.1|1371511_1373686_-	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210772.1|1374894_1376448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1376531_1377341_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_033923762.1|1377468_1377702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210769.1|1378002_1379505_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_016210773.1|1379808_1382502_+	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210771.1|1382498_1385900_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_054300162.1|1385991_1387074_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300297.1|1387136_1388204_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212246.1|1389139_1389796_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|1389899_1390982_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300271.1|1391321_1392296_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212247.1|1392923_1393679_-	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_036779544.1|1394045_1395053_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1395052_1395310_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047187.1|1395673_1396648_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_075273524.1|1396688_1397654_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|1397809_1399360_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_054300299.1|1401561_1402644_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049810.1|1402730_1402910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1403908_1404772_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155047186.1|1404801_1406031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047185.1|1406034_1406921_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	1447593	1623482	3337236	integrase,transposase,tRNA	Staphylococcus_phage(17.65%)	153	1480354:1480413	1553248:1553537
WP_054300304.1|1447593_1447872_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047180.1|1447924_1448128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776195.1|1448770_1450018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923708.1|1450429_1451305_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211947.1|1451419_1452565_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_129556540.1|1452557_1452953_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211946.1|1453171_1453927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212551.1|1455282_1455777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556643.1|1456234_1457599_-	histidine kinase	NA	NA	NA	NA	NA
WP_016211983.1|1457694_1458354_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_155047179.1|1458601_1458946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047178.1|1459014_1459743_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.5e-43
WP_155047177.1|1459789_1459936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300189.1|1459992_1460358_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036779232.1|1460652_1462212_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|1462572_1464543_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|1464734_1465814_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_052104715.1|1465862_1466069_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211210.1|1466075_1467557_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211214.1|1467659_1468223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1469984_1471244_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211940.1|1471364_1471697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1471810_1472785_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_155047176.1|1472929_1473082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300312.1|1473299_1474322_+	YHYH protein	NA	NA	NA	NA	NA
WP_036778055.1|1474329_1476012_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.7e-32
WP_016211344.1|1476172_1476991_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|1477204_1478188_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|1478180_1478402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|1478429_1479071_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_032126804.1|1479314_1480190_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1480354:1480413	attL	TCGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTT	NA	NA	NA	NA
WP_129556490.1|1482652_1483538_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1483542_1483830_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|1483882_1484161_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|1484259_1484607_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|1484928_1485168_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|1485385_1485973_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|1485933_1486269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|1486456_1487101_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|1487435_1488086_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|1488618_1489671_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032126786.1|1489688_1492769_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_054300384.1|1493067_1493883_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047175.1|1494291_1495614_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_155047174.1|1496522_1497167_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.4	1.1e-39
WP_155047173.1|1497222_1497432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209615.1|1498784_1499291_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016209623.1|1499307_1500807_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209624.1|1500828_1501440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274867.1|1501436_1502609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777073.1|1502640_1505178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|1505209_1507102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273639.1|1507469_1508186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777070.1|1508188_1511062_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_016209636.1|1511062_1511467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|1511481_1513203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|1513202_1516151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|1516153_1517551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209630.1|1517564_1518305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|1518285_1518720_+	lipoprotein	NA	NA	NA	NA	NA
WP_016209618.1|1518764_1519394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209616.1|1519464_1520379_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_033923701.1|1520409_1523712_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209627.1|1523708_1525532_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_016209617.1|1525571_1525970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209621.1|1526090_1527095_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|1527527_1528976_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_036777066.1|1529062_1532119_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081007073.1|1532101_1532272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046976.1|1532337_1532475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212485.1|1532771_1533305_-	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_032126753.1|1534109_1534574_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|1534643_1536164_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126752.1|1536251_1536854_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|1536850_1537198_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|1537348_1538332_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_122942160.1|1538959_1539940_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052047087.1|1540100_1540319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047172.1|1540490_1541516_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300320.1|1542661_1543261_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300321.1|1543478_1543850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212346.1|1544644_1544791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1545024_1545888_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211748.1|1547369_1548974_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211752.1|1548989_1550135_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_075273313.1|1550211_1550550_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1550509_1550965_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212445.1|1551210_1551477_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047171.1|1551551_1552115_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	39.9	3.2e-30
WP_155047170.1|1552319_1552601_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047169.1|1552635_1553244_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212534.1|1553656_1553923_-	hypothetical protein	NA	NA	NA	NA	NA
1553248:1553537	attR	TCGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGT	NA	NA	NA	NA
WP_032126362.1|1555050_1555416_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1555361_1555937_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211725.1|1556452_1557367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300322.1|1557405_1559340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1559727_1560321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273534.1|1561952_1562834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1563027_1563300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300326.1|1563401_1563866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046975.1|1564279_1564729_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_016212459.1|1564848_1565229_+	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_054300328.1|1565366_1566143_-	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_155047167.1|1566253_1567771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047166.1|1567820_1568882_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211456.1|1569503_1570082_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_122942091.1|1570109_1570505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211455.1|1570610_1572068_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_016211452.1|1572129_1573617_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211454.1|1574367_1574838_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|1576712_1576985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1577137_1577503_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1577448_1578024_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556641.1|1580106_1581369_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016210751.1|1581456_1583262_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_016210752.1|1583745_1584543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210749.1|1584712_1585174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1585472_1587428_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1588109_1588295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|1588628_1589618_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016211834.1|1592991_1593306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307365.1|1593563_1593824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1593843_1594332_+	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_155046972.1|1595855_1596446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047040.1|1597034_1597973_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047165.1|1597998_1599564_-	amino acid permease	NA	NA	NA	NA	NA
WP_036778182.1|1599770_1600598_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_075273540.1|1600964_1601576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556527.1|1601760_1602021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047164.1|1603013_1603436_+	response regulator	NA	NA	NA	NA	NA
WP_036777256.1|1603858_1604059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104738.1|1604433_1605240_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210795.1|1605345_1606317_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210801.1|1606298_1607270_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155047264.1|1607592_1607952_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_054300271.1|1607991_1608966_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007028.1|1609381_1609837_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1609796_1610135_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|1610308_1610749_-	universal stress protein	NA	NA	NA	NA	NA
WP_032126362.1|1611215_1611581_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1611526_1612102_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211350.1|1612386_1613325_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211349.1|1613388_1615383_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|1615379_1615982_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_036779888.1|1615978_1616317_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|1616392_1617619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300339.1|1618176_1619148_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.2e-25
WP_016211856.1|1619363_1619549_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|1619675_1620143_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|1620139_1621018_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|1621268_1622576_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007028.1|1622728_1623184_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1623143_1623482_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	1639097	1745364	3337236	transposase,tRNA	Staphylococcus_phage(14.81%)	102	NA	NA
WP_054300271.1|1639097_1640072_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047162.1|1640091_1640529_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|1640543_1640909_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210855.1|1641062_1642040_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210849.1|1642157_1643606_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210847.1|1643634_1644639_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210851.1|1644661_1645333_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210850.1|1645317_1646571_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1646819_1647374_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210848.1|1647957_1649142_+	MFS transporter	NA	NA	NA	NA	NA
WP_051307341.1|1649308_1650907_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_155047161.1|1651600_1652572_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300343.1|1652607_1652835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1652838_1653725_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007031.1|1653812_1654085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209794.1|1654819_1655443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776664.1|1655488_1657432_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	23.9	1.1e-05
WP_016209788.1|1657553_1658306_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016209790.1|1658357_1658816_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_129556639.1|1659111_1659522_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209775.1|1659538_1659994_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_016209797.1|1659990_1660482_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_080664822.1|1660478_1661228_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_016209776.1|1661257_1661527_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_036776670.1|1661542_1662328_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_016209786.1|1662341_1663475_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_016209770.1|1663509_1665603_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_016209767.1|1665633_1667094_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_129556524.1|1667074_1667962_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_016209784.1|1667958_1668681_+	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_017377132.1|1668767_1669151_+	response regulator	NA	NA	NA	NA	NA
WP_036776675.1|1669192_1669936_+	chemotaxis protein CheZ	NA	NA	NA	NA	NA
WP_036776682.1|1669948_1671973_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_051307317.1|1672034_1672328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209791.1|1672464_1673187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209771.1|1673351_1674074_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126436.1|1674780_1675236_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209793.1|1675251_1676700_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_016209795.1|1676740_1677496_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_080664823.1|1677476_1678877_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209796.1|1678900_1680118_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_016209778.1|1680148_1680523_+	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209772.1|1680541_1681093_+	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_054300271.1|1682374_1683349_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1683446_1684508_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1685062_1686037_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212424.1|1686380_1686659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|1686651_1686924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1687041_1688124_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300346.1|1688270_1689146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126678.1|1689156_1690167_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_016211554.1|1690493_1691120_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_016211557.1|1691165_1692395_+	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_032126677.1|1692589_1693153_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211555.1|1693227_1694586_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_016211664.1|1695122_1695851_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211666.1|1696223_1699043_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211669.1|1699197_1699548_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1700372_1701347_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556522.1|1702657_1703890_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211405.1|1704096_1705869_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_016211403.1|1706004_1707048_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_036777261.1|1707061_1707805_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211398.1|1707951_1708239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1708843_1709542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047159.1|1709963_1711355_+	protein kinase	NA	NA	NA	NA	NA
WP_016211733.1|1711410_1712235_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_054300173.1|1712849_1713911_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046730.1|1714129_1714270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1714537_1715185_-	LysE family translocator	NA	NA	NA	NA	NA
WP_016212267.1|1715465_1715825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|1715991_1716447_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1716406_1716745_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047158.1|1716880_1719154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126823.1|1719142_1719865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104609.1|1719975_1720608_+	MarC family protein	NA	NA	NA	NA	NA
WP_098082850.1|1720643_1720820_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_016211481.1|1720894_1722037_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_155049129.1|1722115_1722253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126825.1|1722269_1723583_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_054300349.1|1724134_1725859_+	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_155046942.1|1726919_1727805_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046942.1|1727969_1728855_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556521.1|1729389_1729578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1729528_1730682_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047157.1|1730746_1731151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047156.1|1731322_1731946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211631.1|1732204_1733011_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_054300351.1|1733266_1734088_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211632.1|1734123_1734978_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211627.1|1735203_1735368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1735673_1736330_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1736413_1736779_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300181.1|1736835_1737117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|1737120_1737300_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016210103.1|1737652_1739011_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_016210117.1|1739292_1739652_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210111.1|1740072_1741707_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_017377579.1|1741713_1742550_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210099.1|1742571_1743849_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_016210105.1|1743932_1744253_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210106.1|1744272_1745364_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 17
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	1763762	1807716	3337236	integrase,transposase,protease	Staphylococcus_phage(45.45%)	48	1763667:1763726	1790479:1790567
1763667:1763726	attL	GGTAACCCTCCCTTAAAATAGTACAAGTGATAAGTGGAATCTTCTGTTAAATTAACTTAG	NA	NA	NA	NA
WP_054300353.1|1763762_1763990_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300354.1|1764136_1764655_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	42.9	1.3e-30
WP_155047155.1|1764600_1764750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1764793_1765768_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047154.1|1765840_1766221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1766181_1766547_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1766492_1767068_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300355.1|1767057_1767243_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211563.1|1767453_1767615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211564.1|1767647_1768523_-	ParA family protein	NA	NA	NA	NA	NA
WP_052104693.1|1768688_1772555_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_080728343.1|1772636_1772777_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_081007034.1|1772758_1773043_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_155047153.1|1773307_1774726_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_016211991.1|1775634_1776540_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126537.1|1776780_1776966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211994.1|1777002_1777539_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_155047152.1|1777741_1778464_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1778503_1779478_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047151.1|1779474_1780014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047150.1|1780063_1781290_+	DUF4131 domain-containing protein	NA	NA	NA	NA	NA
WP_155047149.1|1781284_1781500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|1781523_1782498_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016212012.1|1782541_1783219_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016212013.1|1783234_1783618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212011.1|1783839_1784961_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_054300357.1|1785194_1786070_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211974.1|1786352_1787474_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075273551.1|1787573_1787876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556638.1|1787875_1788556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377865.1|1789900_1790185_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664876.1|1790543_1792406_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
1790479:1790567	attR	CTAAGTTAATTTAACAGAAGATTCCACTTATCACTTGTACTATTTTAAGGGAGGGTTACCGATGGTTATTTCACTAGATGAATTTTATT	NA	NA	NA	NA
WP_054300359.1|1792630_1793203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047148.1|1793561_1794599_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047147.1|1795128_1796103_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_054300361.1|1796256_1796553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377353.1|1796530_1797196_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1797235_1798210_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211144.1|1798766_1799396_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_036779218.1|1799379_1799802_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|1799808_1801548_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|1801548_1802613_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1802616_1802970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1803082_1804039_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|1804048_1804360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1804375_1804945_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|1805208_1806537_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1806741_1807716_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 18
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	1816604	1864008	3337236	integrase,transposase,tRNA	Staphylococcus_phage(25.0%)	44	1806651:1806710	1849476:1850577
1806651:1806710	attL	GCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTC	NA	NA	NA	NA
WP_129556637.1|1816604_1817384_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|1817858_1818296_-	MFS transporter	NA	NA	NA	NA	NA
WP_155047262.1|1818684_1818801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047146.1|1818743_1818953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300363.1|1819192_1819540_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047145.1|1819485_1820061_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273553.1|1820050_1820977_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300364.1|1821150_1822029_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155064793.1|1822284_1822455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126267.1|1822448_1822691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211330.1|1823038_1824139_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_098082827.1|1824313_1825615_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_052104656.1|1825691_1826195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126265.1|1826518_1827436_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016211336.1|1827501_1828116_-	chorismate mutase	NA	NA	NA	NA	NA
WP_016211334.1|1828164_1828353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210322.1|1828970_1829867_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016210320.1|1830003_1831077_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_054300366.1|1831226_1831640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300568.1|1831660_1832371_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.3	4.1e-38
WP_129556511.1|1832553_1833990_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210321.1|1834186_1835155_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_016210325.1|1837825_1839202_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210326.1|1839355_1840654_-	ankyrin repeats family protein	NA	NA	NA	NA	NA
WP_036778577.1|1840993_1842277_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_016210333.1|1842350_1842980_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_016210330.1|1843183_1843567_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210332.1|1843664_1844408_+	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_075273555.1|1844538_1845072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1845349_1846033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|1846786_1847761_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_155047144.1|1847796_1849122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1849566_1850541_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211804.1|1850923_1852309_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
1849476:1850577	attR	GCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTCTCTAGTTCGCCTTTTGACTTAGAGGGTAGAGATGGTTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGTGCACAAGAAAAACGAGCTAACGCTAAGCAAGGTCAAGCTTTTCGACAAATTTCAGAGGAGGCAAAAATGTTGATCCATCAACGGTTAAGCACCCATACATCCCCCGATGTTATCAGTCAGGAACTTATACGAGAGCATGATATCCAGGTGAGTGAAAGCACGATTTACCGTTATATTTATGATGATAGAGAGCAGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCGGGAAAACCTTATAAGAAAAAGGTGAATCGTGGTGATCAAATAAAAATACCTAATCGCGTTGGTATTGAACACCGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGCGATCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACCTCTGACAATGGAACAGAGTTTGCGGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAGCACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACAGATTTTAATGAAATTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATTGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_081007037.1|1852315_1853854_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211806.1|1853896_1854622_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032126804.1|1854786_1855662_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1855821_1856727_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_032126803.1|1856960_1858193_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_016211764.1|1858393_1859215_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211767.1|1860053_1860863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211289.1|1862479_1862752_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211286.1|1862863_1863211_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_036777656.1|1863228_1864008_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 19
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	1890069	1934415	3337236	transposase,protease,tRNA	Staphylococcus_phage(22.22%)	39	NA	NA
WP_054300173.1|1890069_1891131_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046721.1|1891311_1891479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1891650_1892625_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300373.1|1892621_1893479_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209842.1|1894206_1894596_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209834.1|1894772_1895531_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209829.1|1895527_1897927_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209839.1|1899306_1900605_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209838.1|1900802_1901696_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|1901695_1902910_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|1902929_1904216_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|1904231_1904486_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_036777393.1|1904721_1906089_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|1906419_1907442_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_155064795.1|1908270_1909728_+	amino acid permease	NA	NA	NA	NA	NA
WP_054300271.1|1909967_1910942_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556633.1|1911050_1911947_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209827.1|1912265_1913825_+	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_016209841.1|1913900_1914095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209831.1|1914314_1915013_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|1915291_1915555_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_036777412.1|1915861_1918456_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209835.1|1918452_1918935_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209844.1|1918912_1919953_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209840.1|1920125_1920611_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_032126641.1|1920718_1923289_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_032126642.1|1923324_1923786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047141.1|1923855_1924062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|1925265_1925805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|1926752_1928237_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|1928361_1929897_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|1930130_1930496_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047140.1|1930441_1931026_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047139.1|1931049_1931454_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047138.1|1931429_1931912_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728346.1|1931929_1932262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046723.1|1933169_1933325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|1933483_1933789_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_075273327.1|1933839_1934415_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	1955835	2011361	3337236	transposase,tRNA	Staphylococcus_phage(15.38%)	55	NA	NA
WP_075273298.1|1955835_1956411_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066235.1|1956414_1956789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1957512_1958013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|1958428_1958782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211831.1|1959082_1960810_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_081007040.1|1960947_1961604_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210510.1|1961634_1962363_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_016210506.1|1962355_1963594_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210512.1|1963729_1964767_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210515.1|1964820_1965723_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210514.1|1965831_1967085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1967142_1970640_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075273576.1|1970699_1971428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778516.1|1971555_1972104_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016210508.1|1972424_1974122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1974130_1975284_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_036781272.1|1975879_1976098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047136.1|1976190_1976622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1976789_1977155_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047135.1|1977100_1977676_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211467.1|1977750_1978317_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_032126344.1|1978319_1979408_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032126343.1|1979528_1980341_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|1980471_1982457_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211470.1|1982516_1983170_-	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_155047134.1|1983936_1984959_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047133.1|1985230_1986205_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.6e-27
WP_016212421.1|1986955_1987138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|1987489_1987714_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155047132.1|1987858_1988521_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.6	5.3e-32
WP_032126637.1|1988637_1988931_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556508.1|1988992_1989436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047131.1|1989706_1990363_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047130.1|1990550_1991309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1991371_1992433_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211841.1|1993292_1993745_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211839.1|1993862_1995335_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|1995493_1995958_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|1996428_1996602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1997311_1997677_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1997622_1998198_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300250.1|1998187_1998847_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_032126143.1|1998946_2000218_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_016211422.1|2000306_2000777_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_051307357.1|2000799_2001393_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211417.1|2001529_2002579_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_016211415.1|2002602_2003526_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|2003542_2004004_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211414.1|2004111_2004930_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_129556449.1|2005145_2005652_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2005666_2006032_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047129.1|2006235_2006892_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300382.1|2007162_2007585_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300383.1|2007855_2010336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126139.1|2010431_2011361_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	2018126	2077043	3337236	transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(33.33%)	58	NA	NA
WP_054300162.1|2018126_2019209_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212040.1|2019414_2020764_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_016212039.1|2020940_2021498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133287.1|2021686_2022085_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047128.1|2022140_2023508_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.6e-12
WP_155047127.1|2023916_2024732_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212251.1|2024893_2025430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046960.1|2025591_2026245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047126.1|2026364_2026856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|2027127_2027310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|2027659_2028937_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_080664858.1|2028933_2029071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211223.1|2029582_2031184_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211221.1|2031200_2032343_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211218.1|2032595_2033333_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|2033357_2034629_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_032126790.1|2034857_2035763_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_054300387.1|2036021_2038421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300388.1|2038468_2040151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209976.1|2041020_2041254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007074.1|2041487_2042075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209969.1|2042041_2043007_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016209951.1|2042997_2043408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209957.1|2043414_2043750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556634.1|2043750_2044293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209950.1|2044597_2045389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209973.1|2045425_2048530_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_016209965.1|2048559_2049357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209956.1|2049361_2052352_-	ATPase AAA	NA	NA	NA	NA	NA
WP_036776383.1|2052357_2052789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209972.1|2052839_2053406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036776381.1|2053405_2054449_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_016209954.1|2054454_2054979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209953.1|2055000_2057307_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_016209962.1|2057353_2057593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209958.1|2057594_2058722_-	type II/IV secretion system family protein	NA	NA	NA	NA	NA
WP_016209964.1|2058721_2059474_-	dotC-like type IV secretion system protein	NA	NA	NA	NA	NA
WP_051307320.1|2059466_2059973_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_016209959.1|2059997_2060405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556635.1|2060432_2061440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209971.1|2061498_2062404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209955.1|2062410_2063604_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_155047125.1|2063600_2064527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209960.1|2065144_2065297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211310.1|2065501_2066215_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SEW9	Cyanophage	39.1	2.2e-39
WP_016211308.1|2066290_2066569_-	lipoprotein	NA	NA	NA	NA	NA
WP_032126213.1|2066613_2067504_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_016211307.1|2067588_2068062_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_016211313.1|2068197_2068719_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016211309.1|2068759_2069554_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016211305.1|2069556_2069838_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155047124.1|2069834_2070812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211312.1|2071517_2072264_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|2072385_2073447_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780082.1|2073990_2074896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|2075026_2075755_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|2075874_2076153_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_129556478.1|2076156_2077043_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	2087834	2143267	3337236	transposase,tRNA	uncultured_Mediterranean_phage(30.77%)	46	NA	NA
WP_081007041.1|2087834_2088362_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|2089027_2089222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|2089435_2089789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|2090120_2090741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211823.1|2090781_2090970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047122.1|2091004_2095096_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211770.1|2095295_2096429_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|2096442_2096631_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_054300276.1|2096923_2097898_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_075273594.1|2097937_2099308_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300404.1|2099380_2100274_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|2100382_2101300_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_036777569.1|2101351_2102107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|2102174_2103449_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_036777566.1|2103583_2104261_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209944.1|2104461_2105889_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|2105863_2106502_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|2106711_2106990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|2107223_2108168_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_036777561.1|2108189_2110058_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|2110078_2110432_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777579.1|2110470_2111586_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209932.1|2111768_2112809_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|2112811_2113846_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|2113842_2114904_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|2115015_2116488_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_052104625.1|2116640_2117084_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209940.1|2117159_2119931_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_036777555.1|2120087_2121317_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|2121343_2122006_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|2122527_2123028_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047121.1|2123129_2124233_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	9.5e-10
WP_075274669.1|2124437_2124740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300286.1|2125124_2125589_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962623.1|2125752_2126905_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047120.1|2126914_2127259_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047119.1|2127543_2128866_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_081007042.1|2129274_2130090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300406.1|2132643_2135379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2135679_2136741_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126856.1|2136801_2137143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|2137447_2138601_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_032126362.1|2139235_2139601_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2139546_2140122_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212005.1|2140460_2142221_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_016210592.1|2142610_2143267_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
>prophage 23
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	2147815	2261536	3337236	transposase,tRNA	Staphylococcus_phage(17.65%)	107	NA	NA
WP_032126176.1|2147815_2148598_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210588.1|2148688_2150014_-	fimV domain protein	NA	NA	NA	NA	NA
WP_016210595.1|2150381_2151560_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210594.1|2151736_2152390_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_036778626.1|2152525_2154466_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_129556498.1|2154462_2155071_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054300271.1|2155250_2156225_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080728317.1|2156415_2159781_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211391.1|2159847_2160423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779996.1|2160434_2161991_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_036779999.1|2162010_2162442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780001.1|2162428_2162692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|2163048_2163420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|2163624_2164350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212252.1|2164664_2164823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047118.1|2164860_2166303_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_075273327.1|2166292_2166868_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2166813_2167179_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274672.1|2167216_2167810_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211114.1|2168175_2171106_-	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_016211115.1|2171238_2173191_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211112.1|2173383_2174031_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211113.1|2174086_2175412_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_032126179.1|2175441_2175693_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_080664854.1|2175650_2176232_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300408.1|2176568_2177225_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_032126362.1|2177275_2177641_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2177586_2178162_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209823.1|2179383_2179827_-	response regulator	NA	NA	NA	NA	NA
WP_016209809.1|2180251_2180740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|2180846_2181815_+	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_155047117.1|2182516_2185816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209810.1|2187405_2189319_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209822.1|2189375_2190023_-	methyltransferase domain protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_036777933.1|2190158_2191283_-	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_016209800.1|2191279_2191876_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209821.1|2191906_2192239_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209812.1|2192328_2194152_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_036777937.1|2194598_2196311_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	4.3e-25
WP_016209815.1|2196628_2197168_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016209799.1|2197554_2197971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209818.1|2198066_2198882_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209805.1|2199014_2200508_+	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_032126324.1|2200686_2201109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209801.1|2201108_2203163_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016209813.1|2203447_2204263_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_036778458.1|2204363_2205182_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209808.1|2205178_2205547_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016209806.1|2205889_2206039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212343.1|2206851_2207658_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_129556499.1|2207896_2209050_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211588.1|2209217_2209919_-	cyclase family protein	NA	NA	NA	NA	NA
WP_032126329.1|2209994_2210624_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_129556496.1|2210809_2212048_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_036778365.1|2212322_2212985_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_016211589.1|2212974_2214207_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_129556495.1|2214329_2214587_+	VOC family protein	NA	NA	NA	NA	NA
WP_032126637.1|2215567_2215861_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126540.1|2216091_2216955_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046995.1|2217088_2217974_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126332.1|2218621_2219821_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_016211366.1|2220073_2220361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779263.1|2220416_2222426_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_032126330.1|2222768_2223728_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_016211367.1|2223875_2224658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273303.1|2224813_2225530_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016210281.1|2225543_2226935_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210270.1|2226976_2229964_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210277.1|2230033_2230867_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210279.1|2230920_2232087_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210272.1|2232074_2232785_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210283.1|2232824_2233610_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_129556492.1|2233637_2234381_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|2234478_2236674_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_016210271.1|2236750_2237434_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_032126334.1|2237444_2237876_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_036778186.1|2237915_2238314_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_016210273.1|2238686_2239394_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210275.1|2239458_2239761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210276.1|2239816_2240293_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210284.1|2240347_2240869_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210280.1|2240950_2242045_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_075273327.1|2242456_2243032_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2242977_2243343_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047116.1|2243303_2243555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300415.1|2244144_2244846_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_032126500.1|2244979_2245696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|2245832_2247080_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126499.1|2247458_2248070_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211122.1|2248166_2249033_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2249036_2249798_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_036779309.1|2249961_2250867_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211125.1|2251089_2251920_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|2252089_2252479_+	lipoprotein	NA	NA	NA	NA	NA
WP_032126498.1|2252611_2253172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|2253233_2253599_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2253613_2254120_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047115.1|2254116_2254521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212585.1|2254815_2255136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2255247_2256222_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|2256591_2257167_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2257112_2257478_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274673.1|2257438_2258437_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780900.1|2258607_2259261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047081.1|2259311_2259749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212519.1|2260019_2260400_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300173.1|2260474_2261536_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	2279289	2321923	3337236	transposase	Staphylococcus_phage(25.0%)	44	NA	NA
WP_129556490.1|2279289_2280175_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047111.1|2280179_2281508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047110.1|2281624_2282686_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126869.1|2282663_2282903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2283423_2283999_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2283944_2284310_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047109.1|2284371_2284785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556488.1|2285965_2286816_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275079.1|2286964_2288026_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126801.1|2288073_2288583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274679.1|2289251_2290313_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212218.1|2291763_2292114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285943.1|2292258_2293095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|2293148_2294441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104686.1|2294676_2297433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046955.1|2298588_2298768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|2299009_2299711_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|2299971_2300178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|2300407_2300713_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|2300891_2302889_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2302872_2303919_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|2304639_2305491_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|2305491_2306412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|2306822_2307107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2307098_2307554_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2307513_2307852_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2308064_2308994_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2309150_2309579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047107.1|2309659_2310112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2310137_2311043_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2311239_2311848_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155047106.1|2311888_2312775_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556499.1|2312971_2314124_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211971.1|2314330_2314942_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2314962_2316159_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2316255_2316396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2316408_2316813_-	SufE family protein	NA	NA	NA	NA	NA
WP_075273313.1|2316938_2317277_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300431.1|2317236_2317539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|2317683_2317869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|2318438_2319020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300573.1|2319047_2320181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|2320444_2320972_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_081007045.1|2321293_2321923_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	2343628	2396634	3337236	transposase,protease,tRNA	Leptospira_phage(16.67%)	56	NA	NA
WP_016209884.1|2343628_2344252_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2344328_2344529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2344670_2345369_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2345515_2346085_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2346399_2347023_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2347231_2347834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2347905_2348791_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|2349014_2349901_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273603.1|2349980_2350157_+	phosphatase	NA	NA	NA	NA	NA
WP_016212526.1|2350280_2350814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047105.1|2350984_2351866_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	3.4e-50
WP_016212445.1|2352108_2352375_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|2352433_2353018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274681.1|2353568_2354444_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063519.1|2354492_2354909_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210465.1|2355195_2356038_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2356088_2356436_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2356626_2357514_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2357628_2358231_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2358227_2358947_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_052104601.1|2359015_2360728_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_036777098.1|2360875_2362813_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2362921_2363974_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2363973_2364249_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2364329_2364878_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_051307322.1|2365151_2365331_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_155047104.1|2365334_2365616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2365672_2366038_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047103.1|2366153_2367275_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_155049817.1|2368069_2368956_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036780722.1|2369017_2369992_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_016210459.1|2370156_2370675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047101.1|2370879_2371998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211720.1|2372245_2373169_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211716.1|2373182_2374106_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036778439.1|2374053_2374710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|2375012_2375840_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_155047100.1|2376280_2376640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047099.1|2376784_2376940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126590.1|2377132_2378665_+	nuclease	NA	NA	NA	NA	NA
WP_032126591.1|2378727_2380065_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_016210313.1|2380207_2381674_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210314.1|2381670_2382720_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_036778435.1|2382843_2384958_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|2385122_2385527_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2385587_2386313_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210307.1|2386398_2387289_+	YicC family protein	NA	NA	NA	NA	NA
WP_032126592.1|2387329_2387950_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.3	2.5e-20
WP_016210310.1|2388010_2388217_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_016210316.1|2388238_2390392_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.1e-12
WP_054300439.1|2390398_2392381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780594.1|2392652_2393135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2393138_2393714_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2393659_2394025_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036780787.1|2394223_2395183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2395551_2396634_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 26
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	2400557	2445608	3337236	transposase	Staphylococcus_phage(50.0%)	51	NA	NA
WP_054300443.1|2400557_2400836_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|2400888_2401137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|2401094_2402156_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212179.1|2402576_2402729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|2403151_2403325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2403401_2403659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781320.1|2405877_2406105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2406091_2406418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2406419_2406851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2407379_2408441_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300445.1|2408535_2409087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2409356_2410376_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2410362_2410785_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2410786_2411260_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|2411375_2411999_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|2412028_2412703_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2412708_2413857_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2413853_2414315_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2414390_2415641_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2415767_2417447_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2417556_2418423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2419325_2420300_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_036781250.1|2420395_2421181_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2421324_2422011_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2422044_2422443_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2422606_2422912_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|2422989_2423244_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2423397_2425059_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2425118_2425802_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2425801_2426890_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2426938_2429575_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300173.1|2429987_2431049_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300448.1|2431238_2433608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2433651_2434626_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300449.1|2434645_2435425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2435554_2435893_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2435852_2436308_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211507.1|2436633_2437953_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|2437956_2438673_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|2438669_2439311_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_081007048.1|2439303_2439402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2439742_2440108_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2440053_2440629_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047096.1|2440660_2440933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047095.1|2440989_2441130_+	phosphatase	NA	NA	NA	NA	NA
WP_155047094.1|2441274_2441742_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211503.1|2441892_2442348_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|2442402_2442747_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2442776_2443820_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|2444522_2444732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2444721_2445608_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	2515796	2578139	3337236	transposase,tRNA	Planktothrix_phage(18.18%)	57	NA	NA
WP_129556571.1|2515796_2516507_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2516535_2516940_+	RidA family protein	NA	NA	NA	NA	NA
WP_036777168.1|2516964_2517924_-	response regulator	NA	NA	NA	NA	NA
WP_016209567.1|2518055_2518673_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126712.1|2519107_2519566_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2520310_2521321_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2521805_2522717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2523042_2526537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2526574_2527414_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_036777155.1|2527600_2527816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2527864_2528440_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2528436_2528775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2528943_2529933_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2529933_2530896_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_054300271.1|2531851_2532826_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2532963_2533197_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2533290_2533656_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2533670_2534177_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212572.1|2534234_2534627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2534756_2535122_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2535178_2535487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2535578_2536154_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2536099_2536465_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|2536617_2536890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126774.1|2537498_2537834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2537993_2539526_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2539558_2540398_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2540394_2540892_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_036779082.1|2540895_2541888_-	AAA family ATPase	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_155047091.1|2542002_2543349_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2543572_2544634_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2544712_2545858_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|2551665_2552523_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2552509_2553433_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_036778204.1|2553629_2555021_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2555067_2556111_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2556153_2556597_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2556729_2557920_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2557974_2558121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|2558671_2559589_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2559856_2560150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2560226_2560421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300462.1|2561439_2562357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2562822_2563665_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2563732_2564383_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|2564397_2565438_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|2565560_2566646_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2566672_2567782_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2567798_2568116_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2568112_2568472_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_054300463.1|2568574_2571304_-	kinase	NA	NA	NA	NA	NA
WP_080664847.1|2571804_2572758_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300173.1|2572830_2573892_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212048.1|2574655_2575213_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_032126664.1|2575406_2576090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126663.1|2576808_2577051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|2577077_2578139_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	2668032	2750743	3337236	transposase,tRNA	Escherichia_phage(37.93%)	82	NA	NA
WP_054300202.1|2668032_2668761_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|2668850_2669462_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_036779399.1|2669818_2670073_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2670171_2671956_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779389.1|2672044_2672764_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|2672946_2673153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779393.1|2673152_2673389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2673401_2673779_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2674285_2675104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779396.1|2675197_2675395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|2675489_2676875_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|2677001_2677592_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_155047083.1|2679783_2680512_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	4.3e-43
WP_016211816.1|2681580_2681934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2681975_2683589_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2683810_2684032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2684340_2685069_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2685685_2686783_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2686816_2688067_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_054300202.1|2688206_2688935_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212193.1|2689057_2689396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2689463_2689850_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2689846_2690092_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300475.1|2690500_2691229_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211625.1|2691712_2692582_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_036779883.1|2692578_2693928_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211623.1|2694040_2695681_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_054300202.1|2696495_2697224_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300478.1|2697503_2699240_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_155047082.1|2699401_2699581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300477.1|2699743_2700472_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016212214.1|2700630_2701131_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036780855.1|2701105_2701603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2702368_2703097_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300479.1|2703247_2704288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211653.1|2704485_2705511_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_016211652.1|2705618_2706824_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211655.1|2707083_2707497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2707625_2708195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2708198_2708531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300480.1|2708523_2709363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047081.1|2709450_2710998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2711447_2711951_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2711913_2712621_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2712689_2713550_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_036777969.1|2713530_2714304_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2714334_2715588_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2715587_2716550_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2716593_2717346_+	ComF family protein	NA	NA	NA	NA	NA
WP_036777977.1|2717399_2719280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210615.1|2719427_2719898_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2719943_2720183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777984.1|2720201_2720651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2720871_2722296_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|2722360_2723410_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2723676_2724456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2724507_2725410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047080.1|2725468_2726215_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	4.4e-19
WP_016210616.1|2726463_2729274_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_081007053.1|2729508_2730369_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_155047079.1|2731211_2731454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2731608_2732761_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047078.1|2732947_2733283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2733375_2733675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2733664_2733829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047077.1|2734060_2735213_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	4.4e-58
WP_155047076.1|2735222_2735498_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066236.1|2735732_2736140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049820.1|2736104_2736560_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273369.1|2736668_2737484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047075.1|2737557_2738478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2738489_2739218_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2739307_2739514_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007054.1|2739676_2740909_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_054300482.1|2741424_2742714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049821.1|2743872_2744061_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047219.1|2744107_2744836_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032127022.1|2745512_2747699_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2747760_2748914_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2749199_2749724_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|2749914_2750082_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|2750026_2750743_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
>prophage 29
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	2766085	2794272	3337236	integrase,transposase,protease,tRNA	Acinetobacter_phage(12.5%)	27	2763474:2763533	2781314:2781602
2763474:2763533	attL	ACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTT	NA	NA	NA	NA
WP_155047267.1|2766085_2766295_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007057.1|2767622_2768039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|2768096_2769249_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016212230.1|2769305_2770754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2772287_2772476_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046946.1|2773877_2774153_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2774155_2774758_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_016212522.1|2774854_2775109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|2775653_2776733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780431.1|2777051_2778770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2778813_2779719_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155049822.1|2780189_2780345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047221.1|2780736_2781216_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	42.0	1.7e-11
WP_155047222.1|2781324_2781999_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.8	2.2e-09
2781314:2781602	attR	AAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTT	NA	NA	NA	NA
WP_155047223.1|2782042_2782288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2782918_2783494_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_036778086.1|2783569_2784445_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_052104629.1|2784845_2785871_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047224.1|2786014_2786491_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778088.1|2786475_2787558_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.0e-20
WP_036777829.1|2787798_2788203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047225.1|2788537_2788735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2788915_2789647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2789903_2791205_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2791346_2792015_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2792458_2793055_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2793075_2794272_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
>prophage 30
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	2823488	2875948	3337236	transposase,tRNA	Microbacterium_phage(12.5%)	57	NA	NA
WP_054300282.1|2823488_2823953_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047228.1|2824009_2824492_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2825346_2825742_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|2825738_2826533_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_036778479.1|2826711_2827437_-	D-Ala-D-Ala dipeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2827682_2828870_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016210935.1|2829446_2829989_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2829985_2830672_-	acireductone synthase	NA	NA	NA	NA	NA
WP_036778484.1|2830675_2831287_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2831333_2832353_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2832454_2833249_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2833286_2834093_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2834171_2835221_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2835418_2836678_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2836724_2837402_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2837487_2837769_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|2837860_2839048_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_016210820.1|2839284_2840226_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2840729_2840954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2841245_2841950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|2842420_2843059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2843393_2843924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779158.1|2843920_2845453_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2845449_2846400_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2846820_2847453_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2847695_2847893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2848267_2848633_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2848689_2848854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2848843_2849143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2849190_2849619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300194.1|2849696_2850395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2850372_2851434_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2851658_2851955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|2852059_2852716_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2852939_2853437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047229.1|2854646_2855108_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2855067_2855406_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036778253.1|2855463_2857002_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_098082804.1|2857113_2858212_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2858449_2859649_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2859678_2860317_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|2860332_2862516_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|2862753_2863098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|2864143_2864350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|2864514_2864973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|2865560_2866688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2866811_2867474_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2867565_2867811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2868884_2869544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2869645_2870296_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|2870408_2870729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2870787_2871762_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2872012_2872234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047230.1|2872522_2872945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047231.1|2872945_2873479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300190.1|2873973_2874936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046995.1|2875062_2875948_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	2936827	2994860	3337236	transposase,protease,tRNA	Staphylococcus_phage(37.5%)	57	NA	NA
WP_054300271.1|2936827_2937802_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047235.1|2937821_2938808_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2938898_2939645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275004.1|2939769_2940633_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2940876_2941239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273422.1|2941425_2941953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2942097_2942514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2944610_2945522_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2945573_2946422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2946866_2947577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2947668_2948637_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2948624_2949272_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036779767.1|2949300_2950152_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2950166_2951444_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2951484_2952000_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_054300183.1|2952078_2953140_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2953161_2954250_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_036777788.1|2954294_2956130_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2956172_2956643_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2956679_2957015_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2957027_2957744_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2957680_2958697_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2958693_2959173_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2959256_2961737_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2961799_2962165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2962503_2962842_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2962801_2963257_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2963271_2963562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777784.1|2963627_2965226_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2965356_2965692_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777781.1|2965719_2967384_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210581.1|2967380_2968025_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2968024_2968768_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2968826_2969066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2969216_2970584_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2970594_2971146_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2971226_2972210_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2972331_2974089_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2974311_2974902_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_155049840.1|2974990_2975410_-	DksA protein	NA	NA	NA	NA	NA
WP_075273416.1|2975550_2976165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2976225_2977011_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075273313.1|2977264_2977603_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007003.1|2977562_2978024_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2978396_2979371_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212084.1|2979652_2980669_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2980668_2981184_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2981225_2981699_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_155047236.1|2981754_2982297_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2982320_2982776_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_155046996.1|2984549_2987063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046997.1|2987997_2990520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2991094_2992156_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2992182_2992758_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2992703_2993069_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046755.1|2993140_2993317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2993707_2994860_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 32
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	3119728	3183859	3337236	transposase	Staphylococcus_phage(16.67%)	53	NA	NA
WP_054300271.1|3119728_3120703_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211161.1|3121285_3122395_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|3122406_3123051_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|3123069_3124056_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|3124135_3125212_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|3125414_3126239_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|3126555_3127560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|3127768_3128734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047242.1|3128872_3129748_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|3130044_3131097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|3131364_3131793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|3132006_3132498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|3132553_3133804_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|3133906_3134125_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_036777591.1|3134582_3135437_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016210728.1|3135491_3135962_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|3136349_3137729_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|3137756_3138215_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|3138192_3139410_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|3139601_3139838_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|3139851_3140007_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|3140087_3141050_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|3141209_3142526_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|3142535_3143204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|3143566_3145381_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_054300166.1|3145498_3146287_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211543.1|3146867_3148619_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|3148629_3149430_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|3149532_3150021_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_032126435.1|3150194_3150509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375799.1|3151529_3151874_+	DMT family protein	NA	NA	NA	NA	NA
WP_016210038.1|3157567_3158530_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|3158716_3159976_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|3160199_3160526_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|3160720_3161671_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|3161728_3163795_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|3163800_3164796_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|3165381_3166962_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|3167118_3168528_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|3168587_3169721_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|3169860_3170685_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|3170912_3171542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|3171878_3172250_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|3172553_3172841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|3172992_3173841_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|3173968_3175009_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_155047244.1|3175081_3177019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|3177302_3177962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3178116_3179091_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155066237.1|3179126_3180185_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556602.1|3180583_3180793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|3181667_3182750_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_054300161.1|3182797_3183859_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP038908	Piscirickettsia salmonis strain Psal-009 chromosome, complete genome	3337236	3191744	3305664	3337236	transposase,tRNA	Staphylococcus_phage(33.33%)	113	NA	NA
WP_155047053.1|3191744_3192630_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212222.1|3193106_3193580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|3193576_3193972_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3194901_3195477_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3195422_3195788_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036778680.1|3196052_3198383_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_129556603.1|3198503_3200519_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300160.1|3200702_3204095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3204159_3204465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|3204655_3204835_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_155047245.1|3204838_3205027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|3205050_3206025_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	1.8e-28
WP_032126362.1|3206282_3206648_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047247.1|3206711_3207080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|3207083_3207970_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047248.1|3208033_3208720_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047249.1|3208972_3210073_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|3210467_3211577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|3212619_3212985_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047002.1|3212999_3213605_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036776867.1|3213975_3215373_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_051307313.1|3215492_3216440_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3216436_3216952_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3216938_3218138_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3218134_3218458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3218459_3219689_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3219688_3220732_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3220731_3221415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3221411_3223901_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3223917_3224172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3224172_3224529_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3225308_3226472_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3226491_3229599_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3229600_3231106_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3231133_3231415_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3231563_3231905_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3232024_3233905_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3233989_3235588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3235605_3236721_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3236848_3237847_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_052104582.1|3237850_3238609_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3238610_3239810_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3239793_3240465_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3240486_3241263_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3241266_3242265_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3242266_3242845_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3242841_3244311_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3244354_3244642_-	trp operon repressor	NA	NA	NA	NA	NA
WP_155047250.1|3244842_3245439_+	EamA family transporter	NA	NA	NA	NA	NA
WP_054300152.1|3245465_3245831_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3245887_3246043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273401.1|3246187_3246640_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047251.1|3246677_3246902_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155047003.1|3248497_3249383_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3249569_3249791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047252.1|3249906_3250485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047253.1|3250629_3250824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3250882_3251857_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|3251910_3252972_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776841.1|3253699_3254239_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3254323_3254860_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3255511_3255814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3256263_3256572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|3257180_3257630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3257912_3258623_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3258849_3259248_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_036778156.1|3260115_3261066_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3261065_3263144_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3263291_3263807_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3263815_3264379_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3264359_3265106_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3265245_3265698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3266121_3266958_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3266954_3267851_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3267883_3268951_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3268969_3269338_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3269363_3270812_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3270821_3272201_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3272241_3273573_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3273544_3274504_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3274596_3275100_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3275234_3276386_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3276382_3276862_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3277008_3279330_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3279274_3279901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3279905_3280805_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3280877_3281456_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3281756_3282014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556718.1|3282022_3283209_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_155046758.1|3284023_3284155_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3284299_3284455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777721.1|3284782_3285556_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155047254.1|3286492_3286630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3286673_3287648_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3288742_3289081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007065.1|3289097_3289937_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_081007013.1|3290149_3290449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3290438_3290603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3290659_3291025_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3292329_3293025_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3293021_3294449_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3294474_3294738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3294810_3295785_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047005.1|3295843_3296694_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3296731_3297076_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3297072_3297909_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3297909_3298251_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3298252_3298858_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3298854_3300849_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3300868_3301810_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052104719.1|3302037_3303462_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3303974_3304949_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3305007_3305664_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038909	Piscirickettsia salmonis strain Psal-009 plasmid unnamed1, complete sequence	90105	2991	53084	90105	protease,transposase,integrase	Indivirus(33.33%)	56	NA	NA
WP_155046942.1|2991_3877_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.8	2.6e-10
WP_155047273.1|4016_4154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|4284_5310_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047272.1|5672_6401_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_052104629.1|6610_7636_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212298.1|8302_8629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|8869_9346_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_155047271.1|9460_10577_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	3.6e-57
WP_129556449.1|10581_11088_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	1.0e-06
WP_054300249.1|11102_11468_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556698.1|11581_12283_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_016211912.1|12372_12963_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_032126795.1|13235_13496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|13499_13772_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_016211913.1|14097_15219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273786.1|15651_16050_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556499.1|16058_17212_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016212499.1|18210_18585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|18789_18963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|19210_19660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212412.1|19652_19817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|20117_20744_+	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_075273790.1|20733_21036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|21580_22606_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300590.1|23222_23447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556699.1|23754_23955_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211871.1|23948_24284_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_032126138.1|24849_25113_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_155047297.1|26321_26468_+	phosphatase	NA	NA	NA	NA	NA
WP_155046940.1|26605_26989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066233.1|27193_28045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212010.1|28162_28459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212008.1|28475_29174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126227.1|29211_29502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047053.1|30428_31314_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	23.1	1.5e-10
WP_054300520.1|31355_31670_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273359.1|31615_32191_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.0	2.3e-07
WP_016211797.1|32241_33645_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_081007059.1|33806_34868_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_016211795.1|35550_35745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|35882_36869_-	APC family permease	NA	NA	NA	NA	NA
WP_016212044.1|37591_37846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777801.1|38619_38838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047052.1|39700_40429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047051.1|40573_41443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210130.1|41754_42045_-	PAAR motif family protein	NA	NA	NA	NA	NA
WP_081007060.1|42161_43460_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210137.1|43686_44238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007061.1|44218_44968_+	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	30.4	3.9e-15
WP_016210141.1|45001_46300_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	28.9	1.6e-32
WP_036777821.1|46389_47616_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210136.1|47865_48213_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_016210121.1|48213_49986_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	26.5	3.7e-40
WP_032126492.1|49975_50950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210122.1|51576_52269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|52508_53084_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
>prophage 2
NZ_CP038909	Piscirickettsia salmonis strain Psal-009 plasmid unnamed1, complete sequence	90105	75899	83186	90105	transposase,capsid,tail,head	Acinetobacter_phage(14.29%)	12	NA	NA
WP_129556718.1|75899_77086_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_155047276.1|77114_77894_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	31.7	1.8e-18
WP_155047275.1|77890_78388_+	DNA polymerase	NA	NA	NA	NA	NA
WP_052047108.1|78443_78842_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556716.1|78975_79266_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_016210655.1|79279_79876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210663.1|80194_80506_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210667.1|80502_80826_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210658.1|80818_81214_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210651.1|81210_81561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210664.1|81560_81983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|82280_83186_+|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
>prophage 1
NZ_CP038910	Piscirickettsia salmonis strain Psal-009 plasmid unnamed2, complete sequence	58528	2671	47766	58528	protease,portal,transposase,integrase,tail,head,capsid	Streptococcus_phage(13.64%)	57	NA	NA
WP_052104629.1|2671_3697_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047304.1|3967_4099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047313.1|4825_5179_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_016211142.1|6767_7034_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075274761.1|7090_7414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047305.1|7415_7838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274762.1|7837_8188_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_075274763.1|8184_8580_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	39.1	6.0e-07
WP_075274764.1|8572_8896_-|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	41.7	5.4e-14
WP_075274765.1|8892_9204_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.7	2.5e-08
WP_155064811.1|9541_10105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047306.1|10140_11307_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	38.7	1.2e-66
WP_081007077.1|11362_12034_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	45.8	5.5e-45
WP_054300593.1|11981_13223_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	43.6	2.7e-85
WP_155047307.1|13219_13816_-	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.3	2.0e-38
WP_155047308.1|13859_14834_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	8.3e-26
WP_155047309.1|14853_15783_-	hypothetical protein	NA	A0A1W6JP18	Morganella_phage	52.0	1.5e-85
WP_155047310.1|16011_16494_-	hypothetical protein	NA	Q9B019	Phage_GMSE-1	33.3	1.1e-13
WP_032126915.1|16580_16964_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	4.7e-25
WP_052047121.1|17142_17544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126916.1|17688_18159_-	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	48.8	1.5e-33
WP_155047311.1|18146_18449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923627.1|18445_18733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210963.1|18828_19068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047315.1|19064_19412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047314.1|19404_19767_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.9e-24
WP_036780304.1|19735_20272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211080.1|20312_21299_-	helix-turn-helix domain-containing protein	NA	A0A0S2MVA0	Bacillus_phage	45.4	4.3e-14
WP_036780299.1|21337_21640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211079.1|21794_22100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211067.1|22309_23053_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211077.1|23185_23971_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300594.1|24403_25429_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036780005.1|25576_26224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211069.1|26207_26639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047030.1|26663_26807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211075.1|27021_28263_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211068.1|28266_29079_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080664851.1|29075_29885_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|30087_31062_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047312.1|31097_31439_-	toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.7	2.0e-11
WP_027242955.1|31431_31692_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211925.1|32182_32968_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	28.7	9.7e-17
WP_016211928.1|32960_33401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|33951_34215_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_054300276.1|35154_36129_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.8	2.4e-25
WP_016212188.1|37218_37959_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155047301.1|38136_38409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|39029_39605_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	6.0e-08
WP_032126136.1|39670_40216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|41249_42275_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047302.1|42928_44008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212274.1|44538_45003_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032126154.1|45013_45208_-	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_032126152.1|45423_46014_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
WP_081007075.1|46077_46419_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155047303.1|46764_47766_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.3e-29
>prophage 1
NZ_CP038911	Piscirickettsia salmonis strain Psal-009 plasmid unnamed3, complete sequence	38376	6445	19646	38376	protease,terminase,capsid,portal,head,tail,transposase	Erysipelothrix_phage(25.0%)	15	NA	NA
WP_054300271.1|6445_7420_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047317.1|7554_8391_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_016211139.1|8470_8866_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211132.1|8858_9182_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211137.1|9178_9490_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_155047318.1|9680_11015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211140.1|11135_12329_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_080664855.1|12386_13058_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_155047319.1|13005_13626_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	50.9	5.5e-39
WP_052104629.1|13828_14854_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047320.1|14984_15707_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	40.8	2.6e-40
WP_155047321.1|15703_17386_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	45.7	6.9e-137
WP_016212234.1|17388_17868_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_155047322.1|17944_18337_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	4.4e-26
WP_054300271.1|18671_19646_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
>prophage 1
NZ_CP038912	Piscirickettsia salmonis strain Psal-009 plasmid unnamed4, complete sequence	33277	0	3739	33277	transposase	unidentified_phage(100.0%)	2	NA	NA
WP_155047332.1|876_2289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2764_3739_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
>prophage 2
NZ_CP038912	Piscirickettsia salmonis strain Psal-009 plasmid unnamed4, complete sequence	33277	10182	26836	33277	transposase,tail	Indivirus(18.18%)	19	NA	NA
WP_036781073.1|10182_10443_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	A0A1S5NR91	Burkholderia_phage	48.8	2.1e-13
WP_081007079.1|10513_10786_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_129556478.1|10997_11884_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	5.8e-10
WP_016212315.1|13422_13857_+	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	39.7	9.1e-25
WP_155047334.1|14265_14706_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	37.6	1.1e-06
WP_054300249.1|14666_15032_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047335.1|15046_15490_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	5.1e-07
WP_054300271.1|16499_17474_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047336.1|17470_17755_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047337.1|17773_18136_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|18135_18558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275196.1|18559_18883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|18939_19206_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075275195.1|19209_21288_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.4	2.5e-56
WP_036776958.1|21280_21622_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|21618_22290_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|22258_23005_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_054300696.1|22994_23552_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_075275194.1|23548_26836_+	host specificity protein J	NA	A0A0R6PIC0	Moraxella_phage	33.2	5.2e-112
>prophage 3
NZ_CP038912	Piscirickettsia salmonis strain Psal-009 plasmid unnamed4, complete sequence	33277	30547	32866	33277	transposase	Indivirus(50.0%)	2	NA	NA
WP_075273327.1|30547_31123_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_054300276.1|31891_32866_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.8	2.4e-25
