The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	34311	89825	3146686	transposase	uncultured_Caudovirales_phage(16.67%)	52	NA	NA
WP_129556478.1|34311_35198_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211390.1|36699_38472_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_016211389.1|38898_40026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|40610_40976_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|41032_41197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|41186_41486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211577.1|41838_44532_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.8	2.6e-69
WP_129556616.1|44563_45151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664863.1|45195_46236_+	beta-eliminating lyase	NA	NA	NA	NA	NA
WP_016211572.1|46357_46582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|46823_47399_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|47344_47710_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036776493.1|47908_48670_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_036779326.1|48971_50498_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|50869_51709_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|51748_53056_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|53030_54200_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|54254_54980_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|55258_55648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|55835_56741_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|56788_56932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047031.1|56979_57576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|57810_58964_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016210704.1|59858_61805_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|62459_65522_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|65518_66583_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|66938_67892_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|67923_69087_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|69092_69692_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|69879_70380_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|70397_71486_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|71624_72869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|72865_73708_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_036777711.1|73687_74497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|74664_74892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|74892_75843_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|75898_76450_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|76576_76999_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|76991_77738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|77780_78479_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|78489_79314_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|79643_80012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|80006_81068_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|81117_81348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|81477_82692_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|82992_84054_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_036777695.1|84067_85795_+	oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_016211245.1|85828_86560_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|86559_87348_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|87452_88076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|88395_88608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047032.1|88763_89825_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	128506	182781	3146686	transposase	Staphylococcus_phage(42.86%)	58	NA	NA
WP_054300271.1|128506_129481_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209611.1|129729_129921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047035.1|130000_130180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209580.1|130271_130796_+	ankyrin repeat family protein	NA	NA	NA	NA	NA
WP_016209612.1|131179_131548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209595.1|131585_131858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300576.1|131948_133244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211692.1|133879_134782_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.4	1.6e-18
WP_051307362.1|134838_135690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211694.1|136269_138279_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	3.0e-110
WP_054300271.1|138316_139291_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|139792_141205_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|141697_142705_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|142724_144245_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_016211018.1|145195_146512_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|146615_146999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|147133_150199_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|150267_151371_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|151394_151949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|152063_152633_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|152752_153508_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_155047036.1|153674_154574_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047037.1|154718_155024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082829.1|155418_155814_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|155835_156201_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|156257_156422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|156411_156711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300544.1|156801_157248_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|157743_158310_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|158321_159107_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|159738_160662_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|160713_161709_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|161740_162235_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_036778333.1|162326_162584_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|162673_163096_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|163414_164131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|164174_164426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778330.1|164430_165867_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|165894_167337_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|167424_167763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|167847_168378_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|168438_170631_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|170673_171159_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|171428_171860_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036778324.1|171877_172708_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|172722_172866_-	lipoprotein	NA	NA	NA	NA	NA
WP_052104672.1|172896_173781_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|173752_173974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|174147_174426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|175396_176302_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_036780891.1|176358_177537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|177533_178109_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|178054_178420_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300541.1|178747_179527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126848.1|180060_180861_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_052104671.1|181079_181838_+	ion transporter	NA	NA	NA	NA	NA
WP_016211859.1|181914_182202_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_075273327.1|182205_182781_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	201797	273082	3146686	tail,tRNA,protease,transposase	Acinetobacter_phage(25.0%)	60	NA	NA
WP_016209871.1|201797_203780_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|203989_205333_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|205599_208269_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|208292_210212_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|210381_211803_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|211948_212923_+	phospholipase A	NA	NA	NA	NA	NA
WP_054300537.1|212954_213362_+	glyoxalase	NA	NA	NA	NA	NA
WP_016209859.1|213640_213862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|214025_215687_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|215759_216050_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_036776911.1|216275_216731_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|216795_217260_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|217352_218699_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|218698_219604_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|219665_220652_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|220644_220887_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|221008_222553_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_036776914.1|222599_223886_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|223928_225323_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|225346_225526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|225522_225702_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300181.1|225705_225987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|226043_226409_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210079.1|229414_229912_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|230082_230778_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|230880_232443_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|232758_234552_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|234637_234910_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|234915_235542_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|235528_236959_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|237291_238347_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|238315_238993_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|238982_239819_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|239978_240272_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|240378_241185_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|241489_242344_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_036776920.1|242498_243548_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_036776924.1|243598_244255_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|244272_245553_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|245826_247188_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_032126863.1|247587_248139_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016211802.1|253570_254842_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036778206.1|254898_255882_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_155047042.1|255878_256412_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_155047043.1|256560_256776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047044.1|256769_256952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|257648_258014_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|257959_258535_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300535.1|258538_259258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|259402_259603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|259650_260112_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|260535_262017_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|262079_263189_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|263286_265248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|265777_266182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047045.1|266234_266930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|266906_267881_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_098082809.1|268051_268402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|269344_270427_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556499.1|271929_273082_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 4
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	301844	361704	3146686	transposase	Bodo_saltans_virus(20.0%)	57	NA	NA
WP_054300526.1|301844_302141_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962174.1|302289_302454_-	phosphatase	NA	NA	NA	NA	NA
WP_016211026.1|302552_302957_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075273367.1|303249_304026_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_155047049.1|304034_306116_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	4.0e-17
WP_016211031.1|306280_306760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211032.1|307069_307867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211033.1|307978_309271_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_032126377.1|309436_310438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211034.1|310554_310734_+	rubredoxin	NA	NA	NA	NA	NA
WP_016211023.1|310744_311179_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_016211029.1|311392_311755_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.6e-25
WP_016212102.1|311928_313569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|315079_316232_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556441.1|319660_320887_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126490.1|321235_322201_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_016210868.1|322197_322497_+	pilZ domain protein	NA	NA	NA	NA	NA
WP_036778898.1|322528_323308_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_016210861.1|323333_323564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|323715_323961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210870.1|324112_324904_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016212128.1|325817_326564_+	solute symporter family protein	NA	NA	NA	NA	NA
WP_032126495.1|326654_327539_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_054300397.1|327944_328190_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046705.1|328430_328598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|328543_329119_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047050.1|329171_329909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777815.1|329912_330197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|330290_330554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|330920_331739_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|331811_334184_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_036777812.1|334896_336324_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|336358_337381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|337397_337775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|338737_339103_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|339048_339624_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210122.1|339863_340556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|341182_342157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|342146_343919_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|343919_344267_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036777821.1|344516_345743_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|345832_347131_-	MFS transporter	NA	NA	NA	NA	NA
WP_081007061.1|347164_347914_-	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	30.4	3.9e-15
WP_016210137.1|347894_348446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007060.1|348672_349971_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|350087_350378_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_155047051.1|350689_351559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047052.1|351703_352432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777801.1|353294_353513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212044.1|354286_354541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|355263_356250_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|356387_356582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007059.1|357264_358326_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_016211797.1|358487_359891_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|359941_360517_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|360462_360777_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047053.1|360817_361704_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	445936	546408	3146686	integrase,tRNA,transposase	Escherichia_phage(43.75%)	108	512723:512782	526934:527107
WP_054300513.1|445936_446800_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|447016_448576_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|448597_449632_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|449680_450250_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|450385_451357_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|451368_452946_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|453011_453998_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054300512.1|454329_455439_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|455544_456729_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|456806_458795_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|459003_459159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047055.1|459429_459717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|459754_460120_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|460065_460641_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047056.1|460630_460993_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|461909_463316_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|463333_464320_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|464322_465477_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|465473_466169_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|466303_467794_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_036777447.1|467814_468864_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|468930_470325_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_036777444.1|471203_473135_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	1.0e-120
WP_075273353.1|473139_473670_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|473704_473899_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|473941_474301_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|474720_475716_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_036777440.1|475728_478110_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|478115_478403_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|478674_479151_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|479295_479493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|479617_480592_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|481492_481591_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036780545.1|482075_482786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047057.1|482949_483366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|483602_484295_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|484336_485110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|485111_486053_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|486185_487763_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|487972_489730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|490278_491037_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|491244_491817_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|491920_492469_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|492770_493016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|493044_493341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779353.1|493608_494520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300506.1|495010_495418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|495489_496218_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126799.1|496298_497111_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_155047058.1|498172_498535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|498537_500277_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046941.1|500678_500942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300500.1|501613_502342_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_016212070.1|502751_503351_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_016212069.1|503325_503493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212066.1|503704_504481_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_054300501.1|504841_505570_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|505581_505974_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|505970_506216_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|506376_507105_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211714.1|507179_510524_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|511772_512348_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|512293_512659_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
512723:512782	attL	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCT	NA	NA	NA	NA
WP_155047059.1|512937_513852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212159.1|514119_514317_+	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_054300201.1|514676_515405_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_155047060.1|515434_516109_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	45.9	5.2e-27
WP_016212024.1|516253_516502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|516498_517098_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|517097_517316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|518090_519083_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|519079_519814_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_155047061.1|520074_520341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047062.1|520485_520644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047063.1|520666_520918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300477.1|521367_522096_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_051307368.1|522802_524083_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|524082_525051_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211646.1|525422_525662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|525654_526008_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_017375910.1|526310_527039_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047064.1|527508_527817_-	hypothetical protein	NA	NA	NA	NA	NA
526934:527107	attR	ATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTTTTACCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCC	NA	NA	NA	NA
WP_155047065.1|527978_528656_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.1	7.0e-40
WP_155047066.1|529149_529878_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.5e-43
WP_016212269.1|530046_530730_+	Fic family protein	NA	NA	NA	NA	NA
WP_016212268.1|530733_531318_+	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_017375910.1|531474_532203_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047064.1|532671_532980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|533230_533833_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300203.1|533837_534296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781052.1|535672_536275_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211639.1|536654_536957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211644.1|537071_537338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104773.1|537445_537889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|537950_538836_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047067.1|538936_539830_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047259.1|539974_540190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104771.1|540639_540978_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	54.9	5.4e-25
WP_075274739.1|540970_541318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274717.1|541314_541545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274718.1|541548_542019_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	64.3	1.3e-32
WP_075274740.1|542163_542529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780395.1|542673_542928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377363.1|542911_543268_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_075274719.1|543573_544440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047068.1|544925_545126_+	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	64.3	3.5e-16
WP_155047069.1|545213_545567_+	hypothetical protein	NA	Q6DMU4	Streptococcus_phage	34.8	8.2e-08
WP_054300202.1|545679_546408_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 6
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	554107	602060	3146686	tRNA,transposase	Synechococcus_phage(33.33%)	51	NA	NA
WP_054300202.1|554107_554836_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|554929_555595_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|555659_556616_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|556874_557573_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|557615_558728_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|559332_559908_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|559853_560219_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|560306_560657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|561392_562454_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210908.1|563665_564481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|564571_565555_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|565725_566247_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_036779246.1|566280_566535_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.4e-20
WP_016210909.1|566537_567815_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|568507_569035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|569154_571467_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|571595_572411_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|572608_573073_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|573202_574264_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|574524_574821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|575103_576567_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|576569_577622_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_036779281.1|577611_578067_+	arginine repressor	NA	NA	NA	NA	NA
WP_155047071.1|578091_578415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|578762_579074_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_054300208.1|579203_579995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779278.1|581152_582106_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|582219_582417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|582662_582863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142396463.1|582973_583090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212074.1|583176_583398_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|583424_583790_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|583846_584011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047072.1|584000_584315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046713.1|584452_584617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|584911_586348_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|586389_587841_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|587952_588240_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|588429_589473_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210536.1|589488_590388_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210528.1|590384_590903_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210527.1|590972_591590_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_036776217.1|591599_593087_+	ribonuclease G	NA	NA	NA	NA	NA
WP_016210534.1|593096_596777_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_036776215.1|596850_597663_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210530.1|597659_598340_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_155047260.1|599180_599339_-	phosphatase	NA	NA	NA	NA	NA
WP_155047073.1|599531_600089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|600138_600429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300215.1|601232_601727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|601721_602060_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	623530	649514	3146686	plate,transposase	Acinetobacter_phage(75.0%)	26	NA	NA
WP_016209523.1|623530_624880_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|624930_625368_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|625629_627141_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_036778935.1|627146_628373_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|628366_629395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|629372_630065_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_016209516.1|630069_631539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778941.1|631531_632020_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|632025_633498_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|633497_633896_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|633892_635581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|635562_636519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|636561_637077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300482.1|638408_639698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007054.1|640213_641446_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_080664881.1|641608_641815_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300481.1|641904_642633_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_155047075.1|642644_643565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|643638_644454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212641.1|644982_645429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047076.1|645624_645900_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047077.1|645908_647062_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	4.4e-58
WP_155046696.1|647293_647458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|647447_647747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047078.1|647839_648175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|648360_649514_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 8
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	678025	713090	3146686	tRNA,transposase	Escherichia_phage(57.14%)	34	NA	NA
WP_054300202.1|678025_678754_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_036780855.1|679519_680017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212214.1|679991_680492_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054300477.1|680650_681379_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_155047082.1|681541_681721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300478.1|681882_683619_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_054300202.1|683898_684627_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211623.1|685441_687082_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_036779883.1|687194_688544_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211625.1|688540_689410_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_054300475.1|689893_690622_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016212196.1|691030_691276_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016212195.1|691272_691659_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212193.1|691726_692065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|692187_692916_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211949.1|693055_694306_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_016211951.1|694339_695437_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_054300202.1|696053_696782_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_075274932.1|697090_697312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|697533_699147_-	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_016211816.1|699188_699542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047083.1|700610_701339_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	4.3e-43
WP_016210945.1|703530_704121_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_016210946.1|704247_705633_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_036779396.1|705727_705925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126573.1|706018_706837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|707343_707721_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_036779393.1|707733_707970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210951.1|707969_708176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779389.1|708358_709078_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210954.1|709166_710951_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779399.1|711049_711304_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_144019244.1|711660_712272_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_054300202.1|712361_713090_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 9
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	759781	804046	3146686	transposase	Staphylococcus_phage(25.0%)	41	NA	NA
WP_054300271.1|759781_760756_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211761.1|761171_763163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211760.1|763269_764649_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300467.1|764686_765067_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|765063_766038_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016211616.1|766081_766270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211615.1|766272_766989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211620.1|768532_769057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211619.1|769124_770945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210267.1|771799_772306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210259.1|772369_773788_+	asmA-like family protein	NA	NA	NA	NA	NA
WP_016210248.1|773908_774163_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_016210257.1|774309_774582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777860.1|775153_775729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210251.1|776799_777042_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_036777864.1|777128_778220_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210258.1|778200_779154_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	4.9e-31
WP_016210253.1|779377_780862_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	3.8e-46
WP_032126416.1|780902_781406_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.6	2.8e-09
WP_016210254.1|781665_782841_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_016210252.1|783749_784121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210260.1|786635_787064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556655.1|787291_788296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047085.1|788399_788993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|789065_790127_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047086.1|790121_790892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300465.1|790884_791664_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155047087.1|791885_792029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047088.1|792095_793249_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_155047089.1|793306_793702_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|793716_794082_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211061.1|794143_794497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211058.1|794617_795151_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_032126660.1|795289_796927_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.2	5.8e-88
WP_016211065.1|796931_797153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211066.1|797250_798264_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_016211063.1|798426_800655_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
WP_032126658.1|800635_801340_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|801574_801904_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_155047090.1|802228_802735_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054300237.1|802984_804046_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	905596	987984	3146686	tRNA,transposase	Staphylococcus_phage(29.41%)	85	NA	NA
WP_016211428.1|905596_907660_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
WP_054300173.1|907930_908992_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556651.1|909233_910442_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300148.1|910629_911691_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273329.1|911738_913040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300455.1|913000_913366_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|913380_913887_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075285950.1|913876_914485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300452.1|914549_915611_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210196.1|915568_915922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779341.1|916275_918486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|918486_919173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210198.1|919484_920036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|920052_920454_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210190.1|920644_921520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126472.1|921739_922390_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_036778866.1|922852_925441_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.9	3.3e-122
WP_016210199.1|925546_926308_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_016210206.1|926304_926841_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210205.1|926889_927846_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210187.1|927926_931112_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210201.1|931115_932171_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_036778872.1|932400_933006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778869.1|933049_933712_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_016210194.1|933746_934094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|934150_934312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210192.1|934683_935202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|935514_936400_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556569.1|936390_936600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211502.1|937302_938346_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_016211508.1|938375_938720_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211503.1|938774_939230_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_155047094.1|939380_939848_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047095.1|939992_940133_-	phosphatase	NA	NA	NA	NA	NA
WP_155047096.1|940189_940462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|940493_941069_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|941014_941380_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081007048.1|941720_941819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211506.1|941811_942453_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|942449_943166_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211507.1|943169_944489_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_081007004.1|944814_945270_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|945229_945568_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300449.1|945697_946477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|946496_947471_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300448.1|947514_949884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|950073_951135_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211004.1|951547_954184_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_080664849.1|954232_955321_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016210997.1|955320_956004_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_032126469.1|956063_957725_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210998.1|957878_958133_+	LapA family protein	NA	NA	NA	NA	NA
WP_016211001.1|958210_958516_+	competence protein ComEA	NA	NA	NA	NA	NA
WP_016211002.1|958679_959078_+	VOC family protein	NA	NA	NA	NA	NA
WP_051307345.1|959111_959798_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036781250.1|959941_960727_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300271.1|960822_961797_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210826.1|962699_963566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210824.1|963675_965355_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210830.1|965481_966732_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_032126465.1|966807_967269_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210835.1|967265_968414_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_016210836.1|968419_969094_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_052133275.1|969123_969747_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210828.1|969862_970336_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_016210832.1|970337_970760_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210829.1|970746_971766_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_054300445.1|972035_972587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|972681_973743_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212318.1|974271_974703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|974704_975031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781320.1|975017_975245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|977463_977721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|977797_977971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212179.1|978393_978546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|978966_980028_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|979985_980234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300443.1|980286_980565_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211538.1|980803_981727_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_155047097.1|982421_983105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047098.1|983180_984473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|984488_985571_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036780787.1|985939_986899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|987097_987463_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|987408_987984_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	1012166	1059807	3146686	protease,tRNA,transposase	Hokovirus(16.67%)	46	NA	NA
WP_155047102.1|1012166_1013052_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047103.1|1013847_1014969_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|1015084_1015450_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047104.1|1015506_1015788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|1015791_1015971_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016210458.1|1016244_1016793_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210461.1|1016873_1017149_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_032126596.1|1017148_1018201_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_036777098.1|1018309_1020247_-	AsmA family protein	NA	NA	NA	NA	NA
WP_052104601.1|1020394_1022107_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_016210468.1|1022175_1022895_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_016210467.1|1022891_1023494_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210471.1|1023608_1024496_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|1024686_1025034_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210465.1|1025084_1025927_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_026063519.1|1026213_1026630_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274681.1|1026678_1027554_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|1028104_1028689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212445.1|1028747_1029014_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047105.1|1029256_1030138_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	3.4e-50
WP_016212526.1|1030308_1030842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273603.1|1030965_1031142_-	phosphatase	NA	NA	NA	NA	NA
WP_105962625.1|1031221_1032107_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1032330_1033217_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126745.1|1033288_1033891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122940402.1|1034099_1034723_+	porin family protein	NA	NA	NA	NA	NA
WP_016209896.1|1035037_1035607_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016209891.1|1035753_1036452_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_036777115.1|1036593_1036794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209884.1|1036870_1037494_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052104600.1|1037603_1038497_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209898.1|1038603_1040214_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_016209888.1|1040210_1041506_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209876.1|1041527_1043450_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209881.1|1043560_1043863_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209893.1|1043955_1048845_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_052104599.1|1049187_1050504_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.1	3.2e-65
WP_036777110.1|1050628_1051723_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_052104598.1|1051774_1052713_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_080664826.1|1052793_1053393_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209877.1|1053570_1054461_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_016209887.1|1054663_1055155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209894.1|1055298_1055790_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1055958_1056672_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_036777096.1|1056734_1058075_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_081007045.1|1059177_1059807_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	1063823	1101811	3146686	transposase	Streptomyces_phage(25.0%)	40	NA	NA
WP_075273313.1|1063823_1064162_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211968.1|1064287_1064692_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1064704_1064845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126649.1|1064941_1066138_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_016211971.1|1066158_1066770_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_129556499.1|1066975_1068129_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_155047106.1|1068325_1069211_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|1069252_1069861_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032126790.1|1070057_1070963_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155047107.1|1070988_1071441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556559.1|1071521_1071950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212093.1|1072106_1073036_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_075273313.1|1073248_1073587_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1073546_1074002_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212654.1|1073993_1074278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212100.1|1074688_1075609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212098.1|1075609_1076461_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_155047108.1|1077027_1077222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211518.1|1077181_1078228_+	glutathione synthase	NA	NA	NA	NA	NA
WP_032126840.1|1078211_1080209_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_122941967.1|1080387_1080693_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|1080922_1081129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|1081389_1082091_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046955.1|1082332_1082512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046956.1|1083033_1083198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104686.1|1083667_1086424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|1086659_1087952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285943.1|1088005_1088842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212218.1|1088986_1089337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274679.1|1090787_1091849_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126801.1|1092517_1093027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275079.1|1093074_1094136_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556488.1|1094284_1095134_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047109.1|1096315_1096729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1096790_1097156_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1097101_1097677_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126869.1|1098197_1098437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047110.1|1098414_1099476_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047111.1|1099592_1100921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|1100924_1101811_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	1119564	1173203	3146686	tRNA,transposase	Staphylococcus_phage(14.29%)	58	NA	NA
WP_054300173.1|1119564_1120626_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212519.1|1120700_1121081_+	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_052047081.1|1121351_1121789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780900.1|1121839_1122493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274673.1|1122663_1123662_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1123622_1123988_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1123933_1124509_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1124878_1125853_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212585.1|1125964_1126285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047115.1|1126579_1126984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556449.1|1126980_1127487_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|1127501_1127867_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126498.1|1127928_1128489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211126.1|1128621_1129011_-	lipoprotein	NA	NA	NA	NA	NA
WP_016211125.1|1129180_1130011_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_036779309.1|1130233_1131139_-	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211119.1|1131302_1132064_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211122.1|1132067_1132934_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126499.1|1133030_1133642_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211118.1|1134020_1135268_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126500.1|1135404_1136121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300415.1|1136254_1136956_-	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_155047116.1|1137545_1137797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1137757_1138123_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1138068_1138644_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210280.1|1139055_1140150_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_016210284.1|1140231_1140753_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210276.1|1140807_1141284_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210275.1|1141339_1141642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210273.1|1141706_1142414_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_036778186.1|1142786_1143185_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_032126334.1|1143224_1143656_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210271.1|1143666_1144350_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1144426_1146622_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_129556492.1|1146719_1147463_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210283.1|1147490_1148276_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_016210272.1|1148315_1149026_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210279.1|1149013_1150180_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210277.1|1150233_1151067_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210270.1|1151136_1154124_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210281.1|1154165_1155557_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_075273303.1|1155570_1156287_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016211367.1|1156442_1157225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126330.1|1157372_1158332_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_036779263.1|1158674_1160684_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_016211366.1|1160739_1161027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126332.1|1161279_1162479_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_155046995.1|1163125_1164012_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126540.1|1164145_1165009_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1165239_1165533_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_144019383.1|1165940_1166159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556495.1|1166513_1166771_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211589.1|1166893_1168126_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_036778365.1|1168115_1168778_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_129556496.1|1169052_1170291_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_032126329.1|1170476_1171106_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211588.1|1171181_1171883_+	cyclase family protein	NA	NA	NA	NA	NA
WP_129556499.1|1172050_1173203_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 14
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	1202938	1245421	3146686	tRNA,transposase	Staphylococcus_phage(28.57%)	39	NA	NA
WP_075273327.1|1202938_1203514_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1203459_1203825_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300408.1|1203875_1204532_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_080664854.1|1204868_1205450_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_032126179.1|1205407_1205659_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_016211113.1|1205688_1207014_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_016211112.1|1207069_1207717_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211115.1|1207909_1209862_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211114.1|1209994_1212925_+	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_075274672.1|1213290_1213884_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1213921_1214287_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1214232_1214808_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047118.1|1214797_1216240_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016212252.1|1216277_1216436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|1216750_1217476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|1217680_1218052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780001.1|1218408_1218672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779999.1|1218658_1219090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779996.1|1219109_1220666_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_016211391.1|1220677_1221253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728317.1|1221319_1224685_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|1224875_1225850_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556498.1|1226029_1226638_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036778626.1|1226634_1228575_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_016210594.1|1228710_1229364_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210595.1|1229540_1230719_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210588.1|1231086_1232412_+	fimV domain protein	NA	NA	NA	NA	NA
WP_032126176.1|1232502_1233285_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210587.1|1233386_1234247_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_016210590.1|1234421_1235684_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210593.1|1235763_1236294_+	colicin V production protein	NA	NA	NA	NA	NA
WP_016210586.1|1236315_1237821_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210592.1|1237833_1238490_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016212005.1|1238879_1240640_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_075273327.1|1240978_1241554_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1241499_1241865_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556499.1|1242499_1243652_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_032126856.1|1243957_1244299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1244359_1245421_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	1254194	1308715	3146686	tRNA,transposase	uncultured_Mediterranean_phage(36.36%)	51	NA	NA
WP_105962623.1|1254194_1255348_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300286.1|1255511_1255976_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274669.1|1256360_1256663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047121.1|1256867_1257971_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	9.5e-10
WP_054300405.1|1258072_1258573_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209947.1|1259094_1259757_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_036777555.1|1259783_1261013_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209940.1|1261169_1263941_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_052104625.1|1264016_1264460_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209931.1|1264612_1266085_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209926.1|1266196_1267258_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209945.1|1267254_1268289_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209932.1|1268291_1269332_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_036777579.1|1269514_1270630_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209930.1|1270668_1271022_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777561.1|1271042_1272911_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209935.1|1272932_1273877_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_016209925.1|1274110_1274389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1274598_1275237_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209944.1|1275211_1276639_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_036777566.1|1276839_1277517_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209939.1|1277651_1278926_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_036777569.1|1278993_1279749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209948.1|1279800_1280718_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_054300404.1|1280826_1281720_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075273594.1|1281792_1283163_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300276.1|1283202_1284177_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016211771.1|1284469_1284658_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_016211770.1|1284671_1285805_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_155047122.1|1286004_1290096_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211827.1|1290359_1290980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1291311_1291665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1291878_1292073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1292738_1293266_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300400.1|1293322_1293565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1293709_1293976_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300398.1|1294317_1295199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1295256_1295853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1295885_1296659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1297192_1297489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210888.1|1297511_1297763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047123.1|1297708_1298431_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210886.1|1298499_1299279_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210887.1|1299361_1300312_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210889.1|1300821_1303668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047008.1|1303685_1304000_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_129556478.1|1304057_1304943_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212002.1|1304947_1305226_-	DNA-J related family protein	NA	NA	NA	NA	NA
WP_016212000.1|1305345_1306074_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036780082.1|1306204_1307110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1307653_1308715_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	1345337	1375955	3146686	tRNA,transposase	Bacillus_phage(25.0%)	28	NA	NA
WP_032126790.1|1345337_1346243_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1346471_1347743_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_016211218.1|1347767_1348505_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1348757_1349900_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1349916_1351518_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1352029_1352167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1352163_1353441_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1353790_1353973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047126.1|1354244_1354736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046960.1|1354855_1355509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212251.1|1355670_1356207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047127.1|1356368_1357184_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047128.1|1357592_1358960_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.6e-12
WP_052133287.1|1359015_1359414_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212039.1|1359602_1360160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212040.1|1360336_1361686_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_054300162.1|1361891_1362974_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210803.1|1363048_1364347_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_036776426.1|1364524_1365376_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210805.1|1365384_1366056_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_032126141.1|1366474_1367749_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210804.1|1367813_1369733_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126139.1|1369739_1370669_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_054300383.1|1370764_1373245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300382.1|1373515_1373938_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047129.1|1374208_1374865_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1375068_1375434_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|1375448_1375955_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	1380323	1425265	3146686	tRNA,transposase	Staphylococcus_phage(16.67%)	44	NA	NA
WP_016211422.1|1380323_1380794_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032126143.1|1380882_1382154_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_054300250.1|1382253_1382913_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_075273327.1|1382902_1383478_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1383423_1383789_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211838.1|1384498_1384672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211840.1|1385142_1385607_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211839.1|1385765_1387238_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211841.1|1387355_1387808_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|1388667_1389729_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047130.1|1389791_1390550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047131.1|1390737_1391394_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556508.1|1391664_1392108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|1392169_1392463_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155047132.1|1392579_1393242_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.6	5.3e-32
WP_081377879.1|1393386_1393611_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_016212421.1|1393962_1394145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047133.1|1394895_1395870_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.6e-27
WP_155047134.1|1396141_1397164_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211470.1|1397930_1398584_+	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|1398643_1400629_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_032126343.1|1400759_1401572_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_032126344.1|1401692_1402781_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_016211467.1|1402783_1403350_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_155047135.1|1403424_1404000_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|1403945_1404311_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047136.1|1404478_1404910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036781272.1|1405002_1405221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1405816_1406969_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016210508.1|1406978_1408676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036778516.1|1408996_1409545_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_075273576.1|1409672_1410401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1410460_1413958_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_016210514.1|1414015_1415269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210515.1|1415377_1416280_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210512.1|1416333_1417371_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210506.1|1417506_1418745_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210510.1|1418737_1419466_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_081007040.1|1419496_1420153_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211831.1|1420290_1422018_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|1422318_1422672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1423087_1423588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046962.1|1424239_1424686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|1424689_1425265_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	1446685	1490742	3146686	protease,tRNA,transposase	Klosneuvirus(22.22%)	39	NA	NA
WP_075273327.1|1446685_1447261_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210928.1|1447311_1447617_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_054300375.1|1447831_1448032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728346.1|1448838_1449171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047138.1|1449188_1449671_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047139.1|1449646_1450051_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047140.1|1450074_1450659_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1450604_1450970_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211651.1|1451203_1452739_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016211650.1|1452863_1454348_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211648.1|1455295_1455835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047141.1|1457038_1457245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075278621.1|1457433_1457775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126641.1|1457810_1460381_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_016209840.1|1460488_1460974_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_016209844.1|1461146_1462187_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209835.1|1462164_1462647_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_036777412.1|1462643_1465238_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209832.1|1465544_1465808_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209831.1|1466086_1466785_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|1467004_1467199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209827.1|1467274_1468834_-	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_129556633.1|1469152_1470049_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_054300271.1|1470157_1471132_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209845.1|1471371_1472847_-	APC family permease	NA	NA	NA	NA	NA
WP_016209826.1|1473369_1474392_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_036777393.1|1474722_1476090_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209846.1|1476325_1476580_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126639.1|1476595_1477882_+	GTPase HflX	NA	NA	NA	NA	NA
WP_016209836.1|1477901_1479116_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_016209838.1|1479115_1480009_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209839.1|1480206_1481505_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209829.1|1482884_1485284_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209834.1|1485280_1486039_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209842.1|1486215_1486605_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_054300373.1|1487332_1488190_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|1488186_1489161_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046721.1|1489332_1489500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1489680_1490742_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	1516803	1636539	3146686	protease,integrase,tRNA,transposase	Staphylococcus_phage(29.17%)	110	1530235:1530294	1643201:1643489
WP_036777656.1|1516803_1517583_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211286.1|1517600_1517948_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211289.1|1518059_1518332_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211767.1|1519948_1520758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047143.1|1521061_1521289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211764.1|1521596_1522418_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126803.1|1522618_1523851_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_032126790.1|1524084_1524990_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_032126804.1|1525149_1526025_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211806.1|1526189_1526915_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_081007037.1|1526957_1528496_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211804.1|1528502_1529888_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
1530235:1530294	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_054300271.1|1530270_1531245_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
1530235:1530294	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_155047144.1|1531689_1533015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|1533050_1534025_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016212498.1|1534778_1535462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273555.1|1535739_1536273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210332.1|1536403_1537147_-	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_016210330.1|1537244_1537628_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210333.1|1537831_1538461_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_036778577.1|1538534_1539818_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_016210326.1|1540157_1541456_+	ankyrin repeats family protein	NA	NA	NA	NA	NA
WP_016210325.1|1541609_1542986_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210321.1|1545656_1546625_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_129556511.1|1546821_1548258_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300568.1|1548440_1549151_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.3	4.1e-38
WP_054300366.1|1549171_1549585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210320.1|1549734_1550808_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_016210322.1|1550944_1551841_-	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016211334.1|1552458_1552647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211336.1|1552695_1553310_+	chorismate mutase	NA	NA	NA	NA	NA
WP_032126265.1|1553375_1554293_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_052104656.1|1554616_1555120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082827.1|1555196_1556498_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_016211330.1|1556672_1557773_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_032126267.1|1558120_1558363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300364.1|1558782_1559661_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075273553.1|1559834_1560761_+	MFS transporter	NA	NA	NA	NA	NA
WP_155047145.1|1560750_1561326_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300363.1|1561271_1561619_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047146.1|1561858_1562068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047262.1|1562010_1562127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212589.1|1562515_1562953_+	MFS transporter	NA	NA	NA	NA	NA
WP_129556637.1|1563427_1564207_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016210843.1|1564821_1565052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210844.1|1565138_1566266_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_155047263.1|1566480_1568187_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_032126340.1|1568267_1569029_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_155046965.1|1569308_1571765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1571916_1572690_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_148037535.1|1572748_1572955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1573095_1574070_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211148.1|1574274_1575603_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
1573060:1574161	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTTTCACTCACCTGGATATCATGCTCTCGTATAAGTTCCTGACTGATAACATCGGGGGATGTATGGGTGCTTAACCGTTGATGGATCAACATTTTTGCCTCCTCTGAAATTTGTCGAAAAGCTTGACCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCACAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAAGTGCTCTAGCAATTGATCTGAGCGAGTCTCCCTCTGATAACCGTTGTTCGATATAAAAACGATCTTTTTCATTTAAGTGCCGATAAACCATCTCTACCCTCTAAGTCAAAAGGCGAACTAGAGAGTTTATCTGTATGAATATGAACTCTCTACTGAGTGTTGCACTTCAGATGACGGAGGGC	NA	NA	NA	NA
WP_016211143.1|1575866_1576436_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
1573060:1574161	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTTTCACTCACCTGGATATCATGCTCTCGTATAAGTTCCTGACTGATAACATCGGGGGATGTATGGGTGCTTAACCGTTGATGGATCAACATTTTTGCCTCCTCTGAAATTTGTCGAAAAGCTTGACCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCACAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAAGTGCTCTAGCAATTGATCTGAGCGAGTCTCCCTCTGATAACCGTTGTTCGATATAAAAACGATCTTTTTCATTTAAGTGCCGATAAACCATCTCTACCCTCTAAGTCAAAAGGCGAACTAGAGAGTTTATCTGTATGAATATGAACTCTCTACTGAGTGTTGCACTTCAGATGACGGAGGGC	NA	NA	NA	NA
WP_016211151.1|1576451_1576763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1576772_1577729_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1577841_1578195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211153.1|1578198_1579263_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211145.1|1579263_1581003_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_036779218.1|1581009_1581432_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211144.1|1581415_1582045_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_054300271.1|1582601_1583576_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081377353.1|1583615_1584281_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300361.1|1584258_1584555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047147.1|1584708_1585683_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_155047148.1|1586212_1587250_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300359.1|1587608_1588181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664876.1|1588405_1590268_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_081377865.1|1590626_1590911_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556638.1|1592255_1592936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273551.1|1592935_1593238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211974.1|1593337_1594459_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_054300357.1|1594741_1595617_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212011.1|1595850_1596972_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_016212013.1|1597193_1597577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|1597592_1598270_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_075273474.1|1598313_1599288_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_155047149.1|1599311_1599527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047150.1|1599521_1600748_-	DUF4131 domain-containing protein	NA	NA	NA	NA	NA
WP_155047151.1|1600797_1601337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1601333_1602308_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047152.1|1602347_1603070_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211994.1|1603272_1603809_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_032126537.1|1603845_1604031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211991.1|1604271_1605177_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155047153.1|1606085_1607504_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_081007034.1|1607768_1608053_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_080728343.1|1608034_1608175_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_052104693.1|1608256_1612123_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_016211564.1|1612288_1613164_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211563.1|1613196_1613358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300355.1|1613568_1613754_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|1613743_1614319_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1614264_1614630_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047154.1|1614590_1614971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1615043_1616018_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047155.1|1616061_1616211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300354.1|1616156_1616675_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	42.9	1.3e-30
WP_054300353.1|1616821_1617049_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126690.1|1623091_1623574_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_016210112.1|1624267_1625695_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_122943012.1|1625811_1626267_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210108.1|1626452_1627718_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_016210114.1|1627810_1629070_+	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210107.1|1629141_1629414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210101.1|1629703_1631200_-	flagellin domain protein	NA	NA	NA	NA	NA
WP_016210113.1|1631622_1632672_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210110.1|1632859_1633615_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_036777611.1|1633675_1635265_-	APC family permease	NA	NA	NA	NA	NA
WP_016210106.1|1635447_1636539_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
1643201:1643489	attR	ACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
>prophage 20
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	1644481	1698437	3146686	tRNA,transposase	Staphylococcus_phage(20.0%)	49	NA	NA
WP_081007023.1|1644481_1645138_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211627.1|1645443_1645608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211632.1|1645833_1646688_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_054300351.1|1646723_1647545_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211631.1|1647800_1648607_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_155047156.1|1648865_1649489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047157.1|1649660_1650065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|1650129_1651282_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556521.1|1651233_1651422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046942.1|1651955_1652842_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046942.1|1653005_1653892_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300349.1|1654952_1656677_-	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_032126825.1|1657228_1658542_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_016211481.1|1658774_1659917_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_098082850.1|1659991_1660168_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_052104609.1|1660203_1660836_-	MarC family protein	NA	NA	NA	NA	NA
WP_032126823.1|1660946_1661669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047158.1|1661657_1663931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1664066_1664405_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1664364_1664820_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212267.1|1664986_1665346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1665626_1666274_+	LysE family translocator	NA	NA	NA	NA	NA
WP_155046730.1|1666541_1666682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1666900_1667962_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211733.1|1668576_1669401_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_155047159.1|1669456_1670848_-	protein kinase	NA	NA	NA	NA	NA
WP_016211732.1|1671269_1671968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144019306.1|1672331_1672511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047160.1|1672572_1672872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777261.1|1673006_1673750_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211403.1|1673763_1674807_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211405.1|1674942_1676715_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_129556522.1|1676921_1678154_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_054300271.1|1679464_1680439_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211669.1|1681263_1681614_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211666.1|1681768_1684588_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211664.1|1684960_1685689_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211555.1|1686225_1687584_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_032126677.1|1687658_1688222_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211557.1|1688416_1689646_-	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_016211554.1|1689691_1690318_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_032126678.1|1690644_1691655_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_054300346.1|1691665_1692541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1692687_1693770_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781387.1|1693887_1694160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|1694152_1694431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1694774_1695749_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1696303_1697365_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1697462_1698437_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 21
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	1727085	1762634	3146686	transposase	Staphylococcus_phage(50.0%)	34	NA	NA
WP_105962625.1|1727085_1727971_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300343.1|1727975_1728203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047161.1|1728238_1729210_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307341.1|1729903_1731502_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_016210848.1|1731668_1732853_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1733436_1733991_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210850.1|1734239_1735493_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210851.1|1735477_1736149_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210847.1|1736171_1737176_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210849.1|1737204_1738653_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210855.1|1738770_1739748_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300249.1|1739901_1740267_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047162.1|1740281_1740719_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1740738_1741713_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273543.1|1741752_1741995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776661.1|1742979_1743309_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_032126448.1|1743340_1743721_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211178.1|1743811_1744840_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016211180.1|1744902_1745367_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_032126449.1|1745387_1746311_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_081007029.1|1746377_1746986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776658.1|1747098_1749093_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211177.1|1749478_1750699_+	amino acid permease	NA	NA	NA	NA	NA
WP_155046970.1|1752123_1752372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047163.1|1752488_1752995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126783.1|1753105_1754347_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211741.1|1754492_1755269_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_075273313.1|1757328_1757667_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007028.1|1757626_1758082_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126602.1|1758234_1759542_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211857.1|1759792_1760671_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016211855.1|1760667_1761135_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|1761261_1761447_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_054300339.1|1761662_1762634_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.2e-25
>prophage 22
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	1768708	1830601	3146686	integrase,transposase	Staphylococcus_phage(14.29%)	55	1789142:1789201	1829617:1830031
WP_075273327.1|1768708_1769284_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1769229_1769595_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211352.1|1770061_1770502_+	universal stress protein	NA	NA	NA	NA	NA
WP_075273313.1|1770675_1771014_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007028.1|1770973_1771429_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1771844_1772819_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047264.1|1772858_1773218_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210801.1|1773540_1774512_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210795.1|1774493_1775465_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_052104738.1|1775570_1776377_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036777256.1|1776751_1776952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047164.1|1777374_1777797_-	response regulator	NA	NA	NA	NA	NA
WP_129556527.1|1778789_1779050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273540.1|1779234_1779846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036778182.1|1780212_1781040_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_155047165.1|1781246_1782812_+	amino acid permease	NA	NA	NA	NA	NA
WP_052047040.1|1782837_1783776_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046972.1|1784364_1784955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1786478_1786967_-	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_051307365.1|1786986_1787247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211834.1|1787504_1787819_+	hypothetical protein	NA	NA	NA	NA	NA
1789142:1789201	attL	GGTAACCCTCCCTTAAAATAGTACAAGTGATAAGTGGAATCTTCTGTTAAATTAACTTAG	NA	NA	NA	NA
WP_016212185.1|1791192_1792182_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1792515_1792701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1793384_1795340_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016210749.1|1795638_1796100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210752.1|1796269_1797067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556641.1|1799443_1800706_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_075273327.1|1802788_1803364_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1803309_1803675_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|1803827_1804100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211454.1|1805974_1806445_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_016211452.1|1807195_1808683_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211455.1|1808744_1810202_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_122942091.1|1810307_1810703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1810730_1811309_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_155047166.1|1811930_1812992_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047167.1|1813041_1814559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300328.1|1814669_1815446_+	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_016212459.1|1815583_1815964_-	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_155046975.1|1816083_1816533_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_054300326.1|1816946_1817411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1817512_1817785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273534.1|1817978_1818860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1820491_1821085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300322.1|1821472_1823407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047168.1|1823445_1824366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1824875_1825451_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1825396_1825762_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212534.1|1826889_1827156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047169.1|1827568_1828177_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_155047170.1|1828211_1828493_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047171.1|1828697_1829261_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	39.9	3.2e-30
WP_016212445.1|1829335_1829602_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1829847_1830303_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1829617:1830031	attR	CTAAGTTAATTTAACAGAAGATTCCACTTATCACTTGTACTATTTTAAGGGAGGGTTACCTCAGCCCCAAATTTATATATCATTCGAATGATTTTTATCATAATGAAGTACAATCAACACTGTTAATAATGTTGCACATAATGTAAATAATAACCAGCCCAAATACATCATTTTTAACTCTTTGCCTCACGTGTCATAAAATAAATACACTAATTAGGCTCCGTTGACATTTCACCTTAACCATAAGATAGTGCTTGCAATTTTCAAAAAGGATAAATATCTGCAAGCCCTTTTTTCAAAACGTGAAAAAACTCTTCTAAATTGTTTTAACTTGCCAATGCAGCACTCTATCAAATGCCTTTCCTTGTAAACATGCTGATCGTGGTCAAATTTATTAATCCTATTTGATTTAGAA	NA	NA	NA	NA
WP_075273313.1|1830262_1830601_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	1834924	1901482	3146686	tRNA,transposase	Bacillus_thuringiensis_phage(33.33%)	53	NA	NA
WP_032126540.1|1834924_1835788_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212346.1|1836021_1836168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300321.1|1836962_1837334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300320.1|1837551_1838151_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047172.1|1839296_1840322_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047087.1|1840493_1840712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122942160.1|1840872_1841853_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211465.1|1842480_1843464_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211464.1|1843614_1843962_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_032126752.1|1843958_1844561_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211466.1|1844648_1846169_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126753.1|1846238_1846703_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016212485.1|1847491_1848025_+	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_155046976.1|1848321_1848459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007073.1|1848524_1848695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777066.1|1848677_1851734_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209619.1|1851820_1853269_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209621.1|1853701_1854706_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209617.1|1854826_1855225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209627.1|1855264_1857088_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_033923701.1|1857084_1860387_+	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209616.1|1860417_1861332_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016209618.1|1861402_1862032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|1862076_1862511_-	lipoprotein	NA	NA	NA	NA	NA
WP_016209630.1|1862491_1863232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|1863245_1864643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|1864645_1867594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|1867593_1869315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209636.1|1869329_1869734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777070.1|1869734_1872608_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075273639.1|1872610_1873327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|1873694_1875587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777073.1|1875618_1878156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274867.1|1878187_1879360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209624.1|1879356_1879968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209623.1|1879989_1881489_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209615.1|1881505_1882012_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_155047173.1|1883364_1883574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047174.1|1883629_1884274_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.4	1.1e-39
WP_155047175.1|1885182_1886505_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_054300384.1|1886913_1887729_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032126786.1|1888027_1891108_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016211319.1|1891125_1892178_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211316.1|1892710_1893361_+	porin family protein	NA	NA	NA	NA	NA
WP_016211315.1|1893695_1894340_+	porin family protein	NA	NA	NA	NA	NA
WP_054300314.1|1894527_1894863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273532.1|1894823_1895411_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126997.1|1895628_1895868_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_032126998.1|1896189_1896537_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_036774554.1|1896635_1896914_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1896966_1897254_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_129556490.1|1897257_1898144_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923708.1|1900606_1901482_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	1921053	1979235	3146686	transposase	Escherichia_phage(33.33%)	60	NA	NA
WP_155047178.1|1921053_1921782_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.5e-43
WP_155047179.1|1921850_1922195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211983.1|1922442_1923102_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556643.1|1923197_1924562_+	histidine kinase	NA	NA	NA	NA	NA
WP_016212551.1|1925019_1925514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211946.1|1926869_1927625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556540.1|1927843_1928239_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211947.1|1928231_1929377_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_033923708.1|1929491_1930367_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036776195.1|1930778_1932026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047180.1|1932668_1932872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300304.1|1932924_1933203_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209473.1|1933275_1933659_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_016209489.1|1933655_1934387_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_016209497.1|1934389_1935133_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_016209492.1|1935146_1936046_-	GTPase Era	NA	NA	NA	NA	NA
WP_016209466.1|1936051_1936726_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	34.5	8.9e-27
WP_129556644.1|1937131_1938019_-	signal peptidase I	NA	NA	NA	NA	NA
WP_016209482.1|1938069_1939872_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	39.2	5.1e-21
WP_016209457.1|1940171_1940753_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_036776203.1|1940896_1942471_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_155047181.1|1942478_1942820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209486.1|1942917_1943169_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_080664819.1|1943210_1944248_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_016209471.1|1944394_1944721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209462.1|1944730_1944874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209474.1|1944883_1945294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664818.1|1945435_1945771_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_155047182.1|1946452_1948483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209467.1|1948552_1949578_-	FUSC family protein	NA	NA	NA	NA	NA
WP_016209455.1|1949570_1950617_-	membrane protein	NA	NA	NA	NA	NA
WP_036776209.1|1950767_1951763_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_016209459.1|1952022_1953189_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016209478.1|1953352_1954306_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036776213.1|1954328_1956347_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_016209490.1|1956437_1956761_-	YqcC family protein	NA	NA	NA	NA	NA
WP_016209463.1|1957187_1957571_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032126730.1|1957925_1958414_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_016209472.1|1958516_1959887_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_016209456.1|1960000_1960732_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	M1IDP9	Pelagibacter_phage	35.8	5.3e-09
WP_016209491.1|1960756_1961854_-	alanine racemase	NA	NA	NA	NA	NA
WP_016209475.1|1961886_1963308_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	1.7e-152
WP_016209484.1|1963517_1963970_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|1963981_1964209_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_016209481.1|1964258_1964585_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_052104552.1|1964787_1965477_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016209488.1|1965626_1966115_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_129556542.1|1966155_1967259_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_016209460.1|1967302_1968385_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.1	1.0e-72
WP_075274651.1|1968374_1968941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007071.1|1968931_1970287_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209485.1|1970288_1971311_-	chorismate mutase	NA	NA	NA	NA	NA
WP_155047183.1|1971335_1972109_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209496.1|1972138_1972351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047184.1|1972756_1973776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047185.1|1973875_1974761_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047186.1|1974765_1975995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|1976024_1976888_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046981.1|1977886_1978063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300299.1|1978152_1979235_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	1983142	2052295	3146686	transposase	Bacillus_phage(30.0%)	59	NA	NA
WP_075273524.1|1983142_1984108_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047187.1|1984148_1985123_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_098082828.1|1985486_1985744_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1985743_1986751_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212247.1|1987117_1987873_+	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1988500_1989475_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300162.1|1989814_1990897_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212246.1|1991000_1991657_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300297.1|1992592_1993660_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1993722_1994805_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210771.1|1994896_1998298_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_016210773.1|1998294_2000988_-	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210769.1|2001291_2002794_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_033923762.1|2003094_2003328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|2003455_2004265_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_016210772.1|2004348_2005902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210397.1|2007110_2009285_+	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210388.1|2009281_2009956_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210399.1|2009981_2011973_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210390.1|2011987_2012329_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_032126670.1|2012333_2012771_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210394.1|2012796_2014182_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_122940572.1|2014292_2014718_-	flaG family protein	NA	NA	NA	NA	NA
WP_032126669.1|2014829_2016407_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210398.1|2016631_2018224_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210393.1|2018712_2020914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778065.1|2021007_2022441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|2022483_2022999_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211169.1|2022998_2023946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211168.1|2023929_2024589_-	wbqC-like family protein	NA	NA	NA	NA	NA
WP_036778066.1|2024585_2025314_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307350.1|2025303_2026050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664856.1|2026033_2027098_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_016211172.1|2027286_2028483_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_036778145.1|2028532_2029654_-	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	8.7e-11
WP_036781047.1|2030266_2031124_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_129556646.1|2032441_2033827_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_016211278.1|2033878_2035138_-	threonine synthase	NA	NA	NA	NA	NA
WP_016211277.1|2035124_2036093_-	homoserine kinase	NA	NA	NA	NA	NA
WP_016211279.1|2036106_2038575_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_054300294.1|2039318_2040380_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300293.1|2040651_2041017_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047188.1|2041073_2041238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|2041227_2041401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|2041373_2041526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300292.1|2041981_2042983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779544.1|2043237_2044245_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|2044244_2044502_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007015.1|2044713_2045139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300290.1|2045240_2045498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2045631_2046784_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047265.1|2046793_2047387_-	reverse transcriptase	NA	A0A0N7AE80	Bacillus_phage	28.9	4.0e-07
WP_155047189.1|2047676_2047850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2047909_2048485_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2048430_2048796_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047175.1|2049326_2050649_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.3e-12
WP_054300287.1|2051057_2051387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2051408_2051774_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556556.1|2051719_2052295_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	2118130	2173018	3146686	protease,tRNA,transposase	Orpheovirus(16.67%)	56	NA	NA
WP_016209434.1|2118130_2119552_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_129556553.1|2119641_2121234_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_016209439.1|2121397_2122024_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_054300277.1|2122104_2124786_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_016209445.1|2125268_2126225_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_016209435.1|2126325_2126697_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_016209404.1|2126723_2127587_+	chemotaxis phosphatase CheX family protein	NA	NA	NA	NA	NA
WP_155047194.1|2127576_2128335_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_036776598.1|2128623_2129109_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_016209443.1|2129183_2129705_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016209405.1|2129750_2130644_-	cheW-like domain protein	NA	NA	NA	NA	NA
WP_016209406.1|2130640_2131462_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.2	5.0e-16
WP_016209408.1|2131776_2131947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209427.1|2132100_2133504_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_052047073.1|2133597_2134848_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080664816.1|2134834_2135566_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_016209424.1|2135577_2136855_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209433.1|2136954_2137329_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209412.1|2137413_2138301_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209436.1|2138358_2139087_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_129556555.1|2139083_2140214_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209444.1|2140344_2140773_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_032126508.1|2140867_2141227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036776605.1|2141216_2142428_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016209421.1|2142424_2143213_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209411.1|2143375_2144170_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_054300271.1|2144375_2145350_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126933.1|2145518_2146820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2146823_2147123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2147112_2147277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2147333_2147699_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211553.1|2148038_2148779_-	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_016211549.1|2148782_2151287_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211548.1|2151549_2152506_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211550.1|2152489_2153251_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_054300275.1|2153328_2154204_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2154328_2154574_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016211262.1|2154633_2156907_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_075273504.1|2156961_2157315_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|2157504_2157798_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_032126515.1|2157970_2158150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307354.1|2158225_2158801_-	DedA family protein	NA	NA	NA	NA	NA
WP_032126514.1|2159083_2160400_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2160410_2160779_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016211265.1|2160809_2161472_-	adenylate kinase	NA	NA	NA	NA	NA
WP_032126362.1|2161646_2162012_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2161957_2162533_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126519.1|2162700_2163420_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_016211478.1|2163399_2164215_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126518.1|2164231_2166433_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211474.1|2166515_2167865_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_016211473.1|2167939_2168539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211476.1|2168522_2168732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777061.1|2169049_2170237_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211932.1|2170432_2171722_+	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_129556478.1|2172132_2173018_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	2185557	2229525	3146686	tRNA,transposase	Moraxella_phage(14.29%)	43	NA	NA
WP_054300268.1|2185557_2186619_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776407.1|2186867_2188004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211446.1|2188187_2189915_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_016211448.1|2189904_2191113_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211450.1|2191211_2192234_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155047009.1|2193009_2193183_+	phosphatase	NA	NA	NA	NA	NA
WP_052104774.1|2193327_2193960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556557.1|2194007_2194319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047067.1|2194463_2195357_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126170.1|2195520_2195793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211040.1|2196020_2197232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211037.1|2197582_2198212_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211042.1|2198260_2199277_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211035.1|2199523_2199739_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211043.1|2199791_2200241_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_036779409.1|2200320_2202066_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211036.1|2202157_2204029_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_054300271.1|2204376_2205351_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273494.1|2205370_2205931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|2206995_2209476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047195.1|2209550_2210453_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_033923708.1|2210465_2211341_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210899.1|2211950_2213834_-	APC family permease	NA	NA	NA	NA	NA
WP_016210896.1|2213887_2214970_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210904.1|2215012_2215663_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210903.1|2215884_2216256_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_129556487.1|2216374_2217712_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_054300270.1|2217790_2218768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210894.1|2219108_2219411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|2219885_2220176_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210898.1|2220264_2220615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2220871_2221600_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047196.1|2221670_2222252_+	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_054300269.1|2222396_2222765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2222786_2223152_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2223208_2223373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007012.1|2223362_2223533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|2223527_2224589_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273492.1|2224697_2224817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556486.1|2224907_2225255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779112.1|2225340_2226777_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211781.1|2226999_2228247_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_054300173.1|2228463_2229525_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	2250066	2296286	3146686	integrase,transposase	Staphylococcus_phage(26.67%)	50	2274091:2274150	2299915:2301017
WP_105962625.1|2250066_2250953_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2251336_2251675_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|2251634_2251895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047198.1|2252039_2252207_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300263.1|2252194_2252635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|2252706_2253681_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016212461.1|2254056_2254431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2254434_2255010_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2254955_2255321_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300262.1|2255783_2256074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104721.1|2256065_2257772_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_051307331.1|2257843_2259622_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_036779374.1|2259976_2260543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210553.1|2260667_2261321_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_155047199.1|2261347_2262790_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210545.1|2262886_2263864_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_129556482.1|2264012_2264618_+	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_026063577.1|2264689_2264983_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556629.1|2265209_2265956_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_017376905.1|2266186_2266414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|2266478_2266661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|2267097_2267652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046716.1|2268349_2268496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046984.1|2268917_2270036_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047108.1|2270847_2271246_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047200.1|2271330_2271906_-	DNA polymerase	NA	NA	NA	NA	NA
WP_032126362.1|2272023_2272389_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2272334_2272910_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211578.1|2272979_2273324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|2273339_2273534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|2273600_2273954_-	hypothetical protein	NA	NA	NA	NA	NA
2274091:2274150	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_054300271.1|2274126_2275101_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047201.1|2275176_2275938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211585.1|2275999_2276557_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_075273486.1|2276791_2277766_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.2e-29
WP_054300257.1|2277742_2278552_-	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.6	1.8e-29
WP_054300271.1|2278756_2279731_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211583.1|2279935_2280844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211579.1|2280911_2281397_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155047202.1|2281901_2282966_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.2	4.7e-139
WP_036781361.1|2283248_2283638_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_155047203.1|2283657_2284719_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212302.1|2285019_2285319_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_081007067.1|2285539_2291014_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_036780532.1|2291525_2292566_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_054300162.1|2292643_2293726_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781387.1|2293843_2294116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|2294108_2294387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2294730_2295705_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047204.1|2295728_2296286_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0V4T7	Roseobacter_phage	33.3	8.4e-15
2299915:2301017	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTTTCACTCACCTGGATATCATGCTCTCGTATAAGTTCCTGACTGATAACATCGGGGGATGTATGGGTGCTTAACCGTTGATGGATCAACATTTTTGCCTCCTCTGAAATTTGTCGAAAAGCTTGACCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCACAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAAGTGCTCTAGCAATTGATCTGAGCGAGTCTCCCTCTGATAACCGTTGTTCGATATAAAAACGATCTTTTTCATTTAAGTGCCGATAAACCATCTCTACCCTCTAAGTCAAAAGGCGAACTAGAGAGTTTATCTGTATGAATATGAACTCTCTACTGAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
>prophage 29
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	2299950	2363481	3146686	protease,transposase	Staphylococcus_phage(37.5%)	53	NA	NA
WP_054300271.1|2299950_2300925_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211528.1|2301484_2301790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664862.1|2301770_2302469_-	P-loop NTPase	NA	NA	NA	NA	NA
WP_075273327.1|2303642_2304218_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2304163_2304529_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047205.1|2305016_2305238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212436.1|2305412_2305823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|2306161_2307047_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923634.1|2307037_2307586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126157.1|2307790_2308195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|2308481_2310374_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_036780074.1|2310716_2311523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307360.1|2312614_2313544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2313660_2314566_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275067.1|2315628_2316696_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_059372266.1|2317028_2317514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776625.1|2317603_2319118_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209659.1|2319244_2320273_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_016209654.1|2320337_2321480_+	galactokinase	NA	NA	NA	NA	NA
WP_016209656.1|2321598_2323302_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209642.1|2323298_2325419_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209652.1|2325415_2326765_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209662.1|2326736_2328884_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209657.1|2329311_2329707_+	CrcB family protein	NA	NA	NA	NA	NA
WP_016209643.1|2329715_2330600_-	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_075273480.1|2330631_2332530_-	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209655.1|2332612_2332885_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_032126161.1|2332988_2335421_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209663.1|2335488_2336790_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_016209647.1|2336871_2337477_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209645.1|2337589_2338894_-	trigger factor	NA	NA	NA	NA	NA
WP_016209661.1|2339497_2340373_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_075273478.1|2340488_2341160_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209658.1|2341336_2342692_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_016209641.1|2342812_2343550_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032126159.1|2343629_2344343_-	aldolase	NA	NA	NA	NA	NA
WP_016209651.1|2344988_2346263_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2346293_2346869_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209649.1|2346913_2347879_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209640.1|2348337_2349357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300250.1|2349775_2350435_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_054300271.1|2350517_2351492_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047206.1|2351527_2352037_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|2352051_2352417_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046989.1|2352907_2353972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2354204_2355179_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046989.1|2355271_2356336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2356568_2357543_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047207.1|2357652_2358726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211684.1|2359270_2359846_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016211685.1|2359869_2361675_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211687.1|2361705_2362350_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_033923708.1|2362605_2363481_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	2380162	2428093	3146686	tRNA,transposase	Staphylococcus_phage(42.86%)	37	NA	NA
WP_054300237.1|2380162_2381224_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210741.1|2381909_2382233_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_016210746.1|2382239_2386136_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_054300242.1|2386181_2386718_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210743.1|2386758_2388339_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210739.1|2388407_2389865_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_054300241.1|2390020_2391997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|2392315_2392936_-	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_016210742.1|2393101_2393377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2393527_2394502_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047208.1|2394521_2395994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2396296_2397271_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300240.1|2397570_2397774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|2398030_2398915_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036777316.1|2399224_2399638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211818.1|2399994_2401251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|2401453_2401954_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211819.1|2402250_2402481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047209.1|2402699_2403254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|2403603_2404489_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|2404604_2405666_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2405692_2406268_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2406213_2406579_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047266.1|2407294_2407726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2408833_2409720_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047210.1|2409781_2410144_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273456.1|2410103_2410403_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2410525_2411500_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209398.1|2412058_2413285_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|2413883_2415590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007011.1|2415757_2416978_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209395.1|2417226_2419917_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_016209384.1|2420208_2421024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047211.1|2421374_2422316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047212.1|2422857_2424501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209368.1|2425076_2426606_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_016209374.1|2426641_2428093_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 31
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	2463516	2505698	3146686	protease,tRNA,transposase	Prochlorococcus_phage(50.0%)	42	NA	NA
WP_075273327.1|2463516_2464092_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2464037_2464403_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047215.1|2465308_2466562_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_054300237.1|2466539_2467601_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210612.1|2468886_2470137_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016210605.1|2470125_2471007_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210611.1|2470999_2472085_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210607.1|2472081_2473341_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_036778813.1|2473509_2474169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556471.1|2474310_2474982_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210609.1|2475341_2476277_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_016210606.1|2476373_2477000_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210603.1|2477005_2477587_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210601.1|2477658_2478750_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210599.1|2478832_2479546_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_122940948.1|2479639_2480344_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300148.1|2480666_2481728_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126800.1|2481852_2482587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046954.1|2482813_2482987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|2483093_2483513_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|2484475_2484721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|2485020_2485906_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300223.1|2486143_2487115_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_075273327.1|2487209_2487785_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2487730_2488096_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209900.1|2488553_2490023_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209924.1|2490016_2491393_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209906.1|2491404_2491797_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209919.1|2491793_2492897_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_032126654.1|2493075_2494377_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209907.1|2494384_2495332_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_016209913.1|2495343_2496162_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_032126655.1|2496164_2496965_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209910.1|2496958_2498017_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_016209903.1|2498013_2499024_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|2499030_2499228_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_155047216.1|2499288_2502195_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209918.1|2502236_2503091_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_032126652.1|2503123_2503690_-	chorismate lyase	NA	NA	NA	NA	NA
WP_016209915.1|2503772_2504633_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016209922.1|2504724_2505141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300221.1|2505200_2505698_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
>prophage 32
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	2512632	2559057	3146686	transposase	Escherichia_phage(16.67%)	51	NA	NA
WP_075273327.1|2512632_2513208_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212369.1|2513211_2513658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212599.1|2514892_2515102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047217.1|2515151_2516213_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2516287_2517193_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2517957_2518296_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2518255_2518711_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_036780649.1|2518821_2519808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126181.1|2519823_2520444_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_016210401.1|2520564_2521617_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_016210400.1|2521613_2522462_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210403.1|2522493_2523717_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210413.1|2523791_2524034_-	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210415.1|2524122_2524860_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210406.1|2524887_2525832_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210405.1|2525885_2526836_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210402.1|2526842_2527892_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210404.1|2527950_2528124_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_075273448.1|2528141_2528672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210411.1|2528913_2529555_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_016210409.1|2529717_2531547_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210408.1|2531714_2532587_+	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_155047218.1|2532578_2534747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273445.1|2535019_2535277_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_016209511.1|2535362_2536046_-	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_016209508.1|2536096_2536987_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016209527.1|2537048_2537807_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209518.1|2537809_2539078_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209505.1|2539154_2539406_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209517.1|2539439_2539787_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209507.1|2539790_2540444_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209535.1|2540466_2540931_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_036780687.1|2540927_2541695_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209539.1|2541698_2542499_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_016209498.1|2542638_2543619_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209499.1|2543624_2544182_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_129556465.1|2544168_2544741_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209538.1|2544737_2545469_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_016209519.1|2545624_2547016_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209537.1|2547040_2547352_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209512.1|2547708_2548563_+	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209502.1|2548563_2549166_-	signal peptidase I	NA	NA	NA	NA	NA
WP_016209504.1|2549241_2550081_-	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209530.1|2550261_2550906_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209534.1|2550922_2551309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047219.1|2552421_2553150_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032127022.1|2553826_2556013_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2556074_2557228_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2557513_2558038_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|2558228_2558396_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|2558340_2559057_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
>prophage 33
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	2574398	2603740	3146686	integrase,tRNA,protease,transposase	Acinetobacter_phage(12.5%)	27	2571787:2571846	2589627:2589915
2571787:2571846	attL	ACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTT	NA	NA	NA	NA
WP_155047267.1|2574398_2574608_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007057.1|2575935_2576352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|2576409_2577562_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016212230.1|2577618_2579067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2580600_2580789_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046946.1|2582190_2582466_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2582468_2583071_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_016212522.1|2583167_2583422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|2583966_2585046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780431.1|2585364_2587083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2587126_2588032_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155047220.1|2588505_2588658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047221.1|2589049_2589529_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	42.0	1.7e-11
WP_155047222.1|2589637_2590312_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.8	2.2e-09
2589627:2589915	attR	AAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTT	NA	NA	NA	NA
WP_155047223.1|2590355_2590601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2591231_2591807_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_036778086.1|2591882_2592758_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_052104629.1|2593158_2594184_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047224.1|2594327_2594804_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778088.1|2594788_2595871_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.0e-20
WP_036777829.1|2596111_2596516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047225.1|2596850_2597048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2597228_2597960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2598477_2599539_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210066.1|2600814_2601483_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2601926_2602523_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2602543_2603740_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
>prophage 34
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	2632956	2685409	3146686	tRNA,transposase	Microbacterium_phage(12.5%)	57	NA	NA
WP_054300282.1|2632956_2633421_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047228.1|2633477_2633960_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2634814_2635210_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|2635206_2636001_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_036778479.1|2636179_2636905_-	D-Ala-D-Ala dipeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2637150_2638338_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016210935.1|2638914_2639457_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2639453_2640140_-	acireductone synthase	NA	NA	NA	NA	NA
WP_036778484.1|2640143_2640755_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2640801_2641821_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2641922_2642717_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2642754_2643561_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2643639_2644689_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2644886_2646146_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2646192_2646870_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2646955_2647237_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|2647328_2648516_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_016210820.1|2648752_2649694_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2650197_2650422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2650713_2651418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|2651881_2652520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2652854_2653385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779158.1|2653381_2654914_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2654910_2655861_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2656281_2656914_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2657156_2657354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2657728_2658094_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2658150_2658315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2658304_2658604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2658651_2659080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300194.1|2659157_2659856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2659833_2660895_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2661119_2661416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|2661520_2662177_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2662400_2662898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047229.1|2664107_2664569_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2664528_2664867_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036778253.1|2664924_2666463_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_098082804.1|2666574_2667673_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|2667910_2669110_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|2669139_2669778_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|2669793_2671977_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|2672214_2672559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|2673604_2673811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|2673975_2674434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|2675021_2676149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2676272_2676935_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2677026_2677272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2678345_2679005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2679106_2679757_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|2679869_2680190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2680248_2681223_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2681473_2681695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047230.1|2681983_2682406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047231.1|2682406_2682940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300190.1|2683434_2684397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046995.1|2684523_2685409_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	2746288	2804321	3146686	protease,tRNA,transposase	Staphylococcus_phage(37.5%)	57	NA	NA
WP_054300271.1|2746288_2747263_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047235.1|2747282_2748269_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2748359_2749106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275004.1|2749230_2750094_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2750337_2750700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273422.1|2750886_2751414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2751558_2751975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2754071_2754983_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2755034_2755883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2756327_2757038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2757129_2758098_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2758085_2758733_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036779767.1|2758761_2759613_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2759627_2760905_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2760945_2761461_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_054300183.1|2761539_2762601_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2762622_2763711_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_036777788.1|2763755_2765591_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2765633_2766104_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2766140_2766476_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2766488_2767205_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2767141_2768158_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2768154_2768634_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2768717_2771198_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2771260_2771626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2771964_2772303_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2772262_2772718_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2772732_2773023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777784.1|2773088_2774687_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2774817_2775153_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777781.1|2775180_2776845_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210581.1|2776841_2777486_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2777485_2778229_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2778287_2778527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2778677_2780045_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2780055_2780607_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2780687_2781671_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2781792_2783550_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2783772_2784363_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2784451_2784871_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_075273416.1|2785011_2785626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2785686_2786472_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075273313.1|2786725_2787064_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007003.1|2787023_2787485_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2787857_2788832_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212084.1|2789113_2790130_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2790129_2790645_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2790686_2791160_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_155047236.1|2791215_2791758_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2791781_2792237_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_155046996.1|2794010_2796524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046997.1|2797458_2799981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2800555_2801617_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2801643_2802219_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2802164_2802530_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046755.1|2802601_2802778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2803168_2804321_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 36
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	2929181	2993309	3146686	transposase	Staphylococcus_phage(16.67%)	54	NA	NA
WP_054300271.1|2929181_2930156_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211161.1|2930738_2931848_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2931859_2932504_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2932522_2933509_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2933588_2934665_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2934867_2935692_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2936008_2937013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2937221_2938187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047242.1|2938325_2939201_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2939497_2940550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2940817_2941246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2941459_2941951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2942006_2943257_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2943359_2943578_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_036777591.1|2944035_2944890_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016210728.1|2944944_2945415_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2945798_2947178_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2947205_2947664_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2947641_2948859_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2949050_2949287_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2949300_2949456_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2949536_2950499_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2950658_2951975_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2951984_2952653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2953015_2954830_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_054300166.1|2954947_2955736_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211543.1|2956316_2958068_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|2958078_2958879_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|2958981_2959470_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_032126435.1|2959643_2959958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375799.1|2960978_2961323_+	DMT family protein	NA	NA	NA	NA	NA
WP_016210038.1|2967016_2967979_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_155047243.1|2968165_2969425_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|2969648_2969975_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|2970169_2971120_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|2971177_2973244_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|2973249_2974245_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|2974830_2976411_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|2976567_2977977_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|2978036_2979170_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|2979309_2980134_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|2980361_2980991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|2981327_2981699_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|2982002_2982290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|2982441_2983290_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|2983417_2984458_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_155047244.1|2984530_2986468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|2986751_2987411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2987565_2988540_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2988615_2989635_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047000.1|2989682_2989829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556602.1|2990033_2990243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|2991117_2992200_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_054300161.1|2992247_2993309_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP038893	Piscirickettsia salmonis strain Psal-006a chromosome, complete genome	3146686	3001194	3115114	3146686	tRNA,transposase	Staphylococcus_phage(33.33%)	113	NA	NA
WP_155047053.1|3001194_3002080_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212222.1|3002556_3003030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|3003026_3003422_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3004351_3004927_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3004872_3005238_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036778680.1|3005502_3007833_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_129556603.1|3007953_3009969_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300160.1|3010152_3013545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3013609_3013915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|3014105_3014285_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_155047245.1|3014288_3014477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|3014500_3015475_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	1.8e-28
WP_032126362.1|3015732_3016098_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047247.1|3016161_3016530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|3016533_3017420_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047248.1|3017483_3018170_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047249.1|3018422_3019523_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|3019917_3021027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|3022069_3022435_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047002.1|3022449_3023055_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036776867.1|3023425_3024823_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_051307313.1|3024942_3025890_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3025886_3026402_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3026388_3027588_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3027584_3027908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3027909_3029139_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3029138_3030182_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3030181_3030865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3030861_3033351_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3033367_3033622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3033622_3033979_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3034758_3035922_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3035941_3039049_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3039050_3040556_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3040583_3040865_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3041013_3041355_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3041474_3043355_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3043439_3045038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3045055_3046171_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3046298_3047297_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_052104582.1|3047300_3048059_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3048060_3049260_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3049243_3049915_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3049936_3050713_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3050716_3051715_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3051716_3052295_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3052291_3053761_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3053804_3054092_-	trp operon repressor	NA	NA	NA	NA	NA
WP_155047250.1|3054292_3054889_+	EamA family transporter	NA	NA	NA	NA	NA
WP_054300152.1|3054915_3055281_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3055337_3055493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273401.1|3055637_3056090_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047251.1|3056127_3056352_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155047003.1|3057947_3058833_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3059019_3059241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047252.1|3059356_3059935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047253.1|3060079_3060274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3060332_3061307_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|3061360_3062422_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776841.1|3063149_3063689_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3063773_3064310_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3064961_3065264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3065713_3066022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|3066630_3067080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3067362_3068073_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3068299_3068698_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_036778156.1|3069565_3070516_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3070515_3072594_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3072741_3073257_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3073265_3073829_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3073809_3074556_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3074695_3075148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3075571_3076408_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3076404_3077301_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3077333_3078401_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3078419_3078788_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3078813_3080262_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3080271_3081651_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3081691_3083023_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3082994_3083954_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3084046_3084550_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3084684_3085836_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3085832_3086312_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3086458_3088780_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3088724_3089351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3089355_3090255_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3090327_3090906_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3091206_3091464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556718.1|3091472_3092659_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_155046758.1|3093473_3093605_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3093749_3093905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777721.1|3094232_3095006_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155047254.1|3095942_3096080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3096123_3097098_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3098192_3098531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007065.1|3098547_3099387_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_081007013.1|3099599_3099899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3099888_3100053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3100109_3100475_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3101779_3102475_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3102471_3103899_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3103924_3104188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3104260_3105235_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047005.1|3105293_3106144_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3106181_3106526_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3106522_3107359_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3107359_3107701_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3107702_3108308_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3108304_3110299_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3110318_3111260_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052104719.1|3111487_3112912_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3113424_3114399_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3114457_3115114_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038894	Piscirickettsia salmonis strain Psal-006a plasmid unnamed1, complete sequence	188128	2012	101285	188128	transposase,integrase,head,capsid,protease,tail	Indivirus(15.79%)	114	NA	NA
WP_105962625.1|2012_2898_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.7	4.5e-10
WP_016212151.1|3500_4463_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|4486_4801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|4864_5839_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_033923686.1|5962_7012_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|7120_8161_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|8174_8804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|8894_9194_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_081377909.1|9190_9655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104769.1|10616_11540_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_105962623.1|12684_13837_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274741.1|13906_14164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273822.1|14265_14766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|15210_16293_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212255.1|16479_16650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|16646_16850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|17186_17411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212260.1|17430_17703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|17860_18835_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_129556717.1|19489_20716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|21041_21878_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_016212398.1|22140_22602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047268.1|22768_23149_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|24237_24603_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|24548_25124_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_105962623.1|26107_27261_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273810.1|27281_27989_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	34.2	1.4e-11
WP_081007042.1|30148_30964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728342.1|31278_31782_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_105962174.1|31925_32090_+	phosphatase	NA	NA	NA	NA	NA
WP_155047269.1|32238_32634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273806.1|32895_33459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|33564_34020_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_075273804.1|33979_34318_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|34402_35131_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_016212413.1|35464_35893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|35940_36681_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_075273798.1|37081_37306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|37414_37939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047270.1|38059_38206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047297.1|38350_38497_-	phosphatase	NA	NA	NA	NA	NA
WP_032126138.1|39705_39969_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211871.1|40534_40870_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_129556699.1|40863_41064_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300590.1|41371_41596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|42212_43238_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273790.1|43782_44085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|44074_44701_-	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_016212412.1|45001_45166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|45158_45608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|45855_46029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212499.1|46233_46608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|47606_48759_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_075273786.1|48768_49167_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211913.1|49599_50721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|51046_51319_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|51322_51583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211912.1|51855_52446_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_129556698.1|52535_53237_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_054300249.1|53350_53716_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|53730_54237_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	1.0e-06
WP_155047271.1|54240_55358_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	3.6e-57
WP_051307374.1|55472_55949_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_016212298.1|56189_56516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|57182_58208_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047272.1|58417_59146_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_054300594.1|59508_60534_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047273.1|60664_60802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046942.1|60940_61827_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.8	2.6e-10
WP_155047274.1|61911_62118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|62457_63273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211897.1|63666_64071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|64071_64818_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211895.1|65326_66385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126360.1|66507_67242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211773.1|67828_68503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|68604_68973_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211776.1|69140_70478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556697.1|70960_71353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|71737_72643_-|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_016210664.1|72940_73363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210651.1|73362_73713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210658.1|73709_74105_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210667.1|74097_74421_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210663.1|74417_74729_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210655.1|75047_75644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556716.1|75657_75948_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_052047108.1|76081_76480_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047275.1|76535_77033_-	DNA polymerase	NA	NA	NA	NA	NA
WP_155047276.1|77029_77809_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	31.7	1.8e-18
WP_129556718.1|77837_79023_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_081377350.1|79556_80372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047277.1|80436_81045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211936.1|81779_82802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047278.1|83291_83693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|83810_84836_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|85410_85572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|85571_86072_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273747.1|86333_86924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|86986_87280_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155047279.1|87362_87932_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	3.8e-47
WP_105962625.1|87928_88815_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.7	4.5e-10
WP_155047280.1|88876_89065_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_052104629.1|89314_90340_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047281.1|90566_90896_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.8	5.5e-06
WP_155047018.1|90963_91767_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.9e-55
WP_075274752.1|91802_92102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|92098_92674_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|92619_92985_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|93889_95932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|96701_96902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|97042_98017_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.0	1.9e-25
WP_016212579.1|99513_99711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|100310_101285_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
>prophage 2
NZ_CP038894	Piscirickettsia salmonis strain Psal-006a plasmid unnamed1, complete sequence	188128	105340	171385	188128	integrase,transposase	Streptococcus_phage(28.0%)	59	119494:119553	171386:172630
WP_075273857.1|105340_106075_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	8.4e-39
WP_155047282.1|106228_106705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556709.1|106779_106869_-	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_052047129.1|107080_108664_-	protein kinase	NA	NA	NA	NA	NA
WP_075274745.1|108946_109675_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_016212365.1|110387_110630_+	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_036781349.1|110631_110958_+	potassium ABC transporter ATPase	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.1e-11
WP_054300202.1|111073_111802_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212152.1|112271_112655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|112961_113339_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_155047283.1|113503_113836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|113788_113941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377351.1|114024_114804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047298.1|115333_115519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212019.1|115905_116601_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_105962690.1|117069_117345_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|117341_117587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047016.1|117616_117844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212014.1|118247_118661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|118758_119487_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
119494:119553	attL	TGATCAGGCTACCCTATTCCGGACAAATAAATTACAATAATCCGAGCCGGAGGAATCACA	NA	NA	NA	NA
WP_105962623.1|119553_120706_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155047284.1|121335_122364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|122643_123797_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273826.1|123756_124884_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	30.3	1.9e-18
WP_155047013.1|125104_125251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|125580_126396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780064.1|126641_127232_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	38.3	2.0e-22
WP_016211879.1|128186_129206_+	ParA family protein	NA	NA	NA	NA	NA
WP_075274742.1|129218_130100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|130129_130858_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|131061_133638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|133754_134732_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047285.1|135903_136161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|136179_137157_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036774631.1|137264_137729_+	hypothetical protein	NA	H6WFS7	Cyanophage	38.2	2.9e-21
WP_080963647.1|138067_138238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|139908_140637_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155047299.1|140820_142179_-	DEAD/DEAH box helicase	NA	D2J050	Enterococcus_phage	50.5	2.6e-126
WP_155047286.1|142268_142835_-	helix-turn-helix domain-containing protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	35.0	1.4e-20
WP_017377658.1|142838_143525_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|143772_144501_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155047287.1|144547_145144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273757.1|145487_145937_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556703.1|148417_148906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211956.1|148963_149692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211955.1|150148_151129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275154.1|151265_151922_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.7	7.6e-31
WP_036771347.1|152284_153262_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_027242575.1|153891_154377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242576.1|154410_156273_-	AAA family ATPase	NA	A0A088C4M0	Shewanella_sp._phage	30.9	1.0e-56
WP_036771347.1|156465_157443_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047288.1|157457_157583_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047289.1|157515_157692_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275025.1|157941_159957_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155047290.1|161618_163643_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155047291.1|165304_167335_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|167469_168447_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155047292.1|168524_169442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|170231_171385_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
171386:172630	attR	TGTGATTCCTCCGGCTCGGATTATTGTAATTTATTTGTCCGGAATAGGGTAGCCTGATCACTATTTCTTTGAGATCACGGTAAGATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATGATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTCTACCCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCCAACTAGAGAGTTTATCTGTATGGATATGAACTCTCTACTCGGTGTTGCACTTCATGTGACGGAGGGCGAAGACTATATGCCTCAGAAGTTATTAATTTTGTTTGCACAGATCAGGTATATATTCTGTTCTAGATGAATATTTCCAAAGAGGGCGCCAGAAACTATTTCTAATAATGTTAGATGCTTTCTTGCTATTAATGATATGACCATAGTTTTGTAATCCTGATGGGTAAAAGTTTTGTGATCCTACATAAAACATCCCTTTGTCTACCATCATAAATTTATAATGGCCTGTTATTTTTTCATTATCAGTCCATAAGTCATCATATTCATTGAACCTAATTGTAGAAATATGCAATTTATTGCATAGTTTTAAATTAATAGTATCTTCTTTTAATGCTGGATACATTGCCATCGCTTCACTTTTTATTTTACTCCATACTTCTTCATCGGTGGCTAAAGATAAATAACCTGATTCCATCATAGTTGCATCACTGTAAGGAGATTGGACAATATATACATGGCCTGCTTCCATGAGAAGTTTAGCTAGGGCACTAATAAGGTTAGTGTGTTGTTCCTTTGTAGTATCATAAGGCCAAGTATTAAAGTGTGCTTTAAGGCTCTGTTGTGCTATATAAATCCTTTTTTTTGCTGAAGTTAATAACCGATACAAAGCATAGTCTGAATTATTATTATTTTTAGCTGAATCATCCTTATATAAACCATAACCAGTGCGACCGATTGCAAGAACTTCTGCATTTCCAGAAGTAGTATGAGGTGCAGCATATAAATCATGTCCTAGCAAATCATTACTCACAATAGCATAATTGTTATTTTTTGTTGCGGAATACTCAATAACATTAAAAGGATAGTAAAGATAAAGTTTAATATTATTCCTTACAAACCTCCACAGCAAATTTGTAAATCTAATTGCTTGAGTTGCTGCTGGGCCTTCTAACTCAATCATGAGATCAAAAACTGGGTGTT	NA	NA	NA	NA
>prophage 1
NZ_CP038895	Piscirickettsia salmonis strain Psal-006a plasmid unnamed2, complete sequence	57410	5731	50657	57410	transposase,head,portal,capsid,integrase,protease,tail	Streptococcus_phage(22.73%)	53	NA	NA
WP_075273298.1|5731_6307_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	6.0e-08
WP_016212189.1|6372_6765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|7951_8977_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047302.1|9630_10710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212274.1|11240_11705_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032126154.1|11715_11910_-	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_032126152.1|12125_12716_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
WP_081007075.1|12779_13121_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155047303.1|13466_14468_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.3e-29
WP_036779013.1|14797_16870_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_017375910.1|16899_17628_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420837.1|17769_18702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|19088_19817_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036780061.1|20093_20447_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	35.8	1.1e-12
WP_027242955.1|20439_20700_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_054300271.1|20948_21923_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212288.1|22099_23350_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126388.1|23444_24470_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036780292.1|26275_27025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|27330_27594_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_052104629.1|27900_28926_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047304.1|29196_29328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047313.1|30053_30407_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_016211142.1|31995_32262_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075274761.1|32318_32642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047305.1|32643_33066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274762.1|33065_33416_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_075274763.1|33412_33808_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	39.1	6.0e-07
WP_075274764.1|33800_34124_-|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	41.7	5.4e-14
WP_075274765.1|34120_34432_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.7	2.5e-08
WP_036778347.1|34751_35333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047306.1|35368_36535_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	38.7	1.2e-66
WP_081007077.1|36590_37262_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	45.8	5.5e-45
WP_054300593.1|37209_38451_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	43.6	2.7e-85
WP_155047307.1|38447_39044_-	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.3	2.0e-38
WP_155047308.1|39087_40062_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	8.3e-26
WP_155047309.1|40081_41011_-	hypothetical protein	NA	A0A1W6JP18	Morganella_phage	52.0	1.5e-85
WP_155047310.1|41239_41722_-	hypothetical protein	NA	Q9B019	Phage_GMSE-1	33.3	1.1e-13
WP_032126915.1|41808_42192_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	4.7e-25
WP_052047121.1|42370_42772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126916.1|42916_43387_-	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	48.8	1.5e-33
WP_155047311.1|43374_43677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923627.1|43673_43961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210963.1|44056_44296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047315.1|44292_44640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047314.1|44632_44995_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.9e-24
WP_036780304.1|44963_45500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211080.1|45540_46527_-	helix-turn-helix domain-containing protein	NA	A0A0S2MVA0	Bacillus_phage	45.4	4.3e-14
WP_036780299.1|46565_46868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211079.1|47022_47328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211067.1|47537_48281_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211077.1|48413_49199_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300594.1|49631_50657_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038896	Piscirickettsia salmonis strain Psal-006a plasmid unnamed3, complete sequence	39810	6501	21080	39810	terminase,transposase,tail,portal,capsid,head,protease	unidentified_phage(23.08%)	16	NA	NA
WP_054300271.1|6501_7476_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_054300271.1|7879_8854_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047317.1|8988_9825_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_016211139.1|9904_10300_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211132.1|10292_10616_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211137.1|10612_10924_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_155047318.1|11114_12449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211140.1|12569_13763_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_080664855.1|13820_14492_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_155047319.1|14439_15060_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	50.9	5.5e-39
WP_052104629.1|15262_16288_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047320.1|16418_17141_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	40.8	2.6e-40
WP_155047321.1|17137_18820_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	45.7	6.9e-137
WP_016212234.1|18822_19302_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_155047322.1|19378_19771_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	4.4e-26
WP_054300271.1|20105_21080_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
>prophage 1
NZ_CP038897	Piscirickettsia salmonis strain Psal-006a plasmid unnamed4, complete sequence	33277	10315	26969	33277	transposase,tail	Indivirus(18.18%)	19	NA	NA
WP_036781073.1|10315_10576_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	A0A1S5NR91	Burkholderia_phage	48.8	2.1e-13
WP_081007079.1|10646_10919_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_129556478.1|11130_12017_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	5.8e-10
WP_016212315.1|13555_13990_+	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	39.7	9.1e-25
WP_155047334.1|14398_14839_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	37.6	1.1e-06
WP_054300249.1|14799_15165_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047335.1|15179_15623_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	25.5	5.1e-07
WP_054300271.1|16632_17607_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047336.1|17603_17888_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047337.1|17906_18269_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|18268_18691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275196.1|18692_19016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|19072_19339_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075275195.1|19342_21421_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.4	2.5e-56
WP_036776958.1|21413_21755_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|21751_22423_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|22391_23138_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_054300696.1|23127_23685_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_075275194.1|23681_26969_+	host specificity protein J	NA	A0A0R6PIC0	Moraxella_phage	33.2	5.2e-112
