The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	45566	89679	3165215	transposase	Moraxella_phage(16.67%)	46	NA	NA
WP_129556427.1|45566_46142_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46087_46453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46651_47413_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_016211195.1|47714_49241_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49612_50452_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50491_51799_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51773_52943_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|52997_53723_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54001_54391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54550_55456_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55531_55675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274979.1|55722_56562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|56554_56890_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_155046698.1|57068_57230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|57346_57640_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_016210704.1|58534_60481_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61135_64198_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64194_65259_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65614_66568_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66599_67763_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67768_68368_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68555_69056_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69073_70162_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70588_71833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71829_72672_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016211096.1|72651_73461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73639_73867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73867_74818_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74873_75425_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75551_75974_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75966_76713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76755_77454_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77464_78289_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78618_78987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274980.1|78981_80043_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|80092_80323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80452_81667_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81967_83029_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_016211249.1|83042_84770_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_016211245.1|84803_85535_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85534_86323_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86427_87051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|87370_87583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273383.1|87738_88311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046699.1|88515_89088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274981.1|89082_89679_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	136473	178470	3165215	transposase	Staphylococcus_phage(50.0%)	46	NA	NA
WP_054300271.1|136473_137448_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|137949_139362_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|139854_140862_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|140881_142402_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_129556430.1|142458_142665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211018.1|143640_144957_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145060_145444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145578_148644_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|148712_149816_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|149839_150394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150508_151078_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151197_151953_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_054300545.1|152119_153181_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|153575_153971_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|153992_154358_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154414_154579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|154568_154868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|155120_155486_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|155431_156007_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212607.1|156007_156364_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_155047004.1|156452_156959_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|156973_157339_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|157818_158385_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|158396_159182_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|159813_160737_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|160788_161784_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|161815_162310_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|162401_162659_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|162748_163171_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|163489_164206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|164249_164501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556431.1|164514_165942_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|165969_167412_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|167499_167838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|167922_168453_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|168513_170706_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|170748_171234_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|171503_171935_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_016210245.1|171952_172783_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|172797_172941_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|172971_173856_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|173827_174049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|174222_174501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|175471_176377_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016212383.1|176779_177898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|177894_178470_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	182276	239530	3165215	tail,tRNA,transposase,protease	Escherichia_phage(12.5%)	56	NA	NA
WP_075273327.1|182276_182852_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274985.1|182797_183163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|183226_183499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212441.1|183766_183991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372761.1|185006_185456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|185519_186248_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210779.1|186290_187220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|187512_188106_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|188074_188728_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|188905_189877_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|189899_190796_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|190954_191401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210787.1|191397_192039_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|192148_192727_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|193202_193640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|193964_195305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|195568_196963_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075274986.1|198411_199479_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|199531_199954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|200194_200638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|200692_200950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|200927_201554_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|201631_203614_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|203823_205167_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|205433_208103_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|208126_210046_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|210215_211637_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|211782_212757_+	phospholipase A	NA	NA	NA	NA	NA
WP_016209855.1|212788_213184_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209859.1|213186_213408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|213571_215233_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|215305_215596_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_016209861.1|215821_216277_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|216341_216806_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216898_218245_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|218244_219150_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|219211_220198_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|220190_220433_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|220554_222099_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|222145_223432_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|223474_224869_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224892_225072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|225068_225644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|225589_225955_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274988.1|226016_228251_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016210079.1|228672_229170_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|229340_230036_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|230138_231701_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|232016_233810_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233895_234168_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|234173_234800_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234786_236217_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236549_237605_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237573_238251_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|238240_239077_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|239236_239530_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	256927	302003	3165215	tRNA,transposase	Acinetobacter_phage(40.0%)	48	NA	NA
WP_075274991.1|256927_257503_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377888.1|257506_258067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556436.1|258122_259009_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046701.1|259035_259185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|259329_259530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|259577_260039_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|260462_261944_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|262006_263116_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|263213_265175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|265704_266109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|266161_267223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046702.1|267348_267504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270449_271602_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556437.1|271644_272067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274994.1|272336_273923_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_032126861.1|274126_274441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046703.1|274634_274772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|274775_275662_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212538.1|275833_276274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210630.1|276803_277919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664846.1|277857_278544_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032126366.1|278537_279515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210638.1|279553_280717_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210640.1|281181_281406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|281791_282079_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210633.1|282253_283009_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|283014_283470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210637.1|283445_283922_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210636.1|283928_285506_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_032126367.1|285509_286274_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210629.1|286327_286864_+	tim44-like domain protein	NA	NA	NA	NA	NA
WP_016210634.1|286860_287592_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_032126368.1|287700_288855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275120.1|288999_289311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664872.1|289634_290615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211898.1|290856_291480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211899.1|291807_292101_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_105962625.1|292197_293084_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274996.1|293492_294593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126374.1|294701_295673_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728325.1|295704_296082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211609.1|296735_297044_+	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_032126373.1|297076_299263_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	2.7e-141
WP_016211605.1|299366_299600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|299816_300347_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211607.1|300375_300600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|300782_301598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300526.1|301706_302003_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	329578	375133	3165215	transposase	Hokovirus(33.33%)	46	NA	NA
WP_075273298.1|329578_330154_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210127.1|330206_331232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|331325_331589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|331955_332774_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|332846_335219_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_016210125.1|335931_337359_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|337393_338416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|338432_338810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126491.1|339167_339485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210122.1|339651_340344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|340970_341945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|341934_343707_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|343707_344055_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_032126493.1|344304_345531_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|345620_346919_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664834.1|346952_347312_-	VUT family protein	NA	NA	NA	NA	NA
WP_080664833.1|347357_347702_-	VUT family protein	NA	NA	NA	NA	NA
WP_016210137.1|347682_348234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664832.1|348460_349759_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|349875_350166_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_155049101.1|350477_351719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556427.1|352131_352707_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|352652_353018_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212359.1|353753_353972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|354339_355314_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212044.1|355852_356107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|356829_357816_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|357953_358148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664870.1|358830_359478_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_129556444.1|359470_359893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211797.1|360054_361458_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|361508_362084_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|362029_362344_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556445.1|362384_363271_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126227.1|363909_364200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212008.1|364237_364936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212010.1|364952_365249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212007.1|365372_366518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273619.1|366790_367366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211273.1|367423_368257_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.0	3.5e-17
WP_016211268.1|368372_369557_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211271.1|369575_370520_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016211269.1|370824_371610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211272.1|371727_372096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211270.1|372323_373901_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_054300173.1|374071_375133_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	447745	555814	3165215	tRNA,transposase,integrase	Escherichia_phage(43.24%)	107	507616:507675	540794:541174
WP_075275004.1|447745_448609_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|448825_450385_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|450406_451441_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|451489_452059_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|452194_453166_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|453177_454755_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|454820_455807_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016210646.1|456138_457248_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|457353_458538_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|458615_460604_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|460812_460968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|461225_461525_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_075275005.1|461683_462019_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|462935_464342_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|464359_465346_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|465348_466503_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|466499_467195_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|467329_468820_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|468840_469890_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|469956_471351_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|472229_474161_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|474165_474696_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|474730_474925_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|474967_475327_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|475746_476742_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_032126132.1|476754_479136_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|479141_479429_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|479700_480177_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|480321_480519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|480643_481618_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|482518_482617_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210477.1|483101_484391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126626.1|484627_485320_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|485361_486135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|486136_487078_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|487210_488788_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|488997_490755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|491303_492062_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|492269_492842_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|492945_493494_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|493795_494041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|494069_494366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|494633_495557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556451.1|496035_496293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275008.1|496356_497085_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	3.3e-43
WP_098082828.1|497399_497657_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275009.1|497788_498496_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.8	1.3e-44
WP_075275011.1|498539_499268_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.2e-42
WP_032126799.1|499459_500272_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_129556452.1|501392_501740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049103.1|501742_503059_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300501.1|503008_503737_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|503748_504141_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|504137_504383_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300307.1|505486_506215_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300307.1|506821_507550_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
507616:507675	attL	GATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCG	NA	NA	NA	NA
WP_016212268.1|508194_508779_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|508782_509466_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|509748_510477_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_052104629.1|510813_511839_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212159.1|511982_512180_-	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_016212158.1|512447_513362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275019.1|513471_514176_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	9.2e-43
WP_105962625.1|514139_515026_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211714.1|515400_518745_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_016211713.1|518777_519467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|519489_520218_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_155097708.1|520285_520942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556625.1|521440_521998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126478.1|521990_522329_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.7e-24
WP_032126479.1|522315_522669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212114.1|522665_522896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212110.1|522899_523370_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	62.5	7.6e-33
WP_054300201.1|524016_524745_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_016212024.1|525140_525389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212021.1|525385_525985_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|525984_526203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|526689_527682_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|527678_528413_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_129556453.1|528832_529264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047116.1|529408_529588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|530289_531018_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_051307368.1|531675_532956_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|532955_533924_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_032126737.1|536435_537164_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_036781387.1|537364_537637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|537629_537908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212425.1|538111_538702_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.4	1.1e-20
WP_032126150.1|538906_539140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|539238_540213_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155097709.1|541728_543729_-	DUF1561 family protein	NA	NA	NA	NA	NA
540794:541174	attR	GATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTTTTTCAAAAAGGCAATCGCCCAACCTTATGTGAAATCACCGCGTGTTGTGAATGTCGACAAGCACGCTTCATTTCCACCCGCTCACCAAAAAGCCAAAGATGAAGGTCTCTTTTCTAGTCAGTGTAAACTCAGGCGAGTGAAGTATTTAAACAACTGCATTGAAAATGATCACAAAGCGGTAAAGCGCAAATCCCGTTTCCGCCAATGGTACCAATCACTTTCTACAGCACGGCCTACCATTGACATAATGGAAGCGATGCGCATGGTTCAAAAAGGTCAATTACGTTATATTAAAAAACAGAATATCTGTGCC	NA	NA	NA	NA
WP_016211807.1|543992_544214_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728351.1|544101_544260_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556454.1|544523_546536_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_075275029.1|546704_547433_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	9.6e-43
WP_075275032.1|548176_548986_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	1.1e-15
WP_032126239.1|549036_549309_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|549320_550157_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_016211646.1|550526_550766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|550758_551112_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_129556455.1|551412_552015_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211641.1|552019_552475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211645.1|552497_553247_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	28.2	2.4e-09
WP_016211640.1|553278_553881_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211639.1|554260_554563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211644.1|554677_554944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|555085_555814_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 7
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	563513	614692	3165215	tRNA,transposase	Synechococcus_phage(25.0%)	54	NA	NA
WP_036776715.1|563513_564242_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|564335_565001_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|565065_566022_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|566280_566979_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|567021_568134_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|568738_569314_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|569259_569625_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|569712_570063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|570798_571860_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556458.1|572235_572469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210908.1|573360_574176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|574266_575250_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|575420_575942_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_016210914.1|575975_576227_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210909.1|576232_577510_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_155097710.1|578280_578730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|578849_581162_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|581290_582106_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|582303_582768_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275036.1|582897_583959_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|584219_584516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|584798_586262_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|586264_587317_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211494.1|587306_587762_+	arginine repressor	NA	NA	NA	NA	NA
WP_016211487.1|587786_588110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|588457_588769_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_032126201.1|588898_589645_+	lipoprotein	NA	NA	NA	NA	NA
WP_054300148.1|589666_590728_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|590838_591813_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126197.1|591953_592907_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|593020_593218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047032.1|593430_593664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212072.1|593693_593891_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212074.1|593977_594199_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|594225_594591_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275038.1|594536_595127_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046713.1|595264_595429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|595723_597160_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|597201_598653_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|598764_599052_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|599241_600285_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210536.1|600300_601200_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210528.1|601196_601715_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210527.1|601784_602402_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016210531.1|602411_603899_+	ribonuclease G	NA	NA	NA	NA	NA
WP_016210534.1|603908_607589_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_016210535.1|607662_608475_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210530.1|608471_609152_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_081007010.1|609992_610613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|610662_610953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275039.1|611756_612251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|612245_612584_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|612963_613849_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556462.1|613846_614692_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.8	1.4e-24
>prophage 8
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	635013	735642	3165215	tRNA,transposase,plate,protease	Prochlorococcus_phage(17.65%)	105	NA	NA
WP_016209523.1|635013_636363_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|636413_636851_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|637112_638624_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_032126188.1|638629_639856_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|639849_640878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|640855_641548_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_016209516.1|641552_643022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556464.1|643011_643503_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|643508_644981_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|644980_645379_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|645375_647064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|647045_648002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|648044_648560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|648664_649597_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|649816_650203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|650219_650864_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|651044_651884_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|651959_652562_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|652562_653417_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|653773_654085_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|654109_655501_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|655656_656388_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_129556465.1|656384_656957_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|656943_657501_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|657506_658487_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|658626_659427_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_036780687.1|659430_660198_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|660194_660659_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|660681_661335_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|661338_661686_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|661719_661971_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|662045_663314_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|663316_664075_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|664136_665027_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|665077_665761_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|665846_666104_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_075275046.1|666376_668590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|668581_669454_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|669621_671451_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|671614_672256_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|672497_673028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|673045_673219_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|673277_674327_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|674333_675284_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|675337_676282_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|676309_677047_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|677135_677378_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|677452_678676_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|678707_679556_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|679552_680605_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|680725_681346_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_036780649.1|681361_682348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080743011.1|682458_682914_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075275072.1|682873_683224_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|683975_684881_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275050.1|684956_685652_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275052.1|685796_686306_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|686355_686565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|687799_688246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|688249_688825_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275054.1|688770_689136_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|689256_689442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|689545_690580_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|690576_691287_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|691761_692280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|692397_692730_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209920.1|692759_695714_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209912.1|695759_696257_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|696316_696733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|696824_697685_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|697767_698334_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|698366_699221_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_016209914.1|699262_702169_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|702229_702427_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|702433_703444_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|703440_704499_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|704492_705293_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|705295_706114_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|706125_707073_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|707080_708382_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|708560_709664_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|709660_710053_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|710064_711441_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|711434_712904_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209916.1|713095_714067_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	3.7e-34
WP_129556470.1|714303_715190_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|715489_715735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049893.1|715883_716099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|716283_717018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|717142_718204_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|718526_719231_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|719324_720038_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|720120_721212_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|721283_721865_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|721870_722497_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|722593_723529_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|723888_724560_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210598.1|724701_725361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|725529_726789_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|726785_727871_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|727863_728745_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|728733_729984_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_075275125.1|731575_732619_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|734755_735121_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|735066_735642_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	771060	817740	3165215	tRNA,transposase	Staphylococcus_phage(28.57%)	39	NA	NA
WP_016209374.1|771060_772512_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|772547_774077_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_016209380.1|774652_775075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209378.1|775162_776296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126585.1|776837_777758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|778108_778924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|779215_781906_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_080664814.1|782154_783375_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|783542_785249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|785847_787074_+	MFS transporter	NA	NA	NA	NA	NA
WP_075274832.1|787650_788625_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_075273456.1|788747_789047_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|789006_789462_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212416.1|789463_789994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212417.1|790117_790363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|790413_790779_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|790724_791300_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052047106.1|791373_791850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|792565_792931_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|792876_793452_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300173.1|793478_794540_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556627.1|794592_795198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211819.1|795416_795647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|795943_796444_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|796646_797903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211822.1|798259_798673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|798982_800044_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275065.1|800343_801018_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.9e-10
WP_016212172.1|801908_803381_+	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|803400_804375_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|804525_804801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|804966_805587_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_016210737.1|805905_807882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|808037_809495_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|809563_811144_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210744.1|811184_811670_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|811766_815663_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|815669_815993_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300173.1|816678_817740_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	834427	888880	3165215	transposase,protease	Staphylococcus_phage(15.38%)	45	NA	NA
WP_033923708.1|834427_835303_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|835558_836203_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|836233_838039_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|838062_838638_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556476.1|839182_840193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|840288_841263_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016209640.1|841681_842701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|843159_844125_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|844169_844745_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|844775_846050_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|846676_847390_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|847469_848207_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|848327_849683_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|849859_850531_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|850646_851522_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|852125_853430_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|853542_854148_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|854229_855531_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|855598_858031_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|858134_858407_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_032126162.1|858510_860388_+	SurA domain-containing protein	NA	NA	NA	NA	NA
WP_016209643.1|860419_861304_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|861312_861708_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|862135_864283_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|864254_865604_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|865600_867721_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|867717_869421_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_155049178.1|869539_870682_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|870746_871775_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_129556477.1|871934_873416_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|873505_873991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275067.1|874323_875391_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273512.1|876146_876491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|876627_877602_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126362.1|877773_878139_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051307360.1|878978_879908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780074.1|880999_881806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|882148_884041_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|884327_884732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923634.1|884936_885485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|885474_886361_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|886699_887110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556479.1|887323_887506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274918.1|887993_888359_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|888304_888880_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	895130	942674	3165215	integrase,transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(16.67%)	49	887490:887549	904774:905213
887490:887549	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_032126152.1|895130_895721_-|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016212424.1|895923_896202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|896194_896467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|896611_897694_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211300.1|897744_898785_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_129556480.1|899296_904786_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|904809_905784_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
904774:905213	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTA	NA	NA	NA	NA
WP_016212302.1|906097_906397_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_129556481.1|906581_907013_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_054300162.1|907270_908353_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211579.1|908576_909062_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|909129_910038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211581.1|910314_911085_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.9	8.9e-31
WP_016211585.1|911203_911761_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016211582.1|911822_912602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|912699_913053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|913119_913314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|913329_913674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|914031_914607_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|914552_914918_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275068.1|915002_915593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047108.1|915694_916093_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212107.1|916904_918041_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046716.1|918445_918592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|919289_919844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|920280_920463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210541.1|920527_920755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|920985_921732_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|921958_922252_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|922323_922929_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|923077_924055_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_032126547.1|924151_925594_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|925620_926274_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_016210552.1|926398_926965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|927319_929098_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_016210542.1|929169_930876_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.9	2.5e-25
WP_054300262.1|930867_931158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307332.1|931205_931412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|931620_931986_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|931931_932507_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|932510_932885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275071.1|933260_934235_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_054300264.1|934337_934676_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300265.1|934820_935081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275072.1|935040_935391_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556484.1|935850_937311_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_016211426.1|937654_939097_+	MFS transporter	NA	NA	NA	NA	NA
WP_075273490.1|940079_941372_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_054300148.1|941612_942674_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	957103	1065229	3165215	tRNA,transposase	uncultured_Mediterranean_phage(11.11%)	114	NA	NA
WP_054300173.1|957103_958165_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211781.1|958381_959629_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_129556630.1|959938_961288_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_129556486.1|961373_961721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273492.1|961811_961931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275075.1|962039_963101_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|963095_963266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|963255_963420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|963476_963842_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|963863_964232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210898.1|965143_965494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|965582_965873_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|966347_966650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210897.1|966990_967971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|968049_969387_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|969505_969877_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|970097_970748_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|970790_971873_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|971926_973810_+	APC family permease	NA	NA	NA	NA	NA
WP_032126790.1|974309_975215_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275077.1|975299_976136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212218.1|976280_976631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|979267_980350_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_032126801.1|981020_981530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275079.1|981577_982639_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556488.1|982787_983637_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126540.1|984786_985650_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|986530_986896_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|986841_987417_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|987647_988013_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|987958_988534_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126869.1|989054_989294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|989271_990333_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556489.1|990578_991775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|991778_992665_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212326.1|992890_993088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122941816.1|993174_993483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212323.1|993559_993832_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_075274676.1|993906_994104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211709.1|994262_994409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|996668_998705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664853.1|999428_1001171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155097711.1|1001231_1002776_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|1002788_1003832_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|1003810_1004272_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_016211081.1|1004312_1005248_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211087.1|1005275_1006271_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211088.1|1006490_1007453_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126778.1|1007631_1007826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075285940.1|1008040_1008862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377357.1|1008946_1009348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212611.1|1009831_1010152_+	histidine kinase	NA	NA	NA	NA	NA
WP_075275084.1|1010199_1011261_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212519.1|1011335_1011716_+	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_052047081.1|1011986_1012424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212356.1|1012474_1013320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275086.1|1013297_1014296_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1014256_1014622_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1014567_1015143_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1015512_1016487_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016212585.1|1016598_1016919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212621.1|1017213_1017618_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_155097712.1|1017614_1018220_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155097713.1|1018185_1018500_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126498.1|1018561_1019122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211126.1|1019254_1019644_-	lipoprotein	NA	NA	NA	NA	NA
WP_016211125.1|1019813_1020644_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211128.1|1020866_1021772_-	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211119.1|1021935_1022697_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211122.1|1022700_1023567_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126499.1|1023663_1024275_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211118.1|1024653_1025901_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126500.1|1026037_1026754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275089.1|1026887_1027220_-	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	37.3	8.0e-05
WP_129556631.1|1027364_1027532_-	phosphatase	NA	NA	NA	NA	NA
WP_075275091.1|1028540_1029026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|1029296_1029707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300412.1|1029851_1030166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210280.1|1030402_1031497_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_016210284.1|1031578_1032100_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210276.1|1032154_1032631_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210275.1|1032686_1032989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210273.1|1033053_1033761_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210274.1|1034133_1034532_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_032126334.1|1034571_1035003_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210271.1|1035013_1035697_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1035781_1037977_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_129556492.1|1038074_1038818_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210283.1|1038845_1039631_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_016210272.1|1039670_1040381_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210279.1|1040368_1041535_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210277.1|1041588_1042422_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210270.1|1042491_1045479_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210281.1|1045520_1046912_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210269.1|1046925_1047276_-	L,D-transpeptidase catalytic domain protein	NA	NA	NA	NA	NA
WP_032126362.1|1047313_1047679_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1047624_1048200_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664860.1|1048163_1048601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211367.1|1048756_1049539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126330.1|1049686_1050646_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_032126331.1|1050700_1052710_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_016211366.1|1052765_1053053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126332.1|1053305_1054505_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_075273327.1|1055151_1055727_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1055672_1056038_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|1056171_1057035_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1057265_1057559_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556495.1|1058539_1058797_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211589.1|1058919_1060152_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_016211592.1|1060141_1060804_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_129556496.1|1061078_1062317_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_032126329.1|1062502_1063132_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211588.1|1063207_1063909_+	cyclase family protein	NA	NA	NA	NA	NA
WP_105962623.1|1064076_1065229_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 13
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	1094686	1201200	3165215	tRNA,transposase	uncultured_Mediterranean_phage(23.53%)	94	NA	NA
WP_075275097.1|1094686_1095262_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1095207_1095573_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300408.1|1095623_1096280_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_080664854.1|1096616_1097198_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_032126179.1|1097155_1097407_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_016211113.1|1097436_1098762_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_016211112.1|1098817_1099465_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211115.1|1099657_1101610_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211114.1|1101742_1104673_+	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_075274672.1|1105038_1105632_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046731.1|1105803_1106688_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1106702_1106993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1106938_1107514_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212254.1|1107503_1108946_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016212252.1|1108983_1109142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|1109456_1110182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|1110386_1110758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211395.1|1111114_1111450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779999.1|1111365_1111797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211393.1|1111816_1113373_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_016211391.1|1113384_1113960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728317.1|1114026_1117392_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275098.1|1117582_1118512_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-24
WP_129556498.1|1119024_1119633_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210596.1|1119629_1121570_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.1e-72
WP_016210594.1|1121705_1122359_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210595.1|1122535_1123714_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210588.1|1124081_1125407_+	fimV domain protein	NA	NA	NA	NA	NA
WP_032126176.1|1125497_1126280_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210587.1|1126381_1127242_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_016210590.1|1127416_1128679_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210593.1|1128758_1129289_+	colicin V production protein	NA	NA	NA	NA	NA
WP_016210586.1|1129310_1130816_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210592.1|1130828_1131485_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016212005.1|1131874_1133635_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_155049815.1|1134200_1134353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126856.1|1135992_1136334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377901.1|1136394_1137105_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275102.1|1137285_1137744_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211525.1|1138332_1141068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|1143367_1144183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046719.1|1146401_1146560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1146578_1146851_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1146862_1147699_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_129556510.1|1148222_1149326_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	7.3e-10
WP_054300405.1|1149427_1149928_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209947.1|1150449_1151112_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016209946.1|1151138_1152368_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209940.1|1152524_1155296_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_016209937.1|1155371_1155815_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209931.1|1155967_1157440_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209926.1|1157551_1158613_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209945.1|1158609_1159644_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209932.1|1159646_1160687_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209936.1|1160869_1161985_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.6	1.4e-93
WP_016209930.1|1162023_1162377_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_032126634.1|1162397_1164266_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209935.1|1164287_1165232_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_016209925.1|1165465_1165744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1165953_1166592_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209944.1|1166566_1167994_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209927.1|1168194_1168872_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209939.1|1169006_1170281_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209943.1|1170348_1171104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209948.1|1171155_1172073_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209929.1|1172181_1173075_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075274822.1|1174533_1175508_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016211771.1|1175800_1175989_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_016211770.1|1176002_1177136_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_075274823.1|1177335_1181346_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211823.1|1181380_1181569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1181609_1182230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1182561_1182915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1183128_1183323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1183988_1184516_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300400.1|1184572_1184815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1184959_1185226_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210885.1|1185567_1186449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1186506_1187103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1187135_1187909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1188442_1188739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210888.1|1188761_1189013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155053505.1|1188958_1189681_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210886.1|1189749_1190529_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210887.1|1190611_1191562_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210889.1|1192071_1194918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556636.1|1194935_1195244_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016212002.1|1196197_1196476_-	DNA-J related family protein	NA	NA	NA	NA	NA
WP_016212000.1|1196595_1197324_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016211998.1|1197454_1198018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211999.1|1198007_1198361_-	ras family protein	NA	NA	NA	NA	NA
WP_033923779.1|1198740_1199577_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1199588_1199861_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274825.1|1200138_1201200_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	1238014	1283106	3165215	transposase	Bacillus_phage(50.0%)	35	NA	NA
WP_075274826.1|1238014_1238920_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080664858.1|1244722_1244860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155097714.1|1246482_1246629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155097715.1|1247353_1247596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155097716.1|1248303_1248567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155097717.1|1248524_1248794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155097718.1|1248775_1249027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155097719.1|1250014_1251469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274826.1|1251699_1252605_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1252861_1254133_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_016211218.1|1254157_1254895_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1255147_1256290_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1256306_1257908_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1258419_1258557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1258553_1259831_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_155069065.1|1260221_1260434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211682.1|1261052_1262735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211680.1|1262782_1265182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274826.1|1265412_1266318_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1266574_1267846_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_016211218.1|1267870_1268608_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1268860_1270003_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1270019_1271621_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1272132_1272270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1272266_1273544_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_155069065.1|1273934_1274147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126600.1|1274347_1274869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212250.1|1274991_1275642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212251.1|1275803_1276340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300384.1|1276501_1277317_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075274828.1|1277725_1279048_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.2e-11
WP_052133287.1|1279149_1279548_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212039.1|1279736_1280294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212040.1|1280470_1281820_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_054300162.1|1282023_1283106_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 15
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	1289862	1333539	3165215	tRNA,transposase	Staphylococcus_phage(14.29%)	46	NA	NA
WP_032126139.1|1289862_1290792_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_033923779.1|1293460_1294297_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274829.1|1294308_1294581_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1294604_1295579_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300382.1|1295979_1296402_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377858.1|1296620_1297331_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1297534_1297900_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|1297914_1298421_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211414.1|1298636_1299455_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|1299562_1300024_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211415.1|1300040_1300964_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211417.1|1300987_1302037_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_051307357.1|1302173_1302767_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211422.1|1302789_1303260_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032126143.1|1303348_1304620_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_075274832.1|1304719_1305694_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_016211838.1|1306005_1306179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211840.1|1306649_1307114_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211839.1|1307272_1308745_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211841.1|1308862_1309315_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|1310174_1311236_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1311538_1312621_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212483.1|1312631_1313429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046731.1|1313425_1314311_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300380.1|1314412_1315069_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556508.1|1315339_1315783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|1315844_1316138_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556507.1|1316254_1316941_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.3	5.5e-48
WP_075273327.1|1316930_1317506_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1317451_1317817_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212421.1|1318308_1318491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1319241_1320216_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556505.1|1320256_1321222_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211470.1|1321988_1322642_+	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_016211471.1|1322701_1324687_-	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
WP_032126343.1|1324817_1325630_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_032126344.1|1325750_1326839_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_016211467.1|1326841_1327408_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_075273298.1|1327482_1328058_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|1328003_1328369_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047029.1|1328536_1328878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1328950_1330012_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032127044.1|1330215_1330416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212482.1|1330630_1330774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|1331317_1331611_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556503.1|1332672_1333539_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	5.6e-58
>prophage 16
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	1346065	1411189	3165215	tRNA,transposase,protease	Klosneuvirus(22.22%)	58	NA	NA
WP_081007040.1|1346065_1346722_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211831.1|1346859_1348587_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|1348887_1349241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1349656_1350157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047133.1|1350808_1351255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1351258_1351834_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1351779_1352145_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126565.1|1352355_1352628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211013.1|1352945_1355312_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_016211011.1|1355372_1356569_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_016211010.1|1356847_1359277_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_016211008.1|1359369_1360872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211012.1|1360980_1361553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273571.1|1361702_1362380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556502.1|1362488_1363052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210926.1|1363311_1364781_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016210918.1|1364865_1365615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210930.1|1365618_1366392_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210927.1|1366452_1367403_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210917.1|1367527_1368970_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	5.4e-21
WP_032126561.1|1369183_1370368_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210925.1|1370491_1371178_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.5	9.7e-29
WP_016210921.1|1371269_1371854_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_155046724.1|1372078_1372246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210929.1|1372242_1372599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|1372633_1372939_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_054300375.1|1373153_1373354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728346.1|1374160_1374493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372539.1|1374510_1375374_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556501.1|1375406_1375982_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1375927_1376293_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211651.1|1376526_1378062_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016211650.1|1378186_1379671_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211648.1|1380330_1380870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|1382073_1382280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075278621.1|1382468_1382810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126641.1|1382845_1385416_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_016209840.1|1385523_1386009_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_016209844.1|1386181_1387222_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209835.1|1387199_1387682_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209848.1|1387678_1390273_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209832.1|1390579_1390843_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209831.1|1391121_1391820_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|1392039_1392234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209827.1|1392309_1393869_-	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_129556633.1|1394187_1395084_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|1395300_1396776_-	APC family permease	NA	NA	NA	NA	NA
WP_016209826.1|1397298_1398321_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209830.1|1398651_1400019_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209846.1|1400254_1400509_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126639.1|1400524_1401811_+	GTPase HflX	NA	NA	NA	NA	NA
WP_016209836.1|1401830_1403045_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_016209838.1|1403044_1403938_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209839.1|1404135_1405434_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209829.1|1406813_1409213_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209834.1|1409209_1409968_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209842.1|1410144_1410534_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_075273327.1|1410613_1411189_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	1441978	1487168	3165215	tRNA,transposase,integrase	Tupanvirus(28.57%)	45	1449774:1449833	1497578:1497932
WP_016211285.1|1441978_1442758_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211286.1|1442775_1443123_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211289.1|1443234_1443507_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211767.1|1444835_1445645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211764.1|1446195_1447017_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126803.1|1447217_1448450_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_081377862.1|1448936_1449773_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
1449774:1449833	attL	TCGTTTATCCTCTATATCGGTAGCTTTTTTTCCACAACATCTTTCAAAGCCTCAATTTCT	NA	NA	NA	NA
WP_032126239.1|1449784_1450057_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211806.1|1450846_1451572_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_016211805.1|1451614_1453153_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211804.1|1453159_1454545_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_032126599.1|1455239_1456583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1457222_1457906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273555.1|1458183_1458717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210332.1|1458847_1459591_-	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_016210330.1|1459688_1460072_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210333.1|1460275_1460905_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_032126607.1|1460978_1462262_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_016210326.1|1462601_1463900_+	ankyrin repeats family protein	NA	NA	NA	NA	NA
WP_016210325.1|1464053_1465430_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210327.1|1465565_1466897_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210329.1|1466957_1467476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210321.1|1467524_1468493_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_129556511.1|1468689_1470126_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210323.1|1470308_1471019_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.7	6.3e-39
WP_032126606.1|1470930_1471452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210320.1|1471601_1472675_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_016210322.1|1472811_1473708_-	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016211334.1|1474325_1474514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211336.1|1474562_1475177_+	chorismate mutase	NA	NA	NA	NA	NA
WP_032126265.1|1475242_1476160_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016211328.1|1476483_1476945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082827.1|1477052_1478354_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_016211330.1|1478528_1479629_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_032126267.1|1479976_1480219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211335.1|1480212_1480530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664859.1|1480639_1481227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1481395_1481653_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774189.1|1481652_1482660_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_051307372.1|1482707_1483097_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016212275.1|1483212_1484196_+	MFS transporter	NA	NA	NA	NA	NA
WP_155097720.1|1484185_1484791_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155097721.1|1484756_1485053_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212589.1|1485476_1485914_+	MFS transporter	NA	NA	NA	NA	NA
WP_129556637.1|1486388_1487168_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1497578:1497932	attR	AGAAATTGAGGCTTTGAAAGATGTTGTGGAAAAAAAGCTACCGATATAGAGGATAAACGAATGCTCGCTACTTACCTCAAAGATGAACATAAGCTAAGCCTCGTGGTTGCTTGTAATTTAGTCACTCTTCCAAGAGCAAGCTATTACCGAAAAAAACAGCATCAATCTGATAATGCTGAAATAATTTCAGAGCTAAAGACGTTAGCGAGCAAACACAAACGCTGGGGTTGCGACAAAATGGTCGCATATTTAAAAAACAAAGGTAAGCCTTGGAACCATAAGCGCATTCGTCGAGTCTATATTGAAATGGGCTTAAACATAAGCTGTAAACCAAAGCATCACTACGTCAAAAACG	NA	NA	NA	NA
>prophage 18
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	1496294	1545779	3165215	transposase,protease	Staphylococcus_phage(30.77%)	51	NA	NA
WP_054300271.1|1496294_1497269_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126239.1|1497353_1497626_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1497637_1498474_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_081377864.1|1498487_1498727_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211148.1|1498808_1500137_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1500400_1500970_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211151.1|1500985_1501297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1501306_1502263_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1502375_1502729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211153.1|1502732_1503797_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211145.1|1503797_1505537_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211152.1|1505543_1505966_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211144.1|1505949_1506579_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075273474.1|1507135_1508110_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_075274844.1|1508290_1508542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1508550_1509387_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1509398_1509671_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556515.1|1509689_1510049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046727.1|1510874_1511219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1511462_1512437_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075275108.1|1512413_1513019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212529.1|1513377_1513935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1513975_1514248_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1514259_1515096_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_080664876.1|1515408_1517271_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_081377865.1|1517629_1517914_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556638.1|1519258_1519939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273551.1|1519938_1520241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211974.1|1520340_1521462_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075274847.1|1521744_1522620_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212011.1|1522853_1523975_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_016212013.1|1524196_1524580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|1524595_1525273_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300271.1|1525509_1526484_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300271.1|1527131_1528106_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556517.1|1528503_1528791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1528809_1529646_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1529657_1529930_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274849.1|1530055_1530799_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212348.1|1530793_1532023_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_016211994.1|1533441_1533978_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_032126537.1|1534014_1534200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211991.1|1534440_1535346_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126538.1|1536254_1537673_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_081007034.1|1537937_1538222_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_080728343.1|1538203_1538344_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_016211561.1|1538425_1542292_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_016211564.1|1542457_1543333_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211563.1|1543365_1543527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274852.1|1543737_1544181_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047138.1|1545545_1545779_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	1564182	1749458	3165215	tRNA,transposase	Staphylococcus_phage(12.12%)	169	NA	NA
WP_016210106.1|1564182_1565274_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210105.1|1565293_1565614_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210099.1|1565697_1566975_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_017377579.1|1566996_1567833_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210111.1|1567839_1569474_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_016210117.1|1569894_1570254_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210103.1|1570535_1571894_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_081377868.1|1571969_1572626_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211627.1|1572931_1573096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211632.1|1573321_1574176_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211634.1|1574211_1575033_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211631.1|1575288_1576095_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_155049127.1|1576353_1577532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|1577617_1577911_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_075273327.1|1577986_1578562_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1578507_1578873_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556520.1|1578833_1579730_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.8e-54
WP_129556521.1|1579680_1579869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1580402_1581289_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300349.1|1582440_1584165_-	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_032126825.1|1584716_1586030_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_016211481.1|1586262_1587405_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_098082850.1|1587479_1587656_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_032126824.1|1587691_1588351_-	MarC family protein	NA	NA	NA	NA	NA
WP_032126823.1|1588434_1589157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211482.1|1589145_1591419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273804.1|1591554_1591893_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1591852_1592308_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212267.1|1592474_1592834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1593114_1593762_+	LysE family translocator	NA	NA	NA	NA	NA
WP_155046730.1|1594029_1594170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274856.1|1594388_1595414_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211733.1|1597169_1597994_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_016211731.1|1598049_1599156_-	protein kinase	NA	NA	NA	NA	NA
WP_016211734.1|1599171_1599441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1599862_1600561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211398.1|1601165_1601453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211399.1|1601599_1602343_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211403.1|1602356_1603400_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211405.1|1603535_1605308_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_129556522.1|1605514_1606747_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211669.1|1609855_1610206_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211666.1|1610360_1613180_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211664.1|1613552_1614281_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211555.1|1614817_1616176_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_032126677.1|1616250_1616814_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211557.1|1617008_1618238_-	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_016211554.1|1618283_1618910_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_032126678.1|1619236_1620247_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_075274857.1|1620257_1621133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274858.1|1622712_1623798_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1623934_1624300_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1624245_1624821_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1625511_1626486_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1627040_1628102_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1628199_1629174_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_129556523.1|1629509_1630395_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209772.1|1631414_1631966_-	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_016209778.1|1631984_1632359_-	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209796.1|1632389_1633607_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_080664823.1|1633630_1635031_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209795.1|1635011_1635767_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_016209793.1|1635807_1637256_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_032126436.1|1637271_1637727_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209771.1|1638433_1639156_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016209791.1|1639320_1640043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307317.1|1640179_1640473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209798.1|1640534_1642559_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_016209769.1|1642571_1643315_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_017377132.1|1643356_1643740_-	response regulator	NA	NA	NA	NA	NA
WP_016209784.1|1643826_1644549_-	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_129556524.1|1644545_1645433_-	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_016209767.1|1645413_1646874_-	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_016209770.1|1646904_1648998_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_016209786.1|1649032_1650166_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_016209787.1|1650179_1650965_-	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_016209776.1|1650980_1651250_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_080664822.1|1651279_1652029_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_016209797.1|1652025_1652517_-	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_016209775.1|1652513_1652969_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_129556639.1|1652985_1653396_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_144019182.1|1653691_1654198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209788.1|1654201_1654954_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016209785.1|1655075_1657019_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	23.9	1.1e-05
WP_016209794.1|1657064_1657688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377870.1|1658421_1658940_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	31.0	1.6e-07
WP_081007030.1|1658975_1659947_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307341.1|1660640_1662239_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_016210848.1|1662405_1663590_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1663885_1664440_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210850.1|1664688_1665942_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210851.1|1665926_1666598_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210847.1|1666620_1667625_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_155049131.1|1667653_1669102_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210855.1|1669219_1670197_+	DMT family transporter	NA	NA	NA	NA	NA
WP_129556525.1|1670350_1671170_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1671246_1672221_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212475.1|1672418_1672625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211182.1|1673609_1673939_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_032126448.1|1673970_1674351_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211178.1|1674441_1675470_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016211180.1|1675532_1675997_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_032126449.1|1676017_1676941_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016211185.1|1677007_1677616_+	smr domain protein	NA	NA	NA	NA	NA
WP_032126450.1|1677728_1679723_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211177.1|1680090_1681311_+	amino acid permease	NA	NA	NA	NA	NA
WP_155046970.1|1682735_1682984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046971.1|1683061_1683607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126783.1|1683717_1684959_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211741.1|1685104_1685881_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211738.1|1686357_1687002_-	membrane protein	NA	NA	NA	NA	NA
WP_032126790.1|1687072_1687978_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1688939_1689278_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1689237_1689693_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126602.1|1689845_1691153_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211857.1|1691403_1692282_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016211855.1|1692278_1692746_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|1692872_1693058_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_054300271.1|1693273_1694248_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556640.1|1694514_1695741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211351.1|1695816_1696155_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_032127067.1|1696151_1696754_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211349.1|1696750_1698745_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211350.1|1698808_1699747_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211352.1|1700425_1700866_+	universal stress protein	NA	NA	NA	NA	NA
WP_075273313.1|1701039_1701378_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1701337_1701793_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210793.1|1701794_1702475_+	OmpW family protein	NA	NA	NA	NA	NA
WP_016210801.1|1702797_1703769_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210795.1|1703750_1704722_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_051307339.1|1704827_1705634_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210791.1|1706008_1706209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210799.1|1706635_1707589_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_129556527.1|1708050_1708311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273540.1|1708495_1709107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210800.1|1709473_1710301_+	DsbA family protein	NA	NA	NA	NA	NA
WP_080750117.1|1710436_1712077_+	APC family permease	NA	NA	NA	NA	NA
WP_052047040.1|1712102_1713041_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1713110_1713368_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556528.1|1713789_1714218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1715741_1716230_-	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_051307365.1|1716249_1716510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211834.1|1716766_1717081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664871.1|1717171_1718794_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.9	1.9e-27
WP_032126362.1|1719225_1719591_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1719536_1720112_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212185.1|1720205_1721195_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1721528_1721714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1722393_1724349_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016210749.1|1724647_1725109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210752.1|1725278_1726076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556641.1|1728452_1729715_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_032126362.1|1733589_1733955_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1733900_1734476_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211454.1|1734616_1735087_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_016211452.1|1735837_1737325_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211455.1|1737386_1738844_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_122942091.1|1738949_1739345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1739372_1739951_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_054300325.1|1740572_1740845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046732.1|1741038_1741209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274862.1|1741323_1741920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1742091_1742685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211728.1|1743072_1745007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1745045_1745960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1747530_1747797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1747873_1748530_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1748704_1749160_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1749119_1749458_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	1754069	1821359	3165215	tRNA,transposase,integrase	Bacillus_thuringiensis_phage(50.0%)	59	1765586:1765645	1810512:1811473
WP_032126540.1|1754069_1754933_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212346.1|1755166_1755313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274864.1|1758153_1759179_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047087.1|1759350_1759569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211462.1|1759729_1760710_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211465.1|1761337_1762321_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211464.1|1762471_1762819_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_032126752.1|1762815_1763418_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211466.1|1763505_1765026_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126753.1|1765095_1765560_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
1765586:1765645	attL	TTATAGCGCTGGATTAACAGTTTCTGACATAATATCAGTAGGTTAAAAAATACAATAAGG	NA	NA	NA	NA
WP_032126362.1|1765652_1766018_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1765963_1766539_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212485.1|1767395_1767929_+	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_129556532.1|1768225_1768408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664820.1|1768716_1768887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209620.1|1768869_1771926_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209619.1|1772012_1773461_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209621.1|1773893_1774898_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209617.1|1775018_1775417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209627.1|1775456_1777280_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_033923701.1|1777276_1780579_+	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209616.1|1780609_1781524_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016209618.1|1781594_1782224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|1782268_1782703_-	lipoprotein	NA	NA	NA	NA	NA
WP_016209630.1|1782683_1783424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|1783437_1784835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|1784837_1787786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|1787785_1789507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209636.1|1789521_1789926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209631.1|1789926_1792800_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075273639.1|1792802_1793519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|1793886_1795779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209637.1|1795810_1798348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274867.1|1798379_1799552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209624.1|1799548_1800160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209623.1|1800181_1801681_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209615.1|1801697_1802204_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_155046733.1|1803445_1803583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046734.1|1803727_1803865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377829.1|1804520_1805255_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_129556535.1|1805699_1806585_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1806775_1807033_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377871.1|1807237_1807930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556536.1|1807932_1809086_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155049181.1|1809045_1809555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274873.1|1810059_1810557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1810578_1810944_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1810889_1811465_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274874.1|1811465_1811834_+	hypothetical protein	NA	NA	NA	NA	NA
1810512:1811473	attR	TTATAGCGCTGGATTAACAGTTTCTGACATAATATCAGTAGGTTAAAAAATACAATAAGGAAAAACGATGCCTTCTCCTTACAGTTATGACTTAAGAATTCGAGCACTAAAAATGATTGATGAAGGGATACCTATTACACAAATTTCCAAGCTCTTAAAAATCAGTCGAGACACTCTGCATCGTTGGAAAAATAGGCGTGATCATACAGGAGACGTCAAAGCAAGGTTTGGCTACCAAACGGGCTATAACCATAAAATCAGTGATATGAAAGAATTTCAAAAATTTATTGATCAGAATCCGGGTAAAACTCATCAACAACTCGCTGATCTTTACCCTGTAGAAATGAGTGCAAAAACCATGGGAGTGTGGATTAAAAAATTAGGCTATACCAGAAAAAAAAGAGCTTCAGATACCAAGAACGTGATGCATTAAAGCGGAAAGCTTTCCTGGAAAAAGTCGAGAAAATCGATAACGACAAAATTGTTTATATGGACGAAGCGGGTATGGATGATACTGAGCGTTACGCTTATGGCCACTCTGCTAAAGGTAAACGGTGCTATGCAGAGAAGCCAGGTAAAAAATCAATACGAATTAACTTTATAGGTGGTTTGCGCGGCAAGCAATTTATCGCACCAATGATGGTTGAAGGTTATTGCAATGCTAACGTTTGTCAGGCTTATATCGATCAGTGCTTAATTCCCTGTTTATCTCCTGGAGAGACTGTAATCATGGATAATGCCTCTTTTCACAAATCAAAAGGGGTTAAGGAAGCGATTGAAGATGCGGGTTGTCACTTATTATTTTTACCCCCTTATTCTCCTGATTTAAACCCGATAGAGCATGTATGGTCACCGCTTAAAAATAGGGTTCGCATGAAGCTTGATCAAGATGAAATAAATTTAGAGACAGCGCTTAGTCAAGTAATGAAGTCAATGTCAGAAACTATTCGTTGAGTGCTATA	NA	NA	NA	NA
WP_032126786.1|1812132_1815213_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016211319.1|1815230_1816283_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211316.1|1816815_1817466_+	porin family protein	NA	NA	NA	NA	NA
WP_016211315.1|1817800_1818445_+	porin family protein	NA	NA	NA	NA	NA
WP_054300314.1|1818632_1818968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273532.1|1818928_1819516_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126997.1|1819733_1819973_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_032126998.1|1820294_1820642_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_036774554.1|1820740_1821019_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1821071_1821359_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	1842448	2019836	3165215	integrase,tRNA,transposase,protease	Leptospira_phage(15.0%)	168	1962874:1962933	1966576:1966814
WP_054300307.1|1842448_1843177_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_129556539.1|1843245_1843590_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211983.1|1843837_1844497_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556643.1|1844592_1845957_+	histidine kinase	NA	NA	NA	NA	NA
WP_016212551.1|1846414_1846909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|1847250_1847826_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1847771_1848062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1848075_1848651_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1848596_1848962_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211946.1|1850182_1850938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556540.1|1851156_1851552_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211947.1|1851544_1852690_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_016212202.1|1854378_1855626_+	glutaminase	NA	NA	NA	NA	NA
WP_016209473.1|1856587_1856971_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_016209489.1|1856967_1857699_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_016209497.1|1857701_1858445_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_016209492.1|1858458_1859358_-	GTPase Era	NA	NA	NA	NA	NA
WP_016209466.1|1859363_1860038_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	34.5	8.9e-27
WP_129556644.1|1860443_1861331_-	signal peptidase I	NA	NA	NA	NA	NA
WP_016209482.1|1861381_1863184_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	39.2	5.1e-21
WP_016209457.1|1863483_1864065_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_016209458.1|1864208_1865783_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_155046977.1|1865790_1866111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209486.1|1866229_1866481_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_080664819.1|1866522_1867560_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_016209471.1|1867706_1868033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209462.1|1868042_1868186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209474.1|1868195_1868606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664818.1|1868747_1869083_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016209494.1|1869764_1871789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049139.1|1871858_1872884_-	FUSC family protein	NA	NA	NA	NA	NA
WP_016209455.1|1872876_1873923_-	membrane protein	NA	NA	NA	NA	NA
WP_075273528.1|1874103_1875069_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_016209459.1|1875328_1876495_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016209478.1|1876658_1877612_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_129556645.1|1877703_1879653_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_016209490.1|1879743_1880067_-	YqcC family protein	NA	NA	NA	NA	NA
WP_016209463.1|1880493_1880877_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032126730.1|1881231_1881720_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_016209472.1|1881822_1883193_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_016209456.1|1883306_1884038_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	M1IDP9	Pelagibacter_phage	35.8	5.3e-09
WP_016209491.1|1884062_1885160_-	alanine racemase	NA	NA	NA	NA	NA
WP_016209475.1|1885192_1886614_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	1.7e-152
WP_016209484.1|1886823_1887276_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|1887287_1887515_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_016209481.1|1887564_1887891_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_052047096.1|1888093_1888783_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016209488.1|1888932_1889421_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_016209465.1|1889461_1890562_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_016209460.1|1890608_1891691_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.1	1.0e-72
WP_052133284.1|1891680_1892247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126728.1|1892237_1893542_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209485.1|1893594_1894617_-	chorismate mutase	NA	NA	NA	NA	NA
WP_080664817.1|1894641_1895415_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209496.1|1895444_1895657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209453.1|1895824_1895974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209461.1|1896083_1896548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1896657_1896930_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377873.1|1896941_1897778_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.6e-41
WP_016212058.1|1898420_1899971_-	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_075274880.1|1900126_1901092_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1902087_1902360_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1902371_1903208_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_155097722.1|1903537_1903828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155097723.1|1903824_1903962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779544.1|1903961_1904969_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212247.1|1905335_1906091_+	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1906718_1907693_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300162.1|1908032_1909115_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212246.1|1909218_1909875_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_075274882.1|1910810_1911407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556544.1|1911521_1911878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1911940_1913023_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210771.1|1913114_1916516_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_016210773.1|1916512_1919206_-	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210769.1|1919509_1921012_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_033923762.1|1921312_1921546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1921673_1922483_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_016210772.1|1922566_1924120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1924252_1924552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|1924541_1924706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|1924762_1925128_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210397.1|1925317_1927492_+	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210388.1|1927488_1928163_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210399.1|1928188_1930180_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210390.1|1930194_1930536_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_032126670.1|1930540_1930978_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210394.1|1931003_1932389_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_122940572.1|1932499_1932925_-	flaG family protein	NA	NA	NA	NA	NA
WP_032126669.1|1933043_1934621_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210398.1|1934845_1936438_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210393.1|1936638_1938840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210391.1|1938933_1939884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210396.1|1939951_1940140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211164.1|1940277_1940655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1940697_1941213_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211169.1|1941212_1942160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211168.1|1942143_1942803_-	wbqC-like family protein	NA	NA	NA	NA	NA
WP_016211165.1|1942799_1943528_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307350.1|1943517_1944264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664856.1|1944247_1945312_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_016211172.1|1945500_1946697_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211167.1|1946746_1947868_-	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	1.5e-10
WP_016211170.1|1948499_1948670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126750.1|1948828_1949626_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_054300295.1|1949906_1950131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556646.1|1950941_1952327_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_016211278.1|1952378_1953638_-	threonine synthase	NA	NA	NA	NA	NA
WP_016211277.1|1953624_1954593_-	homoserine kinase	NA	NA	NA	NA	NA
WP_016211279.1|1954606_1957075_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_075274886.1|1957818_1958880_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274888.1|1959151_1959487_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081007004.1|1959491_1959947_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1959906_1960245_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|1960402_1960567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1960556_1960856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212209.1|1961311_1962313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556545.1|1962567_1962909_-	hypothetical protein	NA	NA	NA	NA	NA
1962874:1962933	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_075274890.1|1963113_1963794_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_098082828.1|1963863_1964121_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377874.1|1964289_1964757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049141.1|1965217_1966403_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.6e-58
WP_155046738.1|1966412_1966553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556547.1|1966829_1967390_-	reverse transcriptase	NA	NA	NA	NA	NA
1966576:1966814	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTACGTGCCTTGAATCGGCACACTCCACTACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGCCTTTCGCAACTCCGCTCTGCTAAAAACCCGAA	NA	NA	NA	NA
WP_054300287.1|1967798_1968128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1968149_1968515_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1968460_1969036_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274733.1|1969054_1969372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1969422_1970259_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1970270_1970543_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211421.1|1971401_1971626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210013.1|1972812_1974480_-	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_122941582.1|1974636_1975620_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_122941592.1|1975714_1976566_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_016210019.1|1976823_1977858_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_032126616.1|1977922_1978282_-	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210007.1|1978337_1978910_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210023.1|1978887_1980945_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210021.1|1980941_1982267_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210004.1|1982527_1983169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|1983368_1984124_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210027.1|1984513_1985110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210005.1|1985189_1987994_+	response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	2.4e-57
WP_016210012.1|1987974_1988646_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210009.1|1988721_1988928_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_016210025.1|1988920_1990291_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210020.1|1990555_1990711_-	putative membrane protein	NA	NA	NA	NA	NA
WP_016210016.1|1991311_1992271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273518.1|1992437_1992731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210017.1|1992806_1993190_-	hpt domain protein	NA	NA	NA	NA	NA
WP_016210010.1|1993365_1993542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046739.1|1995186_1995327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556549.1|1996211_1997098_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210524.1|1997636_1998167_-	exsB family protein	NA	NA	NA	NA	NA
WP_016210522.1|1998177_1999230_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210518.1|1999245_2001285_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210525.1|2001271_2002090_-	ZipA protein	NA	NA	NA	NA	NA
WP_032126504.1|2002156_2005696_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210517.1|2005809_2006529_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_016210521.1|2007542_2009480_+	his Kinase A domain protein	NA	NA	NA	NA	NA
WP_016210519.1|2009715_2010483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|2010472_2010817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274897.1|2011329_2012196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|2012436_2012802_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|2013475_2014450_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209449.1|2014623_2016096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209448.1|2016537_2017869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209432.1|2018126_2019836_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 22
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	2052349	2104515	3165215	tRNA,transposase,protease	Orpheovirus(18.18%)	52	NA	NA
WP_016209424.1|2052349_2053627_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209433.1|2053726_2054101_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209412.1|2054185_2055073_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209436.1|2055130_2055859_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_129556555.1|2055855_2056986_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209444.1|2057116_2057545_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_032126508.1|2057639_2057999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209447.1|2057988_2059200_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016209421.1|2059196_2059985_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209411.1|2060147_2060942_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_054300271.1|2061147_2062122_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046761.1|2062548_2062722_+	phosphatase	NA	NA	NA	NA	NA
WP_075274901.1|2062866_2063880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2063883_2064183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2064172_2064337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2064393_2064759_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211553.1|2065098_2065839_-	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_016211549.1|2065842_2068347_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211548.1|2068609_2069566_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211550.1|2069549_2070311_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_075274903.1|2070388_2071264_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2071388_2071634_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016211262.1|2071693_2073967_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_075273504.1|2074021_2074375_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|2074564_2074858_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_032126515.1|2075030_2075210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307354.1|2075285_2075861_-	DedA family protein	NA	NA	NA	NA	NA
WP_032126514.1|2076143_2077460_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2077470_2077839_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016211265.1|2077869_2078532_-	adenylate kinase	NA	NA	NA	NA	NA
WP_032126362.1|2078706_2079072_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556556.1|2079017_2079593_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126519.1|2079760_2080480_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_016211478.1|2080459_2081275_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126518.1|2081291_2083493_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211474.1|2083575_2084925_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_016211473.1|2084999_2085599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211476.1|2085582_2085792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211931.1|2086109_2087297_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211932.1|2087492_2088782_+	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_054300152.1|2089192_2089558_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210558.1|2091194_2091950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210562.1|2092023_2093676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300273.1|2093704_2095243_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.2	5.1e-70
WP_016210560.1|2095242_2096943_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_081007068.1|2097031_2098207_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_016210559.1|2098245_2099208_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_016210566.1|2099568_2099991_-	universal stress protein	NA	NA	NA	NA	NA
WP_016210568.1|2100296_2100938_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210561.1|2101065_2102400_+	dihydroorotase	NA	NA	NA	NA	NA
WP_032126397.1|2102514_2103105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2103453_2104515_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	2112359	2157065	3165215	tRNA,transposase	Staphylococcus_phage(22.22%)	47	NA	NA
WP_129556558.1|2112359_2113253_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126170.1|2113416_2113689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211040.1|2113916_2115128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211037.1|2115478_2116108_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211042.1|2116156_2117173_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211035.1|2117419_2117635_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211043.1|2117687_2118137_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211039.1|2118216_2119962_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211036.1|2120053_2121925_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_054300271.1|2122272_2123247_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211094.1|2123266_2123590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|2124654_2127135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211092.1|2127178_2128471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307348.1|2128706_2131463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211519.1|2132618_2133038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|2133038_2133740_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|2134000_2134207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|2134436_2134742_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|2134920_2136918_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2136901_2137948_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|2138655_2139507_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|2139507_2140428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|2140838_2141123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377876.1|2141114_2141570_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2141529_2141868_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2142080_2143010_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2143166_2143595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556560.1|2143675_2144212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2144181_2145087_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2145277_2145886_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_081007013.1|2145926_2146226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2146215_2146380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274909.1|2146763_2147090_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2147188_2147764_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2147709_2148075_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556499.1|2148245_2149398_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211971.1|2149604_2150216_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2150236_2151433_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2151529_2151670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2151682_2152087_-	SufE family protein	NA	NA	NA	NA	NA
WP_075273313.1|2152212_2152551_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556562.1|2152510_2152813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|2152957_2153143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|2153712_2154294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556649.1|2154321_2155179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|2155718_2156246_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_075273327.1|2156489_2157065_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	2178264	2228011	3165215	tRNA,transposase,protease	Staphylococcus_phage(33.33%)	47	NA	NA
WP_016209884.1|2178264_2178888_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2178964_2179165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2179306_2180005_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2180151_2180721_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2181035_2181659_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2181867_2182470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|2182541_2182907_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046744.1|2182963_2183137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556564.1|2184306_2184636_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273603.1|2185792_2185969_+	phosphatase	NA	NA	NA	NA	NA
WP_129556565.1|2186092_2186488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126686.1|2187957_2188542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274914.1|2189092_2189968_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_059372565.1|2190016_2190388_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556566.1|2190296_2190500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210465.1|2191007_2191850_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2191900_2192248_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2192438_2193326_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2193440_2194043_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2194039_2194759_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_075275113.1|2194827_2196537_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_016210464.1|2196687_2198625_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2198733_2199786_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2199785_2200061_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2200141_2200690_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210459.1|2203764_2204283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212492.1|2204487_2205342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049145.1|2205391_2206366_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_033923740.1|2206424_2206712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155097724.1|2206959_2207883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211716.1|2207896_2208820_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126595.1|2208767_2209424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|2209726_2210554_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_052133280.1|2210994_2211366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126590.1|2211558_2213091_+	nuclease	NA	NA	NA	NA	NA
WP_032126591.1|2213153_2214491_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_016210313.1|2214633_2216100_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210314.1|2216096_2217146_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_016210306.1|2217269_2219378_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|2219542_2219947_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2220007_2220733_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210307.1|2220818_2221709_+	YicC family protein	NA	NA	NA	NA	NA
WP_032126592.1|2221749_2222370_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.3	2.5e-20
WP_016210310.1|2222430_2222637_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_016210316.1|2222658_2224812_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.1e-12
WP_016210317.1|2224818_2226801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2227036_2228011_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 25
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	2234740	2280663	3165215	transposase	Staphylococcus_phage(50.0%)	52	NA	NA
WP_075274916.1|2234740_2235802_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212177.1|2236797_2236971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2237047_2237305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2237417_2237993_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2237938_2238304_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2239338_2239914_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274918.1|2239859_2240225_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212205.1|2240908_2241088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|2241227_2242673_+	MFS transporter	NA	NA	NA	NA	NA
WP_016212319.1|2243231_2243459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2243445_2243772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2243773_2244205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|2244733_2245795_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210831.1|2245889_2246435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2246704_2247724_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2247710_2248133_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2248134_2248608_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|2248723_2249347_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|2249376_2250051_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2250056_2251205_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2251201_2251663_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2251738_2252989_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2253115_2254795_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2254904_2255771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274920.1|2257201_2257936_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	4.8e-10
WP_016211000.1|2258031_2258817_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2258960_2259647_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2259680_2260079_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2260242_2260548_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|2260625_2260880_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2261033_2262695_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2262754_2263438_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2263437_2264526_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2264574_2267211_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300237.1|2267623_2268685_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556568.1|2268874_2270356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2270392_2270968_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|2270913_2271204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2271217_2271793_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2271738_2272104_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212450.1|2272259_2273162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2273205_2274180_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211507.1|2274493_2275813_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|2275816_2276533_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|2276529_2277171_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_075274921.1|2277163_2277262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274922.1|2277239_2277536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211503.1|2277546_2278002_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|2278056_2278401_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2278430_2279474_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|2279888_2280098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2280087_2280663_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	2349866	2409477	3165215	tRNA,transposase	Planktothrix_phage(16.67%)	57	NA	NA
WP_129556571.1|2349866_2350577_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2350605_2351010_+	RidA family protein	NA	NA	NA	NA	NA
WP_016209567.1|2352125_2352743_-	MFS transporter	NA	NA	NA	NA	NA
WP_155046949.1|2352813_2352984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126712.1|2353177_2353636_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2354380_2355391_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2355875_2356787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2357112_2360607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2360644_2361484_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_016209564.1|2361670_2361886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2361934_2362510_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2362506_2362845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2363013_2364003_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2364003_2364966_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_016209559.1|2364975_2365878_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300271.1|2365921_2366896_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2367033_2367267_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2367360_2367726_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2367782_2367947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2367936_2368236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212572.1|2368293_2368686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2368815_2369181_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2369237_2369546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2369637_2370213_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2370158_2370524_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|2370676_2370949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212514.1|2371359_2371497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2371515_2372352_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2372363_2372636_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126774.1|2372791_2373127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2373286_2374819_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2374851_2375691_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2375687_2376185_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211412.1|2376188_2377181_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211408.1|2377295_2378642_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2378865_2379927_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2380005_2381151_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|2387250_2388108_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2388094_2389018_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211368.1|2389214_2390606_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2390652_2391696_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2391738_2392182_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2392314_2393505_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2393559_2393706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|2394257_2395175_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2395442_2395736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2395812_2396007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212197.1|2397025_2397943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2398408_2399251_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2399318_2399969_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|2399983_2401024_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|2401146_2402232_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2402258_2403368_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2403384_2403702_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2403698_2404058_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_080664847.1|2407389_2408343_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_075274927.1|2408415_2409477_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	2447461	2511089	3165215	tRNA,transposase	Staphylococcus_phage(37.5%)	60	NA	NA
WP_036771330.1|2447461_2448436_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_129556574.1|2448732_2449086_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211760.1|2449138_2450518_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211761.1|2450624_2452616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274928.1|2453031_2454006_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	5.2e-28
WP_016209674.1|2454235_2455069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126406.1|2455252_2456731_-	nuclease	NA	NA	NA	NA	NA
WP_155049159.1|2457171_2458968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209671.1|2459050_2459278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556575.1|2459345_2460314_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_032126407.1|2460289_2460700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209685.1|2460704_2461040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556656.1|2461041_2461569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556657.1|2462054_2462495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209678.1|2462596_2465815_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_129556576.1|2465854_2466709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209670.1|2466677_2469686_-	ATPase AAA	NA	NA	NA	NA	NA
WP_032126408.1|2469688_2470114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209688.1|2470145_2470727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209684.1|2470726_2471770_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_016209692.1|2471772_2472252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047060.1|2472260_2474564_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_032126410.1|2474592_2474832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209677.1|2474852_2475959_-	type II/IV secretion system family protein	NA	NA	NA	NA	NA
WP_016209693.1|2475951_2476698_-	type IV secretion system protein DotC	NA	NA	NA	NA	NA
WP_016209695.1|2476690_2477194_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_032126411.1|2477257_2477692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209680.1|2477706_2478744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209681.1|2478759_2479740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556659.1|2479745_2480891_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209676.1|2480947_2481787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209672.1|2482300_2482726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209690.1|2482828_2485516_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_016211689.1|2486102_2487242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211690.1|2487317_2489474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556660.1|2489759_2490512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211688.1|2490697_2490916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211600.1|2491064_2491583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211601.1|2491918_2492341_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	37.3	1.1e-22
WP_016211597.1|2492646_2494017_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.8	2.6e-110
WP_016211595.1|2494374_2494842_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211599.1|2494854_2495865_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_080664865.1|2496060_2496537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2496533_2497370_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2497381_2497654_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211743.1|2497720_2498083_-	ABC transporter membrane domain protein	NA	NA	NA	NA	NA
WP_129556577.1|2498069_2499098_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	4.8e-16
WP_016211744.1|2499075_2499480_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_016211742.1|2499710_2501690_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054300202.1|2501969_2502698_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|2502787_2503399_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016210955.1|2503755_2504010_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2504108_2505893_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_016210956.1|2505981_2506701_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|2506883_2507090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210948.1|2507089_2507326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2507338_2507716_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2508222_2509041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210947.1|2509134_2509332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|2510360_2511089_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
>prophage 28
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	2514724	2622560	3165215	integrase,tRNA,transposase,protease	Escherichia_phage(34.15%)	102	2597419:2597478	2605660:2605947
WP_075274931.1|2514724_2515453_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211816.1|2516521_2516875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2516916_2518530_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2518751_2518973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274933.1|2519281_2520010_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2520626_2521724_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2521757_2523008_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_075274934.1|2523495_2524164_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.0	2.8e-41
WP_016212193.1|2524286_2524625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2524692_2525079_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2525075_2525321_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300202.1|2525729_2526458_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211625.1|2526941_2527811_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_016211621.1|2527807_2529157_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	4.6e-75
WP_016211623.1|2529269_2530910_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_016211987.1|2532731_2534468_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_144019359.1|2534629_2534827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2534971_2535700_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_098082825.1|2535763_2536072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2536064_2536397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2536400_2536970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211655.1|2537098_2537512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211652.1|2537771_2538977_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211653.1|2539084_2540110_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_054300202.1|2540201_2540930_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_033923779.1|2541142_2541979_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2541990_2542263_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155049161.1|2542313_2542823_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036780855.1|2542797_2543295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|2544060_2544789_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155049878.1|2544831_2545407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211047.1|2545485_2547120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2547481_2547985_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2547947_2548655_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2548723_2549584_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_016211045.1|2549564_2550338_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2550368_2551622_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2551621_2552584_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2552627_2553380_+	ComF family protein	NA	NA	NA	NA	NA
WP_016210615.1|2555755_2556226_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2556271_2556511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274938.1|2556529_2557036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2557199_2558624_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|2558688_2559738_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2560004_2560784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2560827_2561730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210625.1|2561788_2562535_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_016210616.1|2562783_2565594_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_129556661.1|2565894_2566458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2566446_2567175_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2567264_2567471_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212263.1|2567633_2568227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212264.1|2568272_2568866_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	5.4e-28
WP_016212238.1|2569381_2570671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274939.1|2570700_2571429_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.8e-42
WP_087910645.1|2571541_2572694_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274940.1|2572722_2573403_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	2.0e-42
WP_016211997.1|2573758_2574868_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.5	4.4e-07
WP_016211996.1|2574869_2575817_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_075274941.1|2576200_2576929_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.2e-42
WP_075275114.1|2576958_2577321_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212339.1|2577473_2578220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274942.1|2578238_2578967_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	2.7e-45
WP_032127022.1|2579643_2581830_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2581891_2583045_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2583330_2583855_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|2584045_2584213_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|2584157_2584874_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
WP_032126817.1|2585230_2586052_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211722.1|2586061_2589364_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_016211321.1|2589744_2590905_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211323.1|2591078_2592176_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211325.1|2592165_2593686_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211322.1|2593748_2594339_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211324.1|2594874_2595429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155097725.1|2596231_2596666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274945.1|2596810_2597161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|2597385_2597535_+	hypothetical protein	NA	NA	NA	NA	NA
2597419:2597478	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_016212659.1|2597679_2597925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046748.1|2598012_2598318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212294.1|2598669_2599014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274946.1|2599027_2599471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|2599692_2599917_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_016212230.1|2599972_2601421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2602954_2603143_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556589.1|2604544_2604820_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2604822_2605425_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_016212522.1|2605521_2605776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|2606320_2607400_+	hypothetical protein	NA	NA	NA	NA	NA
2605660:2605947	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_016211874.1|2607718_2609437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2609480_2610386_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046750.1|2611630_2611768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2612954_2613530_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_016210050.1|2613605_2614481_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210054.1|2614545_2615067_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210069.1|2615051_2616134_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.6e-20
WP_016210051.1|2616374_2616779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2617203_2617935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2618191_2619493_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2619634_2620303_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2620746_2621343_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2621363_2622560_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
>prophage 29
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	2651200	2685654	3165215	tRNA,transposase	Microbacterium_phage(20.0%)	38	NA	NA
WP_054300282.1|2651200_2651665_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377880.1|2651721_2652201_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2653058_2653454_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|2653450_2654245_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211756.1|2654423_2655149_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2655394_2656582_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_081377344.1|2656936_2658064_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210935.1|2658394_2658937_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2658933_2659620_-	acireductone synthase	NA	NA	NA	NA	NA
WP_016210942.1|2659623_2660235_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2660281_2661301_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2661402_2662197_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2662234_2663041_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2663119_2664169_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2664366_2665626_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2665672_2666350_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2666435_2666717_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|2666808_2667996_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_129556549.1|2668103_2668990_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210820.1|2669191_2670133_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2670636_2670861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2671152_2671857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|2672320_2672959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2673293_2673824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779158.1|2673820_2675353_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2675349_2676300_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2676719_2677352_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2677594_2677792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2678141_2678570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307340.1|2678647_2679346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274949.1|2679323_2680385_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2680609_2680906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|2681010_2681667_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2681890_2682388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377881.1|2683304_2683472_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377882.1|2683478_2683760_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2683719_2684058_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210986.1|2684115_2685654_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	1.3e-86
>prophage 30
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	2743350	2826669	3165215	tRNA,transposase,protease	unidentified_phage(21.43%)	82	NA	NA
WP_075273298.1|2743350_2743926_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923659.1|2744063_2744672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307321.1|2744734_2745283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209980.1|2745369_2746536_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.7e-25
WP_032126286.1|2746841_2749640_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	4.9e-180
WP_016209981.1|2749698_2750919_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	8.5e-36
WP_016209998.1|2750948_2751350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209994.1|2752016_2752304_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_016209985.1|2752460_2752799_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_016209995.1|2752833_2754471_-	response regulator	NA	NA	NA	NA	NA
WP_016209992.1|2754572_2755622_+	WD domain, G-beta repeat family protein	NA	NA	NA	NA	NA
WP_016209988.1|2755694_2756339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556662.1|2756335_2757583_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_016209986.1|2757588_2758878_-	ubiquinone biosynthesis hydroxylase UbiH/UbiF/VisC/COQ6 family protein	NA	NA	NA	NA	NA
WP_016209989.1|2758902_2759493_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_016209996.1|2759637_2759862_+	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_016209991.1|2759842_2760172_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_033923658.1|2760397_2760961_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209997.1|2760995_2761457_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_016209977.1|2761533_2763219_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_032126288.1|2763268_2764069_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_016210000.1|2764095_2764644_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_016209993.1|2764773_2765166_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016209990.1|2765222_2765627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556594.1|2765659_2766427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2766892_2767954_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2768044_2768791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274953.1|2768915_2769779_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2770022_2770385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377902.1|2770571_2771099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2771243_2771660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2773431_2774343_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2774394_2775243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2775687_2776398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2776489_2777458_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2777445_2778093_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_016210370.1|2778121_2778973_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2778987_2780265_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2780305_2780821_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210372.1|2780899_2781961_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2781982_2783071_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_016210378.1|2783115_2784951_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2784993_2785464_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2785500_2785836_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2785848_2786565_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2786501_2787518_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2787514_2787994_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2788077_2790558_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2790620_2790986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273456.1|2791363_2791663_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2791622_2792078_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2792092_2792383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210570.1|2792448_2794047_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2794177_2794513_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_016210578.1|2794540_2796205_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	7.1e-33
WP_016210581.1|2796201_2796846_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2796845_2797589_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2797647_2797887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2798037_2799405_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2799415_2799967_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2800047_2801031_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2801152_2802910_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2803132_2803723_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2803810_2804230_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_016210580.1|2804370_2804631_+	methyltransferase	NA	NA	NA	NA	NA
WP_075274955.1|2804706_2805681_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_075274956.1|2805723_2806092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2806152_2806938_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075274955.1|2808323_2809298_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212084.1|2809579_2810596_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2810595_2811111_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2811152_2811626_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_052133268.1|2811783_2812065_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	40.2	3.1e-10
WP_129556741.1|2812086_2812758_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.4	3.4e-10
WP_016212306.1|2812793_2813324_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2813353_2813809_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_129556598.1|2816358_2818872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211935.1|2819806_2822455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274958.1|2822903_2823965_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2823991_2824567_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2824512_2824878_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556599.1|2825516_2826669_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 31
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	2939230	2983576	3165215	transposase,protease	Acanthamoeba_polyphaga_lentillevirus(14.29%)	43	NA	NA
WP_016209259.1|2939230_2940079_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_016209274.1|2940195_2941107_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_075274963.1|2941825_2942887_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212454.1|2943106_2943787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211192.1|2944575_2945934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211189.1|2945978_2946437_-	NfeD family protein	NA	NA	NA	NA	NA
WP_016211187.1|2946461_2947382_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_016211186.1|2947508_2948291_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.3	8.2e-32
WP_016211190.1|2948380_2949880_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_016211188.1|2950201_2952085_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_075273298.1|2952158_2952734_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2952679_2953045_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211157.1|2953609_2954266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211161.1|2954373_2955483_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2955494_2956139_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2956157_2957144_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2957223_2958300_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2958502_2959327_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2959643_2960648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2960856_2961822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274965.1|2961960_2962836_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2963132_2964185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2964452_2964881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2965094_2965586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2965641_2966892_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2966994_2967213_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_052104629.1|2967655_2968681_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080728341.1|2969130_2969301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212561.1|2969272_2969413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210728.1|2970327_2970798_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2971086_2972466_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2972493_2972952_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2972929_2974147_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2974338_2974575_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2974588_2974744_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2974824_2975787_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2975946_2977263_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2977272_2977941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2978303_2980118_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_081007013.1|2980538_2980838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2980827_2980992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2981048_2981414_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052104629.1|2982550_2983576_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP038891	Piscirickettsia salmonis strain Psal-005 chromosome, complete genome	3165215	3015260	3132687	3165215	tRNA,transposase	Staphylococcus_phage(33.33%)	112	NA	NA
WP_054300271.1|3015260_3016235_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|3016310_3017330_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047000.1|3017377_3017524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556602.1|3017728_3017938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274966.1|3019929_3020991_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|3021071_3021380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|3021494_3022811_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664857.1|3023272_3024559_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|3024631_3025528_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|3025614_3026613_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|3026721_3027246_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|3027493_3028732_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|3029279_3029753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|3029749_3030145_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3031074_3031650_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3031595_3031961_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211610.1|3032225_3034556_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_129556603.1|3034676_3036692_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075274967.1|3036875_3040268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3040332_3040638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274968.1|3040807_3041908_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|3042302_3043412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209721.1|3044350_3045748_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.3e-77
WP_051307313.1|3045867_3046815_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3046811_3047327_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3047313_3048513_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3048509_3048833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3048834_3050064_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3050063_3051107_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3051106_3051790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3051786_3054276_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3054292_3054547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3054547_3054904_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3055683_3056847_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3056866_3059974_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3059975_3061481_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3061508_3061790_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3061938_3062280_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3062399_3064280_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3064364_3065963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3065980_3067096_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3067223_3068222_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|3068225_3068984_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3068985_3070185_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3070168_3070840_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3070861_3071638_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3071641_3072640_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3072641_3073220_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3073216_3074686_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3074729_3075017_-	trp operon repressor	NA	NA	NA	NA	NA
WP_016209699.1|3075217_3075814_+	DMT family transporter	NA	NA	NA	NA	NA
WP_075274970.1|3076023_3076494_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3076550_3076706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274971.1|3076850_3077303_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3077488_3077710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|3077825_3078458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274972.1|3078435_3079497_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211865.1|3079936_3080476_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3080560_3081097_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3081748_3082051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3082500_3082809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274973.1|3083399_3083867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3084149_3084860_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3085086_3085485_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|3086352_3087303_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3087302_3089381_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3089528_3090044_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3090052_3090616_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3090596_3091343_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3091482_3091935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3092358_3093195_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3093191_3094088_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3094120_3095188_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3095206_3095575_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3095600_3097049_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3097058_3098438_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3098478_3099810_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3099781_3100741_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3100833_3101337_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3101471_3102623_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3102619_3103099_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3103245_3105567_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3105511_3106138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3106142_3107042_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3107114_3107693_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3107993_3108251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556611.1|3108259_3109413_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155049899.1|3110097_3110241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046758.1|3110549_3110681_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3110825_3110981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212051.1|3111308_3112082_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054300271.1|3113409_3114384_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3115478_3115817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212337.1|3115833_3116544_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_051307375.1|3116531_3116723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|3116884_3117184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3117173_3117338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3117394_3117760_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3119064_3119760_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3119756_3121184_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3121209_3121473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3121833_3122808_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556612.1|3122866_3123717_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3123754_3124099_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3124095_3124932_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3124932_3125274_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3125275_3125881_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3125877_3127872_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3127891_3128833_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211292.1|3129060_3130485_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3130997_3131972_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3132030_3132687_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038892	Piscirickettsia salmonis strain Psal-005 plasmid unnamed1, complete sequence	158589	2892	100909	158589	capsid,transposase,tail,head,integrase	Streptococcus_phage(26.67%)	112	NA	NA
WP_054300202.1|2892_3621_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155049199.1|3589_3835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047019.1|4324_4477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273751.1|4489_6220_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300477.1|6379_7108_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	7.1e-38
WP_155047020.1|7264_8188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275154.1|8428_9085_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.7	7.6e-31
WP_054300202.1|9214_9943_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155049201.1|10187_10808_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_054300202.1|10855_11584_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126843.1|11887_12067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126844.1|12285_12582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212118.1|12676_13138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|15300_16275_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556704.1|16768_17098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|17600_18437_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|18448_18721_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212122.1|19208_19910_+	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_016212121.1|19863_20787_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_032126205.1|21220_21586_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556705.1|21531_22032_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	28.0	9.9e-07
WP_036771330.1|22090_23065_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_054300162.1|23577_24660_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212151.1|25024_25987_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|26010_26325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923686.1|26381_27431_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|27539_28580_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|28593_29223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|29313_29613_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_081377909.1|29609_30074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|30826_31555_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126832.1|31799_32708_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_054300202.1|32818_33547_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046765.1|33658_33853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|34739_35468_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|35671_38248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|38653_39628_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075274931.1|39828_40557_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.4e-38
WP_016212137.1|41000_42062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212139.1|42137_42383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307371.1|42354_42969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|43786_44761_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556707.1|45120_46140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|46768_47922_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126239.1|48066_48339_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|48350_49187_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075275144.1|49219_49951_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|50048_50462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212017.1|50756_51155_+	hypothetical protein	NA	W8VUR5	Pseudomonas_phage	38.8	2.3e-06
WP_047927838.1|51184_51430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|51426_51726_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016212019.1|51882_52578_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_081377351.1|53391_54171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|54254_54407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|54359_54692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|54856_55234_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|55540_55924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|56393_57122_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_129556708.1|57237_57573_-	mRNA-degrading endonuclease	NA	A9D9Y1	Lactobacillus_prophage	35.6	2.6e-11
WP_016212365.1|57565_57808_-	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_054300271.1|58016_58991_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075275142.1|59626_60355_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_075275141.1|60637_62323_+	protein kinase	NA	NA	NA	NA	NA
WP_129556709.1|62534_62624_+	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_129556710.1|62704_63175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275140.1|63328_64063_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.1e-38
WP_075275139.1|64689_64920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212404.1|65534_65768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126756.1|65888_66332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275138.1|66476_66785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047124.1|66989_68651_+	AAA family ATPase	NA	A0A0K2FLP8	Brevibacillus_phage	31.5	9.1e-65
WP_016212457.1|68660_69062_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_016212456.1|69058_69346_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_155097726.1|69389_69803_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126239.1|69858_70131_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|70142_70979_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_155097727.1|71898_72039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155097728.1|72175_72394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|73899_74100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|74110_74686_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|74631_74997_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|75828_77871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|78775_79141_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|79086_79662_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_081377872.1|79675_79966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|79911_80487_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075274752.1|80483_80783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|80818_81972_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_052047048.1|82152_82653_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|82652_82814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211937.1|83083_83473_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_129556711.1|83959_84985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211938.1|85479_86040_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275133.1|86611_86920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|87452_88606_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273327.1|88854_89430_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075275128.1|89375_89741_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556696.1|89840_90857_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.0	3.0e-18
WP_052133287.1|90958_91357_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556716.1|91490_91781_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_016210655.1|91794_92391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210663.1|92709_93021_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210667.1|93017_93341_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210658.1|93333_93729_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210651.1|93725_94076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210664.1|94075_94498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210669.1|94499_94823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|94879_95146_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075273774.1|97347_98505_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275128.1|98646_99012_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|98957_99533_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126790.1|100003_100909_+|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
>prophage 2
NZ_CP038892	Piscirickettsia salmonis strain Psal-005 plasmid unnamed1, complete sequence	158589	105581	153740	158589	transposase,protease,integrase	Acinetobacter_phage(14.29%)	60	114020:114079	137791:138762
WP_075273327.1|105581_106157_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126360.1|106363_107098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|107220_108279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|108787_109534_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|109534_109939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|110332_111148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212298.1|112921_113248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|113488_113965_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
114020:114079	attL	TGATCAGGCTACCCTATTCCGGACAAATAAATTACAATAATCCGAGCCGGAGGAATCACA	NA	NA	NA	NA
WP_075275158.1|114079_114373_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377916.1|114489_115014_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.4	2.5e-29
WP_098082791.1|115218_115521_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.6	8.6e-14
WP_129556698.1|115529_116231_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_016211912.1|116320_116911_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_032126795.1|117183_117444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|117447_117720_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_016211913.1|118045_119167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273786.1|119599_119998_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377915.1|120006_120564_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	2.9e-47
WP_081377914.1|120708_121038_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|121154_121448_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_016212499.1|122446_122821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|123025_123199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|123446_123896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212412.1|123888_124053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|124353_124980_+	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_054300202.1|125085_125814_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_054300590.1|125843_126068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556699.1|126375_126576_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211871.1|126569_126905_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_032126138.1|127470_127734_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211872.1|128288_129092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|129212_129737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273798.1|129845_130070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126346.1|130161_130404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|130470_131211_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_016212413.1|131258_131687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|132020_132749_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_129556700.1|132925_133171_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|133130_133586_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_054300148.1|133691_134753_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728342.1|134792_135296_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032126739.1|135610_135943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556701.1|136189_136714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275159.1|137122_137830_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	32.0	3.8e-12
WP_129556702.1|137850_139003_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
137791:138762	attR	TGATCAGGCTACCCTATTCCGGACAAATAAATTACAATAATCCGAGCCGGAGGAATCACAATGGGAAAGCGTCACGTCACCAAGTACACCGAAGAATTTAAAAAATCATCTGCCAAGCTTGCAGTCGATTCAAATCAAGCAATCAGTCATACAGCACAGGAATTGGGTATTCACTCAAGTACACTGCATGGTTGGGTCAATAAATATCATCCAAACAGTCCAAATACTGTTAAAGATGAAGTTAGTGATATGGCTGCTGAAATAAAACAGTTAAAAAAAGAGTTGGCTAGAGTGACACAGGAACGTGAAATGCTAAAAAAAGCGTCGGCGTACTTTGCAAGCGAAACACAGTAAAGTATGCCTGGATCAAAGAAAATAAATGTGTTTTTCCAGTAGATAGGGTGTGCTCAATCTTAGGTGTTAGCCGATCAGGTTATTACAGTTGGTTAAAGGTACAGCCTTCCAAGCGAATGATAGAGAACCAAAAATTAGCTAGGCGAATCAAGGAAATATTCATCGAAAGCCGTGCAACCTATGGTACTCGAAGAATTAGAAAACAGTTGGCAACACAGGAAATTTCTGTAAGCCGTAAGCGAGTTGGCCGTTTAATGAAGCAGAACCAGCTTTGCTGCAAGATAAAGCGTAAATTCAAAGTAACTACGGATTCTAAACATCGATTGCCAATTGCGAAAAACGTGTTGGACCGGAATTTTTCAGCAACAGGCCCTAACCAAAAATATGTTGGTGATATTACCTACATACGGACCCAACAAGGCTGGTTGTACTTGGCTGTTGTGATTGACTTATTCTCACGAAAAGTTGTTGGCTGGGCCATGGAGGATCATATGGAAGCATCACTCGTCAATGATGCTCTGTTGATGGCCTTATGGAAACGAAAGCCTAAAGCTGGGTTAATTTGGCATTCAGATCGCGGAAGCCAATATGCTTCAGAAAGTCATCGTGAGATTCTTA	NA	NA	NA	NA
WP_075273327.1|139987_140563_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|140508_140874_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212398.1|142221_142683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|142945_143782_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_129556717.1|144107_145334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212260.1|147119_147392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|147411_147636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|147972_148176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212255.1|148172_148343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|148529_149612_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_075273822.1|149768_150269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274741.1|150370_150628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556718.1|150696_151883_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_033923779.1|152619_153456_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|153467_153740_-|transposase	transposase	transposase	NA	NA	NA	NA
