The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	45566	89679	3142869	transposase	Moraxella_phage(16.67%)	45	NA	NA
WP_129556427.1|45566_46142_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|46087_46453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|46651_47413_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_016211195.1|47714_49241_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|49612_50452_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|50491_51799_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|51773_52943_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|52997_53723_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|54001_54391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|54550_55456_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|55531_55675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274979.1|55722_56562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|56554_56890_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_155046698.1|57068_57230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|57346_57640_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_016210704.1|58534_60481_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|61135_64198_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|64194_65259_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|65614_66568_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|66599_67763_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|67768_68368_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|68555_69056_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|69073_70162_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|70588_71833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|71829_72672_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016211096.1|72651_73461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|73639_73867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|73867_74818_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|74873_75425_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|75551_75974_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|75966_76713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|76755_77454_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|77464_78289_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|78618_78987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274980.1|78981_80043_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|80092_80323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|80452_81667_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|81967_83029_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_016211249.1|83042_84770_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_016211245.1|84803_85535_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|85534_86323_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|86427_87051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273383.1|87738_88311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046699.1|88515_89088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274981.1|89082_89679_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	136473	178470	3142869	transposase	Staphylococcus_phage(50.0%)	46	NA	NA
WP_054300271.1|136473_137448_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|137949_139362_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|139854_140862_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|140881_142402_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_129556430.1|142458_142665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211018.1|143640_144957_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|145060_145444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|145578_148644_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|148712_149816_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|149839_150394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|150508_151078_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211020.1|151197_151953_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_054300545.1|152119_153181_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|153575_153971_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|153992_154358_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|154414_154579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|154568_154868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|155120_155486_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|155431_156007_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212607.1|156007_156364_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|156452_157028_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|156973_157339_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|157818_158385_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|158396_159182_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|159813_160737_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|160788_161784_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|161815_162310_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|162401_162659_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|162748_163171_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|163489_164206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|164249_164501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556431.1|164514_165942_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|165969_167412_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|167499_167838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|167922_168453_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|168513_170706_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|170748_171234_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|171503_171935_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_016210245.1|171952_172783_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|172797_172941_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|172971_173856_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|173827_174049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|174222_174501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|175471_176377_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016212383.1|176779_177898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|177894_178470_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	182276	239530	3142869	tail,tRNA,protease,transposase	Escherichia_phage(12.5%)	56	NA	NA
WP_075273327.1|182276_182852_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|182797_183163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|183226_183499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212441.1|183766_183991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372761.1|185006_185456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|185519_186248_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210779.1|186290_187220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|187512_188106_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|188074_188728_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|188905_189877_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|189899_190796_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|190954_191401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210787.1|191397_192039_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|192148_192727_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|193202_193640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|193964_195305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|195568_196963_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075274986.1|198411_199479_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|199531_199954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|200194_200638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|200692_200950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|200927_201554_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|201631_203614_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|203823_205167_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|205433_208103_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|208126_210046_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|210215_211637_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|211782_212757_+	phospholipase A	NA	NA	NA	NA	NA
WP_016209855.1|212788_213184_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209859.1|213186_213408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|213571_215233_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|215305_215596_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_016209861.1|215821_216277_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|216341_216806_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|216898_218245_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|218244_219150_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|219211_220198_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|220190_220433_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|220554_222099_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|222145_223432_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|223474_224869_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|224892_225072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|225068_225644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|225589_225955_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274988.1|226016_228251_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016210079.1|228672_229170_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|229340_230036_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|230138_231701_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|232016_233810_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|233895_234168_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|234173_234800_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|234786_236217_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|236549_237605_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|237573_238251_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|238240_239077_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|239236_239530_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	256927	301882	3142869	tRNA,transposase	Acinetobacter_phage(40.0%)	48	NA	NA
WP_075274991.1|256927_257503_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377888.1|257506_258067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556436.1|258122_259009_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046701.1|259035_259185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|259329_259530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|259577_260039_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|260462_261944_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|262006_263116_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|263213_265175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|265704_266109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|266161_267223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046702.1|267348_267504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|270449_271602_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556437.1|271644_272067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556438.1|272336_273803_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_032126861.1|274006_274321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|274655_275542_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212538.1|275713_276154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210630.1|276683_277799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664846.1|277737_278424_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032126366.1|278417_279395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210638.1|279433_280597_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210640.1|281061_281286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|281671_281959_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210633.1|282133_282889_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|282894_283350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210637.1|283325_283802_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210636.1|283808_285386_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_032126367.1|285389_286154_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210629.1|286207_286744_+	tim44-like domain protein	NA	NA	NA	NA	NA
WP_016210634.1|286740_287472_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_032126368.1|287580_288735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275120.1|288879_289191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664872.1|289514_290495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211898.1|290736_291360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211899.1|291687_291981_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_105962625.1|292077_292964_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046704.1|293575_293728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212296.1|293743_294472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126374.1|294580_295552_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728325.1|295583_295961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211609.1|296614_296923_+	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_032126373.1|296955_299142_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	2.7e-141
WP_016211605.1|299245_299479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|299695_300226_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211607.1|300254_300479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|300661_301477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300526.1|301585_301882_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	329457	375012	3142869	transposase	Hokovirus(33.33%)	46	NA	NA
WP_075273298.1|329457_330033_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210127.1|330085_331111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|331204_331468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|331834_332653_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|332725_335098_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_016210125.1|335810_337238_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|337272_338295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|338311_338689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126491.1|339046_339364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210122.1|339530_340223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|340849_341824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|341813_343586_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|343586_343934_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_032126493.1|344183_345410_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|345499_346798_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664834.1|346831_347191_-	VUT family protein	NA	NA	NA	NA	NA
WP_080664833.1|347236_347581_-	VUT family protein	NA	NA	NA	NA	NA
WP_016210137.1|347561_348113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664832.1|348339_349638_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|349754_350045_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_016212281.1|350356_351811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|352010_352586_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|352531_352897_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212359.1|353632_353851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|354218_355193_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212044.1|355731_355986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|356708_357695_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|357832_358027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664870.1|358709_359357_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_129556444.1|359349_359772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211797.1|359933_361337_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|361387_361963_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|361908_362223_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556445.1|362263_363150_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126227.1|363788_364079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212008.1|364116_364815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212010.1|364831_365128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212007.1|365251_366397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273619.1|366669_367245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211273.1|367302_368136_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.0	3.5e-17
WP_016211268.1|368251_369436_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211271.1|369454_370399_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016211269.1|370703_371489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211272.1|371606_371975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211270.1|372202_373780_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_054300173.1|373950_375012_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	447625	555265	3142869	integrase,tRNA,transposase	Escherichia_phage(45.95%)	103	535384:535443	560125:560988
WP_075275004.1|447625_448489_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|448705_450265_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|450286_451321_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|451369_451939_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|452074_453046_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|453057_454635_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|454700_455687_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016210646.1|456018_457128_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|457233_458418_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|458495_460484_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|460692_460848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|461105_461405_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_075275005.1|461563_461899_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|462815_464222_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|464239_465226_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|465228_466383_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|466379_467075_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|467209_468700_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|468720_469770_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|469836_471231_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|472109_474041_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|474045_474576_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|474610_474805_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|474847_475207_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|475626_476622_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_032126132.1|476634_479016_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|479021_479309_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|479580_480057_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|480201_480399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|480523_481498_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|482398_482497_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210477.1|482981_484271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126626.1|484507_485200_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|485241_486015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|486016_486958_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|487090_488668_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|488877_490635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|491183_491942_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|492149_492722_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|492825_493374_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|493675_493921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|493949_494246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|494513_495437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556451.1|495915_496173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275008.1|496236_496965_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	3.3e-43
WP_098082828.1|497279_497537_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275009.1|497668_498376_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.8	1.3e-44
WP_075275011.1|498419_499148_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.2e-42
WP_032126799.1|499339_500152_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_129556452.1|501272_501620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|501622_503362_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300501.1|503866_504595_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_016212066.1|504955_505732_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016212069.1|505943_506111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212070.1|506085_506685_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_054300500.1|507094_507823_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_075275013.1|507865_508087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300501.1|508171_508900_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|508911_509304_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|509300_509546_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300307.1|510649_511378_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300307.1|511984_512713_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_016212268.1|513357_513942_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|513945_514629_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|514911_515640_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016212159.1|517144_517342_-	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_016212158.1|517609_518524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275019.1|518633_519338_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	9.2e-43
WP_105962625.1|519301_520188_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211714.1|520562_523907_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_144019196.1|523939_524596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|524651_525380_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_075275021.1|525447_526389_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556625.1|526603_527161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126478.1|527153_527492_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.7e-24
WP_032126479.1|527478_527832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212114.1|527828_528059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212110.1|528062_528533_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	62.5	7.6e-33
WP_054300201.1|529179_529908_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_016212024.1|530303_530552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212021.1|530548_531148_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|531147_531366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|531852_532845_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|532841_533576_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_129556453.1|533995_534427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047116.1|534571_534751_-	hypothetical protein	NA	NA	NA	NA	NA
535384:535443	attL	GGGCACTGTTGCAAAAAATTTAGATTTGAGTAGGGTGTAGCAATCAACGGAAGTTAAGAG	NA	NA	NA	NA
WP_054300202.1|535452_536181_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_051307368.1|536838_538119_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|538118_539087_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_032126737.1|541598_542327_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_032126738.1|542527_542800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|542792_543071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212425.1|543274_543865_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.4	1.1e-20
WP_032126150.1|544013_544247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|544345_545320_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_075275025.1|546835_548851_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_016211807.1|549100_549322_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728351.1|549209_549368_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556454.1|549631_551644_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_075275029.1|551812_552541_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	9.6e-43
WP_075275032.1|553284_554094_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	1.1e-15
WP_032126239.1|554144_554417_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|554428_555265_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
560125:560988	attR	GGGCACTGTTGCAAAAAATTTAGATTTGAGTAGGGTGTAGCAATCAACGGAAGTTAAGAGTGAATTGCTGTGGGTAGACGTAAACGATTTAAGAAGAATCAACCCTTTAAATGGAAGCATTATTCCGGTGAGATCATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTACCGTGATCTCAAAGAAATAGCAGCTGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGCTGGGTGCACGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTCTTGGCGGTTAGATGAAACGTTGGTGAAAATCAAAGGTCGTTGGTATTACCTTTATCGAGCCATTGATAAATATGGCCATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTTTTTCAAAAAGGCAATCGCCCAACCTTATGTGAAATCACCGCGTGTTGTGAATGTCGACAAGCACGCTTCATTTCCACCCGCTCACCAAAAAGCCAAAGATGAAGGTGTCTTTTCTAGTCAGTGTAAACTCAGGCGAGTGAAGTATTTAAACAACTGCATTGAAAATGATCACAAAGCGGTAAAGCGCAAATCCCGTTTCCGCCAATGGTACCAATCACTTTCTACAGCACGGCCTACCATTGACATAATGGAAGCGATGCGCATGGTTCAAAAAGGTCAATTACGTTATATTAAAAAACAGAATATCTGTGCCCAAAATCAGCTCATTGATAAATTATTTGGATTAGCTGCTTAATTCTAAGCAGAGAGCACAAGAAAATAACCTTTCTGAAGTTCACTATAATTTTTCGCAACAGTGCCG	NA	NA	NA	NA
>prophage 7
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	560193	604160	3142869	tRNA,transposase	Escherichia_phage(22.22%)	47	NA	NA
WP_054300202.1|560193_560922_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211235.1|561416_561854_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|562283_563672_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211238.1|564114_565608_+	amino acid permease	NA	NA	NA	NA	NA
WP_129556456.1|565809_566559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556457.1|566602_567541_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016211244.1|567524_568220_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_036776715.1|568621_569350_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|569443_570109_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|570173_571130_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|571388_572087_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|572129_573242_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|573846_574422_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|574367_574733_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|574820_575171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|575906_576968_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556458.1|577343_577577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210908.1|578468_579284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|579374_580358_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|580528_581050_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_016210914.1|581083_581335_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210909.1|581340_582618_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_155046712.1|583331_583838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|583957_586270_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|586398_587214_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|587411_587876_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275036.1|588005_589067_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|589327_589624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|589906_591370_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|591372_592425_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211494.1|592414_592870_+	arginine repressor	NA	NA	NA	NA	NA
WP_016211487.1|592894_593218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|593565_593877_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_032126201.1|594006_594753_+	lipoprotein	NA	NA	NA	NA	NA
WP_054300148.1|594774_595836_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|595946_596921_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126197.1|597061_598015_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|598128_598326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|598571_598772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212072.1|598801_598999_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212074.1|599085_599307_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|599333_599699_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275038.1|599644_600235_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046713.1|600372_600537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|600831_602268_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|602309_603761_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|603872_604160_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	640121	740750	3142869	tRNA,plate,protease,transposase	Prochlorococcus_phage(17.65%)	104	NA	NA
WP_016209523.1|640121_641471_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|641521_641959_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|642220_643732_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_032126188.1|643737_644964_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|644957_645986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|645963_646656_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_016209516.1|646660_648130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556464.1|648119_648611_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|648616_650089_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|650088_650487_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|650483_652172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|652153_653110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|653152_653668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|653772_654705_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|654924_655311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|655327_655972_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|656152_656992_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|657067_657670_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|657670_658525_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|658881_659193_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|659217_660609_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|660764_661496_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_129556465.1|661492_662065_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|662051_662609_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|662614_663595_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|663734_664535_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_129556466.1|664538_665306_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|665302_665767_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|665789_666443_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|666446_666794_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|666827_667079_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|667153_668422_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|668424_669183_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|669244_670135_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|670185_670869_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|670954_671212_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_075275046.1|671484_673698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|673689_674562_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|674729_676559_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|676722_677364_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|677605_678136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|678153_678327_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|678385_679435_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|679441_680392_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|680445_681390_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|681417_682155_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|682243_682486_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|682560_683784_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|683815_684664_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|684660_685713_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|685833_686454_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_016210407.1|686469_687456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080743011.1|687566_688022_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556469.1|687981_688290_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|689083_689989_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275050.1|690064_690760_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275052.1|690904_691414_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|691463_691673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|692907_693354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|693357_693933_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275054.1|693878_694244_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|694364_694550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|694653_695688_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|695684_696395_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|696869_697388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|697505_697838_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209920.1|697867_700822_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209912.1|700867_701365_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|701424_701841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|701932_702793_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|702875_703442_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|703474_704329_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_016209914.1|704370_707277_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|707337_707535_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|707541_708552_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|708548_709607_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|709600_710401_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|710403_711222_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|711233_712181_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|712188_713490_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|713668_714772_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|714768_715161_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|715172_716549_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|716542_718012_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209916.1|718203_719175_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	3.7e-34
WP_129556470.1|719411_720298_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|720597_720843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|721391_722126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|722250_723312_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|723634_724339_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|724432_725146_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|725228_726320_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|726391_726973_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|726978_727605_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|727701_728637_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|728996_729668_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210598.1|729809_730469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|730637_731897_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|731893_732979_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|732971_733853_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|733841_735092_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_075275125.1|736683_737727_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|739863_740229_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|740174_740750_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	776180	822866	3142869	tRNA,transposase	Staphylococcus_phage(28.57%)	39	NA	NA
WP_016209374.1|776180_777632_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|777667_779197_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_016209380.1|779772_780195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556473.1|780327_781416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126585.1|781957_782878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|783228_784044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|784335_787026_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_080664814.1|787274_788495_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|788662_790369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|790967_792194_+	MFS transporter	NA	NA	NA	NA	NA
WP_075274832.1|792776_793751_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_075273456.1|793873_794173_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|794132_794588_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212416.1|794589_795120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212417.1|795243_795489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|795539_795905_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|795850_796426_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052047106.1|796499_796976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|797691_798057_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|798002_798578_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300173.1|798604_799666_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556627.1|799718_800324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211819.1|800542_800773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|801069_801570_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|801772_803029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211822.1|803385_803799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|804108_805170_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275065.1|805469_806144_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.9e-10
WP_016212172.1|807034_808507_+	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|808526_809501_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|809651_809927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|810092_810713_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_016210737.1|811031_813008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|813163_814621_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|814689_816270_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210744.1|816310_816796_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|816892_820789_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|820795_821119_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300173.1|821804_822866_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	839553	894006	3142869	protease,transposase	Staphylococcus_phage(15.38%)	45	NA	NA
WP_033923708.1|839553_840429_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|840684_841329_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|841359_843165_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|843188_843764_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556476.1|844308_845319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|845414_846389_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016209640.1|846807_847827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|848285_849251_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|849295_849871_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|849901_851176_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|851802_852516_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|852595_853333_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|853453_854809_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|854985_855657_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|855772_856648_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|857251_858556_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|858668_859274_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|859355_860657_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|860724_863157_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|863260_863533_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_032126162.1|863636_865514_+	SurA domain-containing protein	NA	NA	NA	NA	NA
WP_016209643.1|865545_866430_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|866438_866834_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|867261_869409_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|869380_870730_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|870726_872847_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|872843_874547_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209654.1|874665_875808_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|875872_876901_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_129556477.1|877060_878542_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|878631_879117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275067.1|879449_880517_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273512.1|881272_881617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|881753_882728_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126362.1|882899_883265_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051307360.1|884104_885034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211512.1|886125_886932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|887274_889167_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|889453_889858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923634.1|890062_890611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|890600_891487_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|891825_892236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556479.1|892449_892632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274918.1|893119_893485_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|893430_894006_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	900256	963093	3142869	integrase,transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(14.29%)	58	892616:892675	909900:910339
892616:892675	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_032126152.1|900256_900847_-|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016212424.1|901049_901328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|901320_901593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|901737_902820_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211300.1|902870_903911_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_129556480.1|904422_909912_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|909935_910910_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
909900:910339	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTA	NA	NA	NA	NA
WP_016212302.1|911223_911523_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_129556481.1|911707_912139_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_054300162.1|912396_913479_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211579.1|913702_914188_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|914255_915164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211581.1|915440_916211_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.9	8.9e-31
WP_016211585.1|916329_916887_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016211582.1|916948_917728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|917825_918179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|918245_918440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|918455_918800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|919157_919733_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|919678_920044_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275068.1|920128_920719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047108.1|920820_921219_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212107.1|922030_923167_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046716.1|923571_923718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|924415_924970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|925406_925589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210541.1|925653_925881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|926111_926858_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|927084_927378_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|927449_928055_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|928203_929181_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_032126547.1|929277_930720_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|930746_931400_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_016210552.1|931524_932091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|932445_934224_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_016210542.1|934295_936002_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.9	2.5e-25
WP_054300262.1|935993_936284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|936746_937112_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|937057_937633_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|937636_938011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275071.1|938386_939361_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_054300264.1|939463_939802_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300265.1|939946_940207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556469.1|940166_940475_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556484.1|940976_942437_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_016211426.1|942780_944223_+	MFS transporter	NA	NA	NA	NA	NA
WP_075273490.1|945205_946498_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_054300148.1|946738_947800_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556485.1|947952_950511_+	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.6	6.3e-73
WP_032126554.1|950530_951616_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_016210417.1|952057_952495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210423.1|952491_953376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210416.1|953465_953996_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_016210420.1|954066_955245_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.1	2.0e-50
WP_016210425.1|955393_959242_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_016210422.1|959228_960731_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_016210418.1|961281_961917_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_081377899.1|962229_963093_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	967165	1070345	3142869	tRNA,transposase	uncultured_Mediterranean_phage(11.11%)	110	NA	NA
WP_075275075.1|967165_968227_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|968221_968392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|968381_968546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|968602_968968_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|968989_969358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210898.1|970269_970620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|970708_970999_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|971473_971776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210897.1|972116_973097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|973175_974513_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|974631_975003_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|975223_975874_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|975916_976999_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|977052_978936_+	APC family permease	NA	NA	NA	NA	NA
WP_032126790.1|979435_980341_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275077.1|980425_981262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212218.1|981406_981757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|983206_984268_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|984393_985476_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_032126801.1|986146_986656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275079.1|986703_987765_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556488.1|987913_988763_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126540.1|989912_990776_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|991656_992022_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|991967_992543_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|992773_993139_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|993084_993660_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126869.1|994180_994420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|994397_995459_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212290.1|995575_996901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|996904_997791_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212326.1|998016_998214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122941816.1|998300_998609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212323.1|998685_998958_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_075274676.1|999032_999230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046717.1|999388_999538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|1001794_1003831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664853.1|1004554_1006297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211090.1|1006256_1007891_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|1007903_1008947_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|1008925_1009387_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_016211081.1|1009427_1010363_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211087.1|1010390_1011386_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211088.1|1011605_1012568_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126778.1|1012746_1012941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075285940.1|1013155_1013977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377357.1|1014061_1014463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212611.1|1014946_1015267_+	histidine kinase	NA	NA	NA	NA	NA
WP_075275084.1|1015314_1016376_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212519.1|1016450_1016831_+	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_052047081.1|1017101_1017539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212356.1|1017589_1018435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275086.1|1018412_1019411_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1019371_1019737_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1019682_1020258_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1020627_1021602_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016212585.1|1021713_1022034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212621.1|1022328_1022733_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_075273327.1|1022729_1023305_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1023250_1023616_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126498.1|1023677_1024238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211126.1|1024370_1024760_-	lipoprotein	NA	NA	NA	NA	NA
WP_016211125.1|1024929_1025760_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211128.1|1025982_1026888_-	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211119.1|1027051_1027813_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211122.1|1027816_1028683_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126499.1|1028779_1029391_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211118.1|1029769_1031017_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126500.1|1031153_1031870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275089.1|1032003_1032336_-	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	37.3	8.0e-05
WP_129556631.1|1032480_1032648_-	phosphatase	NA	NA	NA	NA	NA
WP_075275091.1|1033656_1034142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|1034412_1034823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300412.1|1034967_1035282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210280.1|1035518_1036613_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_016210284.1|1036694_1037216_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210276.1|1037270_1037747_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210275.1|1037802_1038105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210273.1|1038169_1038877_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210274.1|1039249_1039648_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_032126334.1|1039687_1040119_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210271.1|1040129_1040813_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1040897_1043093_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_129556492.1|1043190_1043934_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210283.1|1043961_1044747_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_016210272.1|1044786_1045497_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210279.1|1045484_1046651_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210277.1|1046704_1047538_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210270.1|1047607_1050595_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210281.1|1050636_1052028_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210269.1|1052041_1052392_-	L,D-transpeptidase catalytic domain protein	NA	NA	NA	NA	NA
WP_032126362.1|1052429_1052795_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1052740_1053316_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664860.1|1053279_1053717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211367.1|1053872_1054655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126330.1|1054802_1055762_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_032126331.1|1055816_1057826_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_016211366.1|1057881_1058169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126332.1|1058421_1059621_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_075273327.1|1060267_1060843_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1060788_1061154_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|1061287_1062151_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1062381_1062675_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556495.1|1063655_1063913_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211589.1|1064035_1065268_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_016211592.1|1065257_1065920_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_129556496.1|1066194_1067433_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_032126329.1|1067618_1068248_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211588.1|1068323_1069025_+	cyclase family protein	NA	NA	NA	NA	NA
WP_105962623.1|1069192_1070345_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 13
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	1099802	1142862	3142869	tRNA,transposase	Tupanvirus(28.57%)	41	NA	NA
WP_075275097.1|1099802_1100378_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1100323_1100689_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300408.1|1100739_1101396_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_080664854.1|1101732_1102314_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_032126179.1|1102271_1102523_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_016211113.1|1102552_1103878_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_016211112.1|1103933_1104581_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211115.1|1104773_1106726_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211114.1|1106858_1109789_+	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_075274672.1|1110154_1110748_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1110919_1111285_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1111230_1111806_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1111819_1112110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1112055_1112631_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212254.1|1112620_1114063_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016212252.1|1114100_1114259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|1114573_1115299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|1115503_1115875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211395.1|1116231_1116567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779999.1|1116482_1116914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211393.1|1116933_1118490_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_016211391.1|1118501_1119077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728317.1|1119143_1122509_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275098.1|1122699_1123629_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-24
WP_129556498.1|1124141_1124750_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210596.1|1124746_1126687_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.1e-72
WP_016210594.1|1126822_1127476_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210595.1|1127652_1128831_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210588.1|1129198_1130524_+	fimV domain protein	NA	NA	NA	NA	NA
WP_032126176.1|1130614_1131397_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210587.1|1131498_1132359_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_016210590.1|1132533_1133796_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210593.1|1133875_1134406_+	colicin V production protein	NA	NA	NA	NA	NA
WP_016210586.1|1134427_1135933_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210592.1|1135945_1136602_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016212005.1|1136991_1138752_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_155049815.1|1139317_1139470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1139652_1140805_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_032126856.1|1141110_1141452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377901.1|1141512_1142223_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275102.1|1142403_1142862_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	1196847	1249528	3142869	tRNA,protease,transposase	Klosneuvirus(28.57%)	48	NA	NA
WP_016209838.1|1196847_1197741_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|1197740_1198955_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|1198974_1200261_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|1200276_1200531_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016209830.1|1200766_1202134_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|1202464_1203487_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_032126640.1|1204009_1205485_+	APC family permease	NA	NA	NA	NA	NA
WP_129556633.1|1205701_1206598_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209827.1|1206916_1208476_+	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_016209841.1|1208551_1208746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209831.1|1208965_1209664_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|1209942_1210206_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209848.1|1210512_1213107_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209835.1|1213103_1213586_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209844.1|1213563_1214604_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209840.1|1214776_1215262_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_032126641.1|1215369_1217940_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_032126642.1|1217975_1218437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|1218506_1218713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|1219916_1220456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|1221115_1222600_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|1222724_1224260_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|1224493_1224859_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556501.1|1224804_1225380_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_059372539.1|1225412_1226276_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080728346.1|1226293_1226626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046723.1|1227533_1227689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|1227847_1228153_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_016210929.1|1228187_1228544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046724.1|1228540_1228708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210921.1|1228932_1229517_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_016210925.1|1229608_1230295_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.5	9.7e-29
WP_032126561.1|1230418_1231603_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210917.1|1231816_1233259_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	5.4e-21
WP_016210927.1|1233383_1234334_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210930.1|1234394_1235168_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210918.1|1235171_1235921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210926.1|1236005_1237475_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_129556502.1|1237734_1238298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273571.1|1238406_1239084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211012.1|1239233_1239806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211008.1|1239914_1241417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211010.1|1241509_1243939_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_016211011.1|1244217_1245414_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_016211013.1|1245474_1247841_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_032126565.1|1248158_1248431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1248641_1249007_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1248952_1249528_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	1254064	1431299	3142869	tRNA,transposase	Bacillus_phage(11.76%)	169	NA	NA
WP_081007040.1|1254064_1254721_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210510.1|1254751_1255480_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_016210506.1|1255472_1256711_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210512.1|1256846_1257884_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210515.1|1257937_1258840_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210514.1|1258948_1260202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1260259_1263757_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075273576.1|1263816_1264545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|1264672_1265221_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016210508.1|1265541_1267239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556503.1|1267247_1268114_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	5.6e-58
WP_032126637.1|1269175_1269469_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032127044.1|1270370_1270571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1270774_1271836_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047029.1|1271908_1272250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1272417_1272783_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|1272728_1273304_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211467.1|1273378_1273945_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_032126344.1|1273947_1275036_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032126343.1|1275156_1275969_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_016211471.1|1276099_1278085_+	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
WP_016211470.1|1278144_1278798_-	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_129556505.1|1279564_1280530_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1280570_1281545_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212421.1|1282295_1282478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1282969_1283335_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1283280_1283856_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556507.1|1283845_1284532_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.3	5.5e-48
WP_032126637.1|1284648_1284942_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556508.1|1285003_1285447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300380.1|1285717_1286374_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1286475_1286841_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1286786_1287362_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212483.1|1287358_1288156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1288166_1289249_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300173.1|1289551_1290613_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211841.1|1291472_1291925_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211839.1|1292042_1293515_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|1293673_1294138_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|1294608_1294782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274832.1|1295093_1296068_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_032126143.1|1296167_1297439_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_016211422.1|1297527_1297998_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_051307357.1|1298020_1298614_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211417.1|1298750_1299800_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_016211415.1|1299823_1300747_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1300763_1301225_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211414.1|1301332_1302151_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_129556449.1|1302366_1302873_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1302887_1303253_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377858.1|1303456_1304167_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300382.1|1304385_1304808_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046725.1|1305024_1305165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1305208_1306183_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075274829.1|1306206_1306479_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1306490_1307327_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126139.1|1309995_1310925_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_016210804.1|1310931_1312851_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126141.1|1312915_1314190_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210805.1|1314599_1315271_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_016210808.1|1315279_1316131_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210803.1|1316308_1317607_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_054300162.1|1317681_1318764_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212040.1|1318967_1320317_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_016212039.1|1320493_1321051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133287.1|1321239_1321638_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075274828.1|1321739_1323062_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.2e-11
WP_054300384.1|1323470_1324286_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212251.1|1324447_1324984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212250.1|1325145_1325796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126600.1|1325918_1326440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|1326711_1326894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1327243_1328521_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_080664858.1|1328517_1328655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211223.1|1329166_1330768_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211221.1|1330784_1331927_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211218.1|1332179_1332917_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|1332941_1334213_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_075274826.1|1334469_1335375_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211680.1|1335605_1338005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211682.1|1338052_1339735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209976.1|1340604_1340838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126209.1|1341038_1341659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209969.1|1341625_1342591_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016209951.1|1342581_1342992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209957.1|1342998_1343334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556634.1|1343334_1343877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209950.1|1344181_1344973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209973.1|1345009_1348114_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_016209965.1|1348143_1348941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209956.1|1348945_1351936_-	ATPase AAA	NA	NA	NA	NA	NA
WP_016209975.1|1351941_1352373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209972.1|1352423_1352990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126210.1|1352989_1354033_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_016209954.1|1354038_1354563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209953.1|1354584_1356891_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_016209962.1|1356942_1357182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209958.1|1357183_1358311_-	type II/IV secretion system family protein	NA	NA	NA	NA	NA
WP_016209964.1|1358310_1359063_-	dotC-like type IV secretion system protein	NA	NA	NA	NA	NA
WP_051307320.1|1359055_1359562_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_016209959.1|1359586_1359994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556635.1|1360021_1361029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209971.1|1361087_1361993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209955.1|1361999_1363193_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_032126212.1|1363189_1364098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211310.1|1365344_1366058_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SEW9	Cyanophage	39.1	2.2e-39
WP_016211308.1|1366133_1366412_-	lipoprotein	NA	NA	NA	NA	NA
WP_032126213.1|1366441_1367332_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_016211307.1|1367416_1367890_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_016211313.1|1368025_1368547_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016211309.1|1368587_1369382_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016211305.1|1369384_1369666_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211306.1|1369662_1370616_-	pentapeptide repeats family protein	NA	NA	NA	NA	NA
WP_016211312.1|1371321_1372068_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075274825.1|1372189_1373251_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|1373528_1373801_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1373812_1374649_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_016211999.1|1375028_1375382_+	ras family protein	NA	NA	NA	NA	NA
WP_016211998.1|1375371_1375935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|1376065_1376794_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|1376913_1377192_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_129556636.1|1378145_1378454_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016210889.1|1378471_1381318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210887.1|1381827_1382778_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210886.1|1382860_1383640_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210883.1|1383708_1384416_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210888.1|1384376_1384628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1384650_1384947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1385480_1386254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1386286_1386883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210885.1|1386940_1387822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|1388163_1388430_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300400.1|1388574_1388817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|1388873_1389401_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|1390066_1390261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1390474_1390828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211827.1|1391159_1391780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211823.1|1391820_1392009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274823.1|1392043_1396054_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211770.1|1396253_1397387_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|1397400_1397589_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_075274822.1|1397881_1398856_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016209929.1|1400314_1401208_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|1401316_1402234_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209943.1|1402285_1403041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|1403108_1404383_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209927.1|1404517_1405195_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209944.1|1405395_1406823_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|1406797_1407436_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|1407645_1407924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|1408157_1409102_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_032126634.1|1409123_1410992_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|1411012_1411366_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_016209936.1|1411404_1412520_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.6	1.4e-93
WP_016209932.1|1412702_1413743_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|1413745_1414780_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|1414776_1415838_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|1415949_1417422_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209937.1|1417574_1418018_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209940.1|1418093_1420865_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_016209946.1|1421021_1422251_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1422277_1422940_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|1423461_1423962_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556510.1|1424063_1425167_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	7.3e-10
WP_033923779.1|1425690_1426527_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1426538_1426811_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211806.1|1427600_1428326_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_016211805.1|1428368_1429907_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211804.1|1429913_1431299_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
>prophage 16
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	1458149	1494669	3142869	integrase,protease,transposase	Leptospira_phage(33.33%)	41	1450687:1450746	1504997:1505254
1450687:1450746	attL	TCGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGC	NA	NA	NA	NA
WP_098082828.1|1458149_1458407_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774189.1|1458406_1459414_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_051307372.1|1459461_1459851_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016212275.1|1459966_1460950_+	MFS transporter	NA	NA	NA	NA	NA
WP_129556512.1|1460939_1461515_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300363.1|1461460_1461808_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212589.1|1462231_1462669_+	MFS transporter	NA	NA	NA	NA	NA
WP_129556637.1|1463143_1463923_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016210843.1|1464537_1464768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210844.1|1464854_1465982_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_129556513.1|1466157_1467903_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_032126340.1|1467983_1468745_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556514.1|1469024_1471481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|1471632_1472406_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016210841.1|1472464_1472836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1473049_1474024_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126239.1|1474108_1474381_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1474392_1475229_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_081377864.1|1475242_1475482_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211148.1|1475563_1476892_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1477155_1477725_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211151.1|1477740_1478052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1478061_1479018_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1479130_1479484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211153.1|1479487_1480552_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211145.1|1480552_1482292_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211152.1|1482298_1482721_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211144.1|1482704_1483334_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075273474.1|1483890_1484865_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_075274844.1|1485045_1485297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1485305_1486142_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1486153_1486426_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556515.1|1486444_1486804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046727.1|1487629_1487974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1488217_1489192_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075275108.1|1489168_1489774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556516.1|1490132_1490636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1490730_1491003_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1491014_1491851_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_080664876.1|1492163_1494026_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_081377865.1|1494384_1494669_+|transposase	transposase	transposase	NA	NA	NA	NA
1504997:1505254	attR	TCGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTACGTGCCTTGAATCGGCACACTCCACTACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGCCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCA	NA	NA	NA	NA
>prophage 17
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	1498499	1558045	3142869	tRNA,transposase	Staphylococcus_phage(18.75%)	52	NA	NA
WP_075274847.1|1498499_1499375_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212011.1|1499608_1500730_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_016212013.1|1500951_1501335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|1501350_1502028_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300271.1|1502264_1503239_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300271.1|1503886_1504861_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556517.1|1505258_1505546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1505564_1506401_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1506412_1506685_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274849.1|1506810_1507554_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212348.1|1507548_1508778_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_016211994.1|1510196_1510733_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_032126537.1|1510769_1510955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211991.1|1511195_1512101_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126538.1|1513009_1514428_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_081007034.1|1514692_1514977_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_080728343.1|1514958_1515099_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_016211561.1|1515180_1519047_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_016211564.1|1519212_1520088_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211563.1|1520120_1520282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274852.1|1520492_1520936_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1521064_1522039_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_052047138.1|1522301_1522535_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126690.1|1528582_1529065_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_016210112.1|1529758_1531186_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_122943012.1|1531302_1531758_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210108.1|1531943_1533209_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_016210114.1|1533301_1534561_+	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210107.1|1534632_1534905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210101.1|1535194_1536691_-	flagellin domain protein	NA	NA	NA	NA	NA
WP_016210113.1|1537113_1538163_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210110.1|1538350_1539106_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_016210102.1|1539166_1540756_-	APC family permease	NA	NA	NA	NA	NA
WP_016210106.1|1540938_1542030_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210105.1|1542049_1542370_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210099.1|1542453_1543731_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_017377579.1|1543752_1544589_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210111.1|1544595_1546230_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_016210117.1|1546650_1547010_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210103.1|1547291_1548650_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_081377868.1|1548725_1549382_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211627.1|1549687_1549852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211632.1|1550077_1550932_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211634.1|1550967_1551789_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211631.1|1552044_1552851_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_155046729.1|1553109_1554156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|1554373_1554667_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_075273327.1|1554742_1555318_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1555263_1555629_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556520.1|1555589_1556486_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.8e-54
WP_129556521.1|1556436_1556625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1557158_1558045_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	1568310	1624447	3142869	tRNA,transposase	Staphylococcus_phage(13.33%)	48	NA	NA
WP_075273804.1|1568310_1568649_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1568608_1569064_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212267.1|1569230_1569590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|1569870_1570518_+	LysE family translocator	NA	NA	NA	NA	NA
WP_155046730.1|1570785_1570926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274856.1|1571144_1572170_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211733.1|1573925_1574750_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_016211731.1|1574805_1575912_-	protein kinase	NA	NA	NA	NA	NA
WP_016211734.1|1575927_1576197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|1576618_1577317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211398.1|1577921_1578209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211399.1|1578355_1579099_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211403.1|1579112_1580156_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211405.1|1580291_1582064_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_129556522.1|1582270_1583503_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211669.1|1586611_1586962_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211666.1|1587116_1589936_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211664.1|1590308_1591037_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211555.1|1591573_1592932_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_032126677.1|1593006_1593570_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211557.1|1593764_1594994_-	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_016211554.1|1595039_1595666_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_032126678.1|1595992_1597003_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_075274857.1|1597013_1597889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274858.1|1599468_1600554_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1600690_1601056_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1601001_1601577_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1602267_1603242_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|1603796_1604858_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274822.1|1604955_1605930_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_129556523.1|1606265_1607151_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209772.1|1608170_1608722_-	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_016209778.1|1608740_1609115_-	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209796.1|1609145_1610363_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_080664823.1|1610386_1611787_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209795.1|1611767_1612523_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_016209793.1|1612563_1614012_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_032126436.1|1614027_1614483_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209771.1|1615189_1615912_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016209791.1|1616076_1616799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307317.1|1616935_1617229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209798.1|1617290_1619315_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_016209769.1|1619327_1620071_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_017377132.1|1620112_1620496_-	response regulator	NA	NA	NA	NA	NA
WP_016209784.1|1620582_1621305_-	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_129556524.1|1621301_1622189_-	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_032126239.1|1623326_1623599_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1623610_1624447_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
>prophage 19
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	1636412	1692207	3142869	transposase	Staphylococcus_phage(42.86%)	57	NA	NA
WP_081377870.1|1636412_1636931_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	31.0	1.6e-07
WP_081007030.1|1636966_1637938_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307341.1|1638631_1640230_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_016210848.1|1640396_1641581_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1641876_1642431_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210850.1|1642679_1643933_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210851.1|1643917_1644589_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210847.1|1644611_1645616_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210849.1|1645644_1647093_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210855.1|1647210_1648188_+	DMT family transporter	NA	NA	NA	NA	NA
WP_129556525.1|1648341_1649161_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1649237_1650212_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212475.1|1650409_1650616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211182.1|1651600_1651930_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_032126448.1|1651961_1652342_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211178.1|1652432_1653461_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016211180.1|1653523_1653988_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_032126449.1|1654008_1654932_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016211185.1|1654998_1655607_+	smr domain protein	NA	NA	NA	NA	NA
WP_032126450.1|1655719_1657714_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211177.1|1658081_1659302_+	amino acid permease	NA	NA	NA	NA	NA
WP_016212445.1|1659516_1659783_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_129556526.1|1659779_1660565_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	1.3e-45
WP_075274822.1|1660623_1661598_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_016211736.1|1661621_1661822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211739.1|1661938_1662445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126783.1|1662555_1663797_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211741.1|1663942_1664719_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211738.1|1665195_1665840_-	membrane protein	NA	NA	NA	NA	NA
WP_032126790.1|1665910_1666816_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1667777_1668116_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1668075_1668531_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126602.1|1668683_1669991_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211857.1|1670241_1671120_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016211855.1|1671116_1671584_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|1671710_1671896_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_054300271.1|1672111_1673086_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556640.1|1673352_1674579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211351.1|1674654_1674993_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_032127067.1|1674989_1675592_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211349.1|1675588_1677583_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211350.1|1677646_1678585_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211352.1|1679263_1679704_+	universal stress protein	NA	NA	NA	NA	NA
WP_075273313.1|1679877_1680216_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1680175_1680631_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210793.1|1680632_1681313_+	OmpW family protein	NA	NA	NA	NA	NA
WP_016210801.1|1681635_1682607_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210795.1|1682588_1683560_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_051307339.1|1683665_1684472_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210791.1|1684846_1685047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210799.1|1685473_1686427_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_129556527.1|1686888_1687149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273540.1|1687333_1687945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210800.1|1688311_1689139_+	DsbA family protein	NA	NA	NA	NA	NA
WP_051307338.1|1689350_1690916_+	APC family permease	NA	NA	NA	NA	NA
WP_052047040.1|1690941_1691880_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1691949_1692207_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	1698375	1753625	3142869	tRNA,transposase	Pseudomonas_phage(25.0%)	45	NA	NA
WP_075273327.1|1698375_1698951_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212185.1|1699044_1700034_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1700367_1700553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1701232_1703188_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016210749.1|1703486_1703948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210752.1|1704117_1704915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556641.1|1707291_1708554_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_032126362.1|1712428_1712794_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1712739_1713315_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211454.1|1713455_1713926_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_016211452.1|1714676_1716164_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211455.1|1716225_1717683_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_122942091.1|1717788_1718184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1718211_1718790_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_054300325.1|1719411_1719684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046732.1|1719877_1720048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274862.1|1720162_1720759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1720930_1721524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211728.1|1721911_1723846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1723884_1724799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1726369_1726636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|1726712_1727369_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1727543_1727999_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1727958_1728297_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556531.1|1728259_1728457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211752.1|1728661_1729807_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211748.1|1729822_1731427_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211749.1|1731506_1732700_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_032126540.1|1732908_1733772_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075274864.1|1736992_1738018_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047087.1|1738189_1738408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211462.1|1738568_1739549_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211465.1|1740176_1741160_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211464.1|1741310_1741658_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_032126752.1|1741654_1742257_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211466.1|1742344_1743865_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126753.1|1743934_1744399_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_032126362.1|1744491_1744857_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1744802_1745378_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212485.1|1746122_1746656_+	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_129556532.1|1746952_1747135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664820.1|1747443_1747614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209620.1|1747596_1750653_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209619.1|1750739_1752188_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209621.1|1752620_1753625_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	1783247	1827378	3142869	integrase,transposase	Acinetobacter_phage(16.67%)	46	1782191:1782250	1811963:1812253
1782191:1782250	attL	AAACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGA	NA	NA	NA	NA
WP_081377829.1|1783247_1783982_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_129556535.1|1784426_1785312_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1785502_1785760_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377871.1|1785964_1786657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556536.1|1786659_1787813_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274872.1|1787772_1788312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274873.1|1788786_1789284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1789305_1789671_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1789616_1790192_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274874.1|1790192_1790561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126786.1|1790859_1793940_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016211319.1|1793957_1795010_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211316.1|1795542_1796193_+	porin family protein	NA	NA	NA	NA	NA
WP_016211315.1|1796527_1797172_+	porin family protein	NA	NA	NA	NA	NA
WP_054300314.1|1797359_1797695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273532.1|1797655_1798243_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126997.1|1798460_1798700_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_032126998.1|1799021_1799369_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_036774554.1|1799467_1799746_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007020.1|1799798_1800086_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1800089_1800976_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211346.1|1802125_1802767_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_016211340.1|1802794_1803016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211347.1|1803008_1803992_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211344.1|1804205_1805024_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211342.1|1805184_1806867_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.1e-32
WP_016211343.1|1806874_1807897_-	YHYH protein	NA	NA	NA	NA	NA
WP_016211341.1|1808095_1808266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|1808410_1809385_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211940.1|1809498_1809831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|1809951_1811211_-	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211214.1|1812973_1813537_+	hypothetical protein	NA	NA	NA	NA	NA
1811963:1812253	attR	AAACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_016211210.1|1813639_1815121_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211213.1|1815127_1815334_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211211.1|1815382_1816462_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211215.1|1816653_1818624_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211212.1|1818984_1820544_+	APC family permease	NA	NA	NA	NA	NA
WP_075274875.1|1820826_1821129_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300307.1|1821175_1821904_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_129556539.1|1821972_1822317_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211983.1|1822564_1823224_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556643.1|1823319_1824684_+	histidine kinase	NA	NA	NA	NA	NA
WP_016212551.1|1825141_1825636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|1825977_1826553_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1826498_1826789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1826802_1827378_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	1831819	1951357	3142869	integrase,transposase	Leptospira_phage(20.0%)	119	1880815:1880874	1949214:1950373
WP_075274878.1|1831819_1832695_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212202.1|1833106_1834354_+	glutaminase	NA	NA	NA	NA	NA
WP_016209473.1|1835315_1835699_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_016209489.1|1835695_1836427_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_016209497.1|1836429_1837173_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_016209492.1|1837186_1838086_-	GTPase Era	NA	NA	NA	NA	NA
WP_016209466.1|1838091_1838766_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	34.5	8.9e-27
WP_129556644.1|1839171_1840059_-	signal peptidase I	NA	NA	NA	NA	NA
WP_016209482.1|1840109_1841912_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	39.2	5.1e-21
WP_016209457.1|1842211_1842793_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_016209458.1|1842936_1844511_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_129556541.1|1844518_1844833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209486.1|1844957_1845209_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_080664819.1|1845250_1846288_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_016209471.1|1846434_1846761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209462.1|1846770_1846914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209474.1|1846923_1847334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664818.1|1847475_1847811_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016209494.1|1848492_1850517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209467.1|1850586_1851612_-	FUSC family protein	NA	NA	NA	NA	NA
WP_016209455.1|1851604_1852651_-	membrane protein	NA	NA	NA	NA	NA
WP_075273528.1|1852831_1853797_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_016209459.1|1854056_1855223_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016209478.1|1855386_1856340_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_129556645.1|1856431_1858381_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_016209490.1|1858471_1858795_-	YqcC family protein	NA	NA	NA	NA	NA
WP_016209463.1|1859221_1859605_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032126730.1|1859959_1860448_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_016209472.1|1860550_1861921_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_016209456.1|1862034_1862766_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	M1IDP9	Pelagibacter_phage	35.8	5.3e-09
WP_016209491.1|1862790_1863888_-	alanine racemase	NA	NA	NA	NA	NA
WP_016209475.1|1863920_1865342_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	1.7e-152
WP_016209484.1|1865551_1866004_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|1866015_1866243_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_016209481.1|1866292_1866619_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_052047096.1|1866821_1867511_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016209488.1|1867660_1868149_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_016209465.1|1868189_1869290_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_016209460.1|1869336_1870419_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.1	1.0e-72
WP_052133284.1|1870408_1870975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126728.1|1870965_1872270_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209485.1|1872322_1873345_-	chorismate mutase	NA	NA	NA	NA	NA
WP_080664817.1|1873369_1874143_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209496.1|1874172_1874385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209453.1|1874552_1874702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556543.1|1874811_1875294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|1875385_1875658_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377873.1|1875669_1876506_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.6e-41
WP_016212058.1|1877148_1878699_-	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_075274880.1|1878854_1879820_-|transposase	transposase	transposase	NA	NA	NA	NA
1880815:1880874	attL	TATGAAAAAGAGCAAATTAAGTGAATCAAAAATCGTAGAGTTGCTTAAGCGTGTTGAGGC	NA	NA	NA	NA
WP_032126239.1|1880815_1881088_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|1881099_1881936_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_098082828.1|1882433_1882691_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|1882690_1883698_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212247.1|1884064_1884820_+	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|1885447_1886422_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300162.1|1886761_1887844_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212246.1|1887947_1888604_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_075274882.1|1889539_1890136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556544.1|1890250_1890607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1890669_1891752_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210771.1|1891843_1895245_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_016210773.1|1895241_1897935_-	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210769.1|1898238_1899741_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_033923762.1|1900041_1900275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|1900402_1901212_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_016210772.1|1901295_1902849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1902981_1903281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|1903270_1903435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|1903491_1903857_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210397.1|1904046_1906221_+	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210388.1|1906217_1906892_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210399.1|1906917_1908909_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210390.1|1908923_1909265_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_032126670.1|1909269_1909707_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210394.1|1909732_1911118_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_122940572.1|1911228_1911654_-	flaG family protein	NA	NA	NA	NA	NA
WP_032126669.1|1911772_1913350_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210398.1|1913574_1915167_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210393.1|1915367_1917569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210391.1|1917662_1918613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210396.1|1918680_1918869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211164.1|1919006_1919384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|1919426_1919942_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155046736.1|1919941_1920895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211168.1|1920872_1921532_-	wbqC-like family protein	NA	NA	NA	NA	NA
WP_016211165.1|1921528_1922257_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307350.1|1922246_1922993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664856.1|1922976_1924041_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_016211172.1|1924229_1925426_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211167.1|1925475_1926597_-	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	1.5e-10
WP_016211170.1|1927228_1927399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126750.1|1927557_1928355_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_129556646.1|1929670_1931056_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_016211278.1|1931107_1932367_-	threonine synthase	NA	NA	NA	NA	NA
WP_016211277.1|1932353_1933322_-	homoserine kinase	NA	NA	NA	NA	NA
WP_016211279.1|1933335_1935804_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_075274886.1|1936547_1937609_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274888.1|1937880_1938216_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081007004.1|1938220_1938676_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1938635_1938974_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|1939131_1939296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1939285_1939585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212209.1|1940040_1941042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556545.1|1941296_1941638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274890.1|1941842_1942523_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_098082828.1|1942592_1942850_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377874.1|1943018_1943486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556546.1|1943946_1945132_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	5.9e-58
WP_155046738.1|1945141_1945282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556547.1|1945558_1946119_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_054300287.1|1946527_1946857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1946878_1947244_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1947189_1947765_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274733.1|1947783_1948101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1948151_1948988_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1948999_1949272_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211421.1|1950130_1950355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1950451_1951357_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
1949214:1950373	attR	GCCTCAACACGCTTAAGCAACTCTACGATTTTTGATTCACTTAATTTGCTCTTTTTCATATGCTCTCCTGTTTGAAAATGTTAACAGAAGATTCCAGTTATGAGTTGTCTCATTTTAAGGGAGGGTTACCACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGGTTGAGGCGTTTATTGAGCGATTGACACAACATATACCAGAAAAGTTTTTCAAAATGATACGGTATTACGGCTTTTTAGCGAATCGAGTCAGAAAAACCTTGTTACCAAAAGTCTATGATTTATTAGATCAGACCATTGAAGCTGCTCAGTCTGTTACCTATTCCAGCCTGATGAAAGCCAATTATGCAGTAGATCCTCTCATTTGCATACTTTGTGGCAGTGAAATGAGACTCTCTGGATTCACAAACTCAACCCCTTTATGGCAGTTGCGTCAACATCATGAAAAGCTTGCGAAGATGAAGGAGGTCCGGCTTTAATTCAGCCTGCATAGGATTAATCCGTCCAAAAACGATAAAACGCACCATATGTGATACTTTTTGCCGATAATTAAGAATAGTTTCTGTTCTTCAGGTCAAATCTCTCAAATTTTGCTTCACTAAAAAATGATCCATTAACCCGGCTGAAACTTTCAAATTCTTCAATATTAAATTTTCAACAGAAAAACACTGTTTCTTTATTTAAAATAATAAACAAAACCATAGTGATTTTATGCAGATTAACTAATGACATTTTTTTGATTAAAAGTTTAGCTGATGTAAACTTATTAAAGACTGTTATAGCACTCAACGAATAGTTTCTGACATTGACTTCATTACTTGACTAAGCGCTGTCTCTAAATTTATTTCATCTTGATCAAGCTTCATGCGAACCCTATTTTTAAGCGGTGACCATACATGCTCTATCGGGTTTAAATCAGGAGAATAAGGGGGTAAAAATAATAAGTGACAACCCGCATCTTCAATCGCTTCCTTAACCCCTTTTGATTTGTGAAAAGAGGCATTATCCATGATTACAGTCTCTCCAGG	NA	NA	NA	NA
>prophage 23
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	2031079	2082957	3142869	protease,tRNA,transposase	Orpheovirus(20.0%)	51	NA	NA
WP_016209424.1|2031079_2032357_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209433.1|2032456_2032831_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209412.1|2032915_2033803_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209436.1|2033860_2034589_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_129556555.1|2034585_2035716_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209444.1|2035846_2036275_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_032126508.1|2036369_2036729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209447.1|2036718_2037930_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016209421.1|2037926_2038715_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209411.1|2038877_2039672_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_054300271.1|2039877_2040852_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126933.1|2041020_2042322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2042325_2042625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2042614_2042779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2042835_2043201_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211553.1|2043540_2044281_-	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_016211549.1|2044284_2046789_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211548.1|2047051_2048008_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211550.1|2047991_2048753_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_075274903.1|2048830_2049706_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2049830_2050076_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016211262.1|2050135_2052409_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_075273504.1|2052463_2052817_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|2053006_2053300_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_032126515.1|2053472_2053652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307354.1|2053727_2054303_-	DedA family protein	NA	NA	NA	NA	NA
WP_032126514.1|2054585_2055902_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2055912_2056281_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016211265.1|2056311_2056974_-	adenylate kinase	NA	NA	NA	NA	NA
WP_032126362.1|2057148_2057514_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556556.1|2057459_2058035_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126519.1|2058202_2058922_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_016211478.1|2058901_2059717_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126518.1|2059733_2061935_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211474.1|2062017_2063367_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_016211473.1|2063441_2064041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211476.1|2064024_2064234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211931.1|2064551_2065739_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211932.1|2065934_2067224_+	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_054300152.1|2067634_2068000_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210558.1|2069636_2070392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210562.1|2070465_2072118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210560.1|2073685_2075386_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_016210557.1|2075474_2076227_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016210564.1|2076229_2076691_-	amidohydrolase	NA	NA	NA	NA	NA
WP_016210559.1|2076687_2077650_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_016210566.1|2078010_2078433_-	universal stress protein	NA	NA	NA	NA	NA
WP_016210568.1|2078738_2079380_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210561.1|2079507_2080842_+	dihydroorotase	NA	NA	NA	NA	NA
WP_032126397.1|2080956_2081547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2081895_2082957_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	2090801	2135507	3142869	tRNA,transposase	Staphylococcus_phage(22.22%)	47	NA	NA
WP_129556558.1|2090801_2091695_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126170.1|2091858_2092131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211040.1|2092358_2093570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211037.1|2093920_2094550_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211042.1|2094598_2095615_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211035.1|2095861_2096077_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211043.1|2096129_2096579_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211039.1|2096658_2098404_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211036.1|2098495_2100367_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_054300271.1|2100714_2101689_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211094.1|2101708_2102032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|2103096_2105577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211092.1|2105620_2106913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307348.1|2107148_2109905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211519.1|2111060_2111480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|2111480_2112182_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|2112442_2112649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|2112878_2113184_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|2113362_2115360_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2115343_2116390_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|2117097_2117949_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|2117949_2118870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|2119280_2119565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377876.1|2119556_2120012_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2119971_2120310_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|2120522_2121452_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|2121608_2122037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556560.1|2122117_2122654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2122623_2123529_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|2123719_2124328_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_081007013.1|2124368_2124668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2124657_2124822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274909.1|2125205_2125532_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2125630_2126206_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2126151_2126517_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556561.1|2126687_2127840_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	2.6e-58
WP_016211971.1|2128046_2128658_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|2128678_2129875_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|2129971_2130112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|2130124_2130529_-	SufE family protein	NA	NA	NA	NA	NA
WP_075273313.1|2130654_2130993_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556562.1|2130952_2131255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|2131399_2131585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|2132154_2132736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556649.1|2132763_2133621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|2134160_2134688_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_075273327.1|2134931_2135507_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	2156706	2206453	3142869	tRNA,protease,transposase	Staphylococcus_phage(33.33%)	47	NA	NA
WP_016209884.1|2156706_2157330_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|2157406_2157607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|2157748_2158447_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|2158593_2159163_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|2159477_2160101_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|2160309_2160912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|2160983_2161349_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046744.1|2161405_2161579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556564.1|2162748_2163078_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273603.1|2164234_2164411_+	phosphatase	NA	NA	NA	NA	NA
WP_129556565.1|2164534_2164930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126686.1|2166399_2166984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274914.1|2167534_2168410_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_059372565.1|2168458_2168830_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556566.1|2168738_2168942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210465.1|2169449_2170292_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|2170342_2170690_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|2170880_2171768_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|2171882_2172485_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|2172481_2173201_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_075275113.1|2173269_2174979_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_016210464.1|2175129_2177067_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|2177175_2178228_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|2178227_2178503_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|2178583_2179132_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210459.1|2182206_2182725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212492.1|2182929_2183784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2183833_2184808_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_033923740.1|2184866_2185154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211720.1|2185401_2186325_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211716.1|2186338_2187262_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126595.1|2187209_2187866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|2188168_2188996_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_052133280.1|2189436_2189808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126590.1|2190000_2191533_+	nuclease	NA	NA	NA	NA	NA
WP_032126591.1|2191595_2192933_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_016210313.1|2193075_2194542_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210314.1|2194538_2195588_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_016210306.1|2195711_2197820_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|2197984_2198389_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2198449_2199175_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210307.1|2199260_2200151_+	YicC family protein	NA	NA	NA	NA	NA
WP_032126592.1|2200191_2200812_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.3	2.5e-20
WP_016210310.1|2200872_2201079_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_016210316.1|2201100_2203254_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.1e-12
WP_016210317.1|2203260_2205243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2205478_2206453_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 26
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	2212645	2258146	3142869	transposase	Staphylococcus_phage(50.0%)	52	NA	NA
WP_054300443.1|2212645_2212924_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|2212976_2213225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|2213182_2214244_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212177.1|2215239_2215413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|2215489_2215747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2216821_2217397_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274918.1|2217342_2217708_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212205.1|2218391_2218571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|2218710_2220156_+	MFS transporter	NA	NA	NA	NA	NA
WP_016212319.1|2220714_2220942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|2220928_2221255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|2221256_2221688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|2222216_2223278_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210831.1|2223372_2223918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|2224187_2225207_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|2225193_2225616_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|2225617_2226091_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|2226206_2226830_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|2226859_2227534_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|2227539_2228688_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|2228684_2229146_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|2229221_2230472_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|2230598_2232278_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|2232387_2233254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274920.1|2234684_2235419_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	4.8e-10
WP_016211000.1|2235514_2236300_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|2236443_2237130_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|2237163_2237562_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|2237725_2238031_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|2238108_2238363_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|2238516_2240178_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|2240237_2240921_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|2240920_2242009_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|2242057_2244694_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300237.1|2245106_2246168_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556568.1|2246357_2247839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2247875_2248451_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|2248396_2248687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2248700_2249276_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2249221_2249587_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212450.1|2249742_2250645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2250688_2251663_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211507.1|2251976_2253296_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|2253299_2254016_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|2254012_2254654_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_075274921.1|2254646_2254745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274922.1|2254722_2255019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211503.1|2255029_2255485_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|2255539_2255884_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|2255913_2256957_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|2257371_2257581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2257570_2258146_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	2327349	2386960	3142869	tRNA,transposase	Planktothrix_phage(16.67%)	56	NA	NA
WP_129556571.1|2327349_2328060_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2328088_2328493_+	RidA family protein	NA	NA	NA	NA	NA
WP_155049839.1|2329608_2330130_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126712.1|2330660_2331119_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|2331863_2332874_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|2333358_2334270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|2334595_2338090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|2338127_2338967_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_016209564.1|2339153_2339369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|2339417_2339993_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|2339989_2340328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|2340496_2341486_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|2341486_2342449_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_016209559.1|2342458_2343361_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300271.1|2343404_2344379_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|2344516_2344750_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|2344843_2345209_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2345265_2345430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2345419_2345719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212572.1|2345776_2346169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2346298_2346664_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|2346720_2347029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2347120_2347696_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2347641_2348007_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|2348159_2348432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212514.1|2348842_2348980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2348998_2349835_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2349846_2350119_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126774.1|2350274_2350610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|2350769_2352302_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|2352334_2353174_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|2353170_2353668_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211412.1|2353671_2354664_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211408.1|2354778_2356125_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|2356348_2357410_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|2357488_2358634_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|2364733_2365591_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|2365577_2366501_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211368.1|2366697_2368089_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|2368135_2369179_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|2369221_2369665_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|2369797_2370988_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|2371042_2371189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|2371740_2372658_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|2372925_2373219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|2373295_2373490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212197.1|2374508_2375426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|2375891_2376734_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|2376801_2377452_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|2377466_2378507_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|2378629_2379715_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|2379741_2380851_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|2380867_2381185_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|2381181_2381541_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_080664847.1|2384872_2385826_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_075274927.1|2385898_2386960_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	2424944	2598979	3142869	integrase,protease,tRNA,transposase	Escherichia_phage(32.65%)	165	2572603:2572662	2580844:2581131
WP_036771330.1|2424944_2425919_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_129556574.1|2426215_2426569_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211760.1|2426621_2428001_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211761.1|2428107_2430099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274928.1|2430514_2431489_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	5.2e-28
WP_016209674.1|2431718_2432552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126406.1|2432735_2434214_-	nuclease	NA	NA	NA	NA	NA
WP_155049159.1|2434654_2436451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209671.1|2436533_2436761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556575.1|2436828_2437797_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_032126407.1|2437772_2438183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209685.1|2438187_2438523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556656.1|2438524_2439052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556657.1|2439537_2439978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209678.1|2440079_2443298_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_129556576.1|2443337_2444192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209670.1|2444160_2447169_-	ATPase AAA	NA	NA	NA	NA	NA
WP_032126408.1|2447171_2447597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209688.1|2447628_2448210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209684.1|2448209_2449253_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_016209692.1|2449255_2449735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047060.1|2449743_2452047_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_032126410.1|2452075_2452315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209677.1|2452335_2453442_-	type II/IV secretion system family protein	NA	NA	NA	NA	NA
WP_016209693.1|2453434_2454181_-	type IV secretion system protein DotC	NA	NA	NA	NA	NA
WP_016209695.1|2454173_2454677_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_032126411.1|2454740_2455175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209680.1|2455189_2456227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209681.1|2456242_2457223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556659.1|2457228_2458374_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209676.1|2458430_2459270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209672.1|2459783_2460209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209690.1|2460311_2462999_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_016211689.1|2463585_2464725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211690.1|2464800_2466957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556660.1|2467242_2467995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211688.1|2468180_2468399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211600.1|2468547_2469066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211601.1|2469401_2469824_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	37.3	1.1e-22
WP_016211597.1|2470129_2471500_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.8	2.6e-110
WP_016211595.1|2471857_2472325_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211599.1|2472337_2473348_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_080664865.1|2473543_2474020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|2474016_2474853_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|2474864_2475137_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211743.1|2475203_2475566_-	ABC transporter membrane domain protein	NA	NA	NA	NA	NA
WP_129556577.1|2475552_2476581_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	4.8e-16
WP_016211744.1|2476558_2476963_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_016211742.1|2477193_2479173_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054300202.1|2479452_2480181_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300202.1|2480656_2481385_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210955.1|2482108_2482363_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|2482461_2484246_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_016210956.1|2484334_2485054_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|2485236_2485443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210948.1|2485442_2485679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|2485691_2486069_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|2486575_2487394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210947.1|2487487_2487685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|2487779_2489165_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|2489291_2489882_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_075274930.1|2490692_2491112_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274931.1|2491141_2491870_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_032126570.1|2492627_2492927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211816.1|2492939_2493293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|2493334_2494948_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|2495169_2495391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274933.1|2495699_2496428_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|2497044_2498142_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|2498175_2499426_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_075274934.1|2499913_2500582_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.0	2.8e-41
WP_016212193.1|2500704_2501043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|2501110_2501497_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|2501493_2501739_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300202.1|2502147_2502876_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211625.1|2503359_2504229_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_016211621.1|2504225_2505575_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	4.6e-75
WP_016211623.1|2505687_2507328_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_016211987.1|2509149_2510886_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_144019359.1|2511047_2511245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556671.1|2511389_2512118_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_098082825.1|2512181_2512490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|2512482_2512815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|2512818_2513388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211655.1|2513516_2513930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211652.1|2514189_2515395_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211653.1|2515502_2516528_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_054300202.1|2516619_2517348_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212214.1|2517506_2518007_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036780855.1|2517981_2518479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|2519244_2519973_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211053.1|2520015_2520582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211047.1|2520669_2522304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|2522665_2523169_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|2523131_2523839_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|2523907_2524768_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_016211045.1|2524748_2525522_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|2525552_2526806_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|2526805_2527768_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|2527811_2528564_+	ComF family protein	NA	NA	NA	NA	NA
WP_016210615.1|2530939_2531410_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|2531455_2531695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274938.1|2531713_2532220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|2532383_2533808_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|2533872_2534922_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|2535188_2535968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|2536011_2536914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210625.1|2536972_2537719_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_016210616.1|2537967_2540778_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_129556661.1|2541078_2541642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2541630_2542359_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|2542448_2542655_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212263.1|2542817_2543411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212264.1|2543456_2544050_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	5.4e-28
WP_016212238.1|2544565_2545855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274939.1|2545884_2546613_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.8e-42
WP_087910645.1|2546725_2547878_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274940.1|2547906_2548587_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	2.0e-42
WP_016211997.1|2548942_2550052_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.5	4.4e-07
WP_016211996.1|2550053_2551001_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_075274941.1|2551384_2552113_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.2e-42
WP_075275114.1|2552142_2552505_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212339.1|2552657_2553404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274942.1|2553422_2554151_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	2.7e-45
WP_032127022.1|2554827_2557014_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|2557075_2558229_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|2558514_2559039_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|2559229_2559397_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|2559341_2560058_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
WP_032126817.1|2560414_2561236_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211722.1|2561245_2564548_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_016211321.1|2564928_2566089_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211323.1|2566262_2567360_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211325.1|2567349_2568870_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211322.1|2568932_2569523_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211324.1|2570058_2570613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211326.1|2571109_2571850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274945.1|2571994_2572345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|2572569_2572719_+	hypothetical protein	NA	NA	NA	NA	NA
2572603:2572662	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_016212659.1|2572863_2573109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046748.1|2573196_2573502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212294.1|2573853_2574198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274946.1|2574211_2574655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377879.1|2574876_2575101_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_016212230.1|2575156_2576605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|2578138_2578327_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556589.1|2579728_2580004_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|2580006_2580609_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_155046749.1|2580672_2580960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|2581504_2582584_+	hypothetical protein	NA	NA	NA	NA	NA
2580844:2581131	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
WP_016211874.1|2582902_2584621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2584664_2585570_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_081377873.1|2586732_2587569_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.6e-41
WP_032126239.1|2587580_2587853_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046750.1|2588049_2588187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|2589373_2589949_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_016210050.1|2590024_2590900_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210054.1|2590964_2591486_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210069.1|2591470_2592553_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.6e-20
WP_016210051.1|2592793_2593198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|2593622_2594354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|2594610_2595912_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|2596053_2596722_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|2597165_2597762_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|2597782_2598979_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
>prophage 29
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	2627619	2662059	3142869	tRNA,transposase	Microbacterium_phage(20.0%)	38	NA	NA
WP_054300282.1|2627619_2628084_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377880.1|2628140_2628620_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556590.1|2629477_2629873_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|2629869_2630664_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211756.1|2630842_2631568_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211759.1|2631813_2633001_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_081377344.1|2633355_2634483_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210935.1|2634813_2635356_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|2635352_2636039_-	acireductone synthase	NA	NA	NA	NA	NA
WP_016210942.1|2636042_2636654_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|2636700_2637720_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|2637821_2638616_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|2638653_2639460_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|2639538_2640588_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|2640785_2642045_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|2642091_2642769_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|2642854_2643136_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|2643227_2644415_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_129556549.1|2644522_2645409_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210820.1|2645610_2646552_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|2647055_2647280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|2647571_2648276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|2648725_2649364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|2649698_2650229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210821.1|2650225_2651758_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2651754_2652705_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2653124_2653757_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2653999_2654197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2654546_2654975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307340.1|2655052_2655751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274949.1|2655728_2656790_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|2657014_2657311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|2657415_2658072_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2658295_2658793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377881.1|2659709_2659877_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377882.1|2659883_2660165_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2660124_2660463_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210986.1|2660520_2662059_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	1.3e-86
>prophage 30
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	2670145	2721291	3142869	tRNA,transposase	Staphylococcus_phage(37.5%)	51	NA	NA
WP_105962625.1|2670145_2671032_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212032.1|2671288_2672416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|2672539_2673202_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|2673293_2673539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211962.1|2673836_2674352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|2674900_2675560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|2675661_2676312_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|2676424_2676745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2676803_2677778_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|2678028_2678250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212027.1|2678272_2679496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212028.1|2679990_2680239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2680326_2681212_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210162.1|2681897_2682935_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_032126295.1|2682965_2684420_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_016210181.1|2684429_2685614_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_016210176.1|2685687_2686695_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210183.1|2686763_2688767_-	transketolase	NA	NA	NA	NA	NA
WP_016210174.1|2689217_2690378_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	8.2e-121
WP_016210170.1|2690614_2691730_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210172.1|2691892_2692417_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.6	6.9e-51
WP_016210163.1|2692416_2692947_+	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_016210178.1|2693036_2693504_-	DoxX family protein	NA	NA	NA	NA	NA
WP_016210161.1|2694005_2694260_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210179.1|2694460_2694964_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_129556592.1|2695254_2695785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2695945_2696629_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|2696704_2697484_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_032126297.1|2697470_2698331_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210177.1|2698455_2698821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210175.1|2699206_2699536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210171.1|2699849_2701409_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	5.8e-37
WP_036771330.1|2701966_2702941_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_075274951.1|2702937_2703822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211784.1|2704375_2705098_+	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_016211783.1|2705089_2705455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|2705735_2707013_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211782.1|2707612_2707795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2707856_2708222_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2708167_2708743_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556593.1|2708739_2709381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210766.1|2709469_2709913_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_032126291.1|2709916_2710426_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210756.1|2710418_2713232_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
WP_051307336.1|2713370_2714297_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	9.4e-11
WP_016210758.1|2714454_2715993_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2716166_2716427_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_016210763.1|2716735_2717980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210755.1|2718083_2718812_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_016210761.1|2718915_2719653_+	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_075273298.1|2720715_2721291_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	2744257	2804034	3142869	protease,tRNA,transposase	unidentified_phage(33.33%)	57	NA	NA
WP_054300173.1|2744257_2745319_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|2745409_2746156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274953.1|2746280_2747144_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|2747387_2747750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377902.1|2747936_2748464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|2748608_2749025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|2750796_2751708_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|2751759_2752608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|2753052_2753763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|2753854_2754823_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|2754810_2755458_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_016210370.1|2755486_2756338_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|2756352_2757630_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|2757670_2758186_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210372.1|2758264_2759326_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|2759347_2760436_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_016210378.1|2760480_2762316_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2762358_2762829_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2762865_2763201_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|2763213_2763930_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|2763866_2764883_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|2764879_2765359_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|2765442_2767923_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|2767985_2768351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273456.1|2768728_2769028_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2768987_2769443_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|2769457_2769748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210570.1|2769813_2771412_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|2771542_2771878_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_016210578.1|2771905_2773570_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	7.1e-33
WP_016210581.1|2773566_2774211_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|2774210_2774954_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|2775012_2775252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|2775402_2776770_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|2776780_2777332_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|2777412_2778396_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|2778517_2780275_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|2780497_2781088_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2781175_2781595_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_016210580.1|2781735_2781996_+	methyltransferase	NA	NA	NA	NA	NA
WP_075274955.1|2782071_2783046_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_075274956.1|2783088_2783457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|2783517_2784303_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075274955.1|2785688_2786663_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212084.1|2786944_2787961_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|2787960_2788476_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|2788517_2788991_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_075274955.1|2789148_2790123_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212306.1|2790158_2790689_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|2790718_2791174_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_129556598.1|2793723_2796237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211935.1|2797171_2799820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274958.1|2800268_2801330_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2801356_2801932_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2801877_2802243_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046755.1|2802314_2802491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556599.1|2802881_2804034_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 32
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	2917831	2961229	3142869	protease,transposase	Acanthamoeba_polyphaga_lentillevirus(14.29%)	41	NA	NA
WP_016209259.1|2917831_2918680_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_016209274.1|2918796_2919708_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_075274963.1|2920426_2921488_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212454.1|2921707_2922388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211192.1|2923176_2924535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211189.1|2924579_2925038_-	NfeD family protein	NA	NA	NA	NA	NA
WP_016211187.1|2925062_2925983_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_016211186.1|2926109_2926892_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.3	8.2e-32
WP_016211190.1|2926981_2928481_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_016211188.1|2928802_2930686_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_075273298.1|2930759_2931335_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2931280_2931646_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211157.1|2932210_2932867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211161.1|2932974_2934084_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|2934095_2934740_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|2934758_2935745_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|2935824_2936901_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|2937103_2937928_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|2938244_2939249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|2939457_2940423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274965.1|2940561_2941437_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|2941733_2942786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211698.1|2943053_2943482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|2943695_2944187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|2944242_2945493_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|2945595_2945814_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_052104629.1|2946256_2947282_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080728341.1|2947731_2947902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212561.1|2947873_2948014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210728.1|2948928_2949399_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|2949687_2951067_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|2951094_2951553_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|2951530_2952748_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|2952939_2953176_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2953189_2953345_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|2953425_2954388_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|2954547_2955864_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|2955873_2956542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|2956904_2958719_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_129556601.1|2958836_2959613_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_052104629.1|2960203_2961229_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP038876	Piscirickettsia salmonis strain Psal-002 chromosome, complete genome	3142869	2992914	3110341	3142869	tRNA,transposase	Staphylococcus_phage(33.33%)	111	NA	NA
WP_054300271.1|2992914_2993889_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|2993964_2994984_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556602.1|2995382_2995592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274966.1|2997583_2998645_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|2998725_2999034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|2999148_3000465_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664857.1|3000926_3002213_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|3002285_3003182_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|3003268_3004267_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|3004375_3004900_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|3005147_3006386_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|3006933_3007407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|3007403_3007799_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3008728_3009304_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3009249_3009615_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211610.1|3009879_3012210_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_129556603.1|3012330_3014346_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075274967.1|3014529_3017922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212386.1|3017986_3018292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274968.1|3018461_3019562_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|3019956_3021066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209721.1|3022004_3023402_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.3e-77
WP_051307313.1|3023521_3024469_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3024465_3024981_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3024967_3026167_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3026163_3026487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3026488_3027718_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3027717_3028761_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3028760_3029444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3029440_3031930_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3031946_3032201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3032201_3032558_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_080664821.1|3033337_3034501_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3034520_3037628_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3037629_3039135_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3039162_3039444_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3039592_3039934_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3040053_3041934_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_059372650.1|3042018_3043617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3043634_3044750_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3044877_3045876_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|3045879_3046638_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3046639_3047839_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3047822_3048494_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3048515_3049292_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3049295_3050294_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3050295_3050874_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3050870_3052340_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3052383_3052671_-	trp operon repressor	NA	NA	NA	NA	NA
WP_016209699.1|3052871_3053468_+	DMT family transporter	NA	NA	NA	NA	NA
WP_075274970.1|3053677_3054148_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3054204_3054360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274971.1|3054504_3054957_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3055142_3055364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|3055479_3056112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274972.1|3056089_3057151_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211865.1|3057590_3058130_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3058214_3058751_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3059402_3059705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3060154_3060463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274973.1|3061053_3061521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3061803_3062514_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3062740_3063139_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|3064006_3064957_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3064956_3067035_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|3067182_3067698_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|3067706_3068270_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|3068250_3068997_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|3069136_3069589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|3070012_3070849_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|3070845_3071742_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|3071774_3072842_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|3072860_3073229_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|3073254_3074703_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|3074712_3076092_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|3076132_3077464_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|3077435_3078395_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|3078487_3078991_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|3079125_3080277_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3080273_3080753_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|3080899_3083221_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|3083165_3083792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|3083796_3084696_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|3084768_3085347_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|3085647_3085905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556611.1|3085913_3087067_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046758.1|3088203_3088335_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|3088479_3088635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212051.1|3088962_3089736_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126148.1|3090277_3090460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3091063_3092038_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|3093132_3093471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212337.1|3093487_3094198_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_051307375.1|3094185_3094377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|3094538_3094838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|3094827_3094992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|3095048_3095414_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|3096718_3097414_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|3097410_3098838_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211791.1|3098863_3099127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3099487_3100462_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556612.1|3100520_3101371_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|3101408_3101753_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|3101749_3102586_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|3102586_3102928_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|3102929_3103535_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|3103531_3105526_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|3105545_3106487_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211292.1|3106714_3108139_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|3108651_3109626_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|3109684_3110341_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP038877	Piscirickettsia salmonis strain Psal-002 plasmid unnamed1, complete sequence	153781	2323	101076	153781	protease,head,transposase,integrase,tail,capsid	Streptococcus_phage(21.28%)	116	91315:91374	104649:105511
WP_129556705.1|2323_2824_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	28.0	9.9e-07
WP_036771330.1|2882_3857_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_054300162.1|4369_5452_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212151.1|5816_6779_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|6802_7117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923686.1|7173_8223_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|8331_9372_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|9385_10015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|10105_10405_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211886.1|10401_10830_-	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_054300202.1|11618_12347_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126832.1|12591_13500_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_054300202.1|13610_14339_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155062492.1|14406_14565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|15478_16207_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211890.1|16410_18987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046766.1|19211_19349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274822.1|19392_20367_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075274931.1|20567_21296_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.4e-38
WP_016212137.1|21739_22801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212139.1|22876_23122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307371.1|23093_23708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|24525_25500_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556707.1|25859_26879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|27507_28661_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126239.1|28805_29078_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|29089_29926_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075275144.1|29958_30690_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|30787_31201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212017.1|31495_31894_+	hypothetical protein	NA	W8VUR5	Pseudomonas_phage	38.8	2.3e-06
WP_047927838.1|31923_32169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|32165_32465_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016212019.1|32621_33317_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_081377351.1|34130_34910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|34993_35146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|35098_35431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|35595_35973_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|36279_36663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|37132_37861_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_129556708.1|37976_38312_-	mRNA-degrading endonuclease	NA	A9D9Y1	Lactobacillus_prophage	35.6	2.6e-11
WP_016212365.1|38304_38547_-	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_054300271.1|38755_39730_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075275142.1|40365_41094_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_075275141.1|41376_43062_+	protein kinase	NA	NA	NA	NA	NA
WP_129556709.1|43273_43363_+	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_129556710.1|43443_43914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275140.1|44067_44802_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.1e-38
WP_075275139.1|45428_45659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212404.1|46273_46507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126756.1|46627_47071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275138.1|47215_47524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047124.1|47728_49390_+	AAA family ATPase	NA	A0A0K2FLP8	Brevibacillus_phage	31.5	9.1e-65
WP_016212457.1|49399_49801_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_016212456.1|49797_50085_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_075275137.1|50128_50542_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126239.1|50597_50870_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|50881_51718_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_016212579.1|52648_52846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|54351_54552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|54562_55138_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|55083_55449_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|56280_58323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|59227_59593_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|59538_60114_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075274752.1|60110_60410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|60445_61599_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_052047048.1|61779_62280_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|62279_62441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211937.1|62710_63100_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211936.1|63589_64612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211938.1|65106_65667_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275133.1|66238_66547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|67079_68233_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273327.1|68481_69057_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075275128.1|69002_69368_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556696.1|69467_70484_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.0	3.0e-18
WP_052133287.1|70585_70984_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556716.1|71117_71408_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_016210655.1|71421_72018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210663.1|72336_72648_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210667.1|72644_72968_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210658.1|72960_73356_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210651.1|73352_73703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210664.1|73702_74125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210669.1|74126_74450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|74506_74773_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075273774.1|76974_78132_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275128.1|78273_78639_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|78584_79160_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126790.1|79630_80536_+|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_129556697.1|80920_81313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211776.1|81795_83133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|83300_83669_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211773.1|83770_84445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|84897_85263_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|85208_85784_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126360.1|85990_86725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|86847_87906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|88414_89161_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|89161_89566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|89959_90775_-	hypothetical protein	NA	NA	NA	NA	NA
91315:91374	attL	GGCACTGTTGCGAAAAATTATAGTGAACTTCAGAAAGGTTATTTTCTTGTGCTCTCTGCT	NA	NA	NA	NA
WP_054300202.1|91379_92108_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212298.1|92549_92876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|93116_93593_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_075275158.1|93707_94001_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377916.1|94117_94642_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.4	2.5e-29
WP_098082791.1|94846_95149_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.6	8.6e-14
WP_129556698.1|95157_95859_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_016211912.1|95948_96539_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_032126795.1|96811_97072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|97075_97348_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_016211913.1|97673_98795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273786.1|99227_99626_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377915.1|99634_100192_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	2.9e-47
WP_081377914.1|100336_100666_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|100782_101076_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
104649:105511	attR	GGCACTGTTGCGAAAAATTATAGTGAACTTCAGAAAGGTTATTTTCTTGTGCTCTCTGCTTAGAATTAAGCAGCTAATCCAAATAATTTATCAATGAGCTGATTTTGGGCACAGATATTCTGTTTTTTAATATAACGTAATTGACCTTTTTGAACCATGCGCATCGCTTCCATTATGTCAATGGTAGGCCGTGCTGTAGAAAGTGATTGGTACCATTGGCGGAAACGGGATTTGCGCTTTACCGCTTTGTGATCATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACACTGACTAGAAAAGACACCTTCATCTTTGGCTTTTTGGTGAGCGGGTGGAAATGAAGCGTGCTTGTCGACATTCACAACACGCGGTGATTTCACATAAGGTTGGGCGATTGCCTTTTTGAAAAAGCGCATCGCCGCTTTGGCATTTTGCTGTCGGCTGAGCATCCAGTCCAAAGTATGGCCATATTTATCAATGGCTCGATAAAGGTAATACCAACGACCTTTGATTTTCACCAACGTTTCATCTAACCGCCAAGAGGCACACGTTTGACGAAAGTGGGGCCTCAGCCGTTTGGCGATCTGCGAGCCATACTCGTGCACCCAGCGACAAATGGTTGAACGCTCAATCTCAAGACCTCTTTCAGCTGCTATTTCTTTGAGATCACGGTAAGATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATGATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTCTACCCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCCG	NA	NA	NA	NA
>prophage 1
NZ_CP038878	Piscirickettsia salmonis strain Psal-002 plasmid unnamed2, complete sequence	79943	4824	28863	79943	transposase	Streptococcus_phage(16.67%)	33	NA	NA
WP_075273327.1|4824_5400_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|5345_5711_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212400.1|5761_6361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046771.1|6360_6594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|6750_7903_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212392.1|7931_8939_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	26.4	1.2e-06
WP_075273802.1|9002_9731_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_016212131.1|9914_10262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212135.1|10700_11885_+	3-methylitaconate isomerase	NA	NA	NA	NA	NA
WP_075275202.1|12128_12830_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	6.0e-10
WP_075275201.1|12832_13561_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_016212164.1|13689_14718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211443.1|15741_16428_+	Fic family protein	NA	NA	NA	NA	NA
WP_016211439.1|16431_16986_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	40.6	1.0e-20
WP_016211436.1|17030_17969_+	fic/DOC family protein	NA	S4TP71	Salmonella_phage	37.2	5.2e-25
WP_016211434.1|17941_18133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211445.1|18310_18661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211437.1|18677_19304_-	zinc-ribbon domain-containing protein	NA	A0A1S5XYQ1	Kurlavirus	28.2	4.4e-12
WP_032126541.1|19310_19703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211440.1|19713_20628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211444.1|20897_21404_+	antirestriction protein ArdA	NA	A0A222YZE5	Mycobacterium_phage	33.7	2.8e-17
WP_051307358.1|21552_21936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556729.1|22219_22450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212541.1|22436_22661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212539.1|22720_22870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|22866_23841_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212090.1|23884_24064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212087.1|24063_24492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126714.1|24659_25199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212089.1|25435_25666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126713.1|25764_26802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|27271_28297_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275198.1|28323_28863_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	40.2	8.4e-12
>prophage 2
NZ_CP038878	Piscirickettsia salmonis strain Psal-002 plasmid unnamed2, complete sequence	79943	37206	57887	79943	terminase,protease,head,capsid,portal,tail	Pseudomonas_phage(11.76%)	29	NA	NA
WP_129556725.1|37206_37887_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	39.3	3.3e-37
WP_016210977.1|38065_38359_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_129556724.1|38576_38759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046773.1|38903_39083_-	phosphatase	NA	NA	NA	NA	NA
WP_016212235.1|39129_39495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126134.1|39795_40179_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	5.6e-26
WP_016212234.1|40266_40746_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_016212231.1|40749_40959_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	43.1	1.3e-08
WP_080743047.1|40974_41331_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	61.3	5.4e-23
WP_081377926.1|41349_42432_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	1.2e-89
WP_016211136.1|42428_43670_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	46.0	3.1e-86
WP_080664855.1|43617_44289_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_016211140.1|44346_45540_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_016211133.1|45660_46995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|47185_47497_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211132.1|47493_47817_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211139.1|47809_48205_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211129.1|48201_48552_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|48551_48974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126913.1|48975_49299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|49355_49622_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_032126912.1|49625_51704_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.0	2.5e-56
WP_016210657.1|51696_52038_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|52034_52706_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|52674_53421_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_016210665.1|53410_53968_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_016210662.1|53974_54262_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	2.5e-15
WP_016210670.1|54251_54506_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_016210653.1|54599_57887_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	33.5	5.2e-112
>prophage 1
NZ_CP038879	Piscirickettsia salmonis strain Psal-002 plasmid unnamed3, complete sequence	32424	11559	19100	32424	transposase,integrase	unidentified_phage(33.33%)	10	5164:5223	18422:18613
5164:5223	attL	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTA	NA	NA	NA	NA
WP_129556741.1|11559_12231_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.4	3.4e-10
WP_052133268.1|12252_12534_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	38.7	8.3e-11
WP_016212274.1|12606_13071_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032126154.1|13081_13276_-	addiction module toxin, HicA family	NA	A0A1X9I5T5	Streptococcus_phage	48.4	2.8e-10
WP_032126152.1|13491_14082_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
WP_129556740.1|14145_14514_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155046774.1|14725_14902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300579.1|15120_16122_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	1.3e-26
WP_016211990.1|16269_18342_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_129556739.1|18371_19100_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
18422:18613	attR	TTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTACCGTGATCTCAAAGAAATAGCAGCTGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGTTGGGTGCACGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTC	NA	NA	NA	NA
