The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046105	Arthrobacter sp. AQ5-05 chromosome, complete genome	3996248	912262	920305	3996248		Bacillus_phage(33.33%)	8	NA	NA
WP_154606440.1|912262_912481_+	DUF3263 domain-containing protein	NA	A0A0A7RXU7	Mycobacterium_phage	56.1	4.1e-10
WP_154605032.1|912524_913136_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062005040.1|913457_915086_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	54.7	3.5e-146
WP_154605033.1|915188_916181_+	DUF4440 domain-containing protein	NA	V9SDF5	Tunisvirus	39.9	1.7e-18
WP_154605034.1|916195_916489_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_154605035.1|916595_918140_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	32.1	1.5e-24
WP_062009198.1|918145_918856_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	1.6e-34
WP_154605036.1|918943_920305_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	22.8	5.8e-09
>prophage 2
NZ_CP046105	Arthrobacter sp. AQ5-05 chromosome, complete genome	3996248	2337449	2407063	3996248	protease,tRNA,integrase	Tupanvirus(26.67%)	56	2368615:2368646	2412737:2412768
WP_154605492.1|2337449_2340722_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	33.7	3.5e-153
WP_062006783.1|2341056_2341812_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_062006784.1|2341821_2342169_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_062006785.1|2342303_2342813_-	MepB family protein	NA	NA	NA	NA	NA
WP_154605493.1|2342925_2345547_+|tRNA	valine--tRNA ligase	tRNA	A0A2K9KZB8	Tupanvirus	38.7	2.0e-162
WP_062006787.1|2345830_2346085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154605494.1|2346095_2346983_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_154605495.1|2347042_2348674_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_154605496.1|2348857_2349481_-	disulfide bond formation protein DsbA	NA	NA	NA	NA	NA
WP_062006791.1|2349546_2350833_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.0	6.9e-137
WP_062006792.1|2351016_2351691_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	44.3	2.9e-38
WP_082357844.1|2351724_2352345_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	54.1	5.6e-44
WP_082357845.1|2352625_2354128_-	trigger factor	NA	NA	NA	NA	NA
WP_154605497.1|2354438_2355416_-	Fpg/Nei family DNA glycosylase	NA	NA	NA	NA	NA
WP_062006795.1|2355463_2355937_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_154605498.1|2356008_2357001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154606514.1|2357244_2359794_+	aminopeptidase N	NA	A0A2K9L1R3	Tupanvirus	31.0	1.3e-41
WP_154605499.1|2360006_2360825_+	hypothetical protein	NA	A0A160DD06	Gordonia_phage	25.7	3.1e-05
WP_154605500.1|2360880_2361351_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
WP_154606515.1|2361647_2362223_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_154606516.1|2362348_2362867_+	globin	NA	NA	NA	NA	NA
WP_154605501.1|2362958_2363627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154605502.1|2363623_2364172_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_062006800.1|2364287_2365196_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_154605503.1|2365340_2367023_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	29.5	3.1e-44
WP_062009538.1|2367086_2367356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154605504.1|2367620_2368295_-	single-stranded DNA-binding protein	NA	A0A1J0MC80	Streptomyces_phage	35.5	7.1e-16
2368615:2368646	attL	GTCACGTTTTACTCACGTTTTTGAACGAAAAC	NA	NA	NA	NA
WP_154605505.1|2369399_2370833_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_154605506.1|2370816_2373567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154605507.1|2373517_2374558_+	PD-(D/E)XK motif protein	NA	NA	NA	NA	NA
WP_154605508.1|2374550_2375243_+	DUF4357 domain-containing protein	NA	NA	NA	NA	NA
WP_154605509.1|2375365_2376991_-	DNA (cytosine-5-)-methyltransferase	NA	A0A191SB20	Nostoc_phage	27.4	9.4e-14
WP_154605510.1|2377539_2378562_+	DUF4192 family protein	NA	NA	NA	NA	NA
WP_154605511.1|2378612_2378780_+	NrdH-redoxin	NA	Q3V5E2	Corynebacterium_phage	50.0	3.5e-09
WP_062008973.1|2378922_2379549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062008975.1|2379988_2380561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154605512.1|2380557_2383011_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_154605513.1|2383010_2384177_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF08	Clostridium_phage	26.3	4.4e-05
WP_154605514.1|2384634_2385183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154605515.1|2385179_2388758_+	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_154605516.1|2388785_2389367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154605517.1|2389810_2390800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154605518.1|2391549_2392158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154605519.1|2392426_2392927_-	single-stranded DNA-binding protein	NA	A0A1D8ETH0	Propionibacterium_phage	40.8	1.2e-17
WP_154605520.1|2392986_2394138_-	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
WP_154605521.1|2394189_2394726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154605522.1|2394712_2396653_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_154605523.1|2397977_2399450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154605524.1|2399442_2400933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154605525.1|2400942_2401230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154606517.1|2401334_2401883_-	CHAP domain-containing protein	NA	A0A0A8WF62	Clostridium_phage	40.7	1.8e-09
WP_154605526.1|2402494_2403235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154605527.1|2403431_2404319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154605528.1|2404521_2404896_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_154605529.1|2405637_2405859_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_154605530.1|2405938_2407063_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A222ZES9	Arthrobacter_phage	42.4	3.3e-74
2412737:2412768	attR	GTCACGTTTTACTCACGTTTTTGAACGAAAAC	NA	NA	NA	NA
>prophage 3
NZ_CP046105	Arthrobacter sp. AQ5-05 chromosome, complete genome	3996248	3340492	3351107	3996248		uncultured_virus(28.57%)	9	NA	NA
WP_062007506.1|3340492_3342007_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.3	3.8e-94
WP_154605988.1|3342205_3344128_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.3	6.2e-65
WP_062007507.1|3344537_3346145_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	54.8	7.0e-155
WP_038464523.1|3346263_3346560_-	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	47.4	6.2e-17
WP_062007508.1|3346851_3347742_+	ABC transporter ATP-binding protein	NA	A0A2R8FFL6	Cedratvirus	32.6	1.2e-15
WP_062007509.1|3347738_3348551_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_154605990.1|3348593_3349199_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.6	1.5e-09
WP_154605992.1|3349195_3350212_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_154606576.1|3350201_3351107_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	42.8	4.5e-66
