The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016604	Otariodibacter oris strain Baika1, complete genome	2019124	836165	848336	2019124		Staphylococcus_phage(37.5%)	9	NA	NA
WP_121121812.1|836165_838742_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	33.6	4.6e-124
WP_121121810.1|839162_840248_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	37.6	2.4e-50
WP_121121808.1|840303_840951_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	45.1	9.4e-42
WP_121121805.1|841014_842214_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.8	9.4e-96
WP_121121803.1|842325_842787_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	58.1	1.1e-41
WP_121121801.1|843109_843592_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_121121799.1|843601_846295_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.4	4.6e-82
WP_121121797.1|846368_847208_+	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	32.8	3.0e-32
WP_121121795.1|847268_848336_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.1	9.9e-81
>prophage 2
NZ_CP016604	Otariodibacter oris strain Baika1, complete genome	2019124	860186	977272	2019124	head,tail,terminase,protease,plate,capsid,tRNA,holin,integrase,portal	Haemophilus_phage(32.08%)	121	962454:962474	977392:977412
WP_121121772.1|860186_862190_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_154399693.1|864026_864266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121121768.1|864430_864655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147404740.1|864808_865060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121121761.1|865865_866918_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	7.6e-33
WP_121121759.1|866928_868980_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_121121757.1|869095_870130_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_121121755.1|870309_870765_+	DoxX family protein	NA	NA	NA	NA	NA
WP_121121753.1|870783_871143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121121751.1|871217_872141_+	DUF692 family protein	NA	NA	NA	NA	NA
WP_121122289.1|872142_872853_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_121121749.1|872928_874098_-	porin	NA	NA	NA	NA	NA
WP_121121747.1|874424_875597_-	porin	NA	NA	NA	NA	NA
WP_121122287.1|876162_876699_-	DUF1697 domain-containing protein	NA	NA	NA	NA	NA
WP_121121745.1|876703_878191_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.7	4.8e-81
WP_121121743.1|878237_878561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121121741.1|878627_879866_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.6	3.3e-35
WP_121121739.1|880053_881067_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_121121737.1|881173_883309_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_121121735.1|883388_884591_-	acetate kinase	NA	NA	NA	NA	NA
WP_121121733.1|884872_885712_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	38.7	3.4e-36
WP_121121731.1|885966_886722_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_121121729.1|886814_888185_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_121122285.1|888708_889635_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_121121727.1|889638_890391_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_121121725.1|890421_891813_+	HemX protein	NA	NA	NA	NA	NA
WP_121121723.1|891816_893058_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_121121721.1|893336_894737_+	TolC family protein	NA	NA	NA	NA	NA
WP_121122283.1|894849_896298_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_121121719.1|896615_898379_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_121121716.1|898560_899202_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_121121714.1|899201_899621_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.1	1.2e-21
WP_121121712.1|899707_900505_-	alpha/beta fold hydrolase	NA	G1BRG0	Mycobacterium_phage	29.0	5.1e-05
WP_121121710.1|900616_901177_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_121121708.1|901176_902586_+	o-succinylbenzoate--CoA ligase	NA	NA	NA	NA	NA
WP_121121705.1|902578_905896_+	mechanosensitive channel MscK	NA	NA	NA	NA	NA
WP_121121703.1|905899_906982_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.9	2.1e-86
WP_121121701.1|907056_907740_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_121121699.1|907858_909184_-	histidine kinase	NA	NA	NA	NA	NA
WP_121121697.1|909583_910534_+	MBL fold metallo-hydrolase	NA	A0A1V0SGC6	Hokovirus	22.8	3.8e-07
WP_121121695.1|910931_911645_+	UMP kinase	NA	NA	NA	NA	NA
WP_121121693.1|911981_912707_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.5	1.0e-28
WP_121121691.1|912703_913456_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_121121689.1|913485_914136_+	thiaminase II	NA	NA	NA	NA	NA
WP_121121687.1|914149_915094_+	thiamine biosynthesis protein	NA	NA	NA	NA	NA
WP_121121685.1|915104_915905_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_121121682.1|915897_916707_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_121121680.1|916744_917419_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_121121678.1|917408_918002_+	MFS transporter	NA	NA	NA	NA	NA
WP_121121674.1|918559_921130_-	hypothetical protein	NA	A0A0M3LRW6	Mannheimia_phage	57.9	1.8e-56
WP_121122281.1|921129_921681_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	62.8	5.0e-60
WP_121121672.1|921704_922772_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	64.3	3.1e-122
WP_121121670.1|922783_923134_-	hypothetical protein	NA	F6MIL5	Haemophilus_phage	73.3	7.8e-43
WP_121121668.1|923190_923850_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	60.3	3.4e-71
WP_121121666.1|923852_924971_-|tail	phage tail protein	tail	F6MIL3	Haemophilus_phage	72.2	1.2e-148
WP_121121664.1|924954_926319_-	hypothetical protein	NA	A0A0M3LQ21	Mannheimia_phage	47.1	1.0e-106
WP_121121662.1|926257_928543_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	33.4	4.1e-92
WP_121121660.1|928806_929157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121121658.1|929156_929531_-|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	68.5	1.7e-40
WP_121121656.1|929544_930969_-|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	63.1	9.9e-161
WP_121121654.1|930968_931163_-	DUF2635 domain-containing protein	NA	B7SDP7	Haemophilus_phage	53.3	1.5e-08
WP_121121652.1|931152_931788_-	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	69.7	6.8e-77
WP_121122279.1|931784_932222_-	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	64.3	4.7e-45
WP_121121650.1|932227_932452_-	hypothetical protein	NA	B7SDP3	Haemophilus_phage	55.6	9.8e-15
WP_121121648.1|932462_933380_-|head	head protein	head	B7SDP1	Haemophilus_phage	80.5	5.6e-141
WP_121121646.1|933376_934438_-	hypothetical protein	NA	B7SDN9	Haemophilus_phage	70.6	2.6e-137
WP_121121644.1|934672_935137_-	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	55.8	2.6e-38
WP_121121642.1|935236_936514_-|head	phage head morphogenesis protein	head	B7SDN5	Haemophilus_phage	50.1	6.7e-116
WP_121121640.1|936503_938129_-	DUF935 domain-containing protein	NA	B7SDN1	Haemophilus_phage	73.7	6.7e-230
WP_121121638.1|938141_939764_-|terminase	phage terminase large subunit	terminase	A0A0M3LQB7	Mannheimia_phage	86.1	3.5e-279
WP_121121636.1|939763_940267_-	DUF1804 family protein	NA	A0A0M3LQI8	Mannheimia_phage	59.0	5.2e-48
WP_121121634.1|940269_940533_-	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	55.2	1.3e-13
WP_121121631.1|940529_940790_-	hypothetical protein	NA	F6MIK4	Haemophilus_phage	63.4	6.7e-07
WP_121121629.1|940895_941195_-	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_121121627.1|941151_941388_-	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	74.0	3.0e-22
WP_121121625.1|941779_942325_-	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	73.7	6.0e-82
WP_121121623.1|942405_942828_-	mor transcription activator family protein	NA	A0A0M3LRS6	Mannheimia_phage	44.8	4.1e-30
WP_121121619.1|943146_943398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121121616.1|943397_943628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121121614.1|943804_944008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121121612.1|944017_944437_-	regulatory protein GemA	NA	F6MIJ6	Haemophilus_phage	65.4	1.2e-45
WP_121121610.1|944412_944790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121121608.1|944771_945254_-	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	47.7	4.1e-26
WP_121121606.1|945268_946057_-	polymer-forming cytoskeletal protein	NA	A0A076G7L7	Bacillus_phage	54.4	3.6e-11
WP_121121603.1|946174_946372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121121601.1|946381_946690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121122277.1|946702_946894_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_121121599.1|946984_947599_-	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	64.0	8.6e-69
WP_121121598.1|947595_947862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121121596.1|947864_948170_-	hypothetical protein	NA	F6MII9	Haemophilus_phage	68.1	1.5e-29
WP_121121594.1|948132_948363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121121591.1|948371_949253_-	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	77.1	6.6e-123
WP_121121589.1|951228_951495_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_121121587.1|951609_952422_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_121121585.1|952884_953595_+	MFS transporter	NA	NA	NA	NA	NA
WP_121121583.1|953749_954370_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_121121581.1|954483_955815_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_121121579.1|955917_956157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121121577.1|956656_958672_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	23.1	1.8e-14
WP_121121575.1|958773_960459_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.7	1.6e-53
WP_121121573.1|960519_961983_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
962454:962474	attL	TTGTGTTACTATTTGTGTTAC	NA	NA	NA	NA
WP_121121571.1|962743_964648_-	D5 N like family protein	NA	Q7M2A8	Enterobacteria_phage	32.7	3.6e-57
WP_121121569.1|964559_964796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121121568.1|964797_965040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121121566.1|965029_965239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121121564.1|965231_965831_-	ash family protein	NA	NA	NA	NA	NA
WP_121121562.1|966007_966340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121121560.1|966342_966540_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_121121558.1|966679_967678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121121556.1|967771_968068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121121554.1|968136_968604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121121552.1|968612_970283_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	70.2	3.0e-241
WP_121121550.1|970279_970639_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	65.2	2.7e-38
WP_121121548.1|971199_971556_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	53.4	7.7e-30
WP_121121546.1|971563_971869_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	31.7	1.4e-08
WP_121121544.1|971881_972232_-|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	34.8	2.1e-08
WP_121121542.1|972215_973430_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	63.2	7.2e-144
WP_121121540.1|973430_973994_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	57.3	2.5e-51
WP_121121538.1|974048_975236_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	63.5	7.3e-133
WP_121121537.1|975248_975644_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_121121535.1|976036_977272_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	43.8	7.4e-88
977392:977412	attR	TTGTGTTACTATTTGTGTTAC	NA	NA	NA	NA
