The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044136	Proteus mirabilis strain ENT1157 chromosome, complete genome	4105149	156681	199823	4105149	tRNA,integrase,transposase	uncultured_Caudovirales_phage(20.0%)	36	153200:153215	185838:185853
153200:153215	attL	AAAAATAAGAAAGGCA	NA	NA	NA	NA
WP_004246934.1|156681_157632_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.5	2.8e-10
WP_004246933.1|157658_158174_-	peptide deformylase	NA	A0A2I7R586	Vibrio_phage	39.6	1.4e-16
WP_004246932.1|158305_159463_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	30.0	4.2e-32
WP_004246931.1|159481_160039_+	DNA topoisomerase	NA	NA	NA	NA	NA
WP_004249883.1|160031_160601_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	S4VW33	Pandoravirus	27.6	2.4e-09
WP_004249684.1|160608_161433_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017628849.1|161429_161693_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_004249682.1|161668_162232_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_004249680.1|168712_169537_-	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
WP_004246370.1|169652_169991_+	DUF413 domain-containing protein	NA	NA	NA	NA	NA
WP_155290578.1|170038_170752_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000736399.1|170876_171587_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
WP_000573060.1|171587_173498_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000417085.1|173502_174423_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000081835.1|174452_175568_+	TniQ family protein	NA	NA	NA	NA	NA
WP_002017214.1|175560_176991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529372.1|177365_177737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001095006.1|177809_178109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034564.1|178176_179028_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
WP_001277980.1|179040_180507_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.6	2.3e-213
WP_087486612.1|180510_181601_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000262332.1|181702_182035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001992510.1|182042_182597_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001046004.1|183261_184083_-	carbapenem-hydrolyzing class D beta-lactamase OXA-23	NA	NA	NA	NA	NA
WP_087486612.1|184188_185278_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001144964.1|185636_187433_-	hypothetical protein	NA	NA	NA	NA	NA
185838:185853	attR	AAAAATAAGAAAGGCA	NA	NA	NA	NA
WP_017827031.1|188833_188935_+	ilv operon leader peptide	NA	NA	NA	NA	NA
WP_017627862.1|189064_190714_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.3	6.5e-63
WP_004246366.1|190710_190989_+	acetolactate synthase 2 small subunit	NA	NA	NA	NA	NA
WP_004246365.1|190999_191926_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_004249676.1|191998_193849_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_004246363.1|193852_195427_+	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_004246362.1|195412_196300_-	HTH-type transcriptional activator IlvY	NA	NA	NA	NA	NA
WP_012368696.1|196472_197948_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_012368697.1|198175_198592_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	6.0e-42
WP_053828405.1|198614_199823_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	1.1e-187
>prophage 2
NZ_CP044136	Proteus mirabilis strain ENT1157 chromosome, complete genome	4105149	918817	967243	4105149	protease,transposase	Organic_Lake_phycodnavirus(50.0%)	30	NA	NA
WP_004244908.1|918817_920293_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_017628313.1|920782_922846_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_017628314.1|923076_925041_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_026090468.1|925347_927312_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_004244894.1|927776_928661_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017628316.1|928654_929911_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_017628317.1|930279_931665_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_004244891.1|931721_932366_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_017628318.1|932358_935076_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_004247346.1|935101_936523_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_004244888.1|936641_937610_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_017628320.1|938867_939725_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004244871.1|939698_940490_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004244870.1|941136_941442_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_026090475.1|945142_947080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001985440.1|947184_948438_+	TolC family protein	NA	NA	NA	NA	NA
WP_017628323.1|948462_950625_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.5	6.2e-29
WP_053828330.1|950644_951904_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017628325.1|952171_952849_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026090469.1|952978_954307_-	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
WP_017628327.1|954370_956533_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_107034653.1|956906_957014_-	DUF2618 domain-containing protein	NA	NA	NA	NA	NA
WP_004244852.1|958189_958960_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012367549.1|960791_961652_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_017628331.1|963856_964411_+	type IV B pilus protein	NA	NA	NA	NA	NA
WP_004244844.1|964407_965112_+	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_004244842.1|965424_966003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244841.1|966006_966276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628332.1|966502_966775_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004247373.1|966994_967243_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.5	2.9e-07
>prophage 3
NZ_CP044136	Proteus mirabilis strain ENT1157 chromosome, complete genome	4105149	1140052	1151402	4105149		Mycobacterium_phage(25.0%)	12	NA	NA
WP_004246075.1|1140052_1141252_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_012367584.1|1141860_1142829_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	5.9e-133
WP_004252248.1|1142854_1144981_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004246072.1|1145009_1145414_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|1145425_1145650_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|1145931_1146405_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1146602_1146812_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246058.1|1147269_1147644_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|1147659_1148625_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246056.1|1148726_1149371_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|1149728_1149992_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|1150190_1151402_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
>prophage 4
NZ_CP044136	Proteus mirabilis strain ENT1157 chromosome, complete genome	4105149	1187301	1227893	4105149	tail,integrase,lysis	Cronobacter_phage(17.5%)	62	1179553:1179567	1196114:1196128
1179553:1179567	attL	TAATCAATACCTCAC	NA	NA	NA	NA
WP_049213530.1|1187301_1188303_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	43.1	6.9e-68
WP_155290599.1|1188259_1188505_-	excisionase	NA	NA	NA	NA	NA
WP_155289769.1|1190299_1190806_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	46.2	9.0e-24
WP_036932464.1|1190841_1191168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246003.1|1191201_1191540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246002.1|1191572_1192376_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	95.9	1.7e-141
WP_036907947.1|1192368_1193187_-	exodeoxyribonuclease VIII	NA	A0A1P8DTH1	Proteus_phage	96.3	3.8e-157
WP_004245998.1|1193183_1193438_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	95.2	7.2e-38
WP_004245997.1|1193565_1193748_-	host cell division inhibitory peptide Kil	NA	A0A1P8DTH8	Proteus_phage	85.0	4.4e-21
WP_070486800.1|1194091_1194379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155289771.1|1194363_1194525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155290600.1|1194534_1194852_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	9.3e-19
WP_036908285.1|1195306_1195672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908283.1|1195668_1196448_-	hypothetical protein	NA	NA	NA	NA	NA
1196114:1196128	attR	GTGAGGTATTGATTA	NA	NA	NA	NA
WP_036908281.1|1196482_1197127_-	LexA family transcriptional regulator	NA	A0A077KGZ5	Edwardsiella_phage	65.0	1.9e-79
WP_004247477.1|1197232_1197442_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	83.3	1.2e-25
WP_004247478.1|1197587_1197935_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	8.3e-37
WP_036895070.1|1198200_1198968_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	51.9	1.5e-22
WP_060961231.1|1198967_1200353_+	AAA family ATPase	NA	Q716D2	Shigella_phage	47.9	4.7e-115
WP_026090523.1|1200380_1200710_+	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	39.0	1.1e-22
WP_049195179.1|1200777_1201227_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
WP_004245984.1|1201305_1201596_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_004245983.1|1201592_1201949_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004247487.1|1201948_1202581_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	7.3e-23
WP_004247148.1|1202891_1203413_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_155289772.1|1203571_1203994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026164644.1|1204047_1204317_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	3.5e-19
WP_049255374.1|1204316_1204787_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	61.8	9.8e-49
WP_060554533.1|1204929_1205391_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.9	7.4e-25
WP_036976683.1|1205599_1206028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162305727.1|1206043_1206211_+	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	59.0	8.1e-06
WP_036976685.1|1206556_1207165_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	68.5	2.2e-64
WP_060961177.1|1207167_1208655_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	89.0	3.5e-265
WP_012367628.1|1208654_1210025_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.8	9.0e-119
WP_049235950.1|1210021_1211143_+	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	51.2	1.8e-104
WP_036907977.1|1211254_1212016_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	1.5e-67
WP_004245970.1|1212029_1212983_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.6	1.4e-126
WP_107033975.1|1212985_1213270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245968.1|1213309_1213789_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	2.9e-32
WP_062814387.1|1213791_1214142_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	44.2	6.4e-21
WP_155289776.1|1214143_1214725_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	51.6	1.3e-47
WP_004245963.1|1214721_1215123_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_049201298.1|1215168_1215825_+|tail	major tail protein	tail	G8C7Q3	Escherichia_phage	56.7	5.6e-58
WP_004245960.1|1215876_1216182_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	6.6e-22
WP_080972380.1|1216208_1216487_+	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	6.7e-13
WP_162305730.1|1216871_1217567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049201304.1|1217557_1217959_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_049201306.1|1218036_1218435_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_080978928.1|1218559_1218733_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_080978929.1|1218806_1219376_+	Bro-N domain-containing protein	NA	H6WRU8	Salmonella_phage	61.1	2.0e-32
WP_049201307.1|1219452_1220178_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	57.3	4.7e-66
WP_049201309.1|1220389_1220869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049201311.1|1220890_1221208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155289777.1|1221351_1221585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155290601.1|1221652_1224592_+|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	35.6	9.0e-132
WP_004247512.1|1224614_1224827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195346.1|1224866_1225157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245944.1|1225176_1225377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195345.1|1225520_1225862_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
WP_049201315.1|1225858_1226602_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.4	7.6e-88
WP_049201317.1|1226598_1227309_+	C40 family peptidase	NA	A0A1P8DTI6	Proteus_phage	61.2	1.2e-85
WP_049201318.1|1227305_1227893_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	59.9	1.4e-57
>prophage 5
NZ_CP044136	Proteus mirabilis strain ENT1157 chromosome, complete genome	4105149	1410324	1489398	4105149	protease,tRNA,plate	Bacillus_phage(17.65%)	59	NA	NA
WP_004244558.1|1410324_1410639_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|1410669_1412964_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|1413083_1413302_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012367702.1|1413621_1414314_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004244562.1|1414315_1416067_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-18
WP_017628444.1|1416069_1417839_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004244564.1|1417977_1418937_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	9.0e-65
WP_004244566.1|1419479_1419974_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_155290604.1|1420101_1423905_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|1424017_1424623_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012367706.1|1424633_1425983_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244571.1|1426116_1427406_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_004244572.1|1427585_1427918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367707.1|1428318_1429368_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_004244574.1|1429440_1430346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|1430703_1431444_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|1431551_1433834_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|1433888_1434743_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_017628443.1|1435413_1437171_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_004244579.1|1437398_1438436_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_012367709.1|1438510_1439779_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017628442.1|1439915_1441346_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.1	4.4e-07
WP_004244582.1|1441482_1442571_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_017628441.1|1442767_1444054_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|1444342_1445020_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|1445201_1446875_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|1446939_1447227_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_155290605.1|1447283_1447556_+	ATP synthase subunit A	NA	NA	NA	NA	NA
WP_017628440.1|1447760_1450130_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.3	3.6e-22
WP_004244589.1|1450166_1451912_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_012367713.1|1451908_1452910_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|1453405_1453621_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|1454035_1454215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|1454219_1454981_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017628439.1|1455104_1455935_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244596.1|1456314_1457088_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|1457097_1458420_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|1458400_1459132_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_012367715.1|1459128_1463586_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004247636.1|1463868_1464522_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	80.4	8.2e-102
WP_004247637.1|1464927_1465641_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_049194798.1|1465990_1467706_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|1468037_1468586_+	YcbK family protein	NA	NA	NA	NA	NA
WP_004247640.1|1468635_1469286_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|1469378_1469852_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004244608.1|1469942_1471679_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_017628437.1|1471671_1473027_-	membrane protein	NA	NA	NA	NA	NA
WP_017628436.1|1473064_1476613_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_012367720.1|1476615_1478079_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|1478084_1478735_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|1478736_1479525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049194443.1|1479528_1482240_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	1.4e-83
WP_004244617.1|1482248_1483004_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004244618.1|1482996_1484364_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|1484356_1484908_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|1484909_1486178_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_049194444.1|1486182_1487220_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_049194445.1|1487183_1488959_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244624.1|1488966_1489398_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 6
NZ_CP044136	Proteus mirabilis strain ENT1157 chromosome, complete genome	4105149	1649484	1690528	4105149	integrase,lysis,tRNA,terminase,tail,protease,portal	Enterobacteria_phage(31.58%)	48	1649195:1649209	1680790:1680804
1649195:1649209	attL	TTCAAGGTTAATCAG	NA	NA	NA	NA
WP_004247117.1|1649484_1650588_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|1650693_1651146_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004247119.1|1651138_1651768_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004251822.1|1651906_1653160_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
WP_110706675.1|1653268_1654402_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	72.2	2.9e-155
WP_017628380.1|1654376_1654628_-	excisionase	NA	NA	NA	NA	NA
WP_110706674.1|1654713_1655238_-	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	61.6	6.0e-55
WP_017628378.1|1655522_1656155_-	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	44.4	1.5e-39
WP_006537203.1|1656255_1656462_+	cell division protein	NA	H9C161	Pectobacterium_phage	40.7	8.5e-05
WP_110706673.1|1656499_1656976_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	60.4	3.0e-45
WP_110706672.1|1657038_1657248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908081.1|1657237_1657417_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	2.6e-10
WP_110706931.1|1657974_1658490_+	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	2.0e-23
WP_110706671.1|1658511_1659318_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.1	3.0e-90
WP_110706670.1|1659314_1660340_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	46.8	1.3e-85
WP_110706669.1|1660367_1660766_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	54.3	1.6e-31
WP_006537195.1|1661106_1661319_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.0	6.8e-26
WP_036937653.1|1661650_1662109_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_110706668.1|1662427_1663972_-	RNA-directed DNA polymerase	NA	Q2P9X0	Enterobacteria_phage	76.3	6.8e-232
WP_121910090.1|1664219_1665143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110706666.1|1665782_1666205_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	31.7	2.6e-08
WP_063691653.1|1666270_1666540_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	54.4	5.5e-20
WP_110706665.1|1666539_1667010_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	1.4e-50
WP_121910091.1|1667152_1667614_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	45.6	2.4e-23
WP_004247866.1|1669397_1669910_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	64.0	1.1e-58
WP_049209882.1|1669922_1670417_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	65.6	2.3e-48
WP_063073929.1|1670413_1672516_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	68.9	7.7e-295
WP_004247869.1|1672512_1672728_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	64.3	1.2e-17
WP_063073930.1|1672724_1674215_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	67.0	1.6e-190
WP_096058092.1|1674180_1676169_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	63.9	1.0e-248
WP_049209887.1|1676257_1676599_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	47.7	3.9e-15
WP_063073894.1|1676610_1676883_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	46.1	1.1e-15
WP_063073895.1|1676892_1677456_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	57.1	6.2e-50
WP_036973524.1|1677455_1677851_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	59.5	2.2e-41
WP_074153257.1|1677862_1678384_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	74.7	2.2e-65
WP_049202041.1|1678395_1678785_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	39.4	3.1e-16
WP_080591809.1|1678805_1679126_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	42.0	9.7e-16
WP_063073893.1|1679094_1682088_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	33.8	1.3e-109
1680790:1680804	attR	TTCAAGGTTAATCAG	NA	NA	NA	NA
WP_063073892.1|1682088_1682418_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	54.6	6.7e-28
WP_004247884.1|1682512_1683088_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	34.1	4.9e-18
WP_063073891.1|1683140_1683845_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	51.1	1.7e-65
WP_080978935.1|1684564_1685149_+|tail	tail assembly protein	tail	K7PH50	Enterobacteria_phage	47.5	2.0e-43
WP_063073889.1|1685163_1688367_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	55.5	2.9e-277
WP_049219065.1|1688356_1688689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073888.1|1688688_1689375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017827679.1|1689371_1689638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073887.1|1689654_1689894_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	68.4	2.0e-21
WP_139208638.1|1689934_1690528_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	80.4	1.7e-77
>prophage 7
NZ_CP044136	Proteus mirabilis strain ENT1157 chromosome, complete genome	4105149	1949372	1959364	4105149		Escherichia_phage(66.67%)	8	NA	NA
WP_017628120.1|1949372_1951430_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	2.2e-31
WP_004242886.1|1951441_1953142_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004242887.1|1953477_1954164_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242888.1|1954163_1954625_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242890.1|1954677_1955289_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_017628119.1|1955428_1956289_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.5	1.3e-25
WP_004242892.1|1956290_1956908_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_017628118.1|1956919_1959364_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	5.6e-220
>prophage 8
NZ_CP044136	Proteus mirabilis strain ENT1157 chromosome, complete genome	4105149	2479969	2495826	4105149	holin,lysis	Burkholderia_phage(25.0%)	19	NA	NA
WP_004243611.1|2479969_2480746_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004250729.1|2480861_2481404_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.2	1.6e-18
WP_151252884.1|2481972_2482152_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_004243615.1|2483591_2484248_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
WP_036907817.1|2484244_2485432_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	8.5e-73
WP_004243617.1|2485424_2485769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243621.1|2485765_2486458_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243622.1|2486460_2487273_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|2487241_2487562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250719.1|2487574_2488063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074924013.1|2488065_2490369_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	22.8	4.6e-14
WP_004243627.1|2490451_2490910_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_155290632.1|2490969_2491422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004248362.1|2491432_2492920_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.9e-77
WP_151252883.1|2492928_2493441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036918597.1|2493477_2493927_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_017628006.1|2493923_2494328_-	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.6	1.0e-25
WP_004248367.1|2494330_2494630_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_004248368.1|2495010_2495826_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	3.5e-54
>prophage 9
NZ_CP044136	Proteus mirabilis strain ENT1157 chromosome, complete genome	4105149	2767860	2831685	4105149	plate,integrase,capsid,lysis,head,tRNA,terminase,tail,protease,portal,holin	Salmonella_phage(30.56%)	75	2790372:2790396	2822444:2822468
WP_004243990.1|2767860_2768352_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_004243991.1|2768603_2768819_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004248513.1|2768963_2769203_+	YecH family protein	NA	NA	NA	NA	NA
WP_012368173.1|2769315_2769561_-	DinI-like family protein	NA	A0A0M4S6H1	Salmonella_phage	38.2	2.7e-10
WP_004248514.1|2769745_2770093_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_012368174.1|2770070_2770631_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155290644.1|2770705_2771392_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_004244000.1|2772479_2773316_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049210248.1|2773382_2774243_+	T3SS regulon anti-activator ExsD family protein	NA	NA	NA	NA	NA
WP_155290645.1|2774300_2776769_-	sugar transporter	NA	NA	NA	NA	NA
WP_087726437.1|2776774_2777227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244004.1|2777689_2778238_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.1	2.2e-15
WP_004244005.1|2778739_2778949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244007.1|2779256_2779466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244011.1|2779734_2780463_-	fimbrial assembly chaperone	NA	NA	NA	NA	NA
WP_036971218.1|2780428_2781772_-	fimbrial usher protein StbD	NA	NA	NA	NA	NA
WP_155290646.1|2781775_2784340_-	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
WP_049213459.1|2784323_2785082_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_004244016.1|2785140_2785677_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_155290647.1|2786194_2786941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151252893.1|2786913_2787414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049213455.1|2787639_2788380_+	response regulator	NA	NA	NA	NA	NA
WP_049213453.1|2788352_2788835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017827172.1|2789050_2789599_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017827173.1|2789761_2790121_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
2790372:2790396	attL	ATAAAAAAGCCATCTTGCGATGGCT	NA	NA	NA	NA
WP_155290648.1|2790665_2791370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155290649.1|2791401_2791620_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	70.3	2.2e-19
WP_162305724.1|2791731_2793450_+	RNA-directed DNA polymerase	NA	Q2P9X0	Enterobacteria_phage	27.7	3.5e-19
WP_155290651.1|2793470_2794571_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	55.4	6.0e-113
WP_155290652.1|2794570_2795035_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	55.5	1.5e-41
WP_155290653.1|2795034_2797869_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	41.4	2.4e-118
WP_075204427.1|2797861_2798035_-|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	50.9	1.6e-09
WP_155290697.1|2797995_2798331_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	56.8	3.4e-19
WP_109397496.1|2798362_2798878_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	56.7	8.5e-54
WP_155290654.1|2798881_2800054_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	70.9	1.1e-165
WP_049256911.1|2800146_2800563_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_155289962.1|2802140_2802752_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	68.9	1.6e-75
WP_155289963.1|2802744_2803653_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	66.6	1.6e-108
WP_155289964.1|2803654_2803993_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	53.6	3.2e-25
WP_155289965.1|2803989_2804616_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	60.3	3.4e-57
WP_155289966.1|2804681_2805317_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	35.8	5.8e-28
WP_155289967.1|2805306_2805744_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	48.6	1.2e-32
WP_155289968.1|2805718_2806222_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	30.1	1.4e-05
WP_088206918.1|2806218_2806623_-	M15 family metallopeptidase	NA	K4F776	Cronobacter_phage	57.4	7.9e-39
WP_012368194.1|2806615_2806930_-|holin	holin	holin	NA	NA	NA	NA
WP_049220084.1|2806949_2807156_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	51.5	1.1e-15
WP_049220085.1|2807155_2807611_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.3	2.4e-28
WP_012368197.1|2807688_2808357_-|terminase	terminase	terminase	F1BUQ7	Erwinia_phage	46.6	7.2e-45
WP_155289969.1|2808356_2809502_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	67.4	1.2e-127
WP_155289970.1|2809517_2810327_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	48.8	9.9e-65
WP_155289971.1|2810499_2812254_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	73.4	2.3e-260
WP_152134451.1|2812253_2813282_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	67.8	6.1e-136
WP_155289972.1|2813360_2814194_-	RES domain-containing protein	NA	NA	NA	NA	NA
WP_155289973.1|2814399_2815809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155290655.1|2815837_2818213_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	47.2	1.6e-163
WP_036907632.1|2818212_2818536_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_129765337.1|2818535_2819363_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	47.8	1.8e-61
WP_129765336.1|2819364_2819586_-	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	50.7	2.9e-11
WP_012368209.1|2819578_2819836_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_049220105.1|2819853_2820249_-	DUF5347 family protein	NA	NA	NA	NA	NA
WP_155290656.1|2820257_2820407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049256969.1|2820403_2820601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155290657.1|2820606_2820882_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	47.1	3.7e-16
WP_155290658.1|2820984_2821284_+	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	70.7	4.8e-33
WP_012368215.1|2821350_2822334_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	56.5	2.8e-98
WP_049213452.1|2822502_2824017_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.2	4.1e-88
2822444:2822468	attR	ATAAAAAAGCCATCTTGCGATGGCT	NA	NA	NA	NA
WP_096043105.1|2824025_2825124_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.3	4.1e-05
WP_049213450.1|2825295_2827029_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	4.3e-65
WP_004244030.1|2827038_2827746_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_049198773.1|2827779_2828721_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	3.2e-30
WP_004244033.1|2828828_2829347_+	flavodoxin FldB	NA	NA	NA	NA	NA
WP_004244035.1|2829447_2829855_-	membrane protein	NA	NA	NA	NA	NA
WP_004244037.1|2829889_2830084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026090407.1|2830162_2830438_-	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_004248524.1|2830698_2831685_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP044136	Proteus mirabilis strain ENT1157 chromosome, complete genome	4105149	3020971	3037835	4105149	integrase	Morganella_phage(61.54%)	21	3028712:3028725	3036549:3036562
WP_052715531.1|3020971_3024202_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	42.0	1.8e-101
WP_036918873.1|3024218_3024560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072271821.1|3024559_3024733_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036918875.1|3024904_3025417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109829118.1|3025491_3025947_-	ProQ/FinO family protein	NA	A0A1W6JPI6	Morganella_phage	57.4	1.2e-14
WP_046334699.1|3026403_3029124_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.0	0.0e+00
3028712:3028725	attL	TTATACCGTTCAAT	NA	NA	NA	NA
WP_046334700.1|3029120_3029465_-	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	71.1	1.4e-44
WP_052715532.1|3029479_3030076_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.2	6.4e-29
WP_036900272.1|3030075_3030270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334701.1|3030439_3031051_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	46.3	3.3e-20
WP_060555664.1|3031047_3031257_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	6.1e-11
WP_036918882.1|3031253_3031433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334702.1|3031429_3031687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151252795.1|3031689_3031863_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_155290698.1|3031855_3032884_-	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	49.2	1.2e-70
WP_036907503.1|3032904_3033498_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	76.1	1.5e-81
WP_036900286.1|3033512_3033908_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	57.8	7.3e-29
WP_036900289.1|3033907_3034126_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	45.3	6.6e-08
WP_052174190.1|3034335_3035109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036900290.1|3035318_3036530_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.8e-129
WP_017627899.1|3036962_3037835_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	9.7e-34
3036549:3036562	attR	ATTGAACGGTATAA	NA	NA	NA	NA
>prophage 11
NZ_CP044136	Proteus mirabilis strain ENT1157 chromosome, complete genome	4105149	3138454	3146922	4105149	integrase	uncultured_Mediterranean_phage(33.33%)	6	3130439:3130452	3146440:3146453
3130439:3130452	attL	CACATTAATATTTA	NA	NA	NA	NA
WP_155290678.1|3138454_3139735_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PH06	Moraxella_phage	23.3	1.4e-09
WP_155290679.1|3139965_3142530_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.1	9.9e-26
WP_004244343.1|3142595_3143585_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.2	1.6e-32
WP_004244344.1|3144259_3145384_-	murein hydrolase activator NlpD	NA	A0A292GJG6	Xanthomonas_phage	45.8	5.5e-13
WP_004244345.1|3145537_3146164_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.2	1.9e-31
WP_004244347.1|3146157_3146922_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.4	2.1e-64
3146440:3146453	attR	CACATTAATATTTA	NA	NA	NA	NA
>prophage 12
NZ_CP044136	Proteus mirabilis strain ENT1157 chromosome, complete genome	4105149	3326640	3335484	4105149		Caulobacter_phage(50.0%)	9	NA	NA
WP_004245601.1|3326640_3328209_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_012368337.1|3328609_3329290_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|3329386_3329962_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|3330038_3330617_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245605.1|3330684_3331710_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|3331744_3332200_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_017628547.1|3332224_3333361_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_004250201.1|3333361_3333946_-	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017628546.1|3334338_3335484_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	4.5e-31
>prophage 13
NZ_CP044136	Proteus mirabilis strain ENT1157 chromosome, complete genome	4105149	3934266	3998523	4105149	tRNA,transposase	Salmonella_phage(25.0%)	53	NA	NA
WP_063693206.1|3934266_3935475_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.3	3.4e-186
WP_053828396.1|3935497_3935914_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.1e-43
WP_004249011.1|3936734_3937253_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_017628614.1|3937325_3939497_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_142836749.1|3940859_3943811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628612.1|3943810_3944749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249835.1|3944741_3945011_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_017628611.1|3945202_3946126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368584.1|3946215_3946893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249837.1|3946985_3948593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628610.1|3948606_3951102_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004246670.1|3951124_3951808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246669.1|3951897_3952521_-	fimbrillin MatB	NA	NA	NA	NA	NA
WP_004246668.1|3952660_3952981_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017628609.1|3954030_3955065_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	41.3	7.4e-65
WP_004249995.1|3955785_3957828_+	oligopeptidase A	NA	NA	NA	NA	NA
WP_012368588.1|3957831_3958578_+	16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ	NA	NA	NA	NA	NA
WP_004246663.1|3958648_3959398_-	D-threitol dehydrogenase	NA	NA	NA	NA	NA
WP_017628608.1|3959526_3960867_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_004246661.1|3961120_3961555_-	universal stress protein UspA	NA	NA	NA	NA	NA
WP_004246660.1|3961968_3962301_+	universal stress protein UspB	NA	NA	NA	NA	NA
WP_004246659.1|3962372_3963872_-	inorganic phosphate transporter PitA	NA	NA	NA	NA	NA
WP_012368590.1|3964180_3965386_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017628607.1|3965989_3966298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249849.1|3966537_3967239_+	pirin family protein	NA	NA	NA	NA	NA
WP_004246655.1|3967354_3968974_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.4	1.7e-140
WP_004246652.1|3969178_3970063_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_004246651.1|3970090_3970504_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_004249850.1|3970577_3972686_-	intracellular growth attenuator family protein	NA	NA	NA	NA	NA
WP_004246647.1|3973041_3973599_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_004249852.1|3973688_3974492_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017628606.1|3974825_3977360_-	peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA	NA	NA	NA	NA	NA
WP_017628605.1|3977476_3978301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628604.1|3978288_3978888_+	fimbrial assembly protein	NA	NA	NA	NA	NA
WP_017628603.1|3978871_3979405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246639.1|3979411_3980527_+	competence protein E	NA	D0U174	Enterobacteria_phage	24.9	1.7e-11
WP_012368596.1|3981107_3981629_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_004249857.1|3981681_3982776_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_155290688.1|3982930_3983875_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_004249858.1|3983956_3984772_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	47.1	1.2e-65
WP_004246629.1|3984816_3985491_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_004249859.1|3985487_3986198_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_004246627.1|3986199_3987228_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155290689.1|3987288_3988485_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.0	5.4e-184
WP_036895833.1|3988507_3988924_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	7.6e-45
WP_012368600.1|3989011_3989686_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004249861.1|3989803_3990427_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.5	6.4e-64
WP_004249862.1|3990794_3992753_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.1	3.7e-89
WP_004246621.1|3992917_3993229_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_004246620.1|3993225_3994881_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_017628600.1|3995203_3996835_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_063693479.1|3996874_3998083_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	6.2e-188
WP_058336253.1|3998154_3998523_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	2.1e-38
