The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	0	59154	2822516	capsid,tail,portal,head,protease,holin,tRNA	Staphylococcus_phage(64.71%)	59	NA	NA
WP_000025272.1|1677_2865_+|portal	phage portal protein	portal	G4KNQ1	Staphylococcus_phage	100.0	4.6e-220
WP_000642728.1|2848_3586_+|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
WP_000154559.1|3609_4755_+|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
WP_000238236.1|4774_5059_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000150936.1|5048_5333_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|5316_5679_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114226.1|5675_6080_+	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
WP_000565498.1|6076_6484_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000268740.1|6484_7129_+|tail	phage tail protein	tail	G4KNQ7	Staphylococcus_phage	100.0	6.5e-120
WP_071621395.1|7170_7395_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
WP_001096355.1|7444_7795_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_001549167.1|7845_7983_+	hypothetical protein	NA	A0A2I6PDX7	Staphylococcus_phage	100.0	3.4e-18
WP_000504558.1|8039_12581_+|tail	phage tail tape measure protein	tail	A0A2I6PE03	Staphylococcus_phage	100.0	0.0e+00
WP_000567420.1|12580_14065_+|tail	phage tail protein	tail	G4KNR0	Staphylococcus_phage	100.0	1.6e-299
WP_000582126.1|14080_17866_+	hypothetical protein	NA	G4KNR1	Staphylococcus_phage	100.0	0.0e+00
WP_001153681.1|17855_18008_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
WP_001040259.1|18054_18342_+	hypothetical protein	NA	G4KNR2	Staphylococcus_phage	100.0	9.9e-44
WP_000340977.1|18397_18772_+	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
WP_000339141.1|18897_19200_+|holin	phage holin	holin	A0A2I6PF56	Staphylococcus_phage	100.0	3.1e-48
WP_000909204.1|19210_20665_+	CHAP domain-containing protein	NA	A0A2I6PF47	Staphylococcus_phage	100.0	7.5e-289
WP_000239544.1|21054_21993_+	Panton-Valentine bi-component leukocidin subunit S	NA	A0A2I6PF61	Staphylococcus_phage	100.0	1.7e-180
WP_024937002.1|21988_22972_+	Panton-Valentine bi-component leukocidin subunit F	NA	A0A2I6PEU3	Staphylococcus_phage	100.0	4.0e-185
WP_061820357.1|23154_23406_+	hypothetical protein	NA	A0ZS61	Staphylococcus_virus	96.7	2.0e-24
WP_000476889.1|23496_24402_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_000476869.1|24459_25404_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001186908.1|25806_26352_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_001151997.1|26457_26706_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001163813.1|26813_27767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902114.1|27756_29136_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.6	2.2e-56
WP_000069308.1|29288_30749_+	elastin-binding protein EbpS	NA	NA	NA	NA	NA
WP_001824277.1|30873_30990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001174260.1|31150_32137_+	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_000681761.1|32251_33220_-	asparaginase	NA	NA	NA	NA	NA
WP_000644394.1|33296_33956_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_031844926.1|33998_34103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031844924.1|34219_34411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133960.1|34666_35842_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000165530.1|36058_37369_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_000161742.1|37385_38384_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001043863.1|38554_38827_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|39257_39830_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_000774684.1|39832_40558_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_078062714.1|40574_41519_+	heptaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442477.1|41610_42060_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_000789522.1|42269_42470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001269940.1|42856_44023_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.3	2.6e-34
WP_000776330.1|44048_45113_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_000245912.1|45122_46421_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000389518.1|46427_47672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005216.1|47685_48261_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	2.7e-08
WP_000154692.1|48250_48838_+	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_001827022.1|48909_49590_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_000839926.1|49925_50243_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000690024.1|50500_51643_+	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA	NA	NA	NA	NA	NA
WP_000361537.1|51647_52850_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	43.3	5.4e-35
WP_000049916.1|52836_53808_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000525064.1|53831_56525_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.6	1.1e-46
WP_000858801.1|56846_58139_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	1.5e-54
WP_000362218.1|58467_59154_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	1.2e-07
>prophage 2
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	62845	63523	2822516		Bacillus_phage(100.0%)	1	NA	NA
WP_001794297.1|62845_63523_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.9e-24
>prophage 3
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	72798	73677	2822516		Bacillus_phage(100.0%)	1	NA	NA
WP_001133012.1|72798_73677_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.8e-19
>prophage 4
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	112047	121441	2822516		Staphylococcus_phage(60.0%)	13	NA	NA
WP_000282171.1|112047_112752_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.8	8.4e-12
WP_001824522.1|112996_113191_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_001165814.1|113202_113454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000404626.1|113491_114616_+	virulence factor	NA	NA	NA	NA	NA
WP_000995285.1|114631_115069_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934885.1|115492_116449_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000175746.1|116648_117128_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_000166052.1|117142_117982_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	76.5	3.0e-48
WP_000159902.1|118071_118605_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913315.1|118597_119026_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473654.1|119037_119538_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|119537_119759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342123.1|119950_121441_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.5	8.6e-22
>prophage 5
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	125204	127216	2822516		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|125204_125864_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166795.1|125860_127216_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	25.0	8.9e-10
>prophage 6
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	133386	134178	2822516		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|133386_134178_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 7
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	137719	143351	2822516	lysis,protease	Lactobacillus_phage(33.33%)	8	NA	NA
WP_000138424.1|137719_138856_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
WP_001788788.1|138887_139517_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001215907.1|139535_139805_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|139963_140272_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|140442_140643_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876210.1|140839_141241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558407.1|141374_141992_+|protease	protease	protease	NA	NA	NA	NA
WP_000216940.1|142085_143351_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	22.7	1.4e-12
>prophage 8
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	151196	152798	2822516		Klosneuvirus(100.0%)	1	NA	NA
WP_000942303.1|151196_152798_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 9
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	157224	160680	2822516		Indivirus(50.0%)	3	NA	NA
WP_000079452.1|157224_158076_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	6.8e-16
WP_000974847.1|158082_158724_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077558.1|158865_160680_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	46.8	5.7e-153
>prophage 10
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	164094	164796	2822516		Tupanvirus(100.0%)	1	NA	NA
WP_000571245.1|164094_164796_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	28.3	5.8e-13
>prophage 11
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	172312	174667	2822516		Acinetobacter_phage(100.0%)	3	NA	NA
WP_000153622.1|172312_173095_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	35.9	2.1e-27
WP_000173835.1|173096_174095_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.9	1.1e-33
WP_000604804.1|174100_174667_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	31.3	3.8e-23
>prophage 12
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	178985	180248	2822516		Bacillus_phage(100.0%)	1	NA	NA
WP_000283025.1|178985_180248_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	9.9e-96
>prophage 13
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	189894	194288	2822516		Bacillus_phage(50.0%)	2	NA	NA
WP_001289574.1|189894_192297_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.4	2.3e-93
WP_001574370.1|192296_194288_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 14
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	200065	201712	2822516		Vibrio_phage(100.0%)	1	NA	NA
WP_001088980.1|200065_201712_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.4	2.5e-22
>prophage 15
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	205381	206503	2822516		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691293.1|205381_206503_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.7	3.3e-10
>prophage 16
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	210653	216309	2822516		Phage_Wrath(25.0%)	7	NA	NA
WP_001208755.1|210653_211277_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	5.9e-17
WP_000380726.1|211656_212520_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	3.1e-16
WP_001791425.1|212593_212698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688126.1|212694_213672_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	100.0	2.1e-186
WP_001085655.1|213828_214098_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|214551_214701_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000078506.1|214791_216309_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.8	1.8e-91
>prophage 17
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	226480	227014	2822516		Bacillus_phage(100.0%)	1	NA	NA
WP_000841351.1|226480_227014_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
>prophage 18
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	232436	239940	2822516	capsid	Staphylococcus_phage(87.5%)	14	NA	NA
WP_064137920.1|232436_233105_-|capsid	minor capsid protein	capsid	Q4ZE35	Staphylococcus_virus	70.7	1.5e-29
WP_001217295.1|233183_233378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000440735.1|234556_234835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071665623.1|234801_234930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000780597.1|234990_235185_-	hypothetical protein	NA	A0A1J0MG79	Staphylococcus_phage	71.4	2.8e-18
WP_001813273.1|235184_235439_-	hypothetical protein	NA	A0A1J0MF61	Staphylococcus_phage	62.7	1.4e-25
WP_166517775.1|235435_235843_-|capsid	minor capsid protein	capsid	A0A1J0MFV1	Staphylococcus_phage	61.8	2.0e-42
WP_000956747.1|235912_236164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477491.1|236290_236395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000006110.1|236906_237092_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_001788716.1|237520_237631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002343.1|238326_238533_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	56.7	1.9e-12
WP_078065144.1|238828_239053_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	71.0	4.3e-18
WP_001659797.1|239742_239940_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.7e-10
>prophage 19
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	245010	245487	2822516		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448078.1|245010_245487_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 20
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	251429	257910	2822516		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_001103747.1|251429_252248_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	3.1e-26
WP_001077635.1|252721_253264_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516254.1|253269_255279_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.5	5.3e-59
WP_000073335.1|255291_257910_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.6	1.4e-40
>prophage 21
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	267325	268369	2822516		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|267325_268369_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 22
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	273047	278591	2822516		Bacillus_virus(33.33%)	4	NA	NA
WP_000664781.1|273047_274334_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	28.4	7.9e-16
WP_000089949.1|274333_275599_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	27.0	1.6e-40
WP_001293310.1|275629_276343_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014363416.1|276347_278591_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 23
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	283732	295547	2822516	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864174.1|283732_284704_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_000282295.1|284718_285636_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|285805_286156_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000043639.1|286542_288660_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.3	6.2e-26
WP_000020853.1|288664_288982_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|288978_289263_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000097463.1|289283_290459_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036631.1|290479_290947_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_078065168.1|291236_295547_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 24
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	299820	300591	2822516		Flavobacterium_phage(100.0%)	1	NA	NA
WP_058142976.1|299820_300591_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	40.7	6.2e-24
>prophage 25
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	305365	318129	2822516	protease,tRNA	Erwinia_phage(20.0%)	10	NA	NA
WP_000379054.1|305365_306769_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	4.9e-27
WP_000072681.1|306834_307380_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_154285210.1|307376_308273_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.5	1.4e-30
WP_000195254.1|308690_309998_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_001838647.1|310153_312229_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	2.3e-105
WP_000620183.1|312401_313274_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000672856.1|313445_314690_-	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
WP_000110253.1|315156_316065_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	3.0e-17
WP_001020801.1|316086_317253_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000176399.1|317361_318129_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
>prophage 26
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	331424	333545	2822516		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|331424_332156_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|332271_332505_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|332810_333545_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 27
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	343915	345910	2822516		Moumouvirus(100.0%)	1	NA	NA
WP_000579552.1|343915_345910_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 28
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	349057	349993	2822516	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161279.1|349057_349993_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	6.2e-10
>prophage 29
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	354998	357255	2822516		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722166.1|354998_356198_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	2.1e-42
WP_000933956.1|356413_356632_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_058142975.1|356631_357255_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	4.7e-22
>prophage 30
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	360770	361382	2822516		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|360770_361382_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 31
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	365349	369960	2822516		Halovirus(33.33%)	4	NA	NA
WP_001190913.1|365349_366450_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	5.6e-63
WP_000767028.1|366451_367726_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|367743_368625_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178613.1|368652_369960_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 32
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	375719	378473	2822516	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384697.1|375719_378473_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	3.6e-90
>prophage 33
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	398055	398244	2822516		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245798.1|398055_398244_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	85.2	8.5e-20
>prophage 34
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	407441	409401	2822516		Staphylococcus_phage(100.0%)	3	NA	NA
WP_001802045.1|407441_407666_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	71.4	5.6e-18
WP_000765708.1|407622_407769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000857485.1|408441_409401_+	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	30.3	1.3e-34
>prophage 35
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	423466	428024	2822516		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|423466_423781_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_001249291.1|423953_426302_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.8	2.9e-16
WP_000161946.1|426311_428024_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	8.9e-15
>prophage 36
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	432901	433960	2822516	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003566.1|432901_433960_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 37
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	445906	448817	2822516		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000401377.1|445906_446389_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_001263802.1|446390_446933_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000814565.1|447002_447392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049150.1|447394_447649_-	YlbG family protein	NA	NA	NA	NA	NA
WP_000757578.1|447887_448817_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	25.8	2.2e-12
>prophage 38
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	460291	462139	2822516		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000182659.1|460291_462139_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	26.2	1.8e-21
>prophage 39
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	470274	479108	2822516		Mycoplasma_phage(25.0%)	9	NA	NA
WP_000433555.1|470274_471369_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020622.1|471381_471921_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000455590.1|472064_472340_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_154285212.1|472508_473915_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.3	3.3e-47
WP_000863437.1|473918_475211_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_000068176.1|475301_476279_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000035320.1|476282_477395_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	A0A0K0KW14	Prochlorococcus_phage	27.8	1.4e-05
WP_000668338.1|477565_478192_-	cell-wall-binding lipoprotein	NA	NA	NA	NA	NA
WP_000957036.1|478556_479108_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 40
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	488196	489369	2822516		Streptococcus_phage(100.0%)	1	NA	NA
WP_000685063.1|488196_489369_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.8	4.0e-75
>prophage 41
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	492548	507309	2822516		Prochlorococcus_phage(22.22%)	14	NA	NA
WP_000921971.1|492548_493949_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.1e-10
WP_000273256.1|493941_494748_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001101926.1|495013_496261_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000709285.1|496282_497761_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.5	2.7e-76
WP_000238670.1|497775_498342_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	3.6e-29
WP_000030810.1|498344_499373_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	1.3e-61
WP_000483727.1|499365_500850_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.5	1.6e-44
WP_000032747.1|500828_503018_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.7	1.8e-140
WP_000666799.1|503010_503682_-	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
WP_000848350.1|503683_503947_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174047.1|503946_504651_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.2	1.4e-46
WP_001010401.1|504654_505779_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861570.1|505765_506248_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
WP_000225832.1|506448_507309_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.8	1.2e-39
>prophage 42
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	517630	546589	2822516	bacteriocin,protease,transposase	Staphylococcus_phage(42.86%)	29	NA	NA
WP_154285213.1|517630_521395_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A1J0MFB0	Staphylococcus_phage	37.6	1.1e-54
WP_001788579.1|521465_521576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777467.1|521726_523019_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	30.8	2.6e-14
WP_001066124.1|523011_523773_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	44.2	1.1e-54
WP_154285214.1|523828_524227_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000202434.1|524379_525390_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_000777567.1|525585_526740_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000676555.1|527267_528314_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	32.3	6.4e-16
WP_001088784.1|528395_529577_+|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
WP_000284457.1|529614_529944_+	staphostatin B	NA	NA	NA	NA	NA
WP_000184947.1|530182_531004_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_000150220.1|530996_531800_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_000526687.1|531786_533460_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_001804449.1|533446_534658_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_072357920.1|534761_534839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070968.1|534989_535928_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000620942.1|535978_536530_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001788574.1|536619_536910_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	7.5e-07
WP_020978112.1|536973_537105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081331.1|537150_538110_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000766009.1|538597_538954_+	DoxX family protein	NA	NA	NA	NA	NA
WP_001824253.1|539042_539180_-	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
WP_001795266.1|539320_539611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571180.1|539698_540340_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	5.0e-19
WP_000668628.1|540336_540657_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000870825.1|540659_542624_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_029656376.1|542667_542934_-|bacteriocin	bacteriocin transporter	bacteriocin	NA	NA	NA	NA
WP_057504515.1|543944_545591_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	99.6	9.7e-293
WP_001033867.1|545986_546589_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 43
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	552556	557764	2822516	protease	Pithovirus(33.33%)	3	NA	NA
WP_078064575.1|552556_554881_-|protease	serine protease	protease	W5SAB9	Pithovirus	27.4	2.1e-11
WP_000928413.1|555096_555900_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049958.1|556201_557764_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.0	3.2e-35
>prophage 44
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	578980	580789	2822516		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082725.1|578980_580789_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	5.5e-47
>prophage 45
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	584738	590489	2822516	transposase	Bacillus_virus(66.67%)	5	NA	NA
WP_000277723.1|584738_586385_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.1	1.6e-292
WP_049786226.1|586671_587523_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000593421.1|587564_588527_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000427764.1|588519_589500_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-16
WP_001067032.1|589502_590489_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	1.8e-15
>prophage 46
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	594141	596155	2822516		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000786743.1|594141_595083_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	9.3e-06
WP_000140050.1|595072_596155_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.4e-19
>prophage 47
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	604748	611558	2822516		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_000619354.1|604748_605894_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.3	3.9e-06
WP_001047064.1|606003_606873_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353962.1|606931_609541_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.7	9.5e-117
WP_001044212.1|609743_611558_-	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	34.4	1.8e-37
>prophage 48
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	616782	620436	2822516		Bacillus_phage(100.0%)	1	NA	NA
WP_000154915.1|616782_620436_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.5	1.2e-24
>prophage 49
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	631189	638297	2822516		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_000185327.1|631189_632119_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.7	1.5e-16
WP_000138487.1|632570_633815_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_000167314.1|633923_635114_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.7	1.3e-33
WP_000838027.1|635422_636550_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|636911_637289_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035058.1|637703_638297_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 50
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	648231	651849	2822516		Mycoplasma_phage(50.0%)	3	NA	NA
WP_001009700.1|648231_649707_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	35.2	4.0e-48
WP_000046076.1|649837_651046_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001143497.1|651489_651849_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
>prophage 51
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	655893	658562	2822516		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|655893_657108_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_000129662.1|657104_658562_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.3	2.6e-39
>prophage 52
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	671859	696120	2822516	terminase,integrase,coat	Staphylococcus_phage(75.0%)	35	677132:677153	697793:697814
WP_001838628.1|671859_673110_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.8	1.1e-110
WP_000205572.1|673215_674523_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000168845.1|674620_675382_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
WP_001183851.1|675710_676562_+	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_000752917.1|676795_676990_-	CsbD family protein	NA	NA	NA	NA	NA
677132:677153	attL	AGGGAGTGGGACAGAAATGATA	NA	NA	NA	NA
WP_000382163.1|678113_678314_-	hypothetical protein	NA	W5R9N2	Staphylococcus_phage	100.0	3.7e-29
WP_000139423.1|678300_678411_-	hypothetical protein	NA	W5R8J7	Staphylococcus_phage	100.0	1.7e-12
WP_001795626.1|678481_678634_-	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	98.0	7.6e-19
WP_001035631.1|679007_679565_+	DUF4888 domain-containing protein	NA	A0A1W6JQE5	Staphylococcus_phage	73.8	1.4e-70
WP_000278085.1|679642_680443_-	staphylococcal enterotoxin type B	NA	A0A097PAT7	Streptococcus_pyogenes_phage	49.4	1.0e-53
WP_001293067.1|680750_681320_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	97.9	1.0e-100
WP_045181470.1|681316_681529_-	hypothetical protein	NA	Q4ZE86	Staphylococcus_phage	98.6	1.1e-31
WP_000771368.1|681660_682188_-|coat	spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	97.1	3.5e-87
WP_000448773.1|682238_682457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000846285.1|682474_683053_-	hypothetical protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.4	1.4e-28
WP_001190615.1|683064_683406_-	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	99.1	1.4e-57
WP_001019764.1|683922_684564_-	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	91.5	1.5e-108
WP_000998181.1|684560_684845_-	hypothetical protein	NA	A0A1W6JQE4	Staphylococcus_phage	95.7	1.9e-47
WP_001039168.1|684846_685209_-	hypothetical protein	NA	A0A1W6JQD5	Staphylococcus_phage	99.2	8.9e-66
WP_000390454.1|685494_686964_-	hypothetical protein	NA	A0A1W6JQD6	Staphylococcus_phage	99.0	2.9e-288
WP_001002732.1|686980_687850_-	hypothetical protein	NA	A0A1W6JQL5	Staphylococcus_phage	92.7	3.4e-156
WP_001103942.1|687913_688234_-	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	51.9	1.3e-20
WP_001058486.1|688236_688446_-	hypothetical protein	NA	Q4ZE76	Staphylococcus_phage	94.2	1.7e-29
WP_000784875.1|688438_688585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091731.1|688596_688869_-	winged helix-turn-helix domain-containing protein	NA	Q4ZE77	Staphylococcus_phage	90.0	9.7e-41
WP_112368207.1|688884_689124_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J9X2	uncultured_Caudovirales_phage	88.6	1.7e-33
WP_001260004.1|689316_689649_+	helix-turn-helix transcriptional regulator	NA	A0A1J0MFC1	Staphylococcus_phage	74.5	1.6e-37
WP_000281657.1|689660_690119_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0H4J322	Staphylococcus_phage	83.0	5.1e-66
WP_001228759.1|690135_690567_+	hypothetical protein	NA	Q4ZCB6	Staphylococcus_virus	56.0	5.1e-36
WP_001033318.1|690636_691365_+	staphylococcal enterotoxin type Q	NA	A0EX09	Staphylococcus_phage	35.4	1.0e-28
WP_000733774.1|691388_692117_+	staphylococcal enterotoxin type K	NA	A0EX09	Staphylococcus_phage	31.8	5.5e-22
WP_000266157.1|692204_693425_+|integrase	site-specific integrase	integrase	Q4ZE80	Staphylococcus_phage	47.5	6.4e-100
WP_000732334.1|693567_694389_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000520233.1|694406_695102_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000571213.1|695094_696120_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	9.4e-28
697793:697814	attR	TATCATTTCTGTCCCACTCCCT	NA	NA	NA	NA
>prophage 53
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	699462	704640	2822516		Streptococcus_phage(50.0%)	8	NA	NA
WP_000589549.1|699462_699819_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001147955.1|699962_700283_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|700432_700972_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150029.1|701054_701771_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.1	6.8e-17
WP_000974455.1|701918_702341_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569881.1|702739_703234_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255554.1|703389_704007_+	amino acid transporter	NA	NA	NA	NA	NA
WP_072353886.1|704079_704640_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	2.2e-31
>prophage 54
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	708047	709291	2822516		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|708047_708248_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_001823812.1|708604_709291_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	53.4	1.1e-32
>prophage 55
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	718663	727423	2822516		Staphylococcus_phage(50.0%)	8	NA	NA
WP_000757406.1|718663_719392_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	37.5	1.3e-18
WP_000999092.1|719679_720294_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_001085185.1|721260_721725_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
WP_001050031.1|721746_724119_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	1.9e-92
WP_001165974.1|724152_724893_-	carboxylesterase	NA	NA	NA	NA	NA
WP_000556760.1|725021_725255_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785252.1|725321_725780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|726118_727423_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 56
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	738635	744336	2822516		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|738635_739223_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|739792_740737_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248941.1|740847_741843_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369719.1|741839_742751_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134959.1|743400_744336_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	4.9e-84
>prophage 57
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	748729	751576	2822516		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662686.1|748729_751576_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
>prophage 58
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	754894	755734	2822516		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000749391.1|754894_755734_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 59
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	761818	767531	2822516		Streptococcus_phage(66.67%)	5	NA	NA
WP_000370986.1|761818_762901_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.5	2.6e-44
WP_000686342.1|763264_764131_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192947.1|764274_764916_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	4.0e-37
WP_000258151.1|765087_766143_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|766460_767531_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 60
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	776813	800156	2822516		uncultured_Caudovirales_phage(35.71%)	19	NA	NA
WP_000616873.1|776813_777575_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	8.5e-18
WP_001245572.1|777571_778528_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
WP_000876317.1|778514_779486_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.6	3.6e-138
WP_000499195.1|779524_779680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562498.1|780179_781151_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855509.1|781268_783374_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.6	0.0e+00
WP_000692521.1|783336_783735_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068497.1|784535_785402_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930014.1|785421_785922_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
WP_000193751.1|786261_787767_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_031760357.1|787844_787946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429011.1|788038_788956_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	6.2e-07
WP_000197262.1|789563_790106_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000663039.1|790264_791323_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.4	1.4e-21
WP_000180997.1|791562_793077_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589262.1|793069_794047_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	5.4e-25
WP_078368064.1|794268_796050_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	36.8	3.8e-77
WP_000525113.1|796061_797945_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	3.3e-55
WP_000098285.1|798215_800156_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 61
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	803303	813150	2822516		Pandoravirus(12.5%)	12	NA	NA
WP_001217800.1|803303_804455_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	6.0e-23
WP_000604508.1|804438_805032_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.0	6.8e-39
WP_000446724.1|805382_806051_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|806052_806472_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062976.1|806475_807189_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_058142967.1|807287_807872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093553.1|808151_808592_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|808933_809407_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|809381_810068_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244415.1|810067_811123_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_000702774.1|811195_812179_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.3	4.3e-62
WP_000931233.1|812310_813150_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.9	6.7e-56
>prophage 62
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	824692	826066	2822516		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000952025.1|824692_826066_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	34.1	6.6e-45
>prophage 63
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	831043	837322	2822516		Bacillus_phage(33.33%)	6	NA	NA
WP_000857614.1|831043_832717_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	23.6	2.6e-11
WP_000737156.1|832713_834345_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.8	5.7e-11
WP_000469897.1|834563_835439_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358501.1|835609_836293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148822.1|836295_836754_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820892.1|836755_837322_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	6.1e-21
>prophage 64
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	844518	844992	2822516		Pandoravirus(100.0%)	1	NA	NA
WP_000833479.1|844518_844992_-	cupin	NA	A0A291AU44	Pandoravirus	39.4	1.6e-14
>prophage 65
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	850255	851053	2822516		Bacillus_phage(100.0%)	1	NA	NA
WP_000731644.1|850255_851053_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	30.2	1.2e-06
>prophage 66
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	855882	856644	2822516		Planktothrix_phage(100.0%)	1	NA	NA
WP_000985996.1|855882_856644_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	7.2e-33
>prophage 67
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	861018	862062	2822516		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_001030774.1|861018_862062_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	28.0	4.4e-17
>prophage 68
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	868585	869383	2822516		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|868585_869383_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 69
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	872610	876569	2822516		Bacillus_phage(33.33%)	3	NA	NA
WP_000817960.1|872610_874338_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793062.1|874758_876054_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|876170_876569_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 70
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	883503	884247	2822516		Indivirus(100.0%)	1	NA	NA
WP_000894464.1|883503_884247_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	1.2e-11
>prophage 71
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	895198	895759	2822516	integrase	Streptococcus_phage(100.0%)	1	889352:889366	899350:899364
889352:889366	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044917.1|895198_895759_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S9C2	Streptococcus_phage	35.4	1.1e-19
WP_001044917.1|895198_895759_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S9C2	Streptococcus_phage	35.4	1.1e-19
899350:899364	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 72
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	903713	904199	2822516	transposase	Lactococcus_phage(100.0%)	1	NA	NA
WP_000093393.1|903713_904199_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.9e-19
>prophage 73
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	909384	912738	2822516		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|909384_910395_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001788287.1|910893_911415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180234.1|911442_912738_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	1.2e-24
>prophage 74
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	921449	922772	2822516		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860593.1|921449_922772_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.6	9.1e-108
>prophage 75
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	929959	930445	2822516	transposase	Lactococcus_phage(100.0%)	1	NA	NA
WP_000093393.1|929959_930445_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.9e-19
>prophage 76
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	934815	935472	2822516		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455258.1|934815_935472_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	6.4e-46
>prophage 77
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	939140	942461	2822516		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001100844.1|939140_940517_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	24.1	5.7e-20
WP_000347074.1|941060_942461_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.8	1.6e-54
>prophage 78
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	948720	953751	2822516	transposase	Staphylococcus_virus(50.0%)	3	NA	NA
WP_000277723.1|948720_950367_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.1	1.6e-292
WP_001106109.1|950663_952154_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001106712.1|952278_953751_-	glycosyltransferase	NA	A0A1V0SGA9	Hokovirus	23.3	5.5e-05
>prophage 79
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	968063	968726	2822516		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067259.1|968063_968726_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	36.9	3.1e-24
>prophage 80
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	975301	976489	2822516		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250828.1|975301_976489_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.8	8.8e-46
>prophage 81
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	979517	990471	2822516		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|979517_981599_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|981721_982192_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|982257_982671_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|982768_983023_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001819727.1|983159_986756_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	4.3e-67
WP_000918667.1|986919_990471_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.3	2.1e-50
>prophage 82
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	994154	998937	2822516	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|994154_994703_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|994715_994898_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001788193.1|994953_995097_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872872.1|995211_995781_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664738.1|995861_996386_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390339.1|996385_997132_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370186.1|997139_997544_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631977.1|997536_998937_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.0	5.5e-55
>prophage 83
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1004949	1007406	2822516	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|1004949_1007406_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 84
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1026871	1037157	2822516	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288207.1|1026871_1028359_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	40.9	7.8e-92
WP_001790128.1|1028411_1028504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613718.1|1028896_1029373_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154302.1|1029369_1029735_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167940.1|1029712_1030516_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	30.8	8.7e-21
WP_000057594.1|1030731_1031664_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148605.1|1031842_1032724_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001167888.1|1032966_1035060_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000551283.1|1035317_1035857_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176711.1|1035861_1037157_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.5	4.8e-13
>prophage 85
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1046413	1049739	2822516	transposase	Hokovirus(33.33%)	3	NA	NA
WP_000933774.1|1046413_1047379_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_001252528.1|1047525_1048878_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	8.3e-24
WP_000093393.1|1049253_1049739_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.9e-19
>prophage 86
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1055501	1058599	2822516	tRNA	Hokovirus(50.0%)	2	NA	NA
WP_001051120.1|1055501_1057475_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.6	3.2e-93
WP_000279919.1|1057759_1058599_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 87
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1062505	1063123	2822516		Streptococcus_phage(100.0%)	1	NA	NA
WP_154285218.1|1062505_1063123_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	47.8	9.2e-47
>prophage 88
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1071976	1073674	2822516		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109053.1|1071976_1073674_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.1	4.3e-54
>prophage 89
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1090324	1096564	2822516		Lactobacillus_phage(33.33%)	6	NA	NA
WP_001170262.1|1090324_1091329_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.5	1.2e-24
WP_000825529.1|1091660_1092503_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467994.1|1092539_1093199_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569284.1|1093202_1094228_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	4.1e-31
WP_001036643.1|1094523_1095666_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	NA	NA	NA	NA
WP_000634111.1|1095658_1096564_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.4	2.5e-48
>prophage 90
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1114195	1116242	2822516	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_000777467.1|1114195_1115488_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	30.8	2.6e-14
WP_001066124.1|1115480_1116242_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	44.2	1.1e-54
>prophage 91
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1122428	1125087	2822516		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072559.1|1122428_1123538_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	43.9	4.5e-68
WP_000028591.1|1123530_1125087_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	95.8	2.7e-284
>prophage 92
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1134480	1134966	2822516	transposase	Lactococcus_phage(100.0%)	1	NA	NA
WP_000093393.1|1134480_1134966_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.9e-19
>prophage 93
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1146216	1149249	2822516		Hokovirus(50.0%)	2	NA	NA
WP_000424963.1|1146216_1147758_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1147782_1149249_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 94
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1158207	1159731	2822516		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930507.1|1158207_1159731_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.9	6.4e-41
>prophage 95
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1169394	1177930	2822516	transposase	Staphylococcus_phage(33.33%)	10	NA	NA
WP_000934799.1|1169394_1169898_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|1169918_1170215_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052486.1|1170458_1170623_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	76.5	3.1e-18
WP_001066124.1|1170678_1171440_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	44.2	1.1e-54
WP_000777467.1|1171432_1172725_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	30.8	2.6e-14
WP_001218732.1|1172940_1174038_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000157348.1|1174049_1174253_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_000373077.1|1174282_1175164_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_014363379.1|1175317_1176163_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	33.8	3.5e-12
WP_000655692.1|1176826_1177930_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
>prophage 96
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1187851	1188694	2822516		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209561.1|1187851_1188694_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.7	1.0e-11
>prophage 97
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1208661	1211396	2822516		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_000280816.1|1208661_1209684_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	28.1	8.8e-10
WP_001191930.1|1209661_1210606_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_000449065.1|1210595_1211396_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	43.0	3.1e-42
>prophage 98
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1229623	1230301	2822516		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911020.1|1229623_1230301_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	1.2e-31
>prophage 99
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1246018	1250467	2822516		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000549292.1|1246018_1250467_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.7	1.7e-28
>prophage 100
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1261072	1262735	2822516		Amsacta_moorei_entomopoxvirus(50.0%)	2	NA	NA
WP_000570070.1|1261072_1261732_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	37.2	7.6e-23
WP_000736789.1|1261784_1262735_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 101
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1271511	1272948	2822516		Pandoravirus(100.0%)	1	NA	NA
WP_000163992.1|1271511_1272948_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.8	4.8e-30
>prophage 102
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1276708	1281248	2822516		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925394.1|1276708_1278448_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	1.5e-62
WP_000608828.1|1278708_1279383_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975351.1|1279526_1281248_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 103
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1290574	1291618	2822516		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645593.1|1290574_1291618_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.9	6.0e-14
>prophage 104
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1298832	1300362	2822516		Vibrio_phage(100.0%)	1	NA	NA
WP_000838207.1|1298832_1300362_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	49.4	8.2e-12
>prophage 105
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1309238	1310744	2822516		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001008406.1|1309238_1310744_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	3.5e-39
>prophage 106
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1321948	1327307	2822516		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|1321948_1324198_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_000837101.1|1324785_1325754_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_072512167.1|1325750_1327307_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	7.6e-13
>prophage 107
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1337621	1339681	2822516		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818914.1|1337621_1338719_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166908.1|1339102_1339681_-	M23 family metallopeptidase	NA	A0A1Q1PW35	Staphylococcus_phage	39.0	8.7e-15
>prophage 108
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1348216	1349809	2822516		Planktothrix_phage(100.0%)	1	NA	NA
WP_000067354.1|1348216_1349809_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	3.1e-22
>prophage 109
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1366469	1367654	2822516		Klosneuvirus(100.0%)	1	NA	NA
WP_001084449.1|1366469_1367654_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.4	1.8e-35
>prophage 110
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1372511	1379687	2822516		Tupanvirus(100.0%)	1	NA	NA
WP_000605285.1|1372511_1379687_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.9	1.3e-67
>prophage 111
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1384800	1387797	2822516		Bacillus_virus(50.0%)	4	NA	NA
WP_000590858.1|1384800_1385541_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.6	1.1e-38
WP_000171922.1|1385882_1386395_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356963.1|1386573_1386777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013483.1|1386837_1387797_-	cation transporter	NA	A0A1V0SED0	Indivirus	34.2	8.8e-12
>prophage 112
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1391136	1393621	2822516		Catovirus(50.0%)	2	NA	NA
WP_000723443.1|1391136_1392282_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.1	5.4e-24
WP_000779512.1|1392358_1393621_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.8	3.3e-22
>prophage 113
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1400638	1407203	2822516		Catovirus(50.0%)	6	NA	NA
WP_000413171.1|1400638_1401763_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	6.7e-128
WP_001028285.1|1401766_1402876_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459065.1|1402888_1403917_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	2.0e-41
WP_000940777.1|1403906_1405730_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.1	5.2e-29
WP_000565290.1|1405749_1406514_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037326.1|1406516_1407203_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	3.7e-28
>prophage 114
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1411227	1412403	2822516		Clostridium_phage(100.0%)	1	NA	NA
WP_000469827.1|1411227_1412403_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	28.1	2.3e-30
>prophage 115
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1417861	1418635	2822516		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078092.1|1417861_1418635_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.8e-13
>prophage 116
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1425780	1428334	2822516	transposase	Staphylococcus_virus(50.0%)	2	NA	NA
WP_000277723.1|1425780_1427427_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.1	1.6e-292
WP_000874684.1|1427734_1428334_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	2.2e-53
>prophage 117
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1433271	1434252	2822516		Catovirus(100.0%)	1	NA	NA
WP_078065132.1|1433271_1434252_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.0	1.3e-47
>prophage 118
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1437810	1439013	2822516		Tupanvirus(100.0%)	1	NA	NA
WP_001223705.1|1437810_1439013_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.1	3.9e-09
>prophage 119
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1447279	1451489	2822516		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570804.1|1447279_1448260_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.7e-40
WP_001045111.1|1448490_1449483_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000924997.1|1449498_1450494_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_058142957.1|1450490_1451489_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	2.0e-14
>prophage 120
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1454764	1455250	2822516	transposase	Lactococcus_phage(100.0%)	1	NA	NA
WP_000093393.1|1454764_1455250_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.9e-19
>prophage 121
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1476874	1478921	2822516	transposase	Lactococcus_phage(50.0%)	2	NA	NA
WP_001066124.1|1476874_1477636_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	44.2	1.1e-54
WP_000777467.1|1477628_1478921_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	30.8	2.6e-14
>prophage 122
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1496790	1506038	2822516		Staphylococcus_phage(33.33%)	8	NA	NA
WP_000190901.1|1496790_1498305_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	30.2	2.3e-51
WP_000456234.1|1498294_1499596_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_001010920.1|1499579_1502699_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.2	1.3e-72
WP_001015191.1|1502773_1502995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092166.1|1503008_1503512_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_000700854.1|1503526_1503838_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_000175889.1|1503931_1504270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000676592.1|1504358_1506038_-	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	29.2	2.4e-44
>prophage 123
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1511115	1512257	2822516	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_089418807.1|1511115_1512257_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	99.3	6.3e-73
>prophage 124
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1520090	1523963	2822516	transposase	Staphylococcus_phage(50.0%)	5	NA	NA
WP_001106056.1|1520090_1520765_+|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	98.7	2.9e-126
WP_000447786.1|1520913_1521420_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_001083109.1|1521435_1521747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000171559.1|1521842_1522181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000676596.1|1522286_1523963_-	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	29.6	6.2e-45
>prophage 125
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1529101	1529965	2822516		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000680580.1|1529101_1529965_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	27.8	1.2e-15
>prophage 126
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1534094	1544098	2822516		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|1534094_1534895_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104161.1|1535282_1536071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060149.1|1536071_1537406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871607.1|1537398_1539225_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	1.6e-30
WP_000101976.1|1539237_1539939_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000095328.1|1541135_1542419_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000375647.1|1542697_1544098_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 127
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1550784	1562118	2822516	transposase,tRNA	Bacillus_virus(40.0%)	8	NA	NA
WP_000884334.1|1550784_1552071_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
WP_000177463.1|1552448_1553963_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.6	3.0e-91
WP_000449218.1|1554288_1555101_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000819089.1|1555188_1557849_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.8	6.0e-119
WP_000255586.1|1557885_1559820_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	5.7e-143
WP_000775117.1|1559829_1560942_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000249647.1|1560938_1561175_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_000093393.1|1561632_1562118_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.9e-19
>prophage 128
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1570650	1574063	2822516		Faecalibacterium_phage(33.33%)	5	NA	NA
WP_000742837.1|1570650_1571490_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.8	2.2e-06
WP_000491384.1|1572099_1572453_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779135.1|1572520_1572916_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054123.1|1573166_1573736_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	33.3	6.2e-05
WP_001059079.1|1573862_1574063_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
>prophage 129
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1578360	1579119	2822516		Planktothrix_phage(100.0%)	1	NA	NA
WP_000154165.1|1578360_1579119_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.0	1.0e-34
>prophage 130
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1593547	1595260	2822516		Planktothrix_phage(100.0%)	1	NA	NA
WP_000138662.1|1593547_1595260_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.5	2.1e-19
>prophage 131
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1600896	1601910	2822516		Faustovirus(100.0%)	1	NA	NA
WP_000639176.1|1600896_1601910_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	25.4	5.3e-07
>prophage 132
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1614842	1615535	2822516		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185863.1|1614842_1615535_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 133
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1644988	1646848	2822516		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125615.1|1644988_1646848_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 134
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1672707	1674458	2822516		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143422.1|1672707_1673595_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	23.0	3.3e-05
WP_000923775.1|1673702_1674458_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	3.0e-31
>prophage 135
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1677888	1678386	2822516		Canarypox_virus(100.0%)	1	NA	NA
WP_001065268.1|1677888_1678386_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	1.8e-21
>prophage 136
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1683422	1685806	2822516		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071714.1|1683422_1685273_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.3	1.6e-235
WP_000173331.1|1685269_1685806_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	48.0	3.9e-41
>prophage 137
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1690683	1731556	2822516	protease,holin,transposase	Streptococcus_phage(52.38%)	40	NA	NA
WP_000066521.1|1690683_1692393_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|1692672_1692885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028780.1|1693164_1693608_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172340.1|1693801_1695400_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	5.3e-78
WP_025174545.1|1695459_1695789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|1696084_1697581_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031407.1|1697775_1698666_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.2e-07
WP_001237630.1|1698788_1699205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030049.1|1699458_1700796_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.8e-18
WP_000534436.1|1700875_1702324_-	amino acid permease	NA	NA	NA	NA	NA
WP_000846637.1|1703010_1703970_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000186117.1|1704247_1704952_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000953560.1|1705037_1705898_-	oxidoreductase	NA	NA	NA	NA	NA
WP_000860047.1|1705970_1706789_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_000163745.1|1706781_1707633_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_014532712.1|1707646_1708018_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_000161217.1|1708360_1709437_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_014363485.1|1709452_1709800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001015311.1|1709853_1710534_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_001015311.1|1710939_1711620_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_061820394.1|1711673_1712219_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001289198.1|1712200_1712599_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_154285223.1|1712913_1713561_-	type A chloramphenicol O-acetyltransferase	NA	A0A1X9I6V6	Streptococcus_phage	56.7	1.3e-70
WP_038412706.1|1714189_1714870_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	6.5e-126
WP_001067799.1|1715610_1716291_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.7e-126
WP_000713595.1|1716613_1716784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062586.1|1716797_1717400_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	38.3	5.7e-17
WP_002360685.1|1718604_1718901_+	hypothetical protein	NA	A0A2K5B2B2	Erysipelothrix_phage	91.8	4.6e-44
WP_000323438.1|1718901_1719318_+	recombinase	NA	A0A2K5B2B3	Erysipelothrix_phage	98.6	1.2e-71
WP_002390960.1|1719337_1720882_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	88.7	1.8e-256
WP_000205227.1|1721024_1721249_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000233000.1|1721263_1722133_+	hypothetical protein	NA	A0A1X9I6C9	Streptococcus_phage	90.7	6.7e-152
WP_000662263.1|1722113_1722848_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_001255866.1|1722880_1723789_+	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_001096887.1|1724358_1725153_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_001814874.1|1725694_1725778_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001038790.1|1725902_1726640_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	1.4e-134
WP_000576156.1|1726994_1727549_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	52.1	2.3e-36
WP_001240982.1|1727552_1730471_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.1	1.1e-169
WP_001015311.1|1730875_1731556_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
>prophage 138
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1752842	1756623	2822516		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000751271.1|1752842_1753544_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.4	6.8e-38
WP_000996742.1|1753819_1754308_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000379824.1|1754811_1756623_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 139
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1765056	1769226	2822516		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_000161354.1|1765056_1766055_+	D-lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	32.6	5.9e-35
WP_000076662.1|1766144_1766351_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024120.1|1766817_1769226_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.8	7.6e-129
>prophage 140
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1778466	1781459	2822516	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001063329.1|1778466_1780575_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.7	4.1e-118
WP_000262593.1|1780937_1781459_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.7	3.4e-26
>prophage 141
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1788809	1795173	2822516		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062648.1|1788809_1790549_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	3.5e-35
WP_000473669.1|1790848_1792915_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206030.1|1793275_1793686_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000240662.1|1793727_1794072_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228163.1|1794204_1795173_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	4.0e-12
>prophage 142
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1804467	1808072	2822516	transposase	Acanthocystis_turfacea_Chlorella_virus(50.0%)	4	NA	NA
WP_000161536.1|1804467_1805460_-	D-lactate dehydrogenase	NA	M1HYB0	Acanthocystis_turfacea_Chlorella_virus	31.5	1.1e-36
WP_000069098.1|1805729_1806401_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000863974.1|1806520_1807327_-	VOC family protein	NA	NA	NA	NA	NA
WP_000093393.1|1807586_1808072_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.9e-19
>prophage 143
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1815277	1816924	2822516	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_000277722.1|1815277_1816924_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	99.5	2.8e-292
>prophage 144
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1822506	1823202	2822516		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000382894.1|1822506_1823202_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.0	6.8e-38
>prophage 145
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1842542	1843409	2822516		Bacillus_phage(100.0%)	1	NA	NA
WP_000721337.1|1842542_1843409_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.9	3.4e-79
>prophage 146
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1853125	1858305	2822516		Streptococcus_phage(50.0%)	3	NA	NA
WP_000356869.1|1853125_1854763_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	38.1	4.4e-96
WP_000755953.1|1855049_1855442_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000088729.1|1855443_1858305_+	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.9	6.9e-28
>prophage 147
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1861797	1863444	2822516	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
WP_000277723.1|1861797_1863444_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.1	1.6e-292
>prophage 148
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1868970	1869666	2822516		Bacillus_phage(100.0%)	1	NA	NA
WP_000217461.1|1868970_1869666_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	36.5	8.6e-09
>prophage 149
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1874865	1875684	2822516		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000824935.1|1874865_1875684_+	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	26.7	8.3e-11
>prophage 150
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1883553	1885111	2822516		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173873.1|1883553_1884369_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	3.6e-14
WP_000590515.1|1884361_1885111_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	8.1e-21
>prophage 151
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1891480	1895907	2822516		Bacillus_phage(50.0%)	4	NA	NA
WP_000923515.1|1891480_1892143_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	34.5	2.2e-17
WP_000072152.1|1892135_1892912_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000026185.1|1893305_1894493_+	MFS transporter	NA	NA	NA	NA	NA
WP_000700919.1|1894554_1895907_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	2.5e-12
>prophage 152
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1899300	1900527	2822516		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000948987.1|1899300_1900527_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
>prophage 153
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1918905	1927104	2822516	transposase	Bacillus_phage(50.0%)	7	NA	NA
WP_001176863.1|1918905_1920048_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	44.3	5.3e-56
WP_000779353.1|1920315_1920702_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482647.1|1920834_1920942_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000301893.1|1920968_1921136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001064821.1|1921589_1923302_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.3	1.7e-34
WP_000488493.1|1923377_1925111_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	4.8e-32
WP_000277723.1|1925457_1927104_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.1	1.6e-292
>prophage 154
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1930489	1936261	2822516		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971541.1|1930489_1931605_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.9	3.2e-21
WP_000286874.1|1931615_1932308_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200957.1|1932318_1932786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783428.1|1932837_1933815_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	7.1e-142
WP_000916705.1|1933816_1934764_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.8	2.4e-139
WP_000594519.1|1935331_1936261_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.1	3.2e-120
>prophage 155
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1944105	1944837	2822516		Bacillus_virus(100.0%)	1	NA	NA
WP_000615464.1|1944105_1944837_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	6.9e-25
>prophage 156
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1961648	1963208	2822516		Escherichia_phage(100.0%)	1	NA	NA
WP_000692644.1|1961648_1963208_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 157
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1984549	1985584	2822516		Bacillus_virus(100.0%)	1	NA	NA
WP_000655978.1|1984549_1985584_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.2	1.7e-16
>prophage 158
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	1995524	2002082	2822516		Staphylococcus_phage(25.0%)	8	NA	NA
WP_000340145.1|1995524_1996253_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	1.5e-27
WP_000372851.1|1996386_1996950_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000793174.1|1997127_1997583_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_000977025.1|1997579_1998023_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000477337.1|1998185_1999559_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.8	1.8e-13
WP_000249498.1|1999551_2000226_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	45.2	3.6e-52
WP_000761404.1|2000361_2001417_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229921.1|2001416_2002082_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	4.6e-36
>prophage 159
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2005820	2012439	2822516	transposase	Salmonella_phage(33.33%)	5	NA	NA
WP_000998865.1|2005820_2007029_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.3	3.0e-33
WP_000277723.1|2007144_2008791_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.1	1.6e-292
WP_000828571.1|2009172_2009727_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000738244.1|2009847_2010495_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000205257.1|2010507_2012439_+	DHA2 family efflux MFS transporter permease subunit	NA	A0A2H4PQR6	Staphylococcus_phage	28.4	9.4e-05
>prophage 160
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2021071	2021971	2822516		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524841.1|2021071_2021971_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	2.7e-15
>prophage 161
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2035326	2036208	2822516		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000730035.1|2035326_2036208_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	45.9	1.1e-61
>prophage 162
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2044086	2044722	2822516		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285450.1|2044086_2044722_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.1	1.6e-09
>prophage 163
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2057732	2062124	2822516		Staphylococcus_phage(50.0%)	4	NA	NA
WP_072460394.1|2057732_2058371_+	autolysin	NA	A0A1W6JQU5	Staphylococcus_phage	47.4	4.5e-36
WP_000684155.1|2059093_2060218_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	1.6e-12
WP_000417016.1|2060309_2061263_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.9	2.9e-31
WP_000737705.1|2061623_2062124_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 164
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2066041	2066851	2822516		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717388.1|2066041_2066851_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.4e-07
>prophage 165
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2085831	2086437	2822516		Pithovirus(100.0%)	1	NA	NA
WP_000913006.1|2085831_2086437_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.6	3.8e-13
>prophage 166
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2098467	2101635	2822516		Leptospira_phage(100.0%)	1	NA	NA
WP_000592326.1|2098467_2101635_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.9	1.9e-63
>prophage 167
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2125228	2126895	2822516		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000389659.1|2125228_2126038_+	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.1	7.4e-20
WP_000155389.1|2126034_2126895_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	9.7e-10
>prophage 168
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2129936	2134828	2822516		Mycobacterium_phage(50.0%)	3	NA	NA
WP_000204273.1|2129936_2131373_+	MarR family transcriptional regulator	NA	A0A088F7M4	Mycobacterium_phage	31.0	6.0e-57
WP_000655237.1|2132542_2132725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130153.1|2133163_2134828_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.8	1.8e-44
>prophage 169
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2141674	2143984	2822516		Indivirus(50.0%)	3	NA	NA
WP_001015494.1|2141674_2142523_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	34.6	4.1e-37
WP_000875477.1|2142755_2142959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025175269.1|2143243_2143984_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	29.4	1.2e-13
>prophage 170
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2150305	2151718	2822516		Pandoravirus(100.0%)	1	NA	NA
WP_000169231.1|2150305_2151718_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	3.0e-48
>prophage 171
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2155681	2157244	2822516		Vibrio_phage(100.0%)	1	NA	NA
WP_000792348.1|2155681_2157244_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	1.2e-18
>prophage 172
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2167448	2168417	2822516		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989086.1|2167448_2168417_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	29.1	1.0e-15
>prophage 173
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2184543	2185452	2822516		Klosneuvirus(100.0%)	1	NA	NA
WP_000167867.1|2184543_2185452_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.0	3.2e-27
>prophage 174
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2189042	2196476	2822516		Staphylococcus_phage(100.0%)	1	NA	NA
WP_154285229.1|2189042_2196476_+	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	25.2	3.2e-24
>prophage 175
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2202744	2205564	2822516		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_000334462.1|2202744_2204550_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A0A1J0F994	Only_Syngen_Nebraska_virus	38.9	3.4e-97
WP_000908190.1|2204781_2205564_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.3e-08
>prophage 176
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2218166	2221998	2822516		Clostridium_phage(50.0%)	4	NA	NA
WP_000070865.1|2218166_2218610_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_000160304.1|2218730_2219441_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083340.1|2219754_2220417_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242305.1|2220696_2221998_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.9	4.7e-133
>prophage 177
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2229923	2231534	2822516		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159964.1|2229923_2231534_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.1e-146
>prophage 178
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2239337	2247087	2822516		Bacillus_virus(25.0%)	9	NA	NA
WP_000273356.1|2239337_2239937_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460244.1|2239937_2241014_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248731.1|2241000_2241837_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_078065152.1|2241869_2242967_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.3	6.7e-40
WP_000697334.1|2242963_2243383_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654180.1|2243489_2244014_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|2244040_2245279_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|2245306_2245936_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000723421.1|2245959_2247087_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.9	1.0e-27
>prophage 179
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2257878	2260463	2822516	transposase	Escherichia_phage(33.33%)	3	NA	NA
WP_000777467.1|2257878_2259171_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	30.8	2.6e-14
WP_001066124.1|2259163_2259925_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	44.2	1.1e-54
WP_000932694.1|2260067_2260463_+	single-stranded DNA-binding protein	NA	A0A1J0MFK5	Staphylococcus_phage	38.5	1.3e-14
>prophage 180
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2266637	2267285	2822516		Moumouvirus(100.0%)	1	NA	NA
WP_001187610.1|2266637_2267285_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	8.0e-09
>prophage 181
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2274485	2276006	2822516		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178942.1|2274485_2276006_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 182
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2281676	2283704	2822516		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546591.1|2281676_2283704_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.3	1.0e-25
>prophage 183
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2288854	2292239	2822516		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621175.1|2288854_2289217_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390829.1|2289566_2290568_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|2290686_2291013_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001801513.1|2290984_2291494_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041107.1|2291468_2292239_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
>prophage 184
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2306353	2311077	2822516		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000094585.1|2306353_2307883_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.1	7.2e-08
WP_072399972.1|2307912_2308932_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|2309053_2309308_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_000047819.1|2309307_2311077_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	7.0e-63
>prophage 185
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2314837	2329467	2822516	tRNA	Moraxella_phage(16.67%)	13	NA	NA
WP_000159046.1|2314837_2315863_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.9	4.0e-63
WP_000106314.1|2316171_2317782_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	27.0	1.1e-19
WP_001791590.1|2318462_2318591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602050.1|2318735_2320664_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.4	4.2e-53
WP_001283612.1|2320916_2321552_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_078065178.1|2321907_2322936_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581077.1|2322995_2323220_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_154285230.1|2323411_2324662_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.7	1.1e-41
WP_000790321.1|2324844_2325795_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000141422.1|2325943_2327428_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.8	2.3e-19
WP_001253300.1|2327424_2328384_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_031844951.1|2328571_2328679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000688492.1|2328750_2329467_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	2.3e-25
>prophage 186
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2336588	2338565	2822516		uncultured_virus(100.0%)	2	NA	NA
WP_000917289.1|2336588_2336873_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240638.1|2336948_2338565_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	2.6e-157
>prophage 187
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2342455	2346034	2822516		Staphylococcus_phage(100.0%)	3	NA	NA
WP_000791403.1|2342455_2343511_+	bi-component leukocidin LukGH subunit H	NA	A0A1X9IGW5	Staphylococcus_phage	34.3	2.1e-35
WP_000595398.1|2343532_2344549_+	bi-component leukocidin LukGH subunit G	NA	A0A2I6PER8	Staphylococcus_phage	28.4	6.7e-26
WP_000239607.1|2345041_2346034_-	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	99.6	2.4e-161
>prophage 188
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2351357	2353804	2822516		Staphylococcus_phage(100.0%)	3	NA	NA
WP_000991298.1|2351357_2352254_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000645729.1|2352254_2352935_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763046.1|2352931_2353804_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
>prophage 189
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2359051	2359453	2822516		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000205106.1|2359051_2359453_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
>prophage 190
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2363650	2365680	2822516		Bacillus_virus(50.0%)	2	NA	NA
WP_000149686.1|2363650_2364211_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275716.1|2364582_2365680_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	1.5e-47
>prophage 191
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2369709	2371993	2822516		Bacillus_virus(100.0%)	2	NA	NA
WP_000284433.1|2369709_2371179_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	3.5e-108
WP_000040873.1|2371171_2371993_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	1.8e-69
>prophage 192
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2375696	2382463	2822516		Gordonia_phage(33.33%)	5	NA	NA
WP_000572876.1|2375696_2376992_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|2377100_2377403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272066.1|2377574_2378267_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992924.1|2378263_2380456_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000774560.1|2380459_2382463_+	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	36.1	5.0e-110
>prophage 193
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2389692	2394720	2822516		Catovirus(33.33%)	5	NA	NA
WP_001231458.1|2389692_2390640_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.5e-16
WP_001147864.1|2390720_2392082_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	43.8	6.3e-104
WP_000548782.1|2392251_2392782_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140176.1|2393028_2394099_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|2394165_2394720_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 194
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2398173	2398587	2822516		Staphylococcus_phage(100.0%)	1	NA	NA
WP_025174552.1|2398173_2398587_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	40.6	2.3e-17
>prophage 195
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2403641	2404271	2822516		Bacillus_phage(100.0%)	1	NA	NA
WP_000153526.1|2403641_2404271_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.7	2.1e-06
>prophage 196
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2419751	2421488	2822516		Bacillus_phage(100.0%)	1	NA	NA
WP_000597233.1|2419751_2421488_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
>prophage 197
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2438037	2438766	2822516		Planktothrix_phage(100.0%)	1	NA	NA
WP_001144055.1|2438037_2438766_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
>prophage 198
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2449490	2449835	2822516		Streptococcus_phage(100.0%)	1	NA	NA
WP_000290301.1|2449490_2449835_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 199
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2459469	2460210	2822516		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000216874.1|2459469_2460210_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 200
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2469070	2477385	2822516	transposase	Staphylococcus_phage(70.0%)	10	NA	NA
WP_154285231.1|2469070_2469859_-	DUF1828 domain-containing protein	NA	A0A2H4PQI0	Staphylococcus_phage	95.0	2.0e-139
WP_000777467.1|2470252_2471545_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	30.8	2.6e-14
WP_001066124.1|2471537_2472299_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	44.2	1.1e-54
WP_165596011.1|2472594_2472936_+	hypothetical protein	NA	R9QTN8	Staphylococcus_phage	97.3	6.4e-58
WP_000727649.1|2473030_2473480_-	chemotaxis-inhibiting protein CHIPS	NA	A0A1P8L6A8	Staphylococcus_phage	100.0	1.1e-78
WP_000702263.1|2474164_2474515_+	complement inhibitor SCIN-A	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|2474567_2474828_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669789.1|2475138_2475318_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
WP_049280116.1|2475734_2476280_+	hypothetical protein	NA	A0A2H4PQP5	Staphylococcus_phage	32.5	1.8e-09
WP_001044434.1|2476530_2477385_+	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	37.9	6.4e-06
>prophage 201
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2482939	2530251	2822516	protease,tRNA	Staphylococcus_phage(94.44%)	44	NA	NA
WP_000414219.1|2482939_2483512_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.8	3.2e-25
WP_000627534.1|2483612_2483954_-	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	93.8	2.8e-53
WP_154285232.1|2483994_2484621_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	82.7	6.0e-78
WP_000070638.1|2484696_2485692_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	92.7	1.7e-66
WP_001838615.1|2485772_2486423_-	hypothetical protein	NA	A0A2H4PQM8	Staphylococcus_phage	68.5	4.7e-33
WP_078065177.1|2486725_2487181_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	97.9	4.0e-79
WP_000348384.1|2487340_2488819_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	96.7	3.4e-281
WP_000778518.1|2488823_2489825_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.9	4.8e-186
WP_000718107.1|2489821_2490079_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000672009.1|2490144_2490618_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	3.6e-83
WP_078065176.1|2490622_2491369_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.0	7.8e-141
WP_000109912.1|2491662_2493255_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	99.8	0.0e+00
WP_000933822.1|2493626_2494820_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.7	1.9e-218
WP_000366163.1|2494944_2495853_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	100.0	3.4e-138
WP_000453310.1|2496064_2496898_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	1.3e-157
WP_000623471.1|2497147_2497501_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	99.1	1.0e-21
WP_001200550.1|2497497_2497863_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	98.3	6.2e-59
WP_000091445.1|2498118_2498421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096492.1|2498678_2499392_+	transaldolase	NA	M1PR54	Cyanophage	34.5	1.2e-18
WP_000492902.1|2499860_2500481_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_025175276.1|2500647_2501283_-|protease	CPBP family intramembrane metalloprotease SdpA	protease	NA	NA	NA	NA
WP_001030460.1|2501580_2502024_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.0	5.4e-57
WP_001153740.1|2502010_2502454_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000384172.1|2503231_2503456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032836.1|2503731_2504586_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.1	4.9e-38
WP_000163239.1|2504990_2505383_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	99.2	6.9e-72
WP_000989100.1|2505400_2506693_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	97.4	2.2e-223
WP_000221186.1|2506692_2507007_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	95.2	1.4e-51
WP_001261664.1|2507528_2509031_+	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	1.1e-29
WP_000384177.1|2509523_2510555_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.5	9.0e-196
WP_000493883.1|2510561_2511194_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	98.6	2.4e-111
WP_001159028.1|2511204_2512386_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	99.2	1.6e-225
WP_001008551.1|2512398_2512863_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	99.4	5.8e-70
WP_001196343.1|2512984_2513986_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	98.8	1.7e-183
WP_014937042.1|2514097_2514217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058142981.1|2514219_2515047_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000757543.1|2515618_2516020_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000764429.1|2516139_2516703_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	98.9	9.2e-102
WP_000526539.1|2516699_2517653_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
WP_001025062.1|2517762_2518944_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.5	1.2e-217
WP_001108730.1|2519235_2521650_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.5	0.0e+00
WP_000836467.1|2521671_2521983_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	98.1	5.3e-51
WP_001050576.1|2522308_2528866_+	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	93.2	1.2e-290
WP_000285005.1|2528982_2530251_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	98.2	1.0e-55
>prophage 202
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2541773	2547101	2822516		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091379.1|2541773_2542631_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	98.5	4.4e-71
WP_001048371.1|2542659_2543256_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_154285233.1|2543276_2547101_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
>prophage 203
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2555684	2557391	2822516		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000862098.1|2555684_2557391_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	99.6	8.0e-274
>prophage 204
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2564006	2566637	2822516	protease,tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186041.1|2564006_2565269_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	4.6e-85
WP_001279341.1|2565362_2566637_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 205
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2572402	2576537	2822516		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000808838.1|2572402_2574007_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	99.5	2.7e-114
WP_000291428.1|2573993_2575154_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553932.1|2575267_2575714_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174273.1|2575793_2576537_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	29.9	6.4e-18
>prophage 206
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2594306	2597504	2822516		Streptomyces_phage(100.0%)	1	NA	NA
WP_000226897.1|2594306_2597504_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.6	6.5e-136
>prophage 207
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2602437	2604195	2822516		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232650.1|2602437_2604195_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	2.6e-41
>prophage 208
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2609077	2617240	2822516		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080026.1|2609077_2609782_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_078065174.1|2609781_2611443_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.4	5.8e-35
WP_000849430.1|2611941_2613429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038293.1|2613721_2616352_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.0	6.1e-47
WP_001114460.1|2616367_2617240_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	1.1e-42
>prophage 209
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2621154	2632308	2822516	protease,tRNA	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|2621154_2622075_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_031844955.1|2622167_2622290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154285234.1|2622486_2624424_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	1.0e-115
WP_000049297.1|2624850_2626344_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791162.1|2626571_2627099_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	4.1e-11
WP_001125540.1|2627127_2627328_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|2627374_2627731_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032657.1|2627874_2628483_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	35.9	6.6e-21
WP_001280027.1|2628501_2629431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|2629435_2629546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127572.1|2629593_2630895_+	trigger factor	NA	NA	NA	NA	NA
WP_000472293.1|2631045_2632308_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.7	1.1e-139
>prophage 210
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2641878	2644509	2822516	tRNA	Catovirus(100.0%)	1	NA	NA
WP_000425338.1|2641878_2644509_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.4	3.7e-153
>prophage 211
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2654843	2690391	2822516	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005767.1|2654843_2655848_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_001019166.1|2655849_2656875_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|2656897_2658037_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|2658055_2658316_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_154285236.1|2658590_2660870_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_000594983.1|2661072_2663346_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.5	2.1e-64
WP_000364543.1|2663367_2663886_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.8	2.1e-28
WP_001058593.1|2664312_2666502_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869979.1|2666513_2666966_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717807.1|2666962_2667838_+	SH3 domain-containing protein	NA	A0A0N9SGH1	Paenibacillus_phage	33.1	1.0e-11
WP_000590822.1|2668298_2669561_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000044807.1|2669576_2671343_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	33.1	4.1e-15
WP_031845039.1|2671675_2671804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682646.1|2671803_2672577_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000102738.1|2672738_2674013_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.7	1.8e-105
WP_000704122.1|2674097_2674520_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|2674619_2674802_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000009238.1|2674841_2674988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985904.1|2675224_2676238_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409170.1|2676549_2677692_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	1.1e-32
WP_000066097.1|2677692_2678811_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567020.1|2679440_2680109_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001283328.1|2680110_2682588_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.3	8.5e-67
WP_000735809.1|2682930_2685561_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	7.2e-64
WP_000426912.1|2685623_2685884_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939062.1|2685887_2686316_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|2686330_2686639_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342260.1|2686923_2687562_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
WP_000137775.1|2687564_2688488_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000848304.1|2688499_2689768_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000648617.1|2689767_2690391_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 212
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2697061	2700535	2822516	transposase	Lactococcus_phage(66.67%)	3	NA	NA
WP_000542305.1|2697061_2698282_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	33.3	8.5e-52
WP_001823975.1|2699105_2699858_+	enterotoxin	NA	A0A1X9H080	Staphylococcus_phage	38.2	1.3e-42
WP_000093393.1|2700049_2700535_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.9e-19
>prophage 213
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2707869	2714033	2822516		Bacillus_phage(33.33%)	5	NA	NA
WP_000439693.1|2707869_2708331_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_078065172.1|2708389_2710537_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	1.2e-32
WP_001282570.1|2710593_2711568_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001274017.1|2711612_2711864_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368338.1|2712209_2714033_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 214
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2717711	2720819	2822516		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|2717711_2719544_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_001119021.1|2719679_2720819_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.8	1.2e-26
>prophage 215
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2727289	2728237	2822516		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117767.1|2727289_2728237_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	6.4e-47
>prophage 216
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2731291	2745019	2822516	tRNA	Klosneuvirus(25.0%)	13	NA	NA
WP_001030080.1|2731291_2732683_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001794939.1|2733017_2733641_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411298.1|2733651_2734470_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001217251.1|2734530_2736330_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.5e-54
WP_001283055.1|2736553_2737660_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_000624567.1|2737790_2738468_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683914.1|2738470_2739571_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	1.0e-08
WP_001062177.1|2739684_2741031_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	2.4e-55
WP_000924210.1|2741040_2741931_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	3.4e-26
WP_001213908.1|2742056_2742842_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000564316.1|2742883_2743747_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|2743733_2744144_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|2744419_2745019_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 217
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2751192	2751816	2822516		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|2751192_2751816_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 218
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2757360	2760172	2822516		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000019687.1|2757360_2758707_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.7	6.3e-64
WP_000202177.1|2758699_2760172_+	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.3	2.8e-81
>prophage 219
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2767670	2774241	2822516		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|2767670_2769008_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159865.1|2769000_2769231_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000183374.1|2769208_2770090_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	26.1	8.9e-11
WP_001124985.1|2770521_2770974_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000942203.1|2770989_2772669_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001291540.1|2772819_2774241_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	6.6e-40
>prophage 220
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2781070	2782477	2822516		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|2781070_2782477_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 221
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2787123	2788608	2822516		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|2787123_2788608_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 222
NZ_CP045472	Staphylococcus aureus strain ZY05 chromosome, complete genome	2822516	2794272	2822045	2822516	integrase	Staphylococcus_phage(92.45%)	58	2791109:2791123	2809127:2809141
2791109:2791123	attL	ATTTGAAGAAAATAT	NA	NA	NA	NA
WP_000447733.1|2794272_2795160_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_001183423.1|2795237_2795744_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000273370.1|2795835_2796567_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_000368658.1|2796559_2797102_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159570.1|2797094_2797832_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|2797964_2798690_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987767.1|2798670_2800422_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	2.6e-22
WP_001824281.1|2800668_2801577_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001838630.1|2801588_2803616_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	92.5	3.3e-109
WP_000264751.1|2803658_2804864_-|integrase	site-specific integrase	integrase	A0A2I6PEN0	Staphylococcus_phage	100.0	7.7e-223
WP_000191466.1|2804989_2805604_+	hypothetical protein	NA	A0A2I6PEZ0	Staphylococcus_phage	100.0	6.7e-106
WP_001013104.1|2805600_2805747_-	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	89.6	1.1e-14
WP_000705240.1|2805782_2805965_-	hypothetical protein	NA	A0A2I6PDR4	Staphylococcus_phage	100.0	5.3e-27
WP_001089804.1|2806164_2806350_-	hypothetical protein	NA	A0A2I6PDS4	Staphylococcus_phage	100.0	2.3e-25
WP_001049399.1|2806336_2806492_-	hypothetical protein	NA	A0A2I6PDR9	Staphylococcus_phage	100.0	6.3e-21
WP_000094093.1|2806503_2807211_-	helix-turn-helix transcriptional regulator	NA	G4KNM8	Staphylococcus_phage	100.0	7.7e-130
WP_000548578.1|2807381_2807621_+	helix-turn-helix transcriptional regulator	NA	G4KNM9	Staphylococcus_phage	100.0	2.3e-38
WP_000435346.1|2807633_2808077_+	hypothetical protein	NA	G4KNN0	Staphylococcus_phage	100.0	2.0e-75
WP_000939495.1|2808091_2808232_+	hypothetical protein	NA	A0A2I6PDT8	Staphylococcus_phage	100.0	1.9e-16
WP_000772137.1|2808224_2808434_-	hypothetical protein	NA	A0A2I6PDR8	Staphylococcus_phage	100.0	9.1e-31
WP_000502678.1|2808490_2808682_+	hypothetical protein	NA	A0A2I6PDT1	Staphylococcus_phage	100.0	9.5e-27
WP_000801108.1|2808683_2808911_-	hypothetical protein	NA	A7TWL9	Staphylococcus_phage	100.0	1.7e-38
WP_001148617.1|2808971_2809724_+	oxidoreductase	NA	G4KNN1	Staphylococcus_phage	100.0	1.1e-139
2809127:2809141	attR	ATTTGAAGAAAATAT	NA	NA	NA	NA
WP_000435343.1|2809736_2809997_+	hypothetical protein	NA	A0A2I6PDT7	Staphylococcus_phage	100.0	3.5e-40
WP_001662405.1|2810016_2810154_+	hypothetical protein	NA	A0ZS11	Staphylococcus_virus	97.8	3.7e-17
WP_001025595.1|2810230_2810557_+	hypothetical protein	NA	G4KNN2	Staphylococcus_phage	100.0	5.4e-54
WP_001037095.1|2810553_2810772_+	hypothetical protein	NA	A0A2I6PDV4	Staphylococcus_phage	100.0	5.0e-32
WP_001124198.1|2810801_2811065_+	helix-turn-helix domain-containing protein	NA	A0A2I6PEL8	Staphylococcus_phage	100.0	2.5e-46
WP_001285954.1|2811076_2811238_+	DUF1270 domain-containing protein	NA	A7TWM3	Staphylococcus_phage	100.0	8.6e-21
WP_000829610.1|2811326_2811644_+	hypothetical protein	NA	A0A2I6PEL3	Staphylococcus_phage	100.0	3.9e-33
WP_001556704.1|2811648_2811909_+	DUF1108 family protein	NA	G4KNN5	Staphylococcus_phage	100.0	2.0e-43
WP_001004336.1|2811921_2812458_+	hypothetical protein	NA	A0A0F6N4M6	Staphylococcus_phage	100.0	1.4e-80
WP_000840496.1|2812458_2813109_+	single-stranded DNA-binding protein	NA	A0A0F6N3I5	Staphylococcus_phage	100.0	1.1e-119
WP_001099007.1|2813105_2813549_+	single-stranded DNA-binding protein	NA	G4KNN8	Staphylococcus_phage	100.0	1.4e-76
WP_000057262.1|2813560_2814235_+	hypothetical protein	NA	G4KNN9	Staphylococcus_phage	100.0	8.6e-131
WP_001081076.1|2814231_2814381_+	hypothetical protein	NA	A7TWN0	Staphylococcus_phage	100.0	2.4e-17
WP_000414755.1|2814373_2814655_-	hypothetical protein	NA	A0A1W6JPU7	Staphylococcus_phage	100.0	2.6e-49
WP_000190254.1|2814720_2815491_+	hypothetical protein	NA	G4KNP0	Staphylococcus_phage	100.0	6.4e-122
WP_000803062.1|2815500_2816280_+	ATP-binding protein	NA	G4KNP1	Staphylococcus_phage	100.0	3.8e-146
WP_000256594.1|2816273_2816432_+	hypothetical protein	NA	A0A2I6PDX0	Staphylococcus_phage	98.1	4.5e-22
WP_001123669.1|2816444_2816666_+	DUF3269 family protein	NA	A0A2I6PDV8	Staphylococcus_phage	100.0	1.7e-35
WP_000049798.1|2816675_2817080_+	DUF1064 domain-containing protein	NA	G4KNP2	Staphylococcus_phage	100.0	1.6e-68
WP_001187236.1|2817084_2817270_+	DUF3113 family protein	NA	A0A068A236	Staphylococcus_phage	95.1	7.8e-26
WP_000029366.1|2817270_2817627_+	hypothetical protein	NA	G4KNP3	Staphylococcus_phage	100.0	1.1e-60
WP_000131388.1|2817630_2817873_+	hypothetical protein	NA	A0A2I6PDU1	Staphylococcus_phage	100.0	3.9e-41
WP_001065099.1|2817887_2818139_+	DUF1024 family protein	NA	G4KNP4	Staphylococcus_phage	100.0	6.4e-39
WP_000028424.1|2818128_2818302_+	hypothetical protein	NA	A0A2H4PQJ2	Staphylococcus_phage	100.0	1.8e-24
WP_000454994.1|2818302_2818584_+	hypothetical protein	NA	A0A2I6PDX3	Staphylococcus_phage	100.0	8.5e-48
WP_000889683.1|2818584_2818746_+	hypothetical protein	NA	A0A2I6PDW5	Staphylococcus_phage	100.0	2.4e-23
WP_001061834.1|2818760_2819267_+	hypothetical protein	NA	G4KNP5	Staphylococcus_phage	100.0	1.0e-91
WP_001282074.1|2819303_2819549_+	hypothetical protein	NA	A0A2I6PDW7	Staphylococcus_phage	100.0	5.0e-36
WP_000195782.1|2819545_2819734_+	DUF1381 domain-containing protein	NA	A0A2I6PDV0	Staphylococcus_phage	100.0	2.1e-26
WP_001125015.1|2819708_2819909_+	hypothetical protein	NA	A0A2I6PF22	Staphylococcus_phage	100.0	1.8e-28
WP_000501856.1|2819896_2820061_+	transcriptional activator RinB	NA	A0A2I6PDY4	Staphylococcus_phage	100.0	3.9e-21
WP_001005262.1|2820219_2820870_+	hypothetical protein	NA	D2JLD8	Staphylococcus_phage	100.0	8.9e-117
WP_000265043.1|2820869_2821070_+	DUF1514 family protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	1.4e-28
WP_000590122.1|2821097_2821514_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
WP_000988330.1|2821745_2822045_+	HNH endonuclease	NA	G4KNP8	Staphylococcus_phage	100.0	4.6e-52
