The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046069	Pseudomonas aeruginosa strain KRP1 chromosome, complete genome	6737396	638135	695658	6737396	holin,tRNA,tail	Pseudomonas_phage(55.56%)	58	NA	NA
WP_009875776.1|638135_639161_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085061.1|639239_639809_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|639892_640246_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003142783.1|640236_640779_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_022580735.1|640751_641984_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	1.6e-77
WP_003085071.1|642027_642534_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|642628_644182_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|644178_645450_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|645550_647473_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|647751_648084_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|648127_648979_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|648978_649359_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_023114717.1|649395_650202_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_023114716.1|650317_651304_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003129198.1|651300_652593_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_004352244.1|652573_655357_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003109031.1|655489_657202_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	82.1	8.0e-282
WP_003099554.1|658474_659491_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003099549.1|659487_660162_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_004352246.1|660163_660922_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_004352248.1|660922_661984_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_003459408.1|662135_664529_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|664574_665207_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023114715.1|665335_666370_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|666603_667713_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|667768_668815_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003113206.1|668929_670177_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|670282_671113_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|671236_671911_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003113205.1|671910_672729_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003113204.1|672801_674280_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003113203.1|674598_674913_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003113202.1|675012_675783_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|676240_676441_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003113201.1|676488_676848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003117965.1|677304_677652_+|holin	holin	holin	B5TK61	Pseudomonas_phage	51.8	3.9e-26
WP_003118917.1|677667_678297_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	7.1e-87
WP_003142810.1|678293_678656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118919.1|678652_678910_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003113190.1|679225_679720_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_004352265.1|679731_680079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003113188.1|680108_680363_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_023114714.1|680409_682248_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	2.6e-28
WP_003113186.1|682240_682582_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_003118922.1|682589_683285_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	50.2	1.5e-69
WP_003129219.1|683287_684058_+	peptidase P60	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	5.5e-81
WP_016252934.1|684112_684715_+|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	4.9e-53
WP_004352268.1|684773_688388_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	55.3	0.0e+00
WP_004352269.1|688623_689412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003115342.1|689435_690527_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	36.9	1.3e-46
WP_003113180.1|690526_690862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004352270.1|690842_691073_+	hypothetical protein	NA	A0A1W6JT87	Pseudomonas_phage	64.0	1.1e-18
WP_004352271.1|691168_692221_+	hypothetical protein	NA	A0A0H5AXZ9	Pseudomonas_phage	52.5	2.7e-62
WP_023114713.1|692220_692523_+	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	70.0	6.3e-33
WP_003118930.1|692519_692750_+	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	71.6	1.4e-24
WP_003117978.1|693168_693774_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	2.1e-75
WP_003085203.1|693775_694825_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|694821_695658_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NZ_CP046069	Pseudomonas aeruginosa strain KRP1 chromosome, complete genome	6737396	1486298	1495327	6737396		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1486298_1486934_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003115226.1|1486979_1487873_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1487977_1488982_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1489408_1489732_-	Ferredoxin 1	NA	NA	NA	NA	NA
WP_003113873.1|1489798_1492366_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003092265.1|1492491_1493499_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|1493646_1494153_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|1494286_1495327_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 3
NZ_CP046069	Pseudomonas aeruginosa strain KRP1 chromosome, complete genome	6737396	2600334	2607227	6737396	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003160440.1|2600334_2601615_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	4.8e-98
WP_003113366.1|2601616_2603014_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_023114465.1|2603018_2603993_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003108776.1|2604080_2605064_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	9.3e-142
WP_003090393.1|2605060_2605396_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|2605392_2605698_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2605697_2606057_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|2606053_2606449_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|2606558_2607227_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 4
NZ_CP046069	Pseudomonas aeruginosa strain KRP1 chromosome, complete genome	6737396	4821568	4905823	6737396	tail,portal,terminase,integrase,protease,head,plate,holin,tRNA,capsid	Pseudomonas_virus(72.09%)	94	4867320:4867335	4908215:4908230
WP_003085573.1|4821568_4822537_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003101974.1|4822627_4823374_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003101972.1|4823366_4824068_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003085566.1|4824128_4825046_-	GTPase Era	NA	NA	NA	NA	NA
WP_003085565.1|4825038_4825728_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.4	7.2e-24
WP_023086589.1|4825724_4826102_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_003101969.1|4826270_4827125_-	signal peptidase I	NA	NA	NA	NA	NA
WP_023102293.1|4827130_4828930_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	38.5	3.3e-20
WP_003101964.1|4829079_4830504_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	32.0	3.4e-28
WP_003110245.1|4830543_4830999_-	positive regulator for alginate biosynthesis MucC	NA	NA	NA	NA	NA
WP_003101960.1|4830995_4831946_-	sigma factor AlgU regulatory protein MucB	NA	NA	NA	NA	NA
WP_003101958.1|4831954_4832539_-	sigma factor AlgU negative regulatory protein	NA	NA	NA	NA	NA
WP_003085543.1|4832570_4833152_-	RNA polymerase sigma-H factor	NA	NA	NA	NA	NA
WP_003114182.1|4833560_4835177_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003114181.1|4835145_4835598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085532.1|4835581_4835836_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_003101947.1|4836108_4837053_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003085528.1|4837153_4837990_+	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	36.6	2.5e-26
WP_010793854.1|4837998_4839381_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003085524.1|4839373_4840045_-	response regulator	NA	NA	NA	NA	NA
WP_003116508.1|4840255_4841539_+	OprD family porin	NA	NA	NA	NA	NA
WP_003085519.1|4841568_4842552_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_023114050.1|4842600_4843071_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_003120784.1|4843081_4844599_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_003114172.1|4844591_4845629_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_003106436.1|4845755_4846451_-	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	45.2	1.0e-49
WP_003106439.1|4846550_4847372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003106441.1|4847428_4848310_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023114048.1|4848442_4849951_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_023114047.1|4849962_4851126_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003085498.1|4851191_4852010_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_019372102.1|4852068_4853172_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_023114046.1|4853283_4854180_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003085490.1|4854236_4854881_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_003110820.1|4854996_4855638_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023112778.1|4855672_4857649_-	alkyl/aryl-sulfatase	NA	M1I0S7	Paramecium_bursaria_Chlorella_virus	44.9	8.1e-161
WP_003116515.1|4857751_4858666_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003098351.1|4858669_4858858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085479.1|4858980_4859226_-	DUF1145 domain-containing protein	NA	NA	NA	NA	NA
WP_003114164.1|4859342_4859798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003098355.1|4859893_4860073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003114162.1|4860305_4861382_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_003098357.1|4861378_4862194_+	DUF4824 family protein	NA	NA	NA	NA	NA
WP_003120794.1|4862214_4862487_+	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_003114159.1|4862486_4863179_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
WP_003098363.1|4863314_4864358_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003114158.1|4864437_4865175_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016263849.1|4865626_4866529_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
4867320:4867335	attL	TGGCGGCGCTGTGCAG	NA	NA	NA	NA
WP_023114045.1|4867541_4868597_-|portal	phage portal protein	portal	Q9ZXM6	Pseudomonas_virus	97.1	1.7e-197
WP_031275675.1|4868593_4870357_-|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	100.0	0.0e+00
WP_023089196.1|4870512_4871334_+|capsid	GPO family capsid scaffolding protein	capsid	Q9ZXM4	Pseudomonas_virus	99.6	3.4e-129
WP_023091259.1|4871369_4872386_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	99.4	1.7e-191
WP_023083461.1|4872391_4873093_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	98.7	6.2e-124
WP_023083460.1|4873196_4873658_+|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	98.0	3.1e-79
WP_003098378.1|4873657_4873870_+|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	94.1	4.9e-32
WP_003098379.1|4873894_4874248_+	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	100.0	6.0e-59
WP_003098380.1|4874249_4874522_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	97.8	2.6e-38
WP_023115051.1|4874518_4875325_+	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	96.2	1.0e-141
WP_016852029.1|4875321_4875564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016852030.1|4875560_4876022_+	peptidase	NA	Q9ZXL5	Pseudomonas_virus	87.6	5.3e-63
WP_016852031.1|4876099_4876636_+|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	98.9	7.9e-95
WP_016852032.1|4876628_4877087_+	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	89.5	7.0e-68
WP_016852033.1|4877156_4877729_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	98.9	3.6e-93
WP_016852034.1|4877725_4878070_+|plate	phage baseplate protein	plate	Q9ZXK9	Pseudomonas_virus	97.4	7.9e-56
WP_023115050.1|4878066_4878981_+|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	94.1	4.4e-154
WP_015967199.1|4878980_4879517_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	100.0	1.4e-99
WP_023115049.1|4879518_4881909_+	hypothetical protein	NA	Q9ZXK6	Pseudomonas_virus	89.2	0.0e+00
WP_023115048.1|4881960_4882422_+	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	53.9	8.5e-37
WP_023115047.1|4882512_4883688_+|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	98.5	2.3e-219
WP_057427955.1|4883744_4884260_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	94.2	7.4e-90
WP_016852041.1|4884314_4884644_+|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	95.4	1.5e-48
WP_003098394.1|4884652_4884772_+|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	100.0	1.8e-15
WP_023115045.1|4884761_4887521_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	92.3	0.0e+00
WP_003098399.1|4887526_4887967_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	99.3	1.8e-76
WP_023115044.1|4887963_4889247_+	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	97.4	1.4e-235
WP_023114951.1|4889307_4890111_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	37.3	1.5e-44
WP_023114952.1|4890107_4891304_-	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_124119585.1|4891300_4891798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031637493.1|4892005_4892476_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020750421.1|4892502_4892733_+	phage-associated protein, BcepMu gp16 family	NA	NA	NA	NA	NA
WP_031637512.1|4892762_4893236_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	69.5	3.3e-52
WP_023114954.1|4893243_4893462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023089222.1|4893460_4893652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098408.1|4893654_4893948_+	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	99.0	1.1e-50
WP_003098409.1|4893944_4894295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023115041.1|4894366_4894600_+	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	98.7	2.9e-38
WP_023089226.1|4897360_4897714_+	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	97.4	2.4e-60
WP_003098417.1|4897725_4897932_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	100.0	7.3e-33
WP_023115039.1|4898235_4900146_+	hypothetical protein	NA	A0A0U1T6D1	Pseudomonas_phage	94.3	6.6e-285
WP_023115038.1|4900142_4901375_+	phosphoadenosine phosphosulfate reductase family protein	NA	R9TRT5	Rhizobium_phage	72.1	7.2e-176
WP_016852059.1|4901558_4901927_+	ASCH domain-containing protein	NA	A0A291AUQ6	Sinorhizobium_phage	50.4	2.7e-30
WP_003098423.1|4902119_4902323_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_023115037.1|4902329_4903532_-|integrase	integrase family protein	integrase	A0A248SL35	Klebsiella_phage	30.9	2.2e-36
WP_018076254.1|4903969_4905823_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	51.0	1.1e-103
4908215:4908230	attR	TGGCGGCGCTGTGCAG	NA	NA	NA	NA
>prophage 5
NZ_CP046069	Pseudomonas aeruginosa strain KRP1 chromosome, complete genome	6737396	5875380	5911730	6737396	terminase,integrase,transposase,protease,head	Pseudomonas_phage(77.55%)	49	5864055:5864072	5921762:5921779
5864055:5864072	attL	AGGCGCCGCTGCTGGCCG	NA	NA	NA	NA
WP_003099504.1|5875380_5875605_-	hypothetical protein	NA	Q5ZQV7	Pseudomonas_phage	97.3	7.2e-34
WP_003099502.1|5875683_5875971_-	hypothetical protein	NA	A0A076FSS3	Pseudomonas_phage	95.8	6.2e-46
WP_023098814.1|5875967_5877116_-	hypothetical protein	NA	B7SE13	Pseudomonas_virus	99.2	2.7e-225
WP_003099498.1|5877112_5879320_-	hypothetical protein	NA	A0A0A1IX03	Pseudomonas_phage	98.4	0.0e+00
WP_003099496.1|5879309_5879528_-	hypothetical protein	NA	A0A076FR11	Pseudomonas_phage	100.0	5.7e-36
WP_003099487.1|5879524_5879764_-	hypothetical protein	NA	A0A076FRB9	Pseudomonas_phage	100.0	2.1e-39
WP_003099484.1|5879772_5880594_-	DUF2163 domain-containing protein	NA	A0A076FSS7	Pseudomonas_phage	99.3	2.6e-161
WP_003099481.1|5880583_5882287_-	hypothetical protein	NA	L7P7V0	Pseudomonas_phage	98.1	0.0e+00
WP_003099478.1|5882286_5883210_-	hypothetical protein	NA	A0A125RNJ1	Pseudomonas_phage	93.8	2.4e-176
WP_023098816.1|5883211_5884168_-	hypothetical protein	NA	A0A0A7DK02	Pseudomonas_phage	94.7	2.4e-182
WP_003099473.1|5884175_5887874_-	tape measure protein	NA	B7SE05	Pseudomonas_virus	98.2	0.0e+00
WP_031630143.1|5888000_5888519_-	hypothetical protein	NA	B7SE04	Pseudomonas_virus	98.0	1.5e-82
WP_003099463.1|5888523_5889294_-	hypothetical protein	NA	A0A0A1IW08	Pseudomonas_phage	99.2	8.0e-141
WP_003099460.1|5889326_5889506_-	hypothetical protein	NA	A0A0U5G7J8	unidentified_phage	100.0	2.9e-25
WP_003099458.1|5889493_5889967_-	hypothetical protein	NA	A0A0A1IUZ7	Pseudomonas_phage	99.4	5.0e-85
WP_003094564.1|5889963_5890380_-	DUF1320 domain-containing protein	NA	L7P7K2	Pseudomonas_phage	100.0	3.9e-73
WP_003099454.1|5890543_5890984_-	hypothetical protein	NA	A0A125RNI2	Pseudomonas_phage	100.0	1.2e-45
WP_003099452.1|5891051_5891966_-|head	head protein	head	I6PBD3	Pseudomonas_phage	100.0	9.2e-176
WP_031630145.1|5891969_5893067_-|protease	protease	protease	A0A125RNI0	Pseudomonas_phage	99.7	6.4e-200
WP_003099449.1|5893269_5893737_-	phage virion morphogenesis protein	NA	B7SDZ4	Pseudomonas_virus	96.8	2.4e-79
WP_003099448.1|5893736_5895023_-	virion morphogenesis protein	NA	B7SDZ3	Pseudomonas_virus	99.5	5.9e-245
WP_003099445.1|5895022_5896603_-	DUF935 domain-containing protein	NA	A0A0A1IVG5	Pseudomonas_phage	99.6	8.4e-302
WP_003099444.1|5896612_5898259_-|terminase	phage terminase large subunit	terminase	A0SMN6	Pseudomonas_virus	98.2	0.0e+00
WP_003099442.1|5898853_5899354_-	DUF1804 family protein	NA	A0A1C6ZDN3	Pseudomonas_phage	99.4	8.5e-83
WP_003094538.1|5899362_5899551_-	hypothetical protein	NA	A0A0A1IVG3	Pseudomonas_phage	100.0	1.0e-25
WP_003099439.1|5899661_5900063_-	hypothetical protein	NA	A0A0A7DJP8	Pseudomonas_phage	97.0	1.1e-64
WP_003099438.1|5900059_5900302_-	hypothetical protein	NA	L7P808	Pseudomonas_phage	98.8	2.6e-37
WP_003099436.1|5900301_5900718_-	structural protein	NA	A0A125RNG7	Pseudomonas_phage	100.0	3.9e-73
WP_031630147.1|5900717_5901140_-	hypothetical protein	NA	A0A0U5LBV3	unidentified_phage	98.6	4.3e-72
WP_016050131.1|5901132_5901480_-	hypothetical protein	NA	I6P9D0	Pseudomonas_phage	100.0	1.9e-57
WP_015649664.1|5901582_5902032_-	hypothetical protein	NA	I6PBD0	Pseudomonas_phage	100.0	4.6e-80
WP_003099430.1|5902018_5902426_-	regulatory protein GemA	NA	I6PBV8	Pseudomonas_phage	100.0	7.9e-71
WP_003099427.1|5902422_5902719_-	hypothetical protein	NA	L7P7Y1	Pseudomonas_phage	100.0	1.2e-44
WP_003099425.1|5902789_5903059_-	hypothetical protein	NA	A0A0A7DJS6	Pseudomonas_phage	97.8	6.6e-42
WP_003094506.1|5903061_5903268_-	hypothetical protein	NA	A0A0A1IWY9	Pseudomonas_phage	100.0	2.2e-29
WP_003099423.1|5903269_5903551_-	hypothetical protein	NA	A0A125RNF9	Pseudomonas_phage	100.0	2.1e-46
WP_003094501.1|5903553_5903862_-	hypothetical protein	NA	L7P806	Pseudomonas_phage	100.0	8.4e-49
WP_003099420.1|5903863_5904067_-	hypothetical protein	NA	I6PBV7	Pseudomonas_phage	98.5	1.7e-29
WP_003099419.1|5904066_5904585_-	host-nuclease inhibitor protein Gam	NA	L7P7I4	Pseudomonas_phage	99.4	1.5e-90
WP_020750458.1|5904601_5904913_-	hypothetical protein	NA	A0A1C6ZDI6	Pseudomonas_phage	99.0	3.1e-51
WP_003099415.1|5904875_5905289_-	hypothetical protein	NA	A0A0A1IWY8	Pseudomonas_phage	100.0	1.2e-71
WP_003099411.1|5905389_5906025_-	hypothetical protein	NA	A0A125RNF2	Pseudomonas_phage	99.1	5.9e-113
WP_003099409.1|5906096_5906762_-	hypothetical protein	NA	A0A125RNF1	Pseudomonas_phage	99.5	1.7e-123
WP_012613772.1|5906758_5907529_-	ATP-binding protein	NA	A0A125RN40	Pseudomonas_phage	100.0	4.9e-138
WP_003099405.1|5907525_5909595_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0U5LBU1	unidentified_phage	99.4	0.0e+00
WP_003099403.1|5909587_5910019_-	hypothetical protein	NA	L7P827	Pseudomonas_phage	100.0	4.0e-65
WP_003094469.1|5910018_5910453_-	hypothetical protein	NA	L7P7J4	Pseudomonas_phage	100.0	2.3e-76
WP_003094467.1|5910455_5910812_-	nucleotide excision repair protein	NA	A0A0U5KN61	unidentified_phage	100.0	4.5e-62
WP_003099400.1|5911052_5911730_+	helix-turn-helix transcriptional regulator	NA	H1ZZB6	Pseudomonas_virus	97.3	1.1e-117
5921762:5921779	attR	AGGCGCCGCTGCTGGCCG	NA	NA	NA	NA
>prophage 6
NZ_CP046069	Pseudomonas aeruginosa strain KRP1 chromosome, complete genome	6737396	6186953	6275531	6737396	tail,portal,terminase,integrase,transposase,protease,head,plate,holin,tRNA,capsid	Pseudomonas_virus(76.6%)	98	6209459:6209504	6225700:6225745
WP_003104666.1|6186953_6187415_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_003096050.1|6187473_6187965_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_023114929.1|6188001_6188256_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	43.4	4.7e-13
WP_003096058.1|6188257_6188677_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003114478.1|6189001_6190549_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_014603391.1|6190862_6191681_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_031637483.1|6191830_6193117_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	39.8	2.9e-10
WP_003123646.1|6193145_6194456_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.0	5.0e-26
WP_003096069.1|6194455_6195229_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_010793678.1|6195297_6196779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003096075.1|6196815_6197571_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106330.1|6197720_6198473_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106332.1|6198563_6199310_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106334.1|6199481_6200252_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_003106336.1|6200262_6201000_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_003112624.1|6201048_6201309_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_003096087.1|6201312_6201951_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_003096088.1|6201950_6202544_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_003112623.1|6202704_6203103_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003112622.1|6203139_6203376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003112621.1|6203372_6204479_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003105535.1|6204572_6206825_+	AsmA family protein	NA	NA	NA	NA	NA
WP_004352428.1|6206821_6207889_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003096100.1|6207932_6208205_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_003112619.1|6208232_6209315_+	oxidoreductase	NA	NA	NA	NA	NA
6209459:6209504	attL	ATTGAAAATCCCCGTGTCGGCGGTTCGATTCCGTCCCTGGGCACCA	NA	NA	NA	NA
WP_124033777.1|6209530_6210715_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	38.4	5.5e-48
WP_023114932.1|6211026_6213105_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_023114933.1|6213456_6213849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023114934.1|6213991_6214654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023114935.1|6214672_6215875_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	30.1	1.5e-40
WP_023114936.1|6216426_6217473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124033778.1|6217740_6218076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023114937.1|6218076_6220332_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_124033779.1|6220328_6220643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124033780.1|6220630_6220879_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_124074571.1|6221504_6221726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031637489.1|6221781_6222234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086009326.1|6222782_6223920_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.7	7.7e-47
WP_094868201.1|6223947_6225453_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_003096148.1|6225801_6226539_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
6225700:6225745	attR	ATTGAAAATCCCCGTGTCGGCGGTTCGATTCCGTCCCTGGGCACCA	NA	NA	NA	NA
WP_023114939.1|6226697_6227387_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_003096153.1|6227635_6228409_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.1	9.3e-20
WP_003096156.1|6228423_6229176_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016562461.1|6229237_6229933_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003096163.1|6229929_6230622_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010793675.1|6230690_6231911_+	methyltransferase	NA	NA	NA	NA	NA
WP_003110596.1|6232309_6232780_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003112617.1|6232783_6234262_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_003105511.1|6234276_6235461_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003096173.1|6235471_6237001_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_071534457.1|6238063_6238591_+	SocA family protein	NA	NA	NA	NA	NA
WP_124033784.1|6239021_6239441_+	hypothetical protein	NA	L7TJK7	Pseudomonas_virus	38.8	2.2e-23
WP_023114940.1|6239437_6240493_-|portal	phage portal protein	portal	Q9ZXM6	Pseudomonas_virus	96.5	6.0e-195
WP_031643136.1|6240492_6242253_-|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	99.8	0.0e+00
WP_023121181.1|6242408_6243230_+|capsid	GPO family capsid scaffolding protein	capsid	Q9ZXM4	Pseudomonas_virus	98.9	2.2e-128
WP_016852024.1|6243265_6244282_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	99.1	6.6e-191
WP_023114941.1|6244287_6244989_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	98.7	1.1e-123
WP_023116818.1|6245092_6245554_+|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	97.4	6.8e-79
WP_003098378.1|6245553_6245766_+|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	94.1	4.9e-32
WP_003098379.1|6245790_6246144_+	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	100.0	6.0e-59
WP_003098380.1|6246145_6246418_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	97.8	2.6e-38
WP_023114944.1|6246414_6247221_+	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	96.9	9.0e-143
WP_016852029.1|6247217_6247460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016852030.1|6247456_6247918_+	peptidase	NA	Q9ZXL5	Pseudomonas_virus	87.6	5.3e-63
WP_016852031.1|6247995_6248532_+|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	98.9	7.9e-95
WP_023089204.1|6248524_6248983_+	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	91.3	9.8e-70
WP_023089205.1|6248992_6249421_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023089206.1|6249598_6250171_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	96.8	9.7e-91
WP_023089207.1|6250167_6250512_+	hypothetical protein	NA	Q9ZXK9	Pseudomonas_virus	97.4	4.6e-56
WP_023114945.1|6250508_6251423_+|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	96.7	7.0e-160
WP_023091255.1|6251422_6251959_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	99.4	3.1e-99
WP_023089210.1|6251960_6254318_+|tail	phage tail fiber protein	tail	Q9ZXK6	Pseudomonas_virus	87.5	0.0e+00
WP_023114946.1|6254314_6254779_+	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	60.7	2.3e-42
WP_023114947.1|6254869_6256045_+|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	98.5	2.3e-219
WP_023114948.1|6256101_6256617_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	94.2	2.1e-89
WP_023083449.1|6256671_6257001_+|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	96.3	5.3e-49
WP_003098394.1|6257009_6257129_+|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	100.0	1.8e-15
WP_023114949.1|6257118_6259866_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	94.1	0.0e+00
WP_003098399.1|6259871_6260312_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	99.3	1.8e-76
WP_023121182.1|6260308_6261595_+	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	96.2	3.1e-230
WP_071534455.1|6261816_6262356_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_031633861.1|6262478_6263012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023096284.1|6263065_6263416_-	hypothetical protein	NA	Q9ZXJ5	Pseudomonas_virus	89.6	2.9e-53
WP_121334483.1|6263733_6264096_-	helix-turn-helix transcriptional regulator	NA	E5E3P4	Burkholderia_phage	42.1	2.1e-06
WP_031643139.1|6264174_6264387_+	hypothetical protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.8	1.9e-07
WP_031293865.1|6264416_6264887_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	93.6	2.5e-76
WP_003098408.1|6264883_6265177_+	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	99.0	1.1e-50
WP_023096288.1|6265173_6265524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098410.1|6265594_6265828_+	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	100.0	7.8e-39
WP_023121183.1|6265824_6268545_+	hypothetical protein	NA	Q9ZXI8	Pseudomonas_virus	96.6	0.0e+00
WP_023114956.1|6268589_6268943_+	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	97.4	2.4e-60
WP_003098417.1|6268954_6269161_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	100.0	7.3e-33
WP_023114957.1|6269464_6271150_+	hypothetical protein	NA	L7TH64	Pseudomonas_virus	90.8	4.8e-287
WP_023114958.1|6271160_6271349_+	hypothetical protein	NA	Q38017	Pseudomonas_virus	76.5	7.0e-06
WP_023114959.1|6271345_6271558_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_023114960.1|6271554_6272703_+	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	40.5	1.8e-72
WP_023114962.1|6273169_6273676_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_023114963.1|6274211_6275531_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	34.2	1.2e-64
