The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045034	Lactobacillus fermentum strain USM 8633 chromosome, complete genome	2238401	11645	47290	2238401	transposase,protease	Streptococcus_phage(21.43%)	29	NA	NA
WP_021350169.1|11645_13892_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	1.7e-122
WP_012391521.1|14144_14852_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003684192.1|14978_15554_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_012391523.1|15546_16974_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.7	2.3e-96
WP_003684189.1|17260_17854_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_021349807.1|18009_18729_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003684186.1|18739_19528_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	34.5	7.5e-25
WP_035437156.1|19517_20402_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004563053.1|20483_21725_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_003684379.1|21789_22815_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.6	1.7e-45
WP_086031800.1|23334_24585_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_086031801.1|24663_25116_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.8	1.8e-31
WP_035435855.1|25467_26166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024501090.1|26178_27039_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.3e-17
WP_003684176.1|27025_27403_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035435859.1|27512_28445_-	dTDP-glucose 4,6-dehydratase	NA	M1I5F1	Acanthocystis_turfacea_Chlorella_virus	40.2	6.1e-58
WP_035435862.1|28471_30217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031274336.1|30262_31171_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_100184896.1|31188_32220_-	sugar transferase	NA	NA	NA	NA	NA
WP_003684164.1|32258_33839_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	27.3	2.5e-32
WP_042513950.1|34140_35499_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_035437589.1|35627_36605_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	34.8	1.0e-47
WP_035437591.1|36693_37803_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_021350368.1|37802_38735_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	50.0	5.8e-77
WP_080650637.1|38824_39388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086031802.1|39530_41126_-	hydrolase Nlp/P60	NA	A0A1J0GW44	Streptomyces_phage	43.0	3.6e-10
WP_086031804.1|43180_44104_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	1.8e-30
WP_035436033.1|44163_45750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086031805.1|46069_47290_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.8e-95
>prophage 2
NZ_CP045034	Lactobacillus fermentum strain USM 8633 chromosome, complete genome	2238401	77901	180250	2238401	transposase,tRNA,terminase,head,holin,capsid,tail,integrase,portal,protease	Erysipelothrix_phage(38.1%)	98	77790:77849	132078:132189
77790:77849	attL	GACGAATTTACAATTGAAGTGCAACAAGTAAGAAGAAAATAAAAAAGAACTCATAGCCTG	NA	NA	NA	NA
WP_014562466.1|77901_78900_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_014081459.1|79191_79590_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	1.1e-45
WP_004563019.1|79771_80239_-	DNA starvation/stationary phase protection protein	NA	A0A291I9P0	Lactobacillus_phage	31.5	9.2e-15
WP_003684101.1|80319_80880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003684096.1|81352_82612_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_003684094.1|82834_83383_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021349820.1|83590_84001_+	MFS transporter	NA	NA	NA	NA	NA
WP_145998167.1|83954_84755_+	MFS transporter	NA	NA	NA	NA	NA
WP_035437180.1|84786_85305_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	45.5	6.0e-31
WP_035437183.1|85395_85989_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_035437185.1|86005_86227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035437189.1|86264_86954_-	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	41.6	2.6e-34
WP_012391566.1|87116_87689_-	NADPH-dependent F420 reductase	NA	NA	NA	NA	NA
WP_075667505.1|87691_88135_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_086031808.1|88276_89839_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_080650627.1|89878_90385_-|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_035437193.1|90460_91243_+	dimethylargininase	NA	NA	NA	NA	NA
WP_035437196.1|91630_93028_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_080650628.1|93453_94575_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_035437199.1|94984_95248_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_035437201.1|95244_95499_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_041807836.1|95747_96035_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_086031809.1|96058_96937_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.7	1.8e-40
WP_080650602.1|97734_98499_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_154244344.1|98705_99611_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_035431426.1|99547_100162_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003688751.1|101617_101905_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_035436028.1|102219_103338_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_035436025.1|103325_103643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154244345.1|103906_104749_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	97.9	9.1e-154
WP_086031812.1|104802_105054_-|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	94.0	7.8e-37
WP_014562705.1|105385_106573_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_154244346.1|106569_106902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681672.1|106873_107524_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003681670.1|107548_107830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681668.1|107881_108109_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_035435921.1|108131_110060_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.9	1.1e-93
WP_024501125.1|110208_110769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042513934.1|110854_111310_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	1.8e-31
WP_012391038.1|111383_112634_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_086031815.1|114050_115238_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	2.0e-37
WP_086031817.1|115720_116860_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	1.1e-42
WP_021816442.1|116949_117453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035437646.1|118300_118531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048340506.1|122024_122957_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	1.1e-27
WP_086031818.1|122947_123358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035435818.1|123354_123897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035435815.1|123913_124885_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	30.8	6.8e-36
WP_035435812.1|124957_126103_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_035435809.1|126092_127625_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	30.8	2.8e-52
WP_035435808.1|127627_127834_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	68.7	2.3e-18
WP_035435803.1|127996_128893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035435799.1|129277_129736_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_035435797.1|129817_130021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035435794.1|130004_130340_+	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	32.7	1.6e-05
WP_035435791.1|130336_131476_+	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	53.0	4.9e-110
WP_080650596.1|131453_132029_+	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	73.4	7.0e-73
WP_014562466.1|132189_133188_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
132078:132189	attR	GACGAATTTACAATTGAAGTGCAACAAGTAAGAAGAAAATAAAAAAGAACTCATAGCCTGAGTCCTGTAAAATGAAGTCACCACAACAAACATCTAAAGGAGATCTTAGGCT	NA	NA	NA	NA
WP_035435845.1|133210_135145_+	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	58.0	4.6e-225
WP_035435842.1|135231_135618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035435838.1|135620_137876_+	phage/plasmid primase P4 family domain-containing protein	NA	A0A1X9I6B6	Streptococcus_phage	48.6	4.7e-213
WP_021349830.1|138089_138371_+	VRR-NUC domain-containing protein	NA	A0A1B0RXC4	Streptococcus_phage	53.3	2.6e-20
WP_035435834.1|138351_139707_+	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	66.8	4.1e-156
WP_021349831.1|139703_140171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349832.1|140317_140695_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	54.7	5.7e-31
WP_021349833.1|140815_141358_+|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	59.9	1.1e-56
WP_048340505.1|142242_143121_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	5.2e-43
WP_041812698.1|143144_143432_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_021349835.1|143978_144599_+	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	43.6	6.5e-40
WP_021349836.1|144601_144808_+	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_080650631.1|144908_146471_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	76.5	5.5e-245
WP_035433240.1|146565_147765_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	64.1	1.7e-153
WP_003671987.1|147761_148433_+|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	52.2	4.4e-58
WP_021349839.1|148451_149630_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	58.7	3.1e-128
WP_003671991.1|149646_149925_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_021349840.1|149924_150308_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_021349841.1|150294_150705_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	65.8	1.7e-41
WP_035437374.1|151173_151407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035437377.1|151442_153104_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	39.1	5.5e-102
WP_035437379.1|153096_154674_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	48.9	1.1e-131
WP_154244376.1|155004_156588_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_021349514.1|159379_160567_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.3	1.2e-37
WP_021349527.1|161996_163373_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	52.0	6.7e-130
WP_014562608.1|163481_164495_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_003681638.1|164507_165932_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_024501129.1|165945_167409_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004562976.1|167408_167729_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_003681632.1|167903_169016_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_003681631.1|169018_171058_-	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	36.3	2.4e-99
WP_024501130.1|171059_173330_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.8	8.2e-133
WP_003681628.1|173507_174680_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_003681626.1|174681_175269_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003681625.1|175284_175899_-	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	51.7	2.9e-32
WP_003681624.1|176293_177067_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_024501131.1|177360_178464_+	endonuclease	NA	NA	NA	NA	NA
WP_004562969.1|178514_178910_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_004562968.1|178923_179367_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003681620.1|179473_180250_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP045034	Lactobacillus fermentum strain USM 8633 chromosome, complete genome	2238401	211922	240309	2238401	transposase,protease	Lactococcus_phage(25.0%)	30	NA	NA
WP_024501138.1|211922_214427_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.7	1.1e-125
WP_003681550.1|214445_214916_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024501139.1|215055_216075_-	alcohol dehydrogenase AdhP	NA	A0A2K9L7I1	Tupanvirus	29.9	1.1e-28
WP_003681545.1|216361_217078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024501140.1|217139_217805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963713.1|217837_218095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086031821.1|219432_219870_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	71.7	1.4e-49
WP_086031822.1|219932_220958_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.8	8.7e-42
WP_035437484.1|221566_222070_-	energy coupling factor transporter S component ThiW	NA	NA	NA	NA	NA
WP_024501143.1|222913_223744_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_080650634.1|223802_224147_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_035437478.1|224062_224383_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015639408.1|224395_224566_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003681522.1|225306_225948_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	52.5	5.4e-58
WP_003681521.1|226078_227569_-	amino acid permease	NA	NA	NA	NA	NA
WP_012391607.1|227878_228346_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024501146.1|228390_229200_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024501147.1|229418_230087_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003681512.1|230141_230630_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_024501148.1|230639_231389_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_086031824.1|231552_232839_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_014562466.1|233032_234031_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_004562929.1|234162_234363_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.7	6.9e-20
WP_004562927.1|234511_235171_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_014562621.1|235324_236230_+	cation transporter	NA	A0A1V0SED0	Indivirus	32.0	1.3e-09
WP_024501149.1|236384_237080_-	VIT family protein	NA	NA	NA	NA	NA
WP_003681498.1|237097_237781_-	VIT family protein	NA	NA	NA	NA	NA
WP_003681496.1|237929_238406_-	universal stress protein	NA	NA	NA	NA	NA
WP_035436404.1|238611_239046_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024501150.1|239094_240309_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP045034	Lactobacillus fermentum strain USM 8633 chromosome, complete genome	2238401	453576	576567	2238401	transposase,tRNA	Paenibacillus_phage(17.24%)	106	NA	NA
WP_080965008.1|453576_454485_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.6	1.9e-11
WP_014562701.1|454784_455795_-	nickel transporter NixA	NA	NA	NA	NA	NA
WP_021349213.1|455823_456651_-	ATP-dependent sacrificial sulfur transferase LarE	NA	NA	NA	NA	NA
WP_012391743.1|456675_457386_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_012391744.1|457387_458752_-	nickel pincer cofactor biosynthesis protein LarC	NA	NA	NA	NA	NA
WP_012391429.1|458914_460135_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
WP_012391746.1|460856_462140_-	nickel-dependent lactate racemase	NA	NA	NA	NA	NA
WP_023466300.1|462380_463052_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_014562705.1|465136_466324_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_014562706.1|467589_469311_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_003681137.1|469498_470827_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_003681135.1|470841_471237_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_021349696.1|471260_472178_-	ribokinase	NA	NA	NA	NA	NA
WP_021349649.1|472422_473382_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012391752.1|473485_474139_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_003685477.1|474152_475169_+	DUF4432 family protein	NA	NA	NA	NA	NA
WP_003685479.1|475202_476150_+	ribokinase	NA	NA	NA	NA	NA
WP_014562709.1|476209_477634_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_014562710.1|477831_478836_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_021350294.1|479389_480895_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_042513835.1|481685_483044_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014562712.1|483635_486035_-	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_012391758.1|486240_487038_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003685491.1|487044_487773_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003681115.1|487916_488417_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_035436983.1|488420_489164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349122.1|489223_490660_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_014562716.1|490895_491708_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_014562717.1|491973_492489_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_003685499.1|492498_493026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681106.1|493174_494560_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003681105.1|494646_495111_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_021349399.1|495355_495787_-	VOC family protein	NA	NA	NA	NA	NA
WP_021349400.1|495979_497149_+	MFS transporter	NA	NA	NA	NA	NA
WP_024501234.1|497520_499002_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	36.9	3.1e-72
WP_012391767.1|499186_500626_+	NADP-dependent phosphogluconate dehydrogenase	NA	E3SPS4	Prochlorococcus_phage	30.2	1.1e-29
WP_021350129.1|500880_501354_-	universal stress protein	NA	NA	NA	NA	NA
WP_021350128.1|501515_501971_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021350127.1|502129_502897_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	5.6e-17
WP_024501235.1|502913_503915_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_021350126.1|504186_505995_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_014562721.1|505997_507290_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_021350125.1|507537_508209_+	membrane protein	NA	NA	NA	NA	NA
WP_023467458.1|509864_511544_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_004562986.1|512126_512786_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	8.1e-41
WP_042513953.1|514245_515466_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	44.5	4.6e-90
WP_080650603.1|516831_517173_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	48.1	9.1e-12
WP_086031832.1|517273_518299_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	1.9e-44
WP_086031833.1|518440_519727_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003645890.1|519826_519961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102116229.1|520031_520466_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_046041176.1|520472_520565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021353998.1|520679_521657_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_154244349.1|522265_523486_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	44.5	2.7e-90
WP_035437573.1|523750_524047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003688746.1|524065_524230_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_035437571.1|524282_526478_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.1	4.0e-60
WP_035437569.1|526728_527160_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_012391781.1|528655_529327_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	5.0e-30
WP_003685525.1|529331_530378_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_080965022.1|531088_531523_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_086031834.1|531723_532632_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.6	1.9e-11
WP_035436770.1|532887_534831_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_021349353.1|534906_537129_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_012391784.1|537343_538345_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	22.8	9.9e-06
WP_035436767.1|538372_539827_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_021350297.1|539854_541021_-	galactokinase	NA	NA	NA	NA	NA
WP_012391787.1|541192_542143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035436764.1|542148_542937_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_021350299.1|542955_543468_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_035436761.1|543480_543705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021816648.1|543820_544555_-	amino acid ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.6	1.9e-14
WP_035436758.1|544556_545246_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003685553.1|545348_546149_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003682214.1|546287_546614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035436755.1|546715_547654_+	phosphoglycerate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	33.2	5.4e-30
WP_035436752.1|547655_548138_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003682221.1|548354_549149_+	nicotinamide mononucleotide transporter	NA	A0A0C5K6M3	Enterococcus_phage	33.1	5.8e-25
WP_035436749.1|549255_549765_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.4	7.2e-37
WP_021353558.1|549773_551678_-	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.8	3.4e-71
WP_086031835.1|551937_553248_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.0	3.0e-47
WP_003682227.1|553344_553638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035436742.1|553630_554791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682231.1|554783_555926_-	AAA domain-containing protein	NA	A0A141HRX4	Bacillus_phage	31.1	1.7e-22
WP_003682233.1|555927_556557_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_003682235.1|556616_556985_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_012391797.1|557275_557461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003685576.1|557461_558136_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021349314.1|558138_558462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682248.1|558555_559182_+	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_003682249.1|559362_559920_-	elongation factor P	NA	NA	NA	NA	NA
WP_021349677.1|560066_560699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682253.1|560835_561069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682254.1|561115_562063_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_086031836.1|562491_564555_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7RUS8	Clostridium_phage	49.0	1.4e-27
WP_003682256.1|564673_564994_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054173696.1|565336_566587_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_015638507.1|566660_567116_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.7	9.5e-33
WP_003685587.1|567181_567640_-	arginine repressor	NA	NA	NA	NA	NA
WP_035437714.1|567801_568494_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	8.5e-33
WP_086031837.1|568506_569568_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_035437716.1|569491_570094_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046948259.1|571492_572416_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.1e-33
WP_086031838.1|573326_573791_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.4	7.0e-31
WP_086031839.1|573801_574989_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	2.6e-37
WP_086031754.1|575280_576567_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP045034	Lactobacillus fermentum strain USM 8633 chromosome, complete genome	2238401	591614	658382	2238401	transposase,tRNA,protease	Staphylococcus_phage(19.05%)	53	NA	NA
WP_035436826.1|591614_593519_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_003685618.1|593533_594922_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_051132367.1|595067_595928_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_012391813.1|595958_596792_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_003682289.1|596807_597152_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003682291.1|597267_597402_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_154244351.1|597475_597838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035436835.1|597920_599237_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_012390650.1|599401_600541_+	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	30.6	4.7e-12
WP_003682299.1|600762_600981_+	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_035436838.1|600990_602112_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003682301.1|602111_604061_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	45.6	5.7e-143
WP_015638408.1|604086_606597_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	37.3	2.0e-111
WP_042513824.1|606770_608021_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.3	1.8e-57
WP_012390701.1|608099_608552_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_003682303.1|608808_609102_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_035435868.1|609142_609868_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	66.4	5.6e-35
WP_003682305.1|609906_610143_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_035435870.1|610267_612301_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003685631.1|612300_612753_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_035435873.1|612797_614201_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	49.3	3.5e-110
WP_021349470.1|614284_615460_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	28.7	1.7e-44
WP_003682310.1|615471_615804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513823.1|616043_617330_-|transposase	ISL3 family transposase	transposase	A0A2R2ZGN7	Clostridioides_phage	20.6	2.5e-09
WP_014562466.1|617607_618606_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_003685635.1|619124_619832_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.8	7.9e-42
WP_014562047.1|619843_621703_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.6	2.2e-35
WP_003682313.1|621686_622985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562049.1|622986_623787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682315.1|623801_624617_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.2	4.1e-34
WP_003682316.1|624691_625963_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	5.8e-19
WP_021350198.1|626470_626950_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_003685648.1|627164_627590_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_014562051.1|627595_628531_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_035436613.1|628910_630254_+	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_035436615.1|630266_632513_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_003682323.1|632659_633328_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_003682325.1|633714_633903_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_035436617.1|634056_635034_-	choloylglycine hydrolase family protein	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	25.4	2.5e-14
WP_003682327.1|635088_636024_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003682328.1|636326_637319_-	D-2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	31.8	4.8e-37
WP_035436619.1|637334_638519_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003682330.1|638867_639098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562056.1|639202_641296_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.4	5.1e-121
WP_012390672.1|641596_643057_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_024500595.1|643539_647277_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_035436629.1|647283_651297_+	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	22.4	3.3e-12
WP_003685671.1|651296_652160_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	46.4	5.6e-58
WP_035436630.1|652397_654023_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_003682345.1|654316_654673_-	arsenate reductase family protein	NA	NA	NA	NA	NA
WP_035436631.1|654710_655826_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003682349.1|655818_656550_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.7	1.4e-25
WP_086031729.1|657131_658382_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.0	9.0e-57
>prophage 6
NZ_CP045034	Lactobacillus fermentum strain USM 8633 chromosome, complete genome	2238401	688146	730988	2238401	transposase,holin,tRNA	Bifidobacterium_phage(14.29%)	38	NA	NA
WP_003682400.1|688146_689445_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.8	6.2e-93
WP_035436589.1|689807_690821_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_035436592.1|691078_692332_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.0	3.9e-84
WP_014562075.1|692799_694254_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_035436595.1|694257_695001_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.1e-33
WP_014562076.1|695320_696694_+	amino acid permease	NA	NA	NA	NA	NA
WP_014562466.1|697198_698197_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_107504371.1|699632_699722_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_035437017.1|700188_701538_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.6	1.2e-123
WP_021349242.1|703207_704407_+	nucleoside transporter	NA	NA	NA	NA	NA
WP_003685735.1|704640_705561_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_021350222.1|705749_706487_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_003685743.1|706505_707441_+	nucleoid occlusion protein	NA	I3NLC2	Bifidobacterium_phage	33.6	6.2e-10
WP_014562081.1|707454_708288_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	33.5	1.0e-16
WP_003682416.1|708300_708501_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_003682418.1|708516_709614_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_015638460.1|709647_710421_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_003685751.1|710691_711834_+	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	32.4	5.7e-58
WP_035437022.1|713188_713959_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_035437024.1|713975_714716_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_035437027.1|714742_715513_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_035437030.1|715543_716485_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	36.3	5.0e-44
WP_086031840.1|716468_717128_+	exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase	NA	NA	NA	NA	NA
WP_035437035.1|717164_717998_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_080650621.1|718121_719072_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_051132372.1|719115_719601_+	glycosyltransferase	NA	A0A0F7L2F7	uncultured_marine_virus	26.5	4.0e-05
WP_035437042.1|719640_720165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035437044.1|720169_721270_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_080650623.1|721338_722919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035437052.1|722930_724073_+	EpsG family protein	NA	NA	NA	NA	NA
WP_014562705.1|724246_725434_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_154244353.1|725480_725627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562705.1|725911_727099_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_154244353.1|727145_727292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086031733.1|727545_727902_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_086031734.1|728065_728998_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	8.5e-28
WP_080650604.1|728993_729659_+	DUF1919 domain-containing protein	NA	NA	NA	NA	NA
WP_086031735.1|729848_730988_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.1	3.3e-42
>prophage 7
NZ_CP045034	Lactobacillus fermentum strain USM 8633 chromosome, complete genome	2238401	734604	804048	2238401	transposase	Lactobacillus_phage(18.52%)	59	NA	NA
WP_086031736.1|734604_734892_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_086031737.1|734915_735821_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.3	1.2e-39
WP_035436068.1|736204_737086_-	glycosyl transferase family 14	NA	NA	NA	NA	NA
WP_154244354.1|737508_738270_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	96.4	4.1e-137
WP_002816285.1|738323_738575_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_086031739.1|738820_739816_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.7	3.1e-36
WP_086031740.1|740000_741020_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.1	1.0e-42
WP_023487886.1|741238_742426_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_154244377.1|742599_742785_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_035437548.1|742808_743315_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_035437552.1|743511_744201_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.6	1.8e-35
WP_035437547.1|744398_745541_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.0	3.2e-29
WP_035437544.1|745540_746836_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_035437542.1|747170_748031_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003682463.1|748040_748460_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_086031741.1|748654_749026_+	esterase	NA	NA	NA	NA	NA
WP_003682466.1|749368_750556_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_086031742.1|750795_752046_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.4	2.4e-57
WP_086031743.1|752119_752602_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	1.1e-31
WP_021349514.1|752635_753823_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.3	1.2e-37
WP_086031744.1|754001_754715_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.2	6.5e-28
WP_107760586.1|754702_755587_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_035436931.1|755933_756974_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_048340284.1|757061_758723_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_035436933.1|759009_759495_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.2	1.4e-21
WP_035436936.1|759478_760618_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_154244355.1|760636_761932_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.7	6.3e-21
WP_035436938.1|762271_763312_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_035436940.1|763323_764874_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003682490.1|765532_766255_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	36.8	3.3e-35
WP_012390750.1|766257_766500_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003682494.1|766500_767181_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_015638502.1|767184_769410_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.6	6.3e-146
WP_003682498.1|769385_770849_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.7	4.1e-61
WP_012390753.1|770848_771886_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	39.8	9.4e-60
WP_035436943.1|771894_772476_+	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_035436945.1|772477_774013_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.2	7.6e-74
WP_086031745.1|774286_775540_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_003682507.1|775779_776475_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_021349275.1|776599_777778_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_035436953.1|777891_778896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349273.1|779386_779758_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_003686555.1|779771_780080_+	copper-binding protein	NA	NA	NA	NA	NA
WP_003682512.1|780079_782011_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.6	2.7e-92
WP_024271753.1|782122_782557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682515.1|782604_783081_-	nucleoside deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	35.2	7.7e-17
WP_048340466.1|788928_790068_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	1.0e-43
WP_048340467.1|790114_790729_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	32.5	8.1e-19
WP_080964966.1|790665_791574_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.2	4.9e-12
WP_080965009.1|792016_793891_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003684235.1|794037_795024_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_042513971.1|795348_796374_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.1	1.3e-42
WP_080650597.1|797645_798281_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_021350357.1|798406_798796_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_080650598.1|798898_799561_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_015638518.1|799528_800185_+	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	25.5	9.3e-13
WP_003684232.1|800882_801863_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015638522.1|802831_803026_+	CsbD family protein	NA	NA	NA	NA	NA
WP_086031746.1|803592_804048_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	1.6e-32
>prophage 8
NZ_CP045034	Lactobacillus fermentum strain USM 8633 chromosome, complete genome	2238401	854496	907159	2238401	transposase,tRNA,protease	Tupanvirus(12.5%)	44	NA	NA
WP_003686432.1|854496_856497_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.2	5.4e-88
WP_003683977.1|856500_857289_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_012390795.1|857275_857845_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_021349691.1|857837_858725_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003683980.1|859004_859856_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_024271880.1|860033_860939_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_080503614.1|860995_861607_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	1.3e-13
WP_035437682.1|861606_862401_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_021349689.1|862625_863462_+	pur operon repressor	NA	NA	NA	NA	NA
WP_012390797.1|863477_864845_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	34.4	3.4e-33
WP_003683994.1|864920_865907_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	33.6	8.4e-42
WP_003683996.1|866016_866745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035437683.1|866921_867743_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_021349686.1|867754_869110_-	HD domain-containing protein	NA	A0A291ATA1	Pandoravirus	32.1	1.4e-26
WP_003686451.1|869224_869650_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003684002.1|869695_870283_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003684004.1|870449_872051_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.3	1.0e-145
WP_003684007.1|872261_873530_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003684008.1|873624_873870_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_021349684.1|874601_875306_+	class A sortase	NA	NA	NA	NA	NA
WP_003684311.1|875425_875878_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	4.7e-32
WP_003684310.1|875956_877207_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_021349723.1|877392_877857_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_003684020.1|877993_878551_+	LemA family protein	NA	NA	NA	NA	NA
WP_003686466.1|878561_879461_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_021349724.1|879635_881015_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_012390801.1|881185_882664_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	37.8	9.6e-66
WP_003684028.1|882667_883027_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_021349725.1|883029_884151_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.9	3.2e-29
WP_015638559.1|884162_884516_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2K9VCH5	Lactobacillus_phage	38.5	2.3e-10
WP_003686479.1|884648_885284_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003684038.1|885471_886032_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_021349726.1|886049_889592_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_012390804.1|889588_889861_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_003686487.1|889949_890306_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003684046.1|890434_890941_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_024500679.1|890940_892290_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	24.4	4.0e-10
WP_003684053.1|892306_892855_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.1	8.0e-10
WP_035437099.1|892938_895107_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	48.9	7.4e-107
WP_154244357.1|895183_896065_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_021349728.1|896153_897155_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_021349729.1|897170_898664_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	41.4	2.8e-89
WP_042513854.1|904787_906074_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_107504382.1|906778_907159_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	60.3	2.1e-41
>prophage 9
NZ_CP045034	Lactobacillus fermentum strain USM 8633 chromosome, complete genome	2238401	1011968	1124499	2238401	transposase,tRNA,holin,integrase,protease	Streptococcus_phage(32.35%)	97	1061792:1061807	1090843:1090856
WP_042513837.1|1011968_1012901_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.4	5.5e-27
WP_035437299.1|1013222_1013861_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	42.5	7.8e-41
WP_021349636.1|1013924_1015241_+	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	42.9	7.2e-81
WP_031284433.1|1015237_1015912_+	ComF family protein	NA	NA	NA	NA	NA
WP_003682582.1|1016047_1016593_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_003682585.1|1016763_1019133_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_100184032.1|1019235_1020309_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_051132381.1|1020364_1020694_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_003682589.1|1020693_1021047_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003682590.1|1021061_1022024_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_021349634.1|1022016_1022862_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_003682592.1|1022858_1023872_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_021349633.1|1023934_1024846_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.1	3.9e-70
WP_012390859.1|1025369_1026149_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_021349632.1|1026164_1027343_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003682596.1|1027367_1028342_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_086031752.1|1028966_1030217_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	36.8	1.2e-56
WP_004563287.1|1030441_1030858_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_042514036.1|1030918_1031455_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_107504373.1|1031397_1032339_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.9	2.8e-34
WP_003682598.1|1032507_1033449_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	48.4	5.3e-78
WP_003682600.1|1033461_1034280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035436478.1|1034300_1035227_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	57.7	1.4e-99
WP_004563284.1|1035416_1036445_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_014562182.1|1036470_1037412_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_035436481.1|1037514_1038315_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_154244359.1|1038377_1038539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562183.1|1038601_1040326_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	60.1	1.5e-195
WP_024500722.1|1040540_1041176_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_021350021.1|1041181_1041412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004563280.1|1041511_1043527_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_023465865.1|1043536_1046398_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.8	6.8e-302
WP_004563278.1|1046487_1047573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682618.1|1047791_1048661_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.8	3.7e-09
WP_003682620.1|1048682_1049660_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	54.0	2.7e-93
WP_015638637.1|1049677_1050616_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	36.8	2.3e-49
WP_003682627.1|1051415_1052006_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.8	3.6e-56
WP_021350007.1|1054214_1054814_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_015638639.1|1054813_1055395_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_021350006.1|1055406_1059099_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
1056788:1056801	attL	TCGTGATTGCCCAC	NA	NA	NA	NA
WP_154244360.1|1059151_1062718_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
1061792:1061807	attL	CACATCGCTGAGCATA	NA	NA	NA	NA
WP_021350004.1|1062774_1063854_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	40.6	6.3e-67
WP_154244361.1|1063855_1066219_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
1064002:1064017	attR	TATGCTCAGCGATGTG	NA	NA	NA	NA
WP_021350321.1|1066239_1068774_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
1064002:1064017	attR	TATGCTCAGCGATGTG	NA	NA	NA	NA
WP_035436491.1|1068763_1070893_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_021350323.1|1070921_1072709_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_048340475.1|1072732_1073026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645712.1|1073099_1073636_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_107504374.1|1073578_1074520_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	1.8e-33
WP_080965012.1|1074537_1075101_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	33.1	1.4e-09
WP_012390875.1|1075926_1076940_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003682636.1|1077021_1078227_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_003682638.1|1078332_1079100_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_012390876.1|1079216_1080539_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	70.3	2.0e-171
WP_003682642.1|1080732_1082127_+	amino acid permease	NA	NA	NA	NA	NA
WP_014562187.1|1082215_1083766_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_003682647.1|1083843_1084068_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_014562188.1|1084120_1086514_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.1	6.5e-88
WP_003682651.1|1086534_1087008_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	56.8	4.0e-42
WP_021350152.1|1087035_1087620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350151.1|1087757_1088447_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	45.1	8.7e-46
WP_003682658.1|1088480_1089455_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003682659.1|1089463_1089916_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_021350149.1|1089915_1090431_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004563262.1|1090560_1091100_-	exonuclease	NA	M1PFD8	Streptococcus_phage	35.6	2.0e-21
WP_003682662.1|1091227_1092124_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_035423877.1|1092138_1092981_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_014562190.1|1092970_1093849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562191.1|1093888_1095247_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	26.9	3.6e-19
WP_003682666.1|1095460_1097281_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	35.5	2.0e-89
WP_003682667.1|1097560_1097872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035436517.1|1097881_1099732_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	27.7	2.7e-25
WP_014562193.1|1099753_1100581_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_021350141.1|1100901_1101516_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	48.5	1.2e-22
WP_003682672.1|1101912_1102941_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_012390889.1|1103061_1103967_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	41.2	7.5e-05
WP_024500730.1|1104063_1105026_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_003682677.1|1105112_1105952_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	40.5	2.7e-49
WP_003682679.1|1106114_1106630_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_003682680.1|1106863_1107805_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_014562195.1|1108279_1109263_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_014562196.1|1109282_1110086_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003682688.1|1110114_1111035_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_035436511.1|1111035_1111386_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_014562199.1|1112002_1112725_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.8	2.3e-36
WP_003682693.1|1112724_1114227_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	34.6	5.2e-35
WP_003682694.1|1114429_1115290_+	sugar transporter	NA	NA	NA	NA	NA
WP_048340476.1|1115364_1115901_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_107504375.1|1115843_1116785_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	1.0e-33
WP_042514038.1|1116896_1117352_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	2.4e-31
WP_048340477.1|1117425_1118676_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.0	1.8e-57
WP_003685822.1|1119199_1119763_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_014562202.1|1119778_1121443_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	37.8	8.6e-47
WP_042513939.1|1121580_1122933_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003682700.1|1122939_1123137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682701.1|1123297_1123780_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003682702.1|1123797_1124499_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
>prophage 10
NZ_CP045034	Lactobacillus fermentum strain USM 8633 chromosome, complete genome	2238401	1144323	1193421	2238401	transposase,head,tRNA	Streptococcus_phage(33.33%)	46	NA	NA
WP_086031754.1|1144323_1145610_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_014562215.1|1145853_1146972_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_014562216.1|1146968_1147742_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_012390919.1|1147875_1149144_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	35.5	3.5e-64
WP_003682740.1|1149470_1150181_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_003682741.1|1150209_1150422_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_012390920.1|1150467_1150974_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_003682743.1|1150966_1151512_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_014562217.1|1151539_1153078_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_003685874.1|1153109_1154045_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_035437522.1|1154067_1155489_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_003685876.1|1155500_1155923_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_003682748.1|1156158_1156380_+	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_035437520.1|1156389_1157613_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003685879.1|1157687_1158704_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_003682754.1|1158704_1158947_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_003682755.1|1158956_1159181_+	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_003685881.1|1159235_1160438_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_003685883.1|1160449_1160737_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_021350210.1|1160933_1161911_+	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
WP_003682759.1|1161980_1163114_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_014562223.1|1163532_1164378_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003682763.1|1164433_1164913_-	universal stress protein	NA	NA	NA	NA	NA
WP_003682765.1|1164991_1165396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035437518.1|1165557_1166850_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	51.3	1.7e-103
WP_035437516.1|1166846_1167320_-	YueI family protein	NA	NA	NA	NA	NA
WP_003682768.1|1167409_1167820_-	VOC family protein	NA	NA	NA	NA	NA
WP_012390930.1|1167856_1168603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682770.1|1168838_1169684_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	28.3	6.4e-14
WP_021350213.1|1170127_1170448_+|head	head protein	head	Q6SED4	Lactobacillus_prophage	54.2	1.2e-26
WP_021350214.1|1170560_1170728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035437514.1|1170715_1171321_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_012390958.1|1171650_1173360_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_003685978.1|1173540_1174689_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	30.3	2.0e-31
WP_003682780.1|1174701_1175922_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_035437512.1|1176317_1177607_+	GntP family permease	NA	NA	NA	NA	NA
WP_003682784.1|1177619_1178762_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	2.2e-38
WP_086031754.1|1179591_1180878_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_042513950.1|1181468_1182827_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_086031756.1|1184361_1184817_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.7	1.2e-32
WP_012391038.1|1184890_1186141_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_035437599.1|1186789_1187401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035437598.1|1187552_1188047_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_012390965.1|1188352_1191007_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.4	1.3e-158
WP_154244362.1|1191115_1192474_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_021353998.1|1192443_1193421_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP045034	Lactobacillus fermentum strain USM 8633 chromosome, complete genome	2238401	1315775	1372409	2238401	transposase,integrase,protease	Lactobacillus_phage(16.67%)	58	1354262:1354278	1360567:1360583
WP_003684331.1|1315775_1316939_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	71.7	1.8e-160
WP_015638746.1|1317540_1319340_+	ribonuclease J	NA	NA	NA	NA	NA
WP_021349941.1|1319430_1320327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349940.1|1320507_1321698_+	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	28.0	1.1e-32
WP_003682058.1|1321868_1323176_+	trigger factor	NA	NA	NA	NA	NA
WP_003682055.1|1323326_1324577_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.1	3.7e-135
WP_003682053.1|1324590_1325184_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003682052.1|1325183_1325483_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	51.5	6.9e-24
WP_021349939.1|1326083_1326830_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	1.4e-28
WP_003682047.1|1327107_1328919_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_035436721.1|1328983_1330291_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003682045.1|1330317_1331250_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_003682044.1|1331270_1332110_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_021349938.1|1332182_1334480_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	1.2e-70
WP_021349937.1|1334493_1335021_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.0	2.3e-30
WP_003682041.1|1335352_1335730_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003682040.1|1335809_1336808_-	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	36.3	7.7e-51
WP_021349936.1|1337309_1338119_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_003682034.1|1338823_1339360_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_003682030.1|1339651_1339981_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003682029.1|1340328_1340637_-	membrane protein	NA	NA	NA	NA	NA
WP_035433292.1|1341337_1341685_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	42.9	1.0e-10
WP_021349932.1|1341836_1342928_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_015638760.1|1343186_1343366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349931.1|1343727_1344588_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003682017.1|1344587_1345148_+	acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	50.0	5.9e-08
WP_015638766.1|1345507_1345873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349929.1|1346143_1346512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035436724.1|1346638_1347748_-	MFS transporter	NA	NA	NA	NA	NA
WP_021349928.1|1347952_1349488_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.6	2.0e-45
WP_021349926.1|1349946_1351536_-	asparagine synthase B	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	40.3	5.2e-102
WP_003682005.1|1352524_1352965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035437289.1|1352975_1353965_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_003682001.1|1353986_1354433_-	nucleoside 2-deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	36.7	2.4e-20
1354262:1354278	attL	TCTGCGCCCATTCCGGC	NA	NA	NA	NA
WP_035437285.1|1354533_1355154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349922.1|1356181_1357312_-|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	47.3	1.7e-91
WP_021349921.1|1357321_1357783_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_021349920.1|1357801_1358197_-	helix-turn-helix domain-containing protein	NA	Q9G039	Staphylococcus_virus	55.1	1.6e-12
WP_021349919.1|1358344_1358587_+	DUF739 family protein	NA	NA	NA	NA	NA
WP_021349918.1|1358644_1358968_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_021349917.1|1359092_1359242_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_080964974.1|1359556_1360690_+	helix-turn-helix domain-containing protein	NA	X2CYF1	Lactobacillus_phage	29.2	3.5e-15
1360567:1360583	attR	GCCGGAATGGGCGCAGA	NA	NA	NA	NA
WP_035437281.1|1360694_1360913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349883.1|1361019_1361400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349882.1|1361412_1361670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349880.1|1361947_1363222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154244363.1|1363228_1363660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349877.1|1363807_1364029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349876.1|1364055_1364475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349875.1|1364487_1364985_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_042513910.1|1365092_1366313_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.8e-95
WP_021349874.1|1366583_1367354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349873.1|1367462_1367726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035435892.1|1368635_1368926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349870.1|1368941_1369250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349869.1|1370140_1370647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349868.1|1370669_1371092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086031759.1|1371188_1372409_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.7	5.6e-96
>prophage 12
NZ_CP045034	Lactobacillus fermentum strain USM 8633 chromosome, complete genome	2238401	1376128	1425719	2238401	transposase,holin,integrase	Paenibacillus_phage(29.17%)	46	1402489:1402502	1419858:1419871
WP_086031761.1|1376128_1377349_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	8.1e-95
WP_035435959.1|1380463_1381372_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	2.3e-22
WP_080650600.1|1381433_1382600_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012391429.1|1383618_1384839_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
WP_035436083.1|1384962_1385529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086031764.1|1385969_1386584_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	38.0	1.6e-27
WP_154244364.1|1386520_1387426_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_041812692.1|1388081_1388960_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	5.2e-43
WP_086031766.1|1388983_1389271_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_086031761.1|1389357_1390578_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	8.1e-95
WP_035437662.1|1391706_1392057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035437660.1|1392056_1392356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035437658.1|1392528_1392885_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_003586674.1|1392884_1393163_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_012391086.1|1393297_1393987_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	52.2	2.5e-61
WP_051132389.1|1394083_1394419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086031759.1|1395606_1396827_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.7	5.6e-96
WP_086031768.1|1396930_1397854_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.7	6.2e-31
WP_086031769.1|1397947_1399087_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	3.0e-43
WP_003577309.1|1399357_1401196_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	27.3	1.2e-41
WP_085776374.1|1401469_1402399_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.6	1.0e-20
1402489:1402502	attL	GGGGGATTTTTATT	NA	NA	NA	NA
WP_050755181.1|1402594_1403215_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.9	7.4e-28
WP_107760586.1|1403202_1404087_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016511784.1|1404382_1405756_-	MFS transporter	NA	NA	NA	NA	NA
WP_016511783.1|1405795_1407325_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003576326.1|1407451_1407643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085776373.1|1407721_1408651_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.6	5.0e-20
WP_016511790.1|1408779_1410144_-	peroxidase	NA	NA	NA	NA	NA
WP_033609856.1|1410275_1410650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080487858.1|1410643_1411431_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016511417.1|1411620_1411725_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_050755181.1|1412593_1413214_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.9	7.4e-28
WP_107760586.1|1413201_1414086_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_154244365.1|1414117_1414549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086031770.1|1414656_1415241_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	33.3	9.1e-20
WP_035437723.1|1415289_1416153_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	35.7	2.5e-26
WP_035437721.1|1416154_1417015_+	multidrug ABC transporter permease	NA	NA	NA	NA	NA
WP_086031771.1|1417390_1418314_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	1.6e-31
WP_154244366.1|1418706_1419801_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	53.8	2.4e-106
WP_035435907.1|1419898_1420426_-	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	71.4	2.0e-58
1419858:1419871	attR	GGGGGATTTTTATT	NA	NA	NA	NA
WP_035435905.1|1420668_1421430_-	DUF4393 domain-containing protein	NA	E9LUL1	Lactobacillus_phage	94.1	8.3e-130
WP_051132355.1|1421626_1422181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035435902.1|1422230_1422656_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	36.4	2.4e-17
WP_042513835.1|1423087_1424446_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080650595.1|1424574_1425381_-	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	59.1	1.0e-85
WP_035435767.1|1425398_1425719_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	56.0	5.1e-25
>prophage 13
NZ_CP045034	Lactobacillus fermentum strain USM 8633 chromosome, complete genome	2238401	1434095	1550552	2238401	transposase,terminase,tRNA,protease	Staphylococcus_phage(16.22%)	103	NA	NA
WP_086031772.1|1434095_1435028_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	1.1e-27
WP_023465590.1|1435079_1435283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035436107.1|1435266_1435773_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_021349255.1|1436926_1437133_-	CsbD family protein	NA	NA	NA	NA	NA
WP_021349253.1|1437719_1438109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035435989.1|1438163_1438646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035426089.1|1438675_1439107_+|terminase	terminase small subunit	terminase	A0A0A1ENP4	Lactobacillus_phage	57.2	8.7e-36
WP_021349740.1|1439093_1439255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048340500.1|1439516_1440395_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	1.5e-42
WP_003688751.1|1440418_1440706_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145998185.1|1440926_1441310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513837.1|1441415_1442348_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.4	5.5e-27
WP_035435948.1|1443518_1444898_+	MFS transporter	NA	NA	NA	NA	NA
WP_021349248.1|1444894_1445818_+	ferrochelatase	NA	NA	NA	NA	NA
WP_021353718.1|1446044_1447043_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	3.8e-50
WP_048340502.1|1447133_1448420_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_014562466.1|1448575_1449574_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_086031773.1|1451039_1452227_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_010625596.1|1452893_1453382_+	histidine kinase	NA	NA	NA	NA	NA
WP_086031761.1|1453716_1454937_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	8.1e-95
WP_021349110.1|1456141_1456876_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_015638801.1|1456868_1458386_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_003685238.1|1458386_1459193_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_021349108.1|1459445_1460615_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003685235.1|1461084_1461711_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	52.9	6.6e-16
WP_012391088.1|1461866_1462118_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003685231.1|1462194_1462422_+	YneF family protein	NA	NA	NA	NA	NA
WP_003685229.1|1462489_1463122_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_035436535.1|1463217_1463970_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003681959.1|1463962_1464253_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003681957.1|1464406_1465186_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003681955.1|1465276_1466155_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_003681954.1|1466235_1466961_+	UMP kinase	NA	NA	NA	NA	NA
WP_024500830.1|1466957_1467521_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003681952.1|1467647_1468421_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	34.6	1.1e-17
WP_003681950.1|1468437_1469226_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_035436539.1|1469247_1470519_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_015638806.1|1470552_1472274_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	25.9	1.8e-07
WP_024500831.1|1472413_1476757_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	35.3	1.7e-14
WP_014562308.1|1476879_1478031_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	1.5e-21
WP_035436544.1|1478043_1478790_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_003685208.1|1478799_1480002_-	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_003685206.1|1480028_1481054_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_035436547.1|1481298_1482369_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_021349106.1|1482361_1485451_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_003681934.1|1485603_1486083_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003685200.1|1486102_1487329_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_021349105.1|1487365_1487668_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003681928.1|1487660_1487984_+	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_021349104.1|1487988_1490316_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	4.3e-20
WP_003685195.1|1490328_1490691_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_021349103.1|1490760_1491657_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003681923.1|1491667_1492633_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_035436554.1|1492747_1494136_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_080965014.1|1494254_1494953_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	31.3	1.5e-21
WP_080964987.1|1494889_1495798_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.6	3.2e-11
WP_042513934.1|1495950_1496406_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	1.8e-31
WP_014562705.1|1496875_1498063_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_048340463.1|1498194_1499073_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	1.2e-42
WP_003688751.1|1499096_1499384_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_021350231.1|1500880_1502218_-	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_021350232.1|1502226_1503921_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_021350233.1|1504078_1505065_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_080650633.1|1506003_1506513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350236.1|1506493_1506811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562320.1|1506963_1508136_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003685173.1|1509797_1510763_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_021349142.1|1511153_1511474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003685171.1|1513121_1513475_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_021349145.1|1513487_1514069_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_080964989.1|1514169_1514883_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.7	5.0e-28
WP_041812698.1|1515361_1515649_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048340505.1|1515672_1516551_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	5.2e-43
WP_086031844.1|1516607_1516727_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_035436004.1|1516789_1519057_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.7	1.1e-124
WP_086031774.1|1519111_1520044_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	1.9e-27
WP_021353998.1|1520159_1521137_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003681906.1|1521989_1522355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681905.1|1522480_1523527_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003681903.1|1523537_1524125_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_014562323.1|1524162_1526019_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	45.4	9.3e-135
WP_003681899.1|1526130_1527291_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.0	4.8e-20
WP_021349426.1|1529029_1529347_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_003681874.1|1529348_1529669_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_021349425.1|1529681_1530767_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	23.5	2.9e-11
WP_003685127.1|1530834_1532667_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.1	2.5e-23
WP_003681865.1|1533179_1533683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349422.1|1533718_1534342_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	31.3	8.5e-08
WP_021349421.1|1534436_1535456_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_015638841.1|1535715_1536789_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	48.2	5.3e-90
WP_021349420.1|1536800_1537976_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	41.2	1.1e-88
WP_003681857.1|1538115_1539867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349418.1|1539904_1540360_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_021349417.1|1540520_1540991_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.9	6.8e-26
WP_021349416.1|1540983_1542177_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	6.5e-97
WP_003681853.1|1542163_1542772_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.1	4.7e-27
WP_021349415.1|1542771_1543830_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.5	1.3e-40
WP_021349414.1|1544239_1544725_-	flavodoxin	NA	NA	NA	NA	NA
WP_035436973.1|1544785_1545820_-	HAMP domain-containing histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	26.0	7.0e-07
WP_021349411.1|1545812_1546364_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024500857.1|1547307_1548480_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_041812577.1|1548770_1549223_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.1e-32
WP_048340507.1|1549301_1550552_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	36.8	7.6e-56
>prophage 14
NZ_CP045034	Lactobacillus fermentum strain USM 8633 chromosome, complete genome	2238401	1613391	1730552	2238401	transposase,capsid,tRNA,integrase	Streptococcus_phage(12.5%)	109	1633648:1633666	1694172:1694186
WP_003681718.1|1613391_1614366_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_021349547.1|1614365_1616444_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_021349546.1|1616595_1618491_+	DNA primase	NA	A0A1S5RFD7	Helicobacter_phage	32.1	3.3e-42
WP_003681711.1|1618490_1619633_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	36.6	1.9e-37
WP_003681709.1|1619839_1620034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042513964.1|1620093_1620936_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.6	9.7e-156
WP_012391066.1|1620989_1621241_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	4.6e-37
WP_021349446.1|1621536_1622097_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003681705.1|1622108_1622294_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_003681703.1|1622321_1622864_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003681701.1|1622878_1623130_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003681696.1|1623141_1623282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042513968.1|1623499_1624183_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.2	1.6e-31
WP_014562363.1|1624376_1625663_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003683258.1|1625895_1626807_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_035437742.1|1627009_1628017_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_003683256.1|1628029_1629388_-	aspartate kinase	NA	NA	NA	NA	NA
WP_003683241.1|1629859_1631179_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_003683238.1|1631203_1631917_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_015638911.1|1631916_1633071_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_003683233.1|1633073_1634009_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
1633648:1633666	attL	ACGCCCAGGCCCTGACCAC	NA	NA	NA	NA
WP_021350307.1|1634001_1634781_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
1633648:1633666	attL	ACGCCCAGGCCCTGACCAC	NA	NA	NA	NA
WP_021350308.1|1634805_1635990_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003683228.1|1636004_1637057_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003683224.1|1637192_1638533_+	ATPase	NA	NA	NA	NA	NA
WP_003683222.1|1638525_1639200_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_035437740.1|1639208_1639910_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_035437738.1|1639902_1640724_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_035437736.1|1640743_1641985_+	peptidase T	NA	NA	NA	NA	NA
WP_003683213.1|1642056_1642284_-	DUF2929 family protein	NA	NA	NA	NA	NA
WP_035437734.1|1642374_1645674_+	DNA polymerase III subunit alpha	NA	A0A0K1Y9G6	Streptomyces_phage	32.2	2.2e-142
WP_003684953.1|1645812_1647234_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_021349849.1|1647389_1648277_+	S1 RNA-binding protein	NA	NA	NA	NA	NA
WP_015638921.1|1648269_1649148_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142K830	Mycobacterium_phage	29.1	6.4e-09
WP_003684947.1|1649128_1649512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683203.1|1649504_1650293_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	27.5	1.2e-11
WP_003683201.1|1650270_1650858_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	30.7	7.5e-14
WP_003683200.1|1650858_1651584_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_021349848.1|1651855_1652434_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_031284577.1|1652633_1653698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683188.1|1653687_1655145_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	38.7	6.8e-56
WP_003683187.1|1655205_1655760_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003683185.1|1655783_1656464_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_003683184.1|1656540_1657773_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_024500900.1|1657850_1659164_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_003683180.1|1659387_1659663_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	3.4e-25
WP_003684932.1|1659741_1661004_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
1660502:1660520	attR	ACGCCCAGGCCCTGACCAC	NA	NA	NA	NA
WP_003683175.1|1661117_1661975_-	recombinase XerD	NA	NA	NA	NA	NA
1660502:1660520	attR	ACGCCCAGGCCCTGACCAC	NA	NA	NA	NA
WP_021350295.1|1662140_1663343_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	48.6	3.4e-45
WP_015638927.1|1663355_1665242_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.0	2.9e-51
WP_003683168.1|1665307_1666267_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	63.4	9.1e-118
WP_003683166.1|1666278_1666782_+	dihydrofolate reductase	NA	A0A223LJP4	Erwinia_phage	37.8	5.6e-18
WP_003684928.1|1666761_1667391_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_021350296.1|1667557_1668400_+	DegV family protein	NA	NA	NA	NA	NA
WP_003683161.1|1668533_1669712_-	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	36.8	8.7e-62
WP_003683159.1|1669781_1670408_+	chloramphenicol acetyltransferase	NA	NA	NA	NA	NA
WP_003683158.1|1670538_1671456_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003683157.1|1671459_1672053_+	YpmS family protein	NA	NA	NA	NA	NA
WP_003683156.1|1672062_1672287_+	YozE family protein	NA	NA	NA	NA	NA
WP_014562705.1|1672756_1673944_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_003678463.1|1674102_1674366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003678461.1|1674437_1674797_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	42.3	8.1e-19
WP_003678459.1|1674783_1675146_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_012391429.1|1675191_1676412_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
WP_042513852.1|1676563_1678294_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_012391429.1|1679635_1680856_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
WP_003678450.1|1681173_1681542_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021349960.1|1681543_1682158_+	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_003678446.1|1682182_1682737_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	44.3	6.0e-05
WP_021349958.1|1683170_1684391_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	38.9	3.8e-76
WP_021349957.1|1684510_1684762_+	hypothetical protein	NA	W6LM55	Streptococcus_phage	43.3	4.5e-08
WP_035436401.1|1684850_1686110_+|integrase	site-specific integrase	integrase	A0A1S5S9U4	Streptococcus_phage	26.6	4.1e-25
WP_014562383.1|1686246_1687119_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_024500903.1|1687111_1687882_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	35.2	1.4e-20
WP_024500904.1|1687934_1688810_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_035428782.1|1688892_1691025_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.2	6.8e-97
WP_015638933.1|1691153_1691996_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_003683143.1|1692011_1692890_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003683142.1|1692957_1693569_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003683141.1|1693800_1695798_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.2	7.5e-122
WP_035436398.1|1695814_1698283_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.9	1.9e-98
WP_003683135.1|1698348_1698864_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_003683133.1|1698974_1699907_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_003683131.1|1700091_1700493_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003683130.1|1700502_1700928_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003684903.1|1701080_1701590_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024271696.1|1701582_1702038_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_023466126.1|1702194_1703553_+	cytosine permease	NA	NA	NA	NA	NA
WP_024500909.1|1703555_1704794_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_014562388.1|1704956_1706666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562389.1|1706761_1707133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035436395.1|1707147_1708494_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	43.1	3.1e-87
WP_021349896.1|1708490_1709171_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_014562392.1|1709757_1711107_+	MFS transporter	NA	NA	NA	NA	NA
WP_035436393.1|1711233_1711437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015638951.1|1711593_1711884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349899.1|1713726_1714953_+	NAD/NADP octopine/nopaline dehydrogenase	NA	NA	NA	NA	NA
WP_021349900.1|1714952_1715717_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_035436390.1|1715769_1717248_-	amino acid permease	NA	NA	NA	NA	NA
WP_021349902.1|1717405_1718437_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_031284600.1|1719074_1719716_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_021349904.1|1719829_1720396_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_035436387.1|1721530_1722883_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_086031776.1|1722964_1724101_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	3.0e-43
WP_021349906.1|1724281_1724839_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_154244368.1|1726681_1727749_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_014562398.1|1727760_1728897_+	aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	24.3	2.0e-10
WP_003683063.1|1729437_1729647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349962.1|1729655_1730552_+|capsid	phage capsid protein	capsid	U3PFU0	Lactobacillus_phage	46.8	2.3e-62
>prophage 15
NZ_CP045034	Lactobacillus fermentum strain USM 8633 chromosome, complete genome	2238401	1741666	1810991	2238401	transposase,integrase	Lactobacillus_phage(20.0%)	60	1755272:1755289	1784385:1784402
WP_048340509.1|1741666_1742830_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	70.9	9.9e-159
WP_035437536.1|1743784_1744837_+	2,3-butanediol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	25.9	6.1e-14
WP_021350180.1|1744929_1745889_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_003684840.1|1745904_1746534_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_035437538.1|1746530_1747298_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	4.4e-22
WP_003683036.1|1747278_1747923_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003684836.1|1748073_1748976_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015638987.1|1749117_1749567_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003683030.1|1749604_1750030_-	OsmC family protein	NA	NA	NA	NA	NA
WP_021350184.1|1750029_1750566_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021349692.1|1753934_1754414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051132356.1|1754417_1754852_-	MFS transporter	NA	NA	NA	NA	NA
1755272:1755289	attL	CCTTTTTAACGGCGTCGT	NA	NA	NA	NA
WP_080650599.1|1757193_1757625_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042513914.1|1757801_1759088_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_086031777.1|1759247_1759712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086031761.1|1759777_1760998_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	8.1e-95
WP_086031778.1|1761012_1761465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349509.1|1761656_1762664_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.3	5.2e-15
WP_107504380.1|1762721_1763663_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	8.0e-34
WP_048340510.1|1764296_1765517_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	1.6e-95
WP_086031779.1|1765531_1766125_-	DUF3737 family protein	NA	NA	NA	NA	NA
WP_048340512.1|1766980_1767595_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	38.0	7.3e-28
WP_086031781.1|1767922_1768846_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.7e-33
WP_021349264.1|1768972_1769593_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	35.3	3.0e-21
WP_035435926.1|1769889_1770669_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021349259.1|1772668_1772836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003688751.1|1773081_1773369_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021349454.1|1775347_1775731_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003683002.1|1775765_1776587_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_014562409.1|1776596_1778021_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.5	1.4e-69
WP_003683000.1|1778068_1779262_+	MFS transporter	NA	NA	NA	NA	NA
WP_024500926.1|1779492_1780563_+	NAD(P)-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.9	3.0e-08
WP_014562411.1|1780784_1781927_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_012391259.1|1781939_1782851_-	PLP-dependent cysteine synthase family protein	NA	A0A1X9I5K7	Streptococcus_phage	40.8	5.4e-59
WP_003682996.1|1783192_1783459_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_021349455.1|1783468_1784812_+	PFL family protein	NA	NA	NA	NA	NA
1784385:1784402	attR	ACGACGCCGTTAAAAAGG	NA	NA	NA	NA
WP_012391261.1|1785002_1785959_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_003682992.1|1786015_1786408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349457.1|1786629_1786830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003684379.1|1788017_1789043_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.6	1.7e-45
WP_003682985.1|1789141_1789324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024500933.1|1789634_1789997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014562416.1|1790070_1790988_-	EamA family transporter	NA	NA	NA	NA	NA
WP_021349460.1|1791230_1791815_+	DUF4352 domain-containing protein	NA	A0A0P0IXE0	Lactobacillus_phage	63.2	1.1e-41
WP_021349461.1|1791921_1793775_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	62.5	3.0e-218
WP_021349462.1|1793891_1794827_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	42.9	7.4e-64
WP_003682978.1|1794923_1795781_+	patatin family protein	NA	NA	NA	NA	NA
WP_021349464.1|1795875_1797048_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_014562422.1|1797057_1798158_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_021349465.1|1798237_1798978_+	sulfite exporter TauE/SafE family protein	NA	Q6EVM7	Oenoccocus_phage	39.8	1.4e-46
WP_003682974.1|1799171_1799669_-	hypothetical protein	NA	A0A291I9Q0	Lactobacillus_phage	54.3	3.1e-45
WP_003682973.1|1799681_1800734_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003682972.1|1800730_1801930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682969.1|1802129_1802987_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_035437128.1|1803125_1805474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014562426.1|1805860_1806748_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003682964.1|1806838_1807726_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_024500941.1|1807800_1809171_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003682959.1|1809170_1809902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048340515.1|1809965_1810991_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.6	1.3e-45
>prophage 16
NZ_CP045034	Lactobacillus fermentum strain USM 8633 chromosome, complete genome	2238401	1818070	1863069	2238401	transposase,integrase	Lactobacillus_phage(37.5%)	41	1859882:1859918	1867873:1867909
WP_021353998.1|1818070_1819048_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_024271972.1|1819085_1819523_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.2	1.2e-24
WP_024271971.1|1819528_1820071_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024271970.1|1820162_1820696_-	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_003682943.1|1820844_1821117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349991.1|1821257_1822373_-	membrane protein	NA	NA	NA	NA	NA
WP_003682939.1|1822852_1823683_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021349990.1|1823877_1825251_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_021349989.1|1825618_1826803_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_035437463.1|1826978_1828310_-	guanine deaminase	NA	NA	NA	NA	NA
WP_004563085.1|1828431_1829583_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_138464718.1|1830001_1830313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349985.1|1830492_1830909_-	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	35.8	1.5e-13
WP_024271969.1|1831659_1832088_-	NADH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003688751.1|1832355_1832643_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048340463.1|1832666_1833545_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	1.2e-42
WP_003682913.1|1834082_1834850_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_035437564.1|1835828_1837511_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_035437566.1|1837995_1839720_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_023465823.1|1839815_1840568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015639076.1|1840750_1841311_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_107760586.1|1841543_1842428_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_050755181.1|1842415_1843036_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.9	7.4e-28
WP_021349699.1|1843218_1843938_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_035435887.1|1844463_1846383_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_021349211.1|1846553_1847267_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_021349212.1|1847277_1848939_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_080650636.1|1850906_1852124_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_021350120.1|1852083_1852230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003683569.1|1852744_1853077_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	40.9	3.0e-12
WP_004563102.1|1853073_1853439_-	CrcB family protein	NA	NA	NA	NA	NA
WP_012391304.1|1853526_1853955_+	glyoxalase	NA	NA	NA	NA	NA
WP_003683563.1|1854029_1854587_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003683557.1|1856644_1857343_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021350118.1|1857631_1858549_-	ROK family protein	NA	NA	NA	NA	NA
WP_021350117.1|1858620_1858896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350116.1|1858922_1859381_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
1859882:1859918	attL	GCCCTACTTAGGCACTAGGTCTAATGCCCTACTTAGG	NA	NA	NA	NA
WP_042513877.1|1860000_1860843_-|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	45.4	3.9e-64
WP_003688751.1|1860912_1861200_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012391066.1|1861921_1862173_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	4.6e-37
WP_042513964.1|1862226_1863069_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.6	9.7e-156
1867873:1867909	attR	GCCCTACTTAGGCACTAGGTCTAATGCCCTACTTAGG	NA	NA	NA	NA
>prophage 17
NZ_CP045034	Lactobacillus fermentum strain USM 8633 chromosome, complete genome	2238401	1967298	2085893	2238401	transposase,tRNA	Paenibacillus_phage(22.73%)	96	NA	NA
WP_012391429.1|1967298_1968519_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
WP_003683348.1|1969469_1969796_-	branched-chain amino acid transporter AzlD	NA	NA	NA	NA	NA
WP_035431068.1|1970499_1972008_-	threonine synthase	NA	NA	NA	NA	NA
WP_014562494.1|1972122_1973400_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_003683341.1|1973409_1974270_+	homoserine kinase	NA	NA	NA	NA	NA
WP_004563200.1|1974501_1975026_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021350288.1|1975126_1975768_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003683335.1|1975890_1976547_+	HD domain-containing protein	NA	A0A1S5V2G8	Saudi_moumouvirus	27.9	2.2e-06
WP_021350289.1|1976543_1977287_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_024500995.1|1977554_1978166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004563204.1|1978162_1979041_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	38.2	1.2e-15
WP_035436699.1|1979231_1980938_+	fibronectin/fibrinogen-binding protein	NA	M1I5P2	Paramecium_bursaria_Chlorella_virus	35.2	3.3e-09
WP_048340520.1|1981092_1982343_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.2	9.0e-57
WP_042513997.1|1982637_1983795_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.8	3.6e-36
WP_003617037.1|1983939_1984575_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_003683319.1|1984767_1987272_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_035437492.1|1987273_1988356_-	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_046947974.1|1988385_1989261_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_021350105.1|1989301_1989739_-	signal peptidase II	NA	NA	NA	NA	NA
WP_035437494.1|1989738_1990173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003683308.1|1990185_1990587_+	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_004563210.1|1990742_1991345_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003683304.1|1991568_1992432_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012391396.1|1992645_1993335_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_080650635.1|1993421_1994120_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003688751.1|1994241_1994529_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_151130343.1|1995414_1996263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051132368.1|1996968_1998447_+	amidase	NA	NA	NA	NA	NA
WP_024501009.1|1999659_2000793_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_003683293.1|2000835_2001285_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_021349973.1|2001288_2002470_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_035436886.1|2002577_2004512_-	GTP-binding protein	NA	D0R0F5	Streptococcus_phage	28.6	5.3e-64
WP_003683290.1|2005045_2005414_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_024501011.1|2005512_2006109_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_021349975.1|2006200_2006836_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	36.6	1.1e-23
WP_154244370.1|2006828_2009093_+	carboxypeptidase	NA	NA	NA	NA	NA
WP_004563221.1|2009207_2010119_-	EamA family transporter	NA	NA	NA	NA	NA
WP_014562510.1|2010241_2011261_+	glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_003683271.1|2011452_2012460_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_035436895.1|2012559_2013288_-	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	37.1	3.5e-13
WP_004563225.1|2013379_2014675_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.2	7.4e-54
WP_004563226.1|2014701_2015220_-	peptidase	NA	NA	NA	NA	NA
WP_004563227.1|2015270_2018111_-	hypothetical protein	NA	A0A1X9I5C8	Streptococcus_phage	34.6	3.6e-61
WP_003683265.1|2018339_2019275_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_035436899.1|2019276_2020266_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_003683263.1|2020285_2021395_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_003683262.1|2021450_2022536_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_035436902.1|2022692_2023451_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	1.8e-12
WP_154244371.1|2023646_2024897_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.4e-57
WP_035435997.1|2025478_2026852_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_154244372.1|2026979_2027786_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_086031786.1|2028007_2028505_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_151130348.1|2029458_2030301_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.1	1.6e-41
WP_086031788.1|2030361_2030649_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_086031789.1|2030867_2031482_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.5	4.0e-26
WP_086031790.1|2032280_2032730_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	34.1	4.1e-12
WP_086031791.1|2032692_2033634_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.2	1.7e-12
WP_035435979.1|2033716_2034823_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003606447.1|2036195_2036444_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_048340531.1|2036518_2037739_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	1.4e-94
WP_086031734.1|2042414_2043347_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	8.5e-28
WP_086031793.1|2043388_2043616_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035437581.1|2043792_2045565_-	oleate hydratase	NA	NA	NA	NA	NA
WP_035437582.1|2046052_2047384_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_035437584.1|2048062_2049802_+	pyruvate oxidase	NA	NA	NA	NA	NA
WP_035437501.1|2052229_2053147_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_086031794.1|2053159_2056339_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_024501023.1|2056338_2057421_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.6	1.9e-55
WP_024501024.1|2057422_2058712_-	dihydroorotase	NA	NA	NA	NA	NA
WP_035437505.1|2058711_2059677_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	30.5	5.9e-24
WP_035437507.1|2060012_2060807_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_086031795.1|2061374_2062688_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_035436293.1|2062740_2063706_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	28.7	4.4e-19
WP_035436289.1|2063945_2064491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035436286.1|2064677_2064806_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_035436283.1|2064832_2064997_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_035436280.1|2064996_2065314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154244373.1|2065563_2065722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154244374.1|2065769_2065934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035436277.1|2067740_2068292_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_035436274.1|2068303_2069704_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_035436271.1|2069829_2070726_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035436269.1|2070770_2071190_-	amino acid decarboxylase	NA	NA	NA	NA	NA
WP_154244375.1|2071209_2071377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035436266.1|2071650_2072130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035436263.1|2073721_2074600_-	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_015639203.1|2074603_2075542_-	type I-E CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_015639204.1|2075538_2076195_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_035436299.1|2076207_2076915_-	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_086031797.1|2076895_2077993_-	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_035436257.1|2078004_2078589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035436252.1|2078605_2080264_-	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
WP_035436249.1|2080244_2082986_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_003683897.1|2083216_2083576_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_024501037.1|2083696_2085124_-	amino acid permease	NA	NA	NA	NA	NA
WP_003683893.1|2085134_2085893_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
