The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040440	Stenotrophomonas maltophilia strain ICU331 chromosome, complete genome	4995994	223970	313425	4995994	transposase,plate,terminase,tail,tRNA,holin,portal,head,integrase,capsid	Stenotrophomonas_phage(69.77%)	98	246639:246668	299394:299423
WP_049396168.1|223970_224915_-|transposase	IS481-like element ISStma12 family transposase	transposase	NA	NA	NA	NA
WP_049397256.1|225155_226601_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_049395828.1|226902_227760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012478798.1|227803_228475_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033836032.1|228471_229572_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_024956224.1|230204_232607_+	ribonucleoside-diphosphate reductase subunit alpha	NA	M4QQR4	Ostreococcus_lucimarinus_virus	44.4	2.2e-181
WP_005407669.1|232750_233770_+	ribonucleotide-diphosphate reductase subunit beta	NA	R4ZDG8	Choristoneura_biennis_entomopoxvirus	34.6	1.3e-45
WP_012478801.1|234012_234393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012478802.1|234432_235068_-	LysE family translocator	NA	NA	NA	NA	NA
WP_005407672.1|235220_235622_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_012478803.1|235677_236493_+	NAD-dependent protein deacetylase	NA	S5M4R0	Bacillus_phage	22.9	2.3e-13
WP_005411935.1|236614_237715_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_012478804.1|237718_238630_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005411937.1|238744_239596_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	40.2	9.9e-15
WP_005411938.1|239883_240510_-	bifunctional nicotinamidase/pyrazinamidase	NA	NA	NA	NA	NA
WP_032963135.1|240565_241237_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_049395833.1|241726_243136_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.9	1.2e-129
WP_086016255.1|243200_244256_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	44.7	7.8e-78
WP_005407681.1|244443_246336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154344293.1|246329_246476_-	hypothetical protein	NA	NA	NA	NA	NA
246639:246668	attL	AGGTTGCCGGCCAGCGGCCGGCACTACCGC	NA	NA	NA	NA
WP_012478808.1|246699_248067_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_012478809.1|248182_249688_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005407684.1|249702_250869_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005407685.1|250865_251663_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_012478810.1|251659_252835_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_005407687.1|252831_253722_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_004153735.1|253870_254296_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_005407688.1|254407_255388_-	cation diffusion facilitator transporter	NA	NA	NA	NA	NA
WP_012478812.1|255467_255671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012478814.1|255966_257748_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_012478815.1|257790_258222_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_099540251.1|258612_258822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049449397.1|258937_259159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099540247.1|259424_260339_-	DNA cytosine methyltransferase	NA	Q38204	Halobacterium_phage	33.2	1.7e-17
WP_099540245.1|260335_261124_-	hypothetical protein	NA	A0A0E3M3Z6	Verrucomicrobia_phage	37.5	1.6e-35
WP_125895198.1|261116_261512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099527579.1|261504_261690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087786709.1|261682_262108_-	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	87.2	1.0e-57
WP_154344294.1|262193_264884_-	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	96.4	0.0e+00
WP_033833483.1|264992_265238_-	hypothetical protein	NA	V9IQH4	Stenotrophomonas_phage	96.3	1.1e-35
WP_154344295.1|265237_265546_-	hypothetical protein	NA	V9IQM8	Stenotrophomonas_phage	64.1	1.8e-27
WP_154344458.1|265545_265788_-	hypothetical protein	NA	V9IQX5	Stenotrophomonas_phage	71.2	6.6e-25
WP_071306434.1|266114_266321_-	hypothetical protein	NA	V9IQL4	Stenotrophomonas_phage	85.3	2.8e-24
WP_154344296.1|266389_266731_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	66.4	5.6e-38
WP_100053249.1|266727_267045_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_154344459.1|267175_267547_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_154344297.1|268056_269073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154344298.1|269148_270144_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	72.3	2.8e-125
WP_154344299.1|270140_270539_-	oxidoreductase	NA	V9IQX3	Stenotrophomonas_phage	84.8	2.2e-57
WP_154344300.1|270550_273760_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	63.1	3.9e-290
WP_154344301.1|273932_274049_-|tail	GpE family phage tail protein	tail	V9IQH2	Stenotrophomonas_phage	78.4	1.1e-06
WP_154344302.1|274057_274396_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	56.5	1.4e-25
WP_049395235.1|274452_274962_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	86.4	2.8e-81
WP_049395236.1|274984_276157_-|tail	phage tail sheath protein	tail	V9IQK9	Stenotrophomonas_phage	78.1	4.2e-149
WP_154344303.1|276172_276532_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	77.3	2.4e-47
WP_154344304.1|276528_277095_-|plate	phage baseplate assembly protein V	plate	V9IQH1	Stenotrophomonas_phage	67.9	1.1e-41
WP_154344305.1|277201_277783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154344306.1|281023_281575_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	66.7	1.8e-70
WP_154344307.1|281567_282458_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	80.7	1.8e-131
WP_154344308.1|282544_283006_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	77.1	1.5e-57
WP_154344309.1|283002_283488_-|tail	phage tail protein	tail	V9IQM0	Stenotrophomonas_phage	59.6	3.7e-43
WP_154344310.1|283484_284006_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	52.6	7.1e-32
WP_154344460.1|284005_284611_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	77.8	4.8e-64
WP_010481666.1|284642_284918_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	81.3	6.8e-34
WP_033833603.1|284910_285264_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	82.1	2.2e-45
WP_033833604.1|285266_285482_-|tail	tail protein	tail	V9IQL8	Stenotrophomonas_phage	69.0	9.7e-20
WP_154344311.1|285481_285949_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	74.8	1.7e-56
WP_154344312.1|286053_286761_-|terminase	terminase	terminase	V9IQK3	Stenotrophomonas_phage	67.3	1.5e-56
WP_154344313.1|286765_287815_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	64.7	2.5e-124
WP_154344314.1|287848_288763_-|capsid	phage capsid protein	capsid	V9IQG8	Stenotrophomonas_phage	63.2	5.5e-72
WP_154344315.1|288830_290624_+|terminase	terminase	terminase	V9IQL5	Stenotrophomonas_phage	94.0	0.0e+00
WP_154344316.1|290623_291634_+|portal	phage portal protein	portal	V9IQW4	Stenotrophomonas_phage	82.9	8.3e-154
WP_154344317.1|291712_292294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154344318.1|292966_293377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125895207.1|293477_294002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049449473.1|293970_295071_-|integrase	site-specific integrase	integrase	A0A248XD46	Klebsiella_phage	34.8	1.9e-55
WP_154344319.1|295196_296192_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005407693.1|296405_296780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004136763.1|296853_297537_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_032953760.1|297562_298987_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_099470490.1|299587_300379_-	zinc-dependent peptidase	NA	NA	NA	NA	NA
299394:299423	attR	AGGTTGCCGGCCAGCGGCCGGCACTACCGC	NA	NA	NA	NA
WP_044569378.1|300345_300624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012478821.1|300764_301733_+	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_005407698.1|301729_302461_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_012478822.1|302470_303319_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_012478868.1|303519_304644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012478869.1|304671_305271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154344320.1|305504_305792_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	44.2	8.4e-19
WP_012478871.1|305850_306153_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	39.3	1.9e-08
WP_012478872.1|306210_306534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044569408.1|306613_307021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012478874.1|307614_308385_+	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_012478875.1|308444_309389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005407709.1|309493_310414_+	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	33.6	6.4e-28
WP_005407710.1|310574_310712_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_004153772.1|310919_311141_+	CsbD family protein	NA	NA	NA	NA	NA
WP_012478876.1|311214_312024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049395252.1|312132_313425_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP040440	Stenotrophomonas maltophilia strain ICU331 chromosome, complete genome	4995994	615312	622719	4995994		Enterobacteria_phage(42.86%)	7	NA	NA
WP_033835594.1|615312_616368_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	45.9	2.0e-78
WP_049397553.1|616382_617270_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	60.3	1.1e-98
WP_033835936.1|617266_617824_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.1	9.2e-46
WP_049397554.1|617820_618714_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.6	2.1e-28
WP_049397555.1|618766_620170_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.4	5.5e-47
WP_049397556.1|620181_621528_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	1.0e-29
WP_049397557.1|621762_622719_+	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	48.1	5.8e-88
>prophage 3
NZ_CP040440	Stenotrophomonas maltophilia strain ICU331 chromosome, complete genome	4995994	992252	1012118	4995994	tail,head	Rhizobium_phage(38.46%)	29	NA	NA
WP_152905628.1|992252_994397_-	hypothetical protein	NA	L7TLW2	Rhizobium_phage	31.5	2.8e-66
WP_049397858.1|994384_994975_-	hypothetical protein	NA	A0A2R2ZGD2	Ralstonia_phage	41.9	7.8e-27
WP_049397857.1|995074_996028_-	hypothetical protein	NA	L7TJ83	Rhizobium_phage	42.4	5.4e-62
WP_049397856.1|996054_996840_-	hypothetical protein	NA	A0A1B1IVZ8	uncultured_Mediterranean_phage	31.1	6.5e-21
WP_004154577.1|996839_996983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412405.1|996999_998556_-|head,tail	phage collar / T7-like phage head-to-tail joining protein	head,tail	L7TJ79	Rhizobium_phage	37.6	1.1e-85
WP_005412406.1|998548_998701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004154580.1|998721_998901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004154581.1|998965_999502_-	adenylate kinase	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	46.1	1.4e-30
WP_049458784.1|999597_999915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049397854.1|999918_1000125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004154583.1|1000112_1000946_-	hypothetical protein	NA	M1HMA9	Pelagibacter_phage	36.0	2.0e-36
WP_004154584.1|1000942_1001092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049397853.1|1001088_1001379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004154585.1|1001375_1001624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049397852.1|1001774_1002140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050483582.1|1002136_1002475_-	hypothetical protein	NA	A0A2H4P845	Pseudomonas_phage	53.2	9.6e-22
WP_065427651.1|1002456_1004331_-	DNA polymerase	NA	A0A076YNV1	Mesorhizobium_phage	47.9	1.4e-159
WP_049397851.1|1004343_1004994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412417.1|1005004_1005253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049397850.1|1005418_1007050_-	toprim domain-containing protein	NA	L7TLT7	Rhizobium_phage	56.8	1.3e-151
WP_004154591.1|1007036_1007216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080354126.1|1007212_1007614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004154593.1|1007610_1007973_-	putative N-acetylmuramoyl-L-alanine amidase	NA	I6Q9Z5	Yersinia_phage	40.6	2.5e-15
WP_080354127.1|1007973_1008525_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A2I7QZP6	Vibrio_phage	31.1	1.6e-05
WP_154267700.1|1009059_1009218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049397849.1|1009217_1009502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412422.1|1009494_1009638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049397848.1|1009682_1012118_-	T3/T7 RNA polymerase	NA	L7TQW5	Rhizobium_phage	40.7	2.5e-164
>prophage 4
NZ_CP040440	Stenotrophomonas maltophilia strain ICU331 chromosome, complete genome	4995994	1049306	1158325	4995994	tail,transposase,plate,integrase	Escherichia_phage(17.86%)	98	1049260:1049280	1085045:1085065
1049260:1049280	attL	GTGGCATACTGGATGGCATAC	NA	NA	NA	NA
WP_049406765.1|1049306_1050545_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	36.2	1.0e-52
WP_049406770.1|1050783_1051695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049406762.1|1051791_1059483_+	AAA family ATPase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	30.4	1.7e-25
WP_049406759.1|1059591_1060878_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_049406757.1|1061038_1061344_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_049406754.1|1062298_1063255_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	45.3	4.6e-61
WP_049406752.1|1063327_1064314_+	endonuclease	NA	A0A139ZPJ9	Marinitoga_camini_virus	35.7	1.3e-45
WP_049406750.1|1064325_1065222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049406747.1|1065321_1065819_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_080356388.1|1066001_1067210_-	ADP-ribosylglycohydrolase family protein	NA	A0A1I9SA26	Rhodococcus_phage	27.7	1.2e-18
WP_049407026.1|1067368_1068283_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_049407025.1|1068293_1068749_+	BREX-3 system P-loop-containing protein BrxF	NA	NA	NA	NA	NA
WP_049407028.1|1068784_1072513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049407022.1|1072559_1075421_+	DNA methylase	NA	NA	NA	NA	NA
WP_049407020.1|1075423_1078252_+	helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	26.7	1.0e-47
WP_049407018.1|1078248_1080264_+	BREX-3 system phosphatase PglZ	NA	NA	NA	NA	NA
WP_049407016.1|1080260_1080983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049407014.1|1081002_1082838_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_049407010.1|1082924_1084391_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_049407008.1|1084387_1084729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049397088.1|1085359_1087411_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.4	2.1e-47
1085045:1085065	attR	GTGGCATACTGGATGGCATAC	NA	NA	NA	NA
WP_005408298.1|1087417_1087738_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_005408299.1|1087849_1088449_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_005408300.1|1088516_1088876_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_005408301.1|1088953_1089481_-	membrane protein	NA	NA	NA	NA	NA
WP_154344326.1|1089477_1091427_-	DUF3488 domain-containing protein	NA	NA	NA	NA	NA
WP_043033683.1|1091419_1092364_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_005408304.1|1092366_1093320_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012479285.1|1093362_1095204_+	membrane protein	NA	NA	NA	NA	NA
WP_012478995.1|1095289_1096234_-|transposase	IS481-like element ISStma1 family transposase	transposase	NA	NA	NA	NA
WP_012479286.1|1096462_1097032_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_049397145.1|1097145_1097655_+	characterized ACR protein	NA	NA	NA	NA	NA
WP_005408308.1|1097762_1097957_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_005408309.1|1098048_1099026_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_005408310.1|1099104_1099887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049397146.1|1100143_1101088_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_012479289.1|1101170_1101914_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	6.2e-13
WP_005408313.1|1102066_1102306_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	4.6e-10
WP_012479290.1|1102449_1103712_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_012479291.1|1103926_1105291_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_005412449.1|1105416_1106478_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_049397147.1|1106474_1107140_+	dTMP kinase	NA	W8D0J5	Erwinia_phage	34.9	5.5e-21
WP_049397148.1|1107136_1108093_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_005412452.1|1108089_1108443_+	type IV pilus biogenesis protein PilZ	NA	NA	NA	NA	NA
WP_080047683.1|1108628_1109243_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_049397149.1|1109273_1110347_-|tail	phage tail protein	tail	D5LGY1	Escherichia_phage	51.9	2.5e-95
WP_005408322.1|1110337_1110553_-|tail	phage tail protein	tail	A0A193GYC8	Enterobacter_phage	54.3	1.6e-14
WP_005408323.1|1110536_1111004_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	35.2	1.1e-15
WP_049397151.1|1111006_1113469_-|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	26.7	2.7e-12
WP_005408325.1|1113589_1113880_-|tail	phage tail assembly protein	tail	A0A088FQX2	Escherichia_phage	56.4	5.5e-18
WP_005408326.1|1113961_1114465_-|tail	phage major tail tube protein	tail	A0A193GYM4	Enterobacter_phage	54.8	5.4e-45
WP_049397152.1|1114467_1115670_-|tail	tail protein	tail	A0A088FVH5	Escherichia_phage	54.2	4.6e-127
WP_012479299.1|1115776_1116436_-	hypothetical protein	NA	V9IQM3	Stenotrophomonas_phage	32.9	6.2e-17
WP_049397153.1|1116437_1118405_-|tail	tail fiber domain-containing protein	tail	V9IQX0	Stenotrophomonas_phage	38.8	1.8e-104
WP_049397154.1|1118412_1119192_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	51.1	7.1e-44
WP_005412462.1|1119184_1120081_-|plate	baseplate assembly protein J	plate	V5YTH6	Pseudomonas_phage	56.1	1.9e-80
WP_005408332.1|1120083_1120422_-|plate	phage baseplate protein	plate	A0A193GYY8	Enterobacter_phage	62.2	7.8e-32
WP_049397155.1|1120474_1121065_-|plate	phage baseplate assembly protein V	plate	A0A193GYL5	Enterobacter_phage	37.7	1.6e-24
WP_049397157.1|1121061_1121616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134946151.1|1121733_1122063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043033664.1|1121968_1122346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412466.1|1122342_1122828_-	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	56.2	1.4e-42
WP_005408337.1|1122824_1123175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005408338.1|1123171_1123621_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043033660.1|1123955_1124339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049397158.1|1124491_1125130_-	hypothetical protein	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	37.6	4.5e-20
WP_049397160.1|1125171_1125399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049397162.1|1125473_1125749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049397165.1|1125749_1128086_-	toprim domain-containing protein	NA	D5LH15	Escherichia_phage	43.3	3.7e-136
WP_005408344.1|1128572_1128797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012479313.1|1128808_1129063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005412471.1|1129274_1129661_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_049397166.1|1129789_1131928_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_049397172.1|1131939_1133445_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_043033653.1|1133454_1134588_-	MFS transporter	NA	NA	NA	NA	NA
WP_049397173.1|1134599_1135376_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_044569588.1|1135533_1136181_+	Qnr family pentapeptide repeat protein	NA	NA	NA	NA	NA
WP_049397176.1|1136184_1136859_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_049397177.1|1136946_1137645_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_049397178.1|1137760_1138705_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049397180.1|1138643_1140023_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_012479324.1|1140156_1141020_+	DMT family transporter	NA	NA	NA	NA	NA
WP_049397181.1|1141060_1141996_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	21.3	1.7e-07
WP_049397184.1|1142103_1143621_+	MFS transporter	NA	NA	NA	NA	NA
WP_005408360.1|1143900_1144305_-	GFA family protein	NA	NA	NA	NA	NA
WP_005408361.1|1144476_1145451_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_012479329.1|1145450_1147472_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_049397187.1|1147560_1148982_-	MFS transporter	NA	NA	NA	NA	NA
WP_005415534.1|1149011_1149446_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_049397188.1|1149518_1150121_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_049397189.1|1150219_1151095_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049397190.1|1151154_1151976_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_049397192.1|1151994_1152672_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004147099.1|1152759_1153797_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_005408369.1|1153897_1155040_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_049397194.1|1155247_1156231_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_049397195.1|1156285_1157182_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012479096.1|1157410_1158325_-|transposase	IS110-like element ISStma7 family transposase	transposase	Q75QL1	Wolbachia_phage	33.8	8.7e-25
>prophage 5
NZ_CP040440	Stenotrophomonas maltophilia strain ICU331 chromosome, complete genome	4995994	2638926	2645838	4995994	transposase	Stenotrophomonas_phage(66.67%)	9	NA	NA
WP_088610767.1|2638926_2640098_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.7	1.5e-90
WP_154344380.1|2641594_2641732_-	hypothetical protein	NA	S0F2B8	Stenotrophomonas_phage	84.4	6.8e-19
WP_049396927.1|2641782_2641917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049396933.1|2642224_2642527_-	single-stranded DNA-binding protein	NA	B1NI78	Stenotrophomonas_phage	94.8	5.5e-45
WP_049441001.1|2642542_2643640_-	replication protein	NA	B1NI77	Stenotrophomonas_phage	93.7	3.5e-198
WP_154344381.1|2643629_2643806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049407100.1|2643802_2644030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053091128.1|2644162_2644615_+	hypothetical protein	NA	S0F2J2	Stenotrophomonas_phage	69.5	3.4e-38
WP_049396940.1|2644719_2645838_+	sensor histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	37.8	1.9e-58
>prophage 6
NZ_CP040440	Stenotrophomonas maltophilia strain ICU331 chromosome, complete genome	4995994	2778191	2860104	4995994	holin,tRNA,transposase,protease	Catovirus(23.53%)	57	NA	NA
WP_012479096.1|2778191_2779106_-|transposase	IS110-like element ISStma7 family transposase	transposase	Q75QL1	Wolbachia_phage	33.8	8.7e-25
WP_099470392.1|2779941_2782212_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.3	1.1e-09
WP_049395323.1|2782249_2783119_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_014037083.1|2783115_2783712_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_021202077.1|2783708_2784782_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_049395322.1|2785055_2787647_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_005416402.1|2787690_2788089_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_005409505.1|2788095_2788320_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_143565997.1|2788579_2790505_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_049406723.1|2790494_2792585_-	DUF4034 domain-containing protein	NA	NA	NA	NA	NA
WP_049395319.1|2792858_2795612_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_049395318.1|2795742_2797293_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	4.1e-19
WP_049395317.1|2797463_2798054_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_049418853.1|2798092_2799565_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_021202070.1|2799666_2801349_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.0	5.6e-54
WP_049397542.1|2801575_2803252_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	30.3	3.3e-30
WP_049397541.1|2803413_2804286_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_088610767.1|2806476_2807647_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.7	1.5e-90
WP_049397539.1|2807777_2808923_-	two-component system response regulator	NA	NA	NA	NA	NA
WP_049397538.1|2809128_2810640_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	35.6	1.1e-85
WP_049397538.1|2814729_2816241_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	35.6	1.1e-85
WP_049397537.1|2816405_2818046_-	acetolactate synthase large subunit	NA	NA	NA	NA	NA
WP_049397536.1|2818109_2819495_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_049395347.1|2820192_2820975_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014037064.1|2821128_2822254_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.7	2.5e-05
WP_049395346.1|2822507_2825420_-	DUF2135 domain-containing protein	NA	NA	NA	NA	NA
WP_049395345.1|2825563_2827321_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.6	1.6e-43
WP_049395344.1|2827479_2828520_+	DUF1176 domain-containing protein	NA	NA	NA	NA	NA
WP_049395343.1|2828632_2829550_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_005416377.1|2829554_2830031_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_019661462.1|2830027_2833270_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_031270821.1|2833418_2834546_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.8	5.8e-47
WP_080354105.1|2834835_2835564_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_049395341.1|2835781_2836243_+	DUF4304 domain-containing protein	NA	NA	NA	NA	NA
WP_021204545.1|2836330_2836579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049396113.1|2836578_2838444_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_021204543.1|2838440_2838695_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_019661454.1|2838814_2839603_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_019661453.1|2839605_2840007_+	VOC family protein	NA	NA	NA	NA	NA
WP_049396114.1|2840003_2840900_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	34.8	3.9e-38
WP_049396115.1|2841001_2841772_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.5	1.1e-12
WP_005409468.1|2841822_2842389_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_049396116.1|2842551_2843244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049396117.1|2843327_2843720_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_049396118.1|2843700_2846850_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	2.8e-54
WP_049396119.1|2846886_2848032_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005409463.1|2848128_2848878_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_049396120.1|2848877_2849954_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.0	2.1e-22
WP_049407147.1|2849931_2851728_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_005409460.1|2851762_2852062_-	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_049396121.1|2852124_2853513_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_005409458.1|2853682_2854924_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	9.7e-104
WP_080354106.1|2855003_2855618_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005409456.1|2855751_2857227_+	amino acid permease	NA	NA	NA	NA	NA
WP_049407148.1|2857309_2858737_+	amino acid permease	NA	NA	NA	NA	NA
WP_006388655.1|2858953_2859247_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_049396123.1|2859243_2860104_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.2	6.9e-40
>prophage 7
NZ_CP040440	Stenotrophomonas maltophilia strain ICU331 chromosome, complete genome	4995994	3734230	3770321	4995994	terminase,portal,transposase	Stenotrophomonas_phage(84.62%)	33	NA	NA
WP_154344389.1|3734230_3736096_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.1	1.6e-62
WP_154344390.1|3736154_3737006_-	toprim domain-containing protein	NA	A0A1B0VML8	Pseudomonas_phage	49.6	1.4e-40
WP_154344391.1|3736992_3737634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154344392.1|3737630_3737846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154344393.1|3737842_3738052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080354120.1|3738345_3738630_-	ogr/Delta-like zinc finger family protein	NA	E5E3P1	Burkholderia_phage	40.3	8.1e-06
WP_049395279.1|3738639_3738843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088610767.1|3738988_3740159_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.7	1.5e-90
WP_154344394.1|3740880_3742071_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	57.2	9.9e-122
WP_154344395.1|3742415_3743018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154344396.1|3743088_3743586_-	hypothetical protein	NA	B7SYF7	Stenotrophomonas_phage	79.2	2.1e-65
WP_154344397.1|3743945_3744611_+	SOS response-associated peptidase	NA	B7SYF4	Stenotrophomonas_phage	95.5	3.0e-120
WP_154344398.1|3744614_3745406_-	DNA adenine methylase	NA	B7SYF3	Stenotrophomonas_phage	99.2	5.3e-156
WP_154344399.1|3745553_3745787_-	hypothetical protein	NA	B7SYF2	Stenotrophomonas_phage	87.0	3.2e-32
WP_154344400.1|3747971_3748970_-	hypothetical protein	NA	B7SYF0	Stenotrophomonas_phage	34.2	1.6e-40
WP_154344401.1|3748966_3752572_-	hypothetical protein	NA	B7SYE9	Stenotrophomonas_phage	81.2	0.0e+00
WP_053451668.1|3752575_3752992_-	hypothetical protein	NA	B7SYE8	Stenotrophomonas_phage	84.8	1.8e-62
WP_154344402.1|3752991_3756741_-	Laminin subunit alpha-2	NA	B7SYE7	Stenotrophomonas_phage	71.0	0.0e+00
WP_049397889.1|3756733_3757384_-	hypothetical protein	NA	B7SYE6	Stenotrophomonas_phage	89.4	2.2e-107
WP_154344403.1|3757455_3758256_-	hypothetical protein	NA	B7SYE5	Stenotrophomonas_phage	96.2	4.7e-144
WP_154344463.1|3758269_3758689_-	hypothetical protein	NA	B7SYE4	Stenotrophomonas_phage	82.0	1.1e-56
WP_049460312.1|3758744_3759089_-	hypothetical protein	NA	B7SYE3	Stenotrophomonas_phage	69.3	7.0e-36
WP_154344404.1|3759085_3759577_-	endopeptidase	NA	B7SYE1	Stenotrophomonas_phage	64.4	1.2e-44
WP_004152731.1|3759573_3760149_-	glycoside hydrolase family protein	NA	NA	NA	NA	NA
WP_111007503.1|3760138_3760438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111007504.1|3760517_3760883_-	DUF2190 family protein	NA	B7SYD8	Stenotrophomonas_phage	92.6	5.1e-53
WP_154344405.1|3760905_3762888_-	peptidase S14	NA	B7SYD7	Stenotrophomonas_phage	96.7	0.0e+00
WP_004152728.1|3762884_3764375_-|portal	phage portal protein	portal	B7SYD6	Stenotrophomonas_phage	98.6	6.3e-283
WP_015994693.1|3764376_3764592_-	hypothetical protein	NA	B7SYD5	Stenotrophomonas_phage	100.0	7.2e-31
WP_049442272.1|3764671_3764992_-	hypothetical protein	NA	B7SYD4	Stenotrophomonas_phage	97.1	1.8e-49
WP_154344406.1|3764985_3766911_-|terminase	phage terminase large subunit family protein	terminase	B7SYD3	Stenotrophomonas_phage	98.0	0.0e+00
WP_154344407.1|3766907_3767564_-	hypothetical protein	NA	B7SYD2	Stenotrophomonas_phage	92.7	2.1e-89
WP_154344408.1|3767906_3770321_-	toprim domain-containing protein	NA	B7SYD0	Stenotrophomonas_phage	97.1	0.0e+00
>prophage 8
NZ_CP040440	Stenotrophomonas maltophilia strain ICU331 chromosome, complete genome	4995994	3775193	3783593	4995994	integrase	Stenotrophomonas_phage(83.33%)	14	3775438:3775452	3789116:3789130
WP_154344417.1|3775193_3775682_+	hypothetical protein	NA	B7SYG7	Stenotrophomonas_phage	91.4	3.6e-78
3775438:3775452	attL	CGGCACCTGCCCGGG	NA	NA	NA	NA
WP_154344418.1|3775689_3776082_+	hypothetical protein	NA	B7SYG6	Stenotrophomonas_phage	73.1	5.3e-48
WP_154344419.1|3776078_3776810_+	hypothetical protein	NA	B7SYG5	Stenotrophomonas_phage	87.2	1.2e-117
WP_154344420.1|3776849_3777398_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_154344421.1|3777430_3777856_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_154344422.1|3777882_3778326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154344423.1|3778322_3779690_+	reverse transcriptase	NA	D4HTV9	Vibrio_phage	33.7	4.9e-48
WP_154344424.1|3779686_3780577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107380224.1|3780569_3780827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107380226.1|3780819_3781059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154344425.1|3781158_3781503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154344426.1|3781495_3782227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154344427.1|3782223_3782439_+	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	51.4	1.3e-11
WP_107380234.1|3782435_3783593_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	38.9	1.5e-69
3789116:3789130	attR	CGGCACCTGCCCGGG	NA	NA	NA	NA
>prophage 9
NZ_CP040440	Stenotrophomonas maltophilia strain ICU331 chromosome, complete genome	4995994	3787685	3809578	4995994	terminase	Xanthomonas_citri_phage(50.0%)	23	NA	NA
WP_154344429.1|3787685_3793682_-	hypothetical protein	NA	K4NZ44	Pseudomonas_phage	30.7	7.2e-152
WP_154344430.1|3793681_3795925_-	hypothetical protein	NA	K7ZJS6	Xanthomonas_citri_phage	32.9	7.2e-73
WP_154344431.1|3795896_3796331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154344432.1|3796282_3796762_-	hypothetical protein	NA	I6Q9W6	Yersinia_phage	36.1	1.4e-10
WP_154344433.1|3796754_3797237_-	hypothetical protein	NA	K7ZPX6	Xanthomonas_citri_phage	53.9	1.0e-40
WP_100437336.1|3797233_3798880_-	hypothetical protein	NA	K7ZLE6	Xanthomonas_citri_phage	56.9	3.0e-185
WP_100437337.1|3798879_3800052_-	hypothetical protein	NA	K7ZRM6	Xanthomonas_citri_phage	56.0	8.2e-137
WP_088611213.1|3800054_3800696_-	hypothetical protein	NA	K7ZJS5	Xanthomonas_citri_phage	44.9	5.3e-45
WP_088611212.1|3800699_3801032_-	hypothetical protein	NA	K7ZMJ6	Xanthomonas_citri_phage	68.4	7.7e-32
WP_100437338.1|3801081_3801405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100437339.1|3801401_3801836_-	hypothetical protein	NA	A0A2I7RHV3	Vibrio_phage	47.2	4.1e-25
WP_054172936.1|3801906_3802908_-	hypothetical protein	NA	A0A2I7QL96	Vibrio_phage	58.0	3.3e-110
WP_088611209.1|3802977_3803667_-	hypothetical protein	NA	K7ZRM5	Xanthomonas_citri_phage	52.0	2.0e-34
WP_151458228.1|3803656_3804016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154344434.1|3804012_3805725_-	hypothetical protein	NA	K7ZJS4	Xanthomonas_citri_phage	55.8	7.7e-176
WP_154344435.1|3805724_3805988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108270324.1|3805992_3806196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154344436.1|3806206_3807706_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	52.6	4.3e-138
WP_088611205.1|3807677_3808133_-|terminase	terminase small subunit protein	terminase	L7TIB4	Pseudomonas_virus	48.8	1.1e-25
WP_088611204.1|3808132_3808381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151458227.1|3808377_3808848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088611202.1|3808852_3809098_-	hypothetical protein	NA	E5EYD6	Acinetobacter_phage	60.5	2.3e-17
WP_100437344.1|3809113_3809578_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	43.9	6.3e-24
>prophage 10
NZ_CP040440	Stenotrophomonas maltophilia strain ICU331 chromosome, complete genome	4995994	3813031	3831199	4995994	integrase	Xylella_phage(23.08%)	28	3813695:3813710	3829985:3830000
WP_099561975.1|3813031_3814504_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	40.1	1.5e-82
3813695:3813710	attL	GGCCAGGTTGGCCAGC	NA	NA	NA	NA
WP_088611195.1|3815470_3815815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088611194.1|3815814_3816357_-	HNH endonuclease	NA	K4I2Y2	Salmonella_phage	38.9	2.5e-19
WP_088611192.1|3816640_3816886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154344438.1|3816957_3817203_-	helix-turn-helix domain-containing protein	NA	W6MWX8	Pseudomonas_phage	60.0	3.7e-07
WP_154344439.1|3817285_3817945_+	helix-turn-helix transcriptional regulator	NA	C8CLH0	Xylella_phage	28.6	2.5e-13
WP_154344440.1|3817963_3818305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088611190.1|3818443_3818623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154344441.1|3818626_3818977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049446532.1|3818973_3819159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049446528.1|3819268_3819586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049446527.1|3819575_3819866_+	hypothetical protein	NA	K7PMC8	Enterobacterial_phage	43.7	4.1e-05
WP_154344442.1|3820026_3820545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154344443.1|3820704_3821649_+	phage recombination protein Bet	NA	U6C6J0	Ralstonia_phage	50.6	4.1e-62
WP_154344444.1|3821645_3823340_+	hypothetical protein	NA	U6C712	Ralstonia_phage	39.4	9.5e-94
WP_100437353.1|3823339_3823555_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100437354.1|3823551_3823773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100437355.1|3823769_3824630_+	hypothetical protein	NA	A0A067XQE4	Caulobacter_phage	32.1	6.0e-28
WP_087786643.1|3824629_3824920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100437356.1|3824916_3825159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100437357.1|3825155_3825677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154344445.1|3825673_3826498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154344446.1|3826494_3827043_+	adenine methyltransferase	NA	A0A166Y0E3	Gordonia_phage	60.8	3.3e-48
WP_100437360.1|3827054_3827270_+	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	61.5	2.0e-12
WP_088611174.1|3827269_3828298_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	62.0	2.3e-111
WP_049396253.1|3828612_3829569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012481067.1|3829753_3830419_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2I7S903	Vibrio_phage	35.9	4.1e-24
3829985:3830000	attR	GGCCAGGTTGGCCAGC	NA	NA	NA	NA
WP_012481068.1|3830497_3831199_-	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	41.9	4.0e-38
