The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040431	Stenotrophomonas maltophilia strain sm454 chromosome, complete genome	4685439	281098	339311	4685439	plate,transposase,portal,terminase,capsid,head,tRNA,tail,holin,integrase	Stenotrophomonas_phage(80.49%)	70	274561:274592	318814:318845
274561:274592	attL	GGTAGTGCCGGCCGCTGGCCGGCAACCTCATG	NA	NA	NA	NA
WP_061478821.1|281098_282013_-	DNA cytosine methyltransferase	NA	A0A088FRI5	Mycobacterium_phage	34.9	8.3e-36
WP_154329146.1|282009_282798_-	hypothetical protein	NA	A0A0E3M3Z6	Verrucomicrobia_phage	37.2	4.2e-36
WP_154329147.1|282790_282982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154329148.1|282974_283160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154329676.1|283152_283569_-	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	58.3	6.9e-30
WP_154329149.1|283929_286626_-	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	83.5	0.0e+00
WP_099561574.1|286827_287064_-	hypothetical protein	NA	V9IQH4	Stenotrophomonas_phage	55.7	4.1e-11
WP_154329150.1|287084_287393_-	hypothetical protein	NA	V9IQM8	Stenotrophomonas_phage	51.4	5.3e-19
WP_099561573.1|287392_287635_-	hypothetical protein	NA	V9IQX5	Stenotrophomonas_phage	66.2	8.1e-23
WP_099561555.1|287958_288165_-	hypothetical protein	NA	V9IQL4	Stenotrophomonas_phage	72.1	9.3e-20
WP_032963111.1|288231_288576_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	62.8	5.3e-36
WP_076738385.1|288572_288905_-	hypothetical protein	NA	A0A1B0VRL1	Pseudomonas_phage	52.5	1.7e-07
WP_050426929.1|289049_289421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154329151.1|289805_290837_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	71.6	5.9e-123
WP_024956195.1|290833_291235_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	79.4	1.6e-52
WP_154329152.1|291246_294111_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	74.2	0.0e+00
WP_032963109.1|294283_294400_-|tail	GpE family phage tail protein	tail	V9IQH2	Stenotrophomonas_phage	97.4	8.9e-12
WP_099561551.1|294408_294720_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	83.2	6.3e-36
WP_154329153.1|294781_295291_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	91.7	6.0e-84
WP_154329154.1|295311_296481_-|tail	phage tail protein	tail	E5FFG9	Burkholderia_phage	65.3	4.1e-144
WP_024956190.1|296496_296847_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	67.2	2.6e-38
WP_154329155.1|296843_297392_-|plate	phage baseplate assembly protein V	plate	V9IQH1	Stenotrophomonas_phage	52.6	5.3e-38
WP_154329156.1|297679_298846_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	47.1	1.9e-53
WP_154329157.1|298849_299401_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	56.6	2.6e-56
WP_154329158.1|299393_300284_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	67.2	9.4e-109
WP_099561485.1|300370_300832_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	92.0	5.8e-70
WP_099561486.1|300828_301314_-|tail	phage tail protein	tail	V9IQM0	Stenotrophomonas_phage	77.2	1.8e-61
WP_154329159.1|301310_301835_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	70.2	2.0e-50
WP_154329160.1|301834_302470_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	86.3	6.1e-78
WP_024956181.1|302471_302747_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	76.7	2.0e-33
WP_024956180.1|302739_303099_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	90.7	2.1e-43
WP_111105487.1|303101_303317_-|tail	phage tail protein	tail	V9IQL8	Stenotrophomonas_phage	63.4	1.2e-17
WP_109336986.1|303316_303784_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	96.8	2.9e-77
WP_099561254.1|303888_304596_-|terminase	terminase	terminase	V9IQK3	Stenotrophomonas_phage	99.4	3.4e-85
WP_109336987.1|304598_305615_-|capsid	phage major capsid protein, P2 family	capsid	V9IQV7	Stenotrophomonas_phage	88.2	2.2e-162
WP_154329161.1|305648_306509_-|capsid	phage capsid protein	capsid	V9IQG8	Stenotrophomonas_phage	99.6	1.9e-122
WP_154329162.1|306627_308421_+|terminase	terminase	terminase	V9IQL5	Stenotrophomonas_phage	97.1	0.0e+00
WP_154329163.1|308420_309434_+|portal	phage portal protein	portal	V9IQW4	Stenotrophomonas_phage	97.1	2.5e-174
WP_154329164.1|309430_309688_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	95.3	4.5e-40
WP_154329165.1|309605_310316_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	94.0	4.5e-130
WP_154329166.1|310381_311083_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_154329167.1|312621_313296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154329168.1|313292_314369_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GMX8	Marinobacter_phage	40.3	1.5e-63
WP_154329169.1|314494_315490_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005407693.1|315703_316078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004136763.1|316151_316835_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_032953760.1|316860_318285_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_099484566.1|319227_319977_-	zinc-dependent peptidase	NA	NA	NA	NA	NA
318814:318845	attR	GGTAGTGCCGGCCGCTGGCCGGCAACCTCATG	NA	NA	NA	NA
WP_005407696.1|319985_320264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099480825.1|320408_321377_+	bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA	NA	NA	NA	NA	NA
WP_005407698.1|321373_322105_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_099484565.1|322114_322963_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_099484564.1|323433_323736_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_099484589.1|323818_324520_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_099484563.1|324855_325257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099484562.1|325839_326610_+	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_099484588.1|326631_327018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099484561.1|327109_328030_+	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	33.6	2.2e-28
WP_005407710.1|328190_328328_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_004153772.1|328534_328756_+	CsbD family protein	NA	NA	NA	NA	NA
WP_049449498.1|328829_329639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049395252.1|329747_331040_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_099484560.1|331250_331547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099484559.1|331796_332729_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_099484558.1|332834_334487_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_005407716.1|334664_334964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049395254.1|335031_336366_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	28.1	5.0e-29
WP_024956155.1|336587_337715_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099484557.1|337705_338443_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	1.2e-13
WP_099482019.1|338429_339311_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP040431	Stenotrophomonas maltophilia strain sm454 chromosome, complete genome	4685439	656885	668015	4685439		Enterobacteria_phage(42.86%)	8	NA	NA
WP_012479083.1|656885_657941_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.2	2.4e-79
WP_012479084.1|657955_658843_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.9	9.7e-98
WP_012479085.1|658839_659397_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.1	5.4e-46
WP_012479086.1|659393_660299_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	36.2	4.1e-27
WP_143568537.1|660491_661787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099484607.1|661839_663243_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.1	2.3e-40
WP_076739444.1|663254_664601_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.7	7.7e-30
WP_099484608.1|664697_668015_-	DEAD/DEAH box helicase	NA	A0A0P0YNJ0	Yellowstone_lake_phycodnavirus	34.7	1.1e-45
>prophage 3
NZ_CP040431	Stenotrophomonas maltophilia strain sm454 chromosome, complete genome	4685439	1022878	1070816	4685439	terminase,capsid,head,tail,protease,integrase	Rhizobium_phage(25.0%)	60	1015223:1015249	1080742:1080768
1015223:1015249	attL	GGTAGTGCCGGCCGCTGGCCGGCATCG	NA	NA	NA	NA
WP_049417433.1|1022878_1024123_-|integrase	site-specific integrase	integrase	A0A0F7L7C7	uncultured_marine_virus	27.9	4.8e-10
WP_005412378.1|1024190_1024565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412379.1|1025304_1025445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032961789.1|1025686_1026307_-	antirestriction protein	NA	U5P3Z5	Mycobacterium_phage	34.5	5.7e-20
WP_032961791.1|1026370_1026631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032961794.1|1026627_1026810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412383.1|1026806_1027247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412384.1|1027246_1027570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412385.1|1027622_1028222_-	hypothetical protein	NA	Q8HAP4	Burkholderia_phage	41.1	6.5e-13
WP_154267699.1|1028525_1028687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032961796.1|1029762_1030092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043033726.1|1030307_1030640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125899042.1|1030728_1031130_+	response regulator	NA	NA	NA	NA	NA
WP_005412387.1|1031151_1031604_-	hypothetical protein	NA	Q7Y5G6	Xanthomonas_virus	32.9	1.5e-09
WP_005412388.1|1031600_1031909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065426719.1|1031918_1032416_-	hypothetical protein	NA	A0A2H4JFP9	uncultured_Caudovirales_phage	59.2	5.2e-40
WP_005412390.1|1032412_1032604_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_005412391.1|1032612_1034286_-|terminase	phage terminase large subunit	terminase	A0A2R2ZGE7	Ralstonia_phage	56.5	3.6e-178
WP_032961803.1|1034285_1034531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412393.1|1034527_1034797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126411773.1|1034823_1035309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049427184.1|1035308_1038113_-	hypothetical protein	NA	A0A142EZL1	Stenotrophomonas_phage	40.1	7.2e-38
WP_005412396.1|1038138_1040676_-	DUF1983 domain-containing protein	NA	NA	NA	NA	NA
WP_099470283.1|1040715_1043808_-	hypothetical protein	NA	L7TQZ1	Rhizobium_phage	23.3	3.2e-47
WP_032961810.1|1043886_1046061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032961812.1|1046064_1046463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412400.1|1046495_1046969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412401.1|1046965_1049098_-	hypothetical protein	NA	L7TLW2	Rhizobium_phage	31.5	3.6e-66
WP_005412402.1|1049097_1049688_-	hypothetical protein	NA	A0A2R2ZGD2	Ralstonia_phage	41.9	1.7e-26
WP_005412403.1|1049787_1050741_-|capsid	phage capsid protein	capsid	L7TJ83	Rhizobium_phage	42.7	2.4e-62
WP_005412404.1|1050767_1051553_-|capsid	capsid assembly protein, putative	capsid	A0A1B1IVZ8	uncultured_Mediterranean_phage	30.6	1.1e-20
WP_004154577.1|1051552_1051696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412405.1|1051712_1053269_-|head,tail	phage collar / T7-like phage head-to-tail joining protein	head,tail	L7TJ79	Rhizobium_phage	37.6	1.1e-85
WP_005412406.1|1053261_1053414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412407.1|1053434_1053614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004154581.1|1053678_1054215_-	adenylate kinase	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	46.1	1.4e-30
WP_032961816.1|1054283_1054592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005412408.1|1054617_1054824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004154583.1|1054811_1055645_-	hypothetical protein	NA	M1HMA9	Pelagibacter_phage	36.0	2.0e-36
WP_005412410.1|1055641_1055791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043033722.1|1055787_1056099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412412.1|1056095_1056344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412414.1|1056494_1056860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050483582.1|1056856_1057195_-	hypothetical protein	NA	A0A2H4P845	Pseudomonas_phage	53.2	9.6e-22
WP_049417451.1|1057176_1059051_-	DNA polymerase	NA	A0A076YNV1	Mesorhizobium_phage	48.0	5.0e-160
WP_005412416.1|1059063_1059714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412417.1|1059724_1059973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004154589.1|1060138_1061770_-	toprim domain-containing protein	NA	L7TLT7	Rhizobium_phage	56.6	3.7e-151
WP_004154591.1|1061756_1061936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080101784.1|1061932_1062334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004154593.1|1062330_1062693_-	putative N-acetylmuramoyl-L-alanine amidase	NA	I6Q9Z5	Yersinia_phage	40.6	2.5e-15
WP_080101785.1|1062693_1063173_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A2I7QZP6	Vibrio_phage	31.1	1.4e-05
WP_004154595.1|1063114_1063780_-	hypothetical protein	NA	A0A076YJ33	Mesorhizobium_phage	40.9	1.5e-26
WP_154267700.1|1063779_1063938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412421.1|1063937_1064222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412422.1|1064214_1064358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412423.1|1064402_1066838_-	DNA-directed RNA polymerase	NA	L7TQW5	Rhizobium_phage	40.7	1.5e-164
WP_099485203.1|1067401_1068697_+	trigger factor	NA	NA	NA	NA	NA
WP_004146318.1|1068773_1069400_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	7.7e-57
WP_004154600.1|1069526_1070816_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.0	2.9e-135
1080742:1080768	attR	GGTAGTGCCGGCCGCTGGCCGGCATCG	NA	NA	NA	NA
>prophage 4
NZ_CP040431	Stenotrophomonas maltophilia strain sm454 chromosome, complete genome	4685439	1134668	1153466	4685439	plate,tail	Escherichia_phage(33.33%)	24	NA	NA
WP_154329269.1|1134668_1135742_-|tail	phage tail protein	tail	D5LGY1	Escherichia_phage	50.7	3.3e-92
WP_049430174.1|1135732_1135948_-|tail	tail protein	tail	NA	NA	NA	NA
WP_049430173.1|1135931_1136399_-|tail	phage tail protein	tail	A4PE53	Ralstonia_virus	29.6	2.2e-08
WP_099497690.1|1136401_1138849_-|tail	phage tail tape measure protein	tail	A0A1W6JT50	Escherichia_phage	22.4	3.5e-28
WP_005412456.1|1138969_1139260_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	58.5	1.5e-18
WP_005412457.1|1139340_1139844_-|tail	phage major tail tube protein	tail	A0A193GYM4	Enterobacter_phage	51.2	1.4e-40
WP_012479298.1|1139846_1141049_-|tail	tail protein	tail	A0A088FVH5	Escherichia_phage	54.2	6.1e-127
WP_099497691.1|1141155_1141815_-	hypothetical protein	NA	V9IQM3	Stenotrophomonas_phage	32.9	6.2e-17
WP_099497692.1|1141816_1143784_-|tail	phage tail protein	tail	V9IQX0	Stenotrophomonas_phage	39.1	4.8e-105
WP_043033669.1|1143791_1144571_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	50.6	9.3e-44
WP_099497693.1|1144563_1145460_-|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	56.1	1.1e-80
WP_005408332.1|1145462_1145801_-|plate	phage baseplate protein	plate	A0A193GYY8	Enterobacter_phage	62.2	7.8e-32
WP_154329270.1|1145853_1146444_-|plate	phage baseplate assembly protein V	plate	A0A193GYL5	Enterobacter_phage	38.2	4.3e-25
WP_005412464.1|1146440_1146995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154267725.1|1147113_1147443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012479305.1|1147348_1147726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012479306.1|1147722_1148208_-	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	55.6	5.4e-42
WP_005408337.1|1148204_1148555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005408338.1|1148551_1149001_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043033660.1|1149335_1149719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154329271.1|1149871_1150510_-	hypothetical protein	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	37.6	5.8e-20
WP_099481189.1|1150551_1150779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111173606.1|1150853_1151129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154329272.1|1151129_1153466_-	toprim domain-containing protein	NA	D5LH15	Escherichia_phage	43.3	4.8e-136
