The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046003	Escherichia coli strain 1916D6 chromosome, complete genome	4734139	1055767	1068950	4734139		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1055767_1056529_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1056522_1057149_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1057288_1058428_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1058490_1059483_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1059576_1060941_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1061029_1061806_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1061810_1062449_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1062445_1063708_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1063704_1064613_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|1064808_1065576_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1065626_1066283_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_085438572.1|1066388_1068950_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	7.8e-31
>prophage 2
NZ_CP046003	Escherichia coli strain 1916D6 chromosome, complete genome	4734139	1149991	1250454	4734139	terminase,head,tail,holin,transposase,capsid,tRNA,integrase,portal	Cronobacter_phage(45.65%)	103	1169590:1169606	1239302:1239318
WP_154205232.1|1149991_1151153_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.4e-50
WP_000795662.1|1151520_1151727_+	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	6.5e-05
WP_000151178.1|1151747_1152047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572958.1|1152295_1152571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071526642.1|1152742_1153048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001422398.1|1153315_1153675_-	hypothetical protein	NA	M1PL54	Cellulophaga_phage	46.1	4.7e-19
WP_000614786.1|1156418_1157315_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_021570915.1|1157311_1158208_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_021570914.1|1158197_1159754_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.3	1.1e-19
WP_085947917.1|1159801_1161074_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001384082.1|1161372_1162602_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.3	2.7e-207
WP_000162574.1|1163345_1163828_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600189.1|1163959_1164436_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1164425_1164716_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1164777_1165119_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1165267_1166929_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1167014_1167893_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1168015_1168609_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1168663_1169950_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
1169590:1169606	attL	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_001338897.1|1169970_1170762_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1170928_1172290_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1172538_1172787_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1172805_1173354_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1173384_1174152_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1174193_1174541_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589847.1|1174616_1175099_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|1175114_1176341_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1176330_1176849_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000976004.1|1176998_1177364_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168037.1|1177573_1178644_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225229.1|1178654_1179776_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200120.1|1179818_1180979_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010723158.1|1181077_1181125_-	phe operon leader peptide	NA	NA	NA	NA	NA
WP_077629794.1|1181288_1182308_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	57.2	5.9e-107
WP_000089404.1|1182347_1182647_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	54.2	5.9e-23
WP_000662537.1|1182755_1183037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000853270.1|1183063_1183399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681788.1|1183408_1183978_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	50.5	7.2e-46
WP_032292416.1|1184238_1186896_+	toprim domain protein	NA	A0A077K8T2	Ralstonia_phage	46.5	1.8e-240
WP_000909748.1|1186964_1187684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100224585.1|1187823_1188099_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	61.4	1.7e-24
WP_000746492.1|1188152_1189172_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	69.1	9.3e-137
WP_064670487.1|1189168_1190950_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	70.3	2.9e-250
WP_064670488.1|1191093_1191933_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	48.0	1.2e-44
WP_032295604.1|1191967_1192996_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.9	2.2e-133
WP_032292413.1|1193006_1193720_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	54.3	3.9e-65
WP_064670486.1|1193721_1193913_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	55.2	7.3e-11
WP_077760539.1|1194006_1194459_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	62.0	1.2e-46
WP_032292410.1|1194455_1194938_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	5.2e-37
WP_032292409.1|1194934_1195639_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	60.3	4.0e-70
WP_151140365.1|1195635_1196763_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.5	8.1e-174
WP_089587597.1|1196759_1197215_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.3e-58
WP_032292406.1|1197227_1197524_+|holin	holin	holin	C7BGD7	Burkholderia_phage	50.6	2.4e-16
WP_032292405.1|1197520_1197862_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	85.1	8.1e-45
WP_032292404.1|1197861_1198194_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	65.5	3.3e-35
WP_032292402.1|1198340_1198598_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	62.2	2.8e-21
WP_154205233.1|1198648_1198789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151140366.1|1198785_1200753_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.7	7.5e-268
WP_032292401.1|1200749_1201079_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	71.4	2.1e-37
WP_032292400.1|1201075_1202260_+	phage protein	NA	F1BUK6	Cronobacter_phage	78.9	3.3e-178
WP_032292399.1|1202252_1202840_+	protein phage	NA	F1BUK5	Cronobacter_phage	86.2	6.6e-95
WP_032292398.1|1202849_1204427_+|tail	tail protein	tail	F1BUK3	Cronobacter_phage	80.7	2.7e-135
WP_064670485.1|1204426_1205014_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	56.0	3.6e-56
WP_064670484.1|1205003_1205729_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	51.9	3.6e-58
WP_032292395.1|1205700_1206246_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	1.6e-63
WP_032292425.1|1206248_1207949_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	79.3	3.7e-223
WP_032187555.1|1208980_1210168_-	acyltransferase	NA	NA	NA	NA	NA
WP_000178456.1|1210311_1210653_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1210923_1211661_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079100.1|1211795_1212776_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040169.1|1212772_1213504_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_064670483.1|1213633_1216207_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.0e-127
WP_000841103.1|1222061_1223360_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|1223356_1223680_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1223725_1225081_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083005.1|1225194_1227855_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001300438.1|1227886_1228585_-	DTW domain-containing protein YfiP	NA	NA	NA	NA	NA
WP_001098726.1|1228653_1229073_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1229279_1230317_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|1230364_1231054_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|1231358_1231742_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|1231797_1232385_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_053286107.1|1232487_1233369_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|1233577_1234912_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001295363.1|1235043_1235781_+|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
WP_001094491.1|1235765_1237388_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001303621.1|1237643_1237799_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001295364.1|1237795_1238371_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168459.1|1238403_1239054_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812053.1|1239053_1240010_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
1239302:1239318	attR	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_000589068.1|1240006_1240486_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790168.1|1240683_1242483_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002541.1|1242498_1243473_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|1243744_1244425_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000020749.1|1244421_1245327_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399404.1|1245338_1246067_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_001297412.1|1246078_1246810_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986023.1|1246809_1247190_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000128776.1|1247610_1247691_+	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_001196283.1|1247884_1248145_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
WP_001013779.1|1248200_1249049_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190655.1|1249257_1249893_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001295367.1|1249917_1250454_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP046003	Escherichia coli strain 1916D6 chromosome, complete genome	4734139	1463032	1475057	4734139	integrase,plate	Enterobacteria_phage(57.14%)	15	1459924:1459940	1477067:1477083
1459924:1459940	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_151140423.1|1463032_1463551_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	64.8	1.7e-54
WP_089519078.1|1463594_1464173_-	HNH endonuclease	NA	K7PHS8	Enterobacteria_phage	99.0	1.2e-109
WP_001614322.1|1464159_1464336_-	DUF2737 family protein	NA	K7PL43	Enterobacteria_phage	100.0	3.7e-25
WP_000753555.1|1464352_1464667_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_000041317.1|1464678_1465161_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.8	1.4e-79
WP_064670570.1|1465440_1466520_+	hypothetical protein	NA	Q8SBG7	Shigella_phage	99.2	2.9e-205
WP_001259084.1|1466519_1467068_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_000424747.1|1467067_1467493_+	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	2.0e-80
WP_064670569.1|1467479_1468538_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	99.7	3.0e-202
WP_064670568.1|1468528_1469113_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	1.2e-112
WP_001349560.1|1470131_1470548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077878018.1|1470802_1471951_-	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	31.1	3.9e-30
WP_064670333.1|1472259_1472649_+	hypothetical protein	NA	K7P6F7	Enterobacteria_phage	87.5	4.6e-60
WP_064670332.1|1472655_1473813_-|integrase	prophage integrase IntS	integrase	Q716F9	Shigella_phage	98.2	1.0e-219
WP_000368140.1|1474124_1475057_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
1477067:1477083	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP046003	Escherichia coli strain 1916D6 chromosome, complete genome	4734139	1715367	1724808	4734139		Enterobacteria_phage(85.71%)	10	NA	NA
WP_064670440.1|1715367_1716294_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	31.1	2.2e-23
WP_000783120.1|1716298_1717030_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1717010_1717118_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1717177_1717909_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1718130_1719816_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1719812_1720532_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1720578_1721049_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1721088_1721550_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001402348.1|1721674_1723675_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_064670439.1|1723671_1724808_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	9.4e-162
>prophage 5
NZ_CP046003	Escherichia coli strain 1916D6 chromosome, complete genome	4734139	1817039	1825006	4734139		Klebsiella_phage(16.67%)	8	NA	NA
WP_064670358.1|1817039_1818434_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_000999466.1|1818591_1819587_+	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_000183034.1|1819829_1820723_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	2.3e-46
WP_000699411.1|1821094_1822180_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	8.8e-101
WP_000676086.1|1822179_1823043_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	68.1	2.0e-111
WP_001025599.1|1823046_1823442_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000971201.1|1823438_1823906_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000564888.1|1823902_1825006_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.1	8.0e-41
>prophage 6
NZ_CP046003	Escherichia coli strain 1916D6 chromosome, complete genome	4734139	1849145	1942382	4734139	terminase,head,holin,lysis,tail,transposase,integrase,portal,coat	Enterobacteria_phage(47.83%)	109	1842391:1842406	1926272:1926287
1842391:1842406	attL	CCTGCCGGATGCGGCG	NA	NA	NA	NA
WP_048266533.1|1849145_1850324_+|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	99.5	3.4e-231
WP_000132739.1|1850304_1850496_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_000545720.1|1850835_1851003_-	hypothetical protein	NA	K7P728	Enterobacteria_phage	98.2	2.9e-27
WP_154205236.1|1851103_1851406_-	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	98.0	6.5e-54
WP_154205238.1|1851402_1851999_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	77.1	5.4e-52
WP_000348980.1|1852001_1852193_-	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	100.0	2.1e-26
WP_032285064.1|1852194_1852602_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.0	6.3e-68
WP_000118152.1|1852603_1852903_-	hypothetical protein	NA	Q716F3	Shigella_phage	100.0	1.5e-58
WP_016063110.1|1852899_1853067_-	DUF2737 family protein	NA	K7PJV9	Enterobacteria_phage	100.0	1.0e-24
WP_001388110.1|1853077_1853371_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	1.9e-50
WP_000168274.1|1853384_1853891_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	100.0	2.3e-80
WP_000365280.1|1853891_1854599_-	recombinase	NA	K7PKU3	Enterobacteria_phage	100.0	7.6e-138
WP_001308813.1|1854853_1855129_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	100.0	1.6e-46
WP_154205239.1|1855242_1855485_-	hypothetical protein	NA	U5PUY0	Salmonella_phage	58.4	2.1e-18
WP_000394306.1|1855512_1855764_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	97.6	2.4e-41
WP_021512407.1|1855772_1856072_-	hypothetical protein	NA	C6ZCW1	Enterobacteria_phage	98.0	5.5e-45
WP_001095982.1|1856386_1857037_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000276885.1|1857117_1857303_+	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_000035948.1|1857418_1857715_+	hypothetical protein	NA	K7PKU6	Enterobacteria_phage	100.0	2.3e-48
WP_021823884.1|1857747_1858392_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_052319315.1|1858378_1859221_+	replication protein	NA	K7PGT1	Enterobacteria_phage	94.2	1.3e-128
WP_085701393.1|1859223_1860069_+	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	73.6	1.2e-110
WP_000145948.1|1860065_1860356_+	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
WP_154205240.1|1860437_1860605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130951072.1|1860630_1860831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085455278.1|1860842_1861163_+	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	74.5	1.3e-36
WP_154205242.1|1861165_1861576_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	4.7e-71
WP_001254220.1|1861572_1861749_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_001351812.1|1861751_1862114_+	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	100.0	1.8e-66
WP_000950973.1|1862106_1862283_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_053292536.1|1862275_1863001_+	DNA-binding protein	NA	A0A2I6PIF5	Escherichia_phage	94.2	2.9e-124
WP_032284927.1|1863000_1863291_+	DUF1364 domain-containing protein	NA	Q9MCN9	Enterobacteria_phage	97.9	4.2e-50
WP_154205244.1|1863287_1863650_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	1.0e-61
WP_000994516.1|1863646_1863835_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_021528613.1|1863831_1864350_+	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	99.4	4.5e-95
WP_112958522.1|1864931_1866062_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	88.6	2.9e-195
WP_000783734.1|1866156_1866480_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_089564108.1|1866463_1866940_+	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	99.4	4.9e-88
WP_154205245.1|1866936_1867404_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	94.8	1.1e-73
WP_053878044.1|1867391_1867544_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	3.6e-21
WP_001016386.1|1867745_1868264_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	100.0	3.2e-93
WP_000807785.1|1868616_1868859_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_154205247.1|1868861_1869305_+|terminase	terminase	terminase	C7U0V7	Enterobacteria_phage	93.8	1.2e-64
WP_040090633.1|1869301_1870780_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	65.6	2.7e-177
WP_154205248.1|1870781_1872980_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.1	0.0e+00
WP_154205249.1|1873070_1873964_+	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	97.3	7.7e-127
WP_001462595.1|1873982_1875236_+|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	98.6	2.7e-234
WP_001462613.1|1875277_1875466_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	98.4	6.5e-28
WP_001140510.1|1875446_1875908_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_154205250.1|1875917_1877336_+	hypothetical protein	NA	A0A2D1GM00	Escherichia_phage	99.6	9.2e-276
WP_154205251.1|1877335_1878037_+|tail	phage tail protein	tail	A0A2D1GLK3	Escherichia_phage	98.7	1.3e-118
WP_000627633.1|1878036_1878492_+	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	99.3	5.2e-87
WP_114443138.1|1878494_1879187_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	98.7	7.8e-111
WP_000246949.1|1879196_1880528_+	DNA injection protein	NA	A0A2D1GLX5	Escherichia_phage	99.8	3.1e-217
WP_154205252.1|1880528_1882922_+	transglycosylase SLT domain-containing protein	NA	Q716G2	Shigella_phage	96.6	0.0e+00
WP_154205253.1|1883162_1883591_-	HNH endonuclease	NA	A0A173GC65	Salmonella_phage	43.7	2.8e-26
WP_154205254.1|1883611_1885648_+|head	head-binding protein	head	S4TU85	Salmonella_phage	52.9	1.6e-156
WP_104726698.1|1885708_1886740_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	29.9	9.1e-23
WP_154205255.1|1886843_1887233_+	LexA family transcriptional regulator	NA	K7P6F7	Enterobacteria_phage	88.4	4.2e-61
WP_016247321.1|1887576_1888743_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	6.5e-227
WP_001105415.1|1888861_1889335_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_064670363.1|1889532_1890591_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|1890762_1891092_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016348.1|1891192_1891375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|1891863_1891977_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|1891989_1892184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854814.1|1892180_1892555_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_001285585.1|1892643_1893012_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|1893085_1893307_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186773.1|1893369_1893846_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860076.1|1893861_1894341_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_064670364.1|1894422_1895244_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	4.7e-46
WP_000846713.1|1895464_1895875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775500.1|1895890_1896574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102643.1|1896709_1897780_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000270974.1|1898436_1898838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221617.1|1898825_1899236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000656352.1|1901550_1902585_-	phosphotriesterase	NA	NA	NA	NA	NA
WP_001066368.1|1903609_1904368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973176.1|1907649_1908195_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_025670340.1|1908191_1908935_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193786.1|1908946_1910026_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_122985809.1|1910087_1911023_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011447.1|1911480_1912398_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_047662175.1|1912499_1913450_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122985555.1|1913567_1915211_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532923.1|1915841_1916558_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1916900_1918355_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378572.1|1918456_1919773_-	shikimate transporter	NA	NA	NA	NA	NA
WP_001442913.1|1922987_1923785_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001079074.1|1924537_1925068_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_001317164.1|1925410_1926082_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001241499.1|1926317_1926953_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
1926272:1926287	attR	CGCCGCATCCGGCAGG	NA	NA	NA	NA
WP_000740094.1|1926953_1927958_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920132.1|1928066_1928480_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001339045.1|1928612_1929284_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826787.1|1929283_1930642_+	heavy metal sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	6.6e-05
WP_000218214.1|1930749_1931601_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_089660501.1|1932193_1932421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139152026.1|1932461_1933735_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.0e-177
WP_072134966.1|1933778_1934588_-	porin	NA	Q1MVN1	Enterobacteria_phage	50.3	8.1e-67
WP_001313057.1|1935153_1935519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365561.1|1935558_1936254_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001157230.1|1936320_1937739_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.7	3.0e-101
WP_000786004.1|1937719_1938190_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001507517.1|1938178_1939099_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|1939271_1940189_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009306.1|1940267_1940450_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001564714.1|1940687_1942382_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
>prophage 7
NZ_CP046003	Escherichia coli strain 1916D6 chromosome, complete genome	4734139	1976350	2015864	4734139	integrase,transposase	Staphylococcus_phage(33.33%)	32	2005994:2006053	2021980:2022096
WP_024169776.1|1976350_1977550_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_112918427.1|1977975_1978290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000045627.1|1978315_1978849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034167753.1|1978921_1979356_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_042631080.1|1981304_1981631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096106433.1|1981679_1984280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053266086.1|1984326_1984965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000281555.1|1984954_1985155_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053266085.1|1985305_1986433_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	28.2	6.9e-16
WP_032172475.1|1986575_1987706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112918425.1|1988212_1989445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032174629.1|1989751_1991275_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.3	3.7e-89
WP_094323336.1|1991264_1992524_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	22.7	7.0e-09
WP_151140382.1|1992520_1993204_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_063078878.1|1993226_1995011_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_097506538.1|1995080_1998365_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.4	6.9e-64
WP_001290572.1|1998361_1999117_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_105629577.1|1999979_2000714_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_053275385.1|2000734_2001775_-	fimbrial protein	NA	NA	NA	NA	NA
WP_077816311.1|2001787_2004319_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_112910902.1|2004406_2005093_-	molecular chaperone	NA	NA	NA	NA	NA
WP_112910903.1|2005150_2005678_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
2005994:2006053	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_117355267.1|2006048_2006141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118645.1|2006187_2007111_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_112918391.1|2007103_2007400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034167755.1|2008168_2008909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024169776.1|2008989_2010189_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000054834.1|2010614_2010929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000045627.1|2010954_2011488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021579298.1|2011560_2011995_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_089580313.1|2012835_2013759_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.9e-176
WP_151140383.1|2014811_2015864_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
2021980:2022096	attR	GCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCCAATTCTCAACGTTAACCCACATGCCCATCATAAAATCAAATTTTGAAAGAAAATGC	NA	NA	NA	NA
>prophage 8
NZ_CP046003	Escherichia coli strain 1916D6 chromosome, complete genome	4734139	2355391	2371196	4734139	integrase	Salmonella_phage(25.0%)	15	2353095:2353108	2365460:2365473
2353095:2353108	attL	GCGGCAATCAGCAT	NA	NA	NA	NA
WP_000041681.1|2355391_2357818_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	4.5e-214
WP_001300836.1|2358016_2358322_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2358429_2359140_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2359142_2359703_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2359737_2360079_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2360213_2360540_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2360745_2361960_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|2361971_2362991_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|2363048_2363177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876986.1|2363178_2364459_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_001296941.1|2364493_2364730_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_021570798.1|2364817_2367289_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	4.2e-58
2365460:2365473	attR	ATGCTGATTGCCGC	NA	NA	NA	NA
WP_001083297.1|2367381_2367573_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854559.1|2367569_2367758_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000527809.1|2369735_2371196_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
>prophage 9
NZ_CP046003	Escherichia coli strain 1916D6 chromosome, complete genome	4734139	3613443	3679181	4734139	integrase,lysis,tail,holin	Enterobacteria_phage(47.37%)	71	3642355:3642373	3663565:3663583
WP_000131044.1|3613443_3615477_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3615605_3616193_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3616206_3617679_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3617692_3619363_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3619575_3620244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3620486_3621182_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_064670551.1|3621174_3622602_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3622612_3623332_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3623858_3624713_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064670552.1|3624938_3625175_+	FAD-binding protein	NA	A0A2K5B2C5	Erysipelothrix_phage	53.9	5.5e-16
WP_000474084.1|3627148_3627385_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3627396_3627990_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|3628579_3629431_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000662258.1|3633557_3633659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3634022_3634286_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3634285_3634426_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3634460_3634688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3635511_3636054_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3636128_3636716_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3636773_3637442_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3637467_3639993_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|3639982_3641626_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3641594_3642305_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
3642355:3642373	attL	CGTTTAAATGATGTGGAAG	NA	NA	NA	NA
WP_001303809.1|3642617_3642947_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3643194_3643809_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|3644226_3644916_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3644912_3645869_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_053286015.1|3645865_3648064_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	26.1	1.9e-38
WP_000121359.1|3648073_3649030_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3649008_3649419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064670530.1|3649987_3651004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064670529.1|3651464_3652697_+	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	99.3	4.3e-237
WP_064670528.1|3652825_3653410_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	4.3e-102
WP_151140399.1|3653409_3656760_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000453558.1|3657332_3657878_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_000025003.1|3658215_3658536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085438473.1|3658916_3659360_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	82.8	7.3e-62
WP_000900879.1|3659356_3659674_-	lysozyme	NA	A0A2I6TCA1	Escherichia_phage	98.1	1.2e-55
WP_000186784.1|3659880_3660561_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.7	2.3e-131
WP_072126246.1|3660557_3660740_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_000548531.1|3660712_3660904_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|3660914_3661196_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_085438467.1|3661294_3661513_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	97.2	1.4e-34
WP_000488407.1|3661560_3661839_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_071791770.1|3661810_3662161_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	98.3	4.6e-59
WP_053271768.1|3662037_3663201_+|integrase	site-specific integrase	integrase	S5FNS2	Shigella_phage	99.7	9.1e-229
WP_085438561.1|3663703_3663856_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	86.2	3.9e-07
3663565:3663583	attR	CGTTTAAATGATGTGGAAG	NA	NA	NA	NA
WP_085438563.1|3664451_3665534_+	acyltransferase	NA	W6MVL2	Pseudomonas_phage	22.9	4.0e-05
WP_021548946.1|3665579_3665744_-	hypothetical protein	NA	A0A077KCA4	Edwardsiella_phage	64.5	2.1e-06
WP_136710480.1|3665754_3666171_-|tail	tail assembly chaperone	tail	A0A077KAY3	Edwardsiella_phage	55.3	4.5e-13
WP_064670553.1|3667173_3667512_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	93.4	3.6e-53
WP_000774473.1|3667508_3667799_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.1e-47
WP_000211034.1|3667791_3667962_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_064670554.1|3667961_3668417_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.8e-60
WP_072097297.1|3668413_3668515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074400827.1|3668609_3669392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064670555.1|3669566_3669890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709067.1|3670001_3671528_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	7.9e-31
WP_001301135.1|3671585_3671735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|3671783_3672116_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3672183_3672486_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788886.1|3672482_3673184_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	99.6	9.9e-130
WP_064670557.1|3673180_3674110_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	1.6e-111
WP_064670556.1|3674196_3674736_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	5.8e-61
WP_000184665.1|3674766_3674994_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001295669.1|3675104_3675797_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000380252.1|3675877_3676939_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|3676916_3677294_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|3677769_3677976_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_033561765.1|3678051_3678348_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_074400828.1|3678353_3679181_+	phage recombination protein Bet	NA	A0A0P0ZDB4	Stx2-converting_phage	87.6	4.0e-114
>prophage 10
NZ_CP046003	Escherichia coli strain 1916D6 chromosome, complete genome	4734139	3688315	3731755	4734139	head,tail,terminase,lysis,protease,holin,capsid,integrase,portal,plate	Shigella_phage(52.73%)	59	3686182:3686229	3727852:3727899
3686182:3686229	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_072161528.1|3688315_3689530_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_094304446.1|3689564_3690998_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	49.9	5.4e-106
WP_000355484.1|3691401_3692175_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_151140400.1|3692235_3692790_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.7	5.3e-86
WP_001008234.1|3693249_3693693_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_151140401.1|3693664_3694267_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	92.5	1.7e-101
WP_151140402.1|3694266_3694989_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	93.5	1.6e-50
WP_063073499.1|3694992_3695577_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	2.0e-112
WP_028125900.1|3695567_3696626_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.9	1.2e-200
WP_000424744.1|3696612_3697038_-	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	3.9e-81
WP_052921837.1|3697037_3697586_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.9	2.5e-96
WP_063073500.1|3697585_3698665_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.2	3.4e-206
WP_063073501.1|3698661_3699990_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_040072272.1|3700043_3700721_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	45.6	6.6e-46
WP_063073503.1|3700802_3702584_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	91.8	9.8e-275
WP_000661054.1|3702725_3702995_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090998.1|3702994_3703351_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_151140403.1|3703350_3704847_-|tail	phage tail protein	tail	U5P0H3	Shigella_phage	98.4	1.4e-274
WP_063073505.1|3704830_3705001_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	7.9e-25
WP_000779292.1|3705009_3705570_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000224836.1|3705566_3706073_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702401.1|3706047_3706458_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.9	8.0e-71
WP_000927711.1|3706454_3706778_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|3706780_3706981_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_063073507.1|3707030_3708236_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	1.3e-222
WP_001193640.1|3708250_3708901_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	5.6e-119
WP_000466255.1|3708878_3710120_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605605.1|3710119_3710302_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
WP_072011717.1|3710313_3711810_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_063073508.1|3712048_3712534_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	98.8	1.4e-85
WP_001135220.1|3712659_3713010_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	95.7	1.2e-62
WP_000738423.1|3713534_3713828_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_123010240.1|3713918_3714101_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	95.0	2.1e-15
WP_001197766.1|3714317_3714794_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120496.1|3714797_3715124_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_001532221.1|3715442_3716540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021552536.1|3716550_3716973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073510.1|3716965_3717601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021552535.1|3717576_3717963_-	hypothetical protein	NA	A5LH77	Enterobacteria_phage	90.0	6.8e-56
WP_021552534.1|3717981_3718971_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	6.2e-194
WP_001061445.1|3718978_3719788_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	4.0e-151
WP_000767103.1|3719807_3720197_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_061356387.1|3720193_3720520_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	2.9e-52
WP_074149693.1|3720519_3721014_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	8.1e-86
WP_061356389.1|3721010_3721952_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.4	5.0e-153
WP_001250269.1|3721941_3722121_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_063073513.1|3722296_3722854_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	2.6e-96
WP_000649477.1|3722897_3723098_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|3723188_3723863_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000549626.1|3724097_3724304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|3724275_3724710_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000008236.1|3725254_3725791_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242749.1|3725781_3726144_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|3726143_3726449_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_077769569.1|3726364_3726799_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	98.6	1.0e-76
WP_000051887.1|3726675_3727839_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893278.1|3728043_3729297_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3727852:3727899	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3729308_3730412_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3730699_3731755_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 1
NZ_CP046001	Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence	73506	61967	73431	73506	integrase,transposase	Escherichia_phage(33.33%)	10	69854:69913	72675:73495
WP_000105636.1|61967_63662_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001067855.1|63934_64639_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032492336.1|64766_65996_+	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXG2	Streptococcus_phage	39.0	2.1e-74
WP_054377175.1|66141_67005_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|67042_67288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|67756_68548_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
69854:69913	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067858.1|69905_70610_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000845048.1|70755_71769_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001317507.1|71924_72398_+	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_001067858.1|72726_73431_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
72675:73495	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGTTGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGTGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCC	NA	NA	NA	NA
>prophage 1
NZ_CP046002	Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence	59351	1111	52794	59351	integrase,transposase	Escherichia_phage(55.56%)	53	NA	NA
WP_001067855.1|1111_1816_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_124354296.1|2125_5158_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_154139449.1|5097_5808_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	96.7	5.5e-120
WP_148245969.1|5772_6300_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|6299_6884_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|7376_8141_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001323889.1|8477_10055_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_002210513.1|10382_11144_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|11164_12025_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|12161_12866_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_103859199.1|13671_15231_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	24.4	1.5e-16
WP_000844627.1|15958_16201_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_072109431.1|16232_16895_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000804063.1|16973_18173_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|18439_18745_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034167813.1|18772_19987_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.6	1.5e-19
WP_001447541.1|20203_21088_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|21118_22612_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_094309310.1|22950_24108_-	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_151140429.1|24097_24994_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_001067858.1|25287_25992_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_065799592.1|26003_26816_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_001206356.1|26947_27739_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_065799591.1|27884_28649_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	36.9	1.3e-26
WP_001067858.1|28539_29244_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_024245155.1|30041_30680_-	resolvase	NA	A0A1V0E035	Clostridioides_phage	27.1	1.9e-07
WP_000864791.1|30965_31586_+	ParA family protein	NA	A2I303	Vibrio_virus	33.8	1.1e-18
WP_000051064.1|31637_31868_+	partitioning protein	NA	NA	NA	NA	NA
WP_015060510.1|31883_32177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118619.1|32223_33147_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_154205225.1|33206_33560_-	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
WP_001050931.1|34182_35019_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000121743.1|36274_36526_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000220560.1|36515_36797_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	3.8e-24
WP_001181903.1|36942_37266_+	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	46.1	9.2e-14
WP_000356546.1|37310_37556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001180116.1|37545_37761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866648.1|37853_38183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000160399.1|38631_38904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038976855.1|39230_39776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000538023.1|39778_40936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000872475.1|41296_41788_+	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000953539.1|42012_42657_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000921916.1|42640_42931_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_000108725.1|42954_45714_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_000737859.1|45715_46453_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_001228869.1|46462_46723_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_000235774.1|46734_47790_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000394570.1|47979_48702_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_025755764.1|48707_49637_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_025755765.1|49633_50848_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_154139455.1|50865_51576_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_085948178.1|51581_52794_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
